EP1019529A1 - Procede pour le traitement du cancer - Google Patents

Procede pour le traitement du cancer

Info

Publication number
EP1019529A1
EP1019529A1 EP98941069A EP98941069A EP1019529A1 EP 1019529 A1 EP1019529 A1 EP 1019529A1 EP 98941069 A EP98941069 A EP 98941069A EP 98941069 A EP98941069 A EP 98941069A EP 1019529 A1 EP1019529 A1 EP 1019529A1
Authority
EP
European Patent Office
Prior art keywords
ras
cells
protein transferase
assay
map kinases
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP98941069A
Other languages
German (de)
English (en)
Other versions
EP1019529A4 (fr
Inventor
David C. Heimbrook
Deborah Defeo-Jones
Allen I. Oliff
Steven M. Stirdivant
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Merck and Co Inc
Original Assignee
Merck and Co Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GBGB9724299.4A external-priority patent/GB9724299D0/en
Application filed by Merck and Co Inc filed Critical Merck and Co Inc
Publication of EP1019529A1 publication Critical patent/EP1019529A1/fr
Publication of EP1019529A4 publication Critical patent/EP1019529A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/48—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving transferase
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5011—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity

Definitions

  • FPTase farnesyl-protein transferase
  • GGPTase-I geranylgeranyl- protein transferase type I
  • Rab GGPTase geranylgeranyl-protein transferase type-II
  • the compound may be further characterized by one or more of the following: b) an inhibitory activity (IC50) against K4B-Ras dependent activation of MAP kinases in cells greater than 5 fold lower than the inhibitory activity (IC50) against Myr-Ras dependent activation of MAP kinases in cells; c) an inhibitory activity (IC50) against H-ras-CVLL dependent activation of MAP kinases in cells greater than 5 fold lower than the inhibitory activity (IC50) against Myr-Ras dependent activation of MAP kinases in cells; d) an inhibitory activity (IC50) against H-Ras dependent activation of MAP kinases in cells greater than 2 fold lower but less than 20,000 fold lower than the inhibitory activity (IC50) against
  • the prenyl-protein transferases that are being inhibited by the instant method are both farnesyl-protein transferase and geranylgeranyl-protein transferase type I.
  • the compound that is being administered is a dual inhibitor of farnesyl-protein transferase and geranylgeranyl-protein transferase type I.
  • the first embodiment of the method of the instant invention comprises one or both of the additional steps of: d) evaluating the test compound in the instant assay wherein the ras gene is H-ras ; and e) evaluating the test compound in the instant assay wherein the ras gene is H-ras-CVLL.
  • the method of identifying a prenyl-protein transferase inhibitor comprises the steps of: a) evaluating the test compound in the instant assay wherein the ras gene is H-ras ; b) evaluating the test compound in the instant assay wherein the ras gene is H-ras-CVLL; c) evaluating the test compound in the instant assay wherein the ras gene is Myr-ras ; and d) comparing the activity of the test compound against Myr- Ras dependent activation of MAP kinases in the instant assay with the activity of the test compound against H- Ras dependent activation of MAP kinases in the instant assay and H-Ras-CVLL dependent activation of MAP kinases in the instant assay.
  • the compounds of the invention have inhibitory concentrations (IC50) of ⁇ 10 nM against H-Ras dependent activation of MAP kinases in cells in the SEAP assay.
  • IC50 inhibitory concentrations
  • the ratio of inhibitory activity (IC50) against K-Ras4B dependent activation to inhibitory activity against H-Ras dependent activation is ⁇ 2000.
  • the compounds of the invention have inhibitory concentrations (IC50) of ⁇ 5 ⁇ M against cellular N-Ras dependent activation of MAP kinases in the SEAP assay. More preferably, the compounds of the invention have inhibitory concentrations (IC50) of ⁇ 1 ⁇ M against cellular N-Ras dependent activation of MAP kinases in the SEAP assay.
  • non-specific cytotoxicity of a test compound may be evaluated by incubating a cell that has been transfected with the pCMV-SEAP plasmid and analyzing the assay medium for the presence of the SEAP protein.
  • the term selective as used herein refers to the inhibitory activity of the particular compound against one biological activity (such as inhibition of prenyl-protein transferases) when compared to the inhibitory activity of the compound against another biological activity. It is understood that the greater the selectivity of a prenyl- protein transferase inhibitor, the more preferred such a compound is for the methods of treatment described.
  • Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives.
  • Suitable dispersing or wetting agents and suspending agents are exemplified by those already mentioned above. Additional excipients, for example sweetening, flavoring and coloring agents, may also be present. These compositions may be preserved by the addition of an anti-oxidant such as ascorbic acid.
  • the sterile injectable preparation may also be a sterile injectable oil-in-water microemulsion where the active ingredient is dissolved in the oily phase.
  • the active ingredient may be first dissolved in a mixture of soybean oil and lecithin. The oil solution then introduced into a water and glycerol mixture and processed to form a microemulation.
  • the injectable solutions or microemulsions may be introduced into a patient's blood-stream by local bolus injection.
  • a continuous intravenous delivery device may be utilized.
  • An example of such a device is the Deltec CADD- PLUSTM model 5400 intravenous pump.
  • Compounds of Formula A may also be administered in the form of a suppositories for rectal administration of the drug.
  • These compositions can be prepared by mixing the drug with a suitable non-irritating excipient which is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug.
  • suitable non-irritating excipient include cocoa butter, glycerinated gelatin, hydrogenated vegetable oils, mixtures of polyethylene glycols of various molecular weights and fatty acid esters of polyethylene glycol.
  • the instant compounds may be utilized in combination with farnesyl pyrophosphate competitive inhibitors of the activity of farnesyl-protein transferase or in combination with a compound which has Raf antagonist activity.
  • the instant compounds may also be co-administered with compounds that are selective inhibitors of geranylgeranyl protein transferase or selective inhibitors of farnesyl- protein transferase.
  • the compounds of the instant invention may also be co-administered with other well known cancer therapeutic agents that are selected for their particular usefulness against the condition that is being treated. Included in such combinations of therapeutic agents are combinations of the instant prenyl-protein transferase inhibitors and an antineoplastic agent. It is also understood that the instant combination of antineoplastic agent and inhibitor of prenyl-protein transferase may be used in conjunction with other methods of treating cancer and/or tumors, including radiation therapy and surgery.
  • the term refers to compounds which selectively antagonize, inhibit or counteract binding of a physiological ligand to the ocv ⁇ 3 integrin, which selectively antagonize, inhibit or counteract binding of a physiological ligand to the v ⁇ 5 integrin, which antagonize, inhibit or counteract binding of a physiological ligand to both the ⁇ v ⁇ 3 integrin and the ⁇ v ⁇ 5 integrin, or which antagonize, inhibit or counteract the activity of the particular integrin(s) expressed on capillary endothelial cells.
  • a suitable amount of a prenyl-protein transferase inhibitor are administered to a mammal undergoing treatment for cancer.
  • Administration occurs in an amount of each type of inhibitor of between about 0.1 mg/kg of body weight to about 60 mg/kg of body weight per day, preferably of between 0.5 mg/kg of body weight to about 40 mg/kg of body weight per day.
  • a particular therapeutic dosage that comprises the instant composition includes from about O.Olmg to about lOOOmg of a prenyl-protein transferase inhibitor.
  • the dosage comprises from about lmg to about lOOOmg of a prenyl-protein transferase inhibitor.
  • antineoplastic agents include estramustine, cisplatin, carboplatin, cyclophosphamide, bleomycin, gemcitibine, ifosamide, melphalan, hexamethyl melamine, thiotepa, cytarabin, idatrexate, trimetrexate, dacarbazine, L-asparaginase, camptothecin, CPT- 11 , topotecan, ara-C, bicalutamide, flutamide, leuprolide, pyridobenzoindole derivatives, interferons and interleukins.
  • R2 is selected from H; unsubstituted or substituted aryl, unsubstituted or substituted heteroaryl,
  • R6a is selected from:
  • R6 and R7 are independently selected from: H; Cl-4 alkyl, C3-6 cycloalkyl, aryl, heterocycle, unsubstituted or substituted with: a) Cl-4 alkoxy, b) halogen, or c) aryl or heterocycle;
  • V is selected from: a) hydrogen, b) heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, pyridonyl, 2-oxopiperidinyl, indolyl, quinolinyl, isoquinolinyl, and thienyl, c) aryl, d) C1-C20 alkyl wherein from 0 to 4 carbon atoms are replaced with a heteroatom selected from O, S, and N, and e) C2-C2O alkenyl, and provided that V is not hydrogen if Al is S(0) m and V is not hydrogen if Al is a bond, n is 0 and A ⁇ is S(0)m;
  • Cl-4 alkyl unsubstituted or substituted with: a) Cl-4 alkoxy, b) NR6R7, c) C3-6 cycloalkyl, d) aryl, substituted aryl or heterocycle, e) HO, f) -S(0) m R 6a , or g) -C(0)NR6R7,
  • n 0, 1, 2, 3 or 4
  • p 0, 1, 2, 3 or 4
  • r 0 to 5, provided that r is 0 when V is hydrogen; and v is 0, 1 or 2;
  • Rl is independently selected from: hydrogen or Cl-C6 alkyl
  • R2 is independently selected from: a) hydrogen, b) substituted or unsubstituted aryl, substituted or unsubstituted heterocycle, C3-C10 cycloalkyl, RlOO- or
  • C2-C6 alkenyl c) C1-C6 alkyl unsubstituted or substituted by aryl, heterocycle, C3-C10 cycloalkyl, C2-C6 alkenyl, R OO-, or -N(Rl ) 2 ;
  • R3 is selected from: a) hydrogen, b) Cl-C6 alkyl unsubstituted or substituted by
  • R 4 and R5 are independently selected from: a) hydrogen, b) C1-C6 alkyl unsubstituted or substituted by
  • R6 is independently selected from: a) hydrogen, b) substituted or unsubstituted aryl, substituted or unsubstituted heterocycle, Cl-C6 alkyl, C2-C6 alkenyl,
  • Rl2 is independently selected from hydrogen, C1-C6 alkyl, C1-C6 alkyl substituted with C ⁇ 2Rl°, C1-C6 alkyl substituted with aryl, C1-C6 alkyl substituted with substituted aryl, C1-C6 alkyl substituted with heterocycle, C1-C6 alkyl substituted with substituted heterocycle, aryl and substituted aryl;
  • a 4 is selected from: a bond, O, -N(R7)- or S;
  • R8 is selected from: a) hydrogen, b) C l -C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C l -C6 perfluoroalkyl, F, Cl, RlOO-, R10C(O)NR10-, CN, NO2, (RlO)2N-C(NRlO)-, RlOc(O)-, RlO ⁇ C(O)-, -N(RlO)2, or Rl l ⁇ C(O)NRl0-, and c) C1-C6 alkyl substituted by C1-C6 perfluoroalkyl, RlOO-, R!0C(O)NR10-, (R10)2N-C(NR10)-, RlOC(O)-, RlO ⁇ C(O)-, -N(RlO)2, or RHOC(O)NR10- ;
  • RIO is independently selected from hydrogen, C1-C6 alkyl, C1-C6 perfluoroalkyl, 2,2,2-trifluoroethyl, benzyl and aryl;
  • RU is independently selected from C1-C6 alkyl, benzyl and aryl;
  • R b is independently selected from: a) hydrogen, b) aryl, heterocycle, cycloalkyl, RlOO-, -N(RlO)2 or C2-C6 alkenyl, c) C1-C6 alkyl unsubstituted or substituted by aryl, heterocycle, cycloalkyl, alkenyl, R OO-, or -N(RlO)2;
  • R8 is independently selected from: a) hydrogen, b) C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 perfluoroalkyl, F, Cl, RlOO-, R10C(O)NR10-, CN, N02,
  • Rl 1 is independently selected from C1-C6 alkyl and aryl
  • Z is an unsubstituted or substituted group selected from aryl, arylmethyl and arylsulfonyl, wherein the substituted group is substituted with one or more of the following: a) Cl-4 alkyl, unsubstituted or substituted with:
  • inhibitors of farnesyl-protein transferase are illustrated by the formula Il-a:
  • Rlc is selected from: a) hydrogen, b) unsubstituted or substituted Cl-C6 alkyl wherein the substituent on the substituted C1-C6 alkyl is selected from unsubstituted or substituted aryl, heterocyclic, C3-C10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, RlOO-, Rl lS(0) ⁇ r, R 10 C(O)NRl0-, (Rl0) 2 N-C(O)-, CN,
  • R6, R7 and R7a are independently selected from:
  • Rl 2 is selected from: H; unsubstituted or substituted Cl-8 alkyl, unsubstituted or substituted aryl or unsubstituted or substituted heterocycle, wherein the substituted alkyl, substituted aryl or substituted heterocycle is substituted with one or more of:
  • substituted aryl substituted heterocycle
  • substituted cycloalkyl are intended to include the cyclic group which is substituted with 1 or 2 substituents selected from the group which includes but is not limited to F, Cl, Br, CF3, NH2, N(Cl-C6 alkyl)2, N02, CN, (C1-C6 alkyl)0-, -OH, (C1-C6 alkyl)S(0) m -, (C1-C6 alkyl)C(0)NH-, H2N-C(NH)-, (C1-C6 alkyl)C(O)-, (C1-C6 alkyl)OC(O)-, N3,(Cl-C6 alkyl)OC(0)NH- and C1-C2O alkyl.
  • cyclic moieties may optionally include a heteroatom(s).
  • heteroatom-containing cyclic moieties include, but are not limited to:
  • the pharmaceutically acceptable salts of the compounds of this invention include the conventional non-toxic salts of the compounds of this invention as formed, e.g., from non-toxic inorganic or organic acids.
  • such conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like: and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic, phenyl- acetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetoxy-benzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, trifluoroacetic and the like.
  • the pharmaceutically acceptable salts of the compounds of this invention can be synthesized from the compounds of this invention which contain a basic moiety by conventional chemical methods. Generally, the salts are prepared by reacting the free base with stoichiometric amounts or with an excess of the desired salt- forming inorganic or organic acid in a suitable solvent or various combinations of solvents.
  • the compounds used in the methods of the instant invention are useful in various pharmaceutically acceptable salt forms.
  • pharmaceutically acceptable salt refers to those salt forms which would be apparent to the pharma-ceutical chemist, i.e., those which are substantially non-toxic and which provide the desired pharmacokinetic properties, palatability, absorption, distribution, metabolism or excretion.
  • compositions may be prepared from the active ingredients in combination with pharmaceutically acceptable carriers.
  • the intermediate VIII can be reductively alkylated with a variety of aldehydes, such as XII.
  • the aldehydes can be prepared by standard procedures, such as that described by O. P. Goel, U. Krolls, M. Stier and S. Kesten in Organic Syntheses. 1988, 67, 69-75, from the appropriate amino acid (Scheme 2).
  • the reductive alkylation can be accomplished at pH 5-7 with a variety of reducing agents, such as sodium triacetoxyborohydride or sodium cyanoborohydride in a solvent such as dichloroethane, methanol or dimethylformamide.
  • the imidazole acetic acid XVIII can be converted to the acetate XIX by standard procedures, and XIX can be first reacted with an alkyl halide, then treated with refluxing methanol to provide the regiospecifically alkylated imidazole acetic acid ester XX (Scheme 3).
  • Hydrolysis and reaction with piperazinone VIII in the presence of condensing reagents such as l-(3-dimethylaminopropyl)- 3-ethylcarbodiimide (EDC) leads to acylated products such as XXI.
  • the piperazinone VIII is reductively alkylated with an aldehyde which also has a protected hydroxyl group, such as XXII in Scheme 4, the protecting groups can be subsequently removed to unmask the hydroxyl group (Schemes 4, 5).
  • the alcohol can be oxidized under standard conditions to e.g. an aldehyde, which can then be reacted with a variety of organometallic reagents such as Grignard reagents, to obtain secondary alcohols such as XXIV.
  • the isomeric piperazin-3-ones can be prepared as described in Scheme 10.
  • the imine formed from arylcarboxamides XLII and 2-aminoglycinal diethyl acetal (XLIII) can be reduced under a variety of conditions, including sodium triacetoxyborohydride in dichloroethane, to give the amine XLIV.
  • Amino acids I can be coupled to amines XLIV under standard conditions, and the resulting amide XLV when treated with aqueous acid in tetrahydrofuran can cyclize to the unsaturated XL VI.
  • Catalytic hydrogenation under standard conditions gives the requisite intermediate XL VII, which is elaborated to final products as described in Schemes 1-7.
  • Amino acids of the general formula IL which have a sidechain not found in natural amino acids may be prepared by the reactions illustrated in Scheme 11 starting with the readily prepared imine XL VIII.
  • Reactions used to generate the compounds of the formula (II) are prepared by employing reactions as shown in the Schemes 16- 37, in addition to other standard manipulations such as ester hydrolysis, cleavage of protecting groups, etc., as may be known in the literature or exemplified in the experimental procedures.
  • Substituents R a and Rb, as shown in the Schemes, represent the substituents R2, R3, R4 ? an d R5; substituent "sub” represents a suitable substituent on the substituent Z.
  • the point of attachment of such substituents to a ring is illustrative only and is not meant to be limiting.
  • the deprotected intermediate LIII can also be reductively alkylated with a variety of other aldehydes and acids as shown above in Schemes 4-7.
  • the protected piperidine LX may be dehydrated and then hydroborated to provide the 3- hydroxypiperidine LXIII.
  • This compound may be deprotected and further derivatized to provide compounds of the instant invention (as shown in Scheme 27) or the hydroxyl group may be alkylated, as shown in Scheme 26, prior to deprotection and further manipulation.
  • the dehydration product may also be catalytically reduced to provide the des-hydroxy intermediate LXV, as shown in Scheme 28, which can be processed via the reactions illustrated in the previous Schemes.
  • Schemes 29 and 30 illustrate further chemical manipulations of the 4-carboxylic acid functionality to provide instant compounds wherein the substituent Y is an acetylamine or sulfonamide moiety.
  • Scheme 31 illustrates inco ⁇ oration of a nitrile moiety in the 4-position of the piperidine of the compounds of formula II.
  • the hydroxyl moiety of a suitably substituted 4-hydroxypiperidine is substituted with nitrile to provide intermediate LXVI, which can undergo reactions previously described in Schemes 17-21.
  • Scheme 32 illustrates the preparation of several pyridyl intermediates that may be utilized with the piperidine intermediates such as compound LI in Scheme 16 to provide the instant compounds.
  • Scheme 33 shows a generalized reaction sequence which utilizes such pyridyl intermediates.
  • prenyl transferase inhibitors of formula (A) can be synthesized in accordance with Reaction Scheme below, in addition to other standard manipulations such as ester hydrolysis, cleavage of protecting groups, etc., as may be known in the literature or exemplified in the experimental procedures. Some key reactions utilized to form the aminodiphenyl moiety of the instant compounds are shown.
  • the reactions may be employed in a linear sequence to provide the compounds of the invention or they may be used to synthesize fragments which are subsequently joined by the alkylation reactions described in the Reaction Scheme.
  • a method of forming the benzophenone intermediates is a Stille reaction with an aryl stannane. Such amine intermediates may then be reacted as illustrated hereinabove with a variety of aldehydes and esters/acids.
  • Step A Preparation of l-triphenylmethyl-4-(hydroxymethyl)- imidazole To a solution of 4-(hydroxymethyl)imidazole hydrochloride (35.0 g, 260 mmol) in 250 mL of dry DMF at room temperature was added triethylamine (90.6 mL, 650 mmol). A white solid precipitated from the solution. Chlorotriphenylmethane (76.1 g, 273 mmol) in 500 mL of DMF was added dropwise. The reaction mixture was stirred for 20 hours, poured over ice, filtered, and washed with ice water. The resulting product was slurried with cold dioxane, filtered, and dried in vacuo to provide the titled product as a white solid which was sufficiently pure for use in the next step.
  • Step B Preparation of l-triphenylmethyl-4-(acetoxymethyl)- imidazole
  • Step C Preparation of l-(4-cyanobenzyl)-5-(acetoxymethyl)- imidazole hydrobromide
  • a solution of the product from Step B (85.8 g, 225 mmol) and ⁇ -bromo-/?-tolunitrile (50.1 g, 232 mmol) in 500 mL of EtOAc was stirred at 60°C for 20 hours, during which a pale yellow precipitate formed.
  • the reaction was cooled to room temperature and filtered to provide the solid imidazolium bromide salt.
  • the filtrate was concentrated in vacuo to a volume 200 mL, reheated at 60°C for two hours, cooled to room temperature, and filtered again.
  • the filtrate was concentrated in vacuo to a volume 100 mL, reheated at 60°C for another two hours, cooled to room temperature, and concentrated in vacuo to provide a pale yellow solid. All of the solid material was combined, dissolved in 500 mL of methanol, and warmed to 60°C. After two hours, the solution was reconcentrated in vacuo to provide a white solid which was triturated with hexane to remove soluble materials. Removal of residual solvents in vacuo provided the titled product hydrobromide as a white solid which was used in the next step without further purification.
  • Step D Preparation of l-(4-cyanobenzyl)-5-(hydroxymethyl)- imidazole
  • Step E Preparation of l-(4-cyanobenzyl)-5- imidazolecarboxaldehyde
  • Step G Preparation of V-( -butoxycarbonyl)-.V'-(3- chlorophenvDethylenediamine
  • the amine hydrochloride from Step F (ca. 282 mmol, crude material prepared above) was taken up in 500 mL of THF and 500 mL of sat. aq. NaHC ⁇ 3 soln., cooled to 0°C, and ⁇ i-tert- butylpyrocarbonate (61.6 g, 282 mmol) was added. After 30 h, the reaction was poured into EtOAc, washed with water and brine, dried (Na2S04), filtered, and concentrated in vacuo to provide the titled carbamate as a brown oil which was used in the next step without further purification.
  • Step H Preparation of ⁇ -[2-(tert-butoxycarbamoyl)ethyl]- ⁇ -(3- chlorophenyl)-2-chloroacetamide
  • Step I Preparation of 4-(tert-butoxycarbonyl)-l-(3- chlorophenyl)-2-piperazinone To a solution of the chloroacetamide from Step H ⁇ ca.
  • Step K Preparation of l-(3-chlorophenyl)-4-[l-(4- cyanobenzyl)imidazolylmethyll-2-piperazinone dihydrochloride
  • Examples 2-5 were prepared using the above protocol, which describes the synthesis of the structurally related compound l-(3-chlorophenyl)-4-[l-(4-cyanobenzyl)-imidazolylmethyl]-2- piperazinone dihydrochloride.
  • Step F the appropriately substituted aniline was used in place of 3-chloroaniline.
  • Step C Preparation of Methyl 4-Cyano-3-hydroxybenzoate
  • a mixture of the iodide product from Step B (101 g, 0.36 mol) and zinc(II)cyanide (30 g, 0.25 mol) in 400 mL of dry DMF was degassed by bubbling argon through the solution for 20 minutes. Tetrakis(triphenylphosphine)palladium (8.5 g, 7.2 mmol) was added, and the solution was heated to 80°C for 4 hours. The solution was cooled to room temperature, then stirred for an additional 36 hours.
  • Step F Preparation of 4-Cyano-3-methoxybenzyl Bromide A solution of the alcohol from Step E (35.5 g,
  • Step G Preparation of l-(4-cyano-3-methoxybenzyl)-5-
  • the titled product was prepared by reacting the bromide from Step F (21.7 g, 96 mmol) with the imidazole product from Step B of Example 1 (34.9 g, 91 mmol) using the procedure outlined in Step C of Example 1.
  • the crude product was triturated with hexane to provide the titled product hydrobromide (19.43 g, 88% yield).
  • Step H Preparation of l-(4-cyano-3-methoxybenzyl)-5- (hydroxymethyl)-imidazole
  • the titled product was prepared by hydrolysis of the acetate from Step G (19.43 g, 68.1 mmol) using the procedure outlined in Step D of Example 1.
  • the crude titled product was isolated in modest yield (11 g, 66% yield). Concentration of the aqueous extracts provided solid material (ca. 100 g) which contained a significant quantity of the titled product , as judged by H NMR spectroscopy.
  • Step I Preparation of l-(4-cyano-3-methoxybenzyl)-5- imidazolecarboxaldehyde
  • the titled product was prepared by oxidizing the alcohol from Step H (11 g, 45 mmol) using the procedure outlined in Step E of Example 1.
  • the titled aldehyde was isolated as a white powder (7.4 g, 68% yield) which was sufficiently pure for use in the next step without further purification.
  • Step J Preparation of l-(3-chlorophenyl)-4-[l-(4-cyano-3- methoxybenzyl)imidazolylmethyl]-2-piperazinone dihydrochloride
  • the titled product was prepared by reductive alkylation of the aldehyde from Step I (859 mg, 3.56 mmol) and the amine (hydrochloride) from Step K of Example 1 (800 mg, 3.24 mmol) using the procedure outlined in Step H of Example 1. Purification by flash column chromatography through silica gel (50%-75% acetone CH 2 C1 2 ) and conversion of the resulting white foam to its dihydrochloride salt provided the titled product as a white powder (743 mg, 45% yield). FAB ms (m+1) 437. Anal. Calc. for C23H23ClN5 ⁇ 2*2.0HCl « 0.35CH2Cl2: C, 51.97; H, 4.80; N, 12.98.
  • Step P Preparation of (l-(4-Cyanobenzyl)-lH-imidazol-5-yl)- ethanol
  • methanol 20ml
  • sodium borohydride l.Og, 26.3mmol
  • the reaction was stirred at 0°C for 1 hr and then at room temperature for an additional 1 hr.
  • the reaction was quenched by the addition of sat.NH4Cl solution and the methanol was evaporated in vacuo..
  • Step O l-(4-Cyanobenzyl)-imidazol-5-yl-ethylmethanesulfonate
  • Step R N ⁇ 1 -(4-Cy anobenzyl)- 1 H-imidazol-5-ylethyl ⁇ -4(R)- benzyloxyoxy-2(S)- ⁇ N'-acetyl-N'-3- chlorobenzyl ⁇ aminomethylpyrrolidine
  • Isoprenyl-protein transferase activity assays were carried out at 30°C unless noted otherwise.
  • a typical reaction contained (in a final volume of 50 ⁇ L): [ 3 H]farnesyl diphosphate or [ 3 H] geranylgeranyl diphosphate, Ras protein , 50 mM HEPES, pH 7.5, 5 mM MgCl 2 , 5 mM dithiothreitol, 10 ⁇ M ZnCl 2 , 0.1% polyethyleneglycol (PEG) (15,000-20,000 mw) and isoprenyl-protein transferase.
  • a modulating anion such as lOmM glycerol phosphate or 5mM ATP may also be added to the assay medium.
  • inhibitors were prepared as concentrated solutions in 100% dimethyl sulfoxide and then diluted 20-fold into the enzyme assay mixture.
  • Substrate concentrations for inhibitor IC50 determinations were as follows: FTase, 650 nM Ras-CVLS (SEQ.ID.NO.: 2), 100 nM farnesyl diphosphate; GGPTase-I, 500 nM Ras-CAIL (SEQ.ID.NO.: 3), 100 nM geranylgeranyl diphosphate.
  • the modified geranylgeranyl-protein transferase inhibition assay is carried out at room temperature.
  • a typical reaction contains (in a final volume of 50 ⁇ L): [ 3 H] geranylgeranyl diphosphate, biotinylated Ras peptide, 50 mM HEPES, pH 7.5, a modulating anion (for example 10 mM glycerophosphate or 5mM ATP), 7 mM MgCl 2 , 10 ⁇ M ZnCl 2 ,
  • the GGTase- type I enzyme employed in the assay is prepared as described in U.S. Pat. No. 5,470,832, inco ⁇ orated by reference.
  • the Ras peptide is derived from the K4B-Ras protein and has the following sequence: biotinyl-GKKKKKKSKTKCVIM (single amino acid code) (SEQ.ID.NO.: 13).
  • GGTase and inhibitors are preincubated for one hour and reactions are initiated by the addition of peptide substrate, following methodology described by J.F. Morrison, C.T. Walsh, Adv. Enzymol. & Related Areas Mol. Biol., 61 201-301 (1988).
  • IC 50 values are determined with Ras peptide near KM concentrations. Enzyme and substrate concentrations for inhibitor IC 50 determinations are as follows: 75 pM GGTase-I, 1.6 ⁇ M
  • enzymologic K values for inhibition of GGPTase-I can be determined using the methodology described by I. H. Segel ("Enzyme Kinetics", pages 342-345; Wiley and Sons, New York, N.Y. (1975) and references cited therein).
  • the assay can also be performed using cell lines transformed with human H-ras, N-ras or Ki4B-ras. The assay is performed essentially as described in DeClue, J.E.
  • the media is removed, the cells washed, and 3 ml of media containing the same or a different test compound added.
  • the lysis is carried out as above. Aliquots of lysates containing equal numbers of acid-precipitable counts are bought to 1 ml with IP buffer (lysis buffer lacking DTT) and immunoprecipitated with the ras-specific monoclonal antibody Y13-259 (Furth, M.E. et al., J. Virol. 43:294-304, (1982)).
  • the SEAP reporter plasmid, pDSElOO was constructed by ligating a restriction fragment containing the SEAP coding sequence into the plasmid pCMV-RE-AKI.
  • the SEAP gene is derived from the plasmid pSEAP2-Basic (Clontech, Palo Alto, CA).
  • the plasmid pCMV-RE-AKI was constructed by Deborah Jones (Merck) and contains 5 sequential copies of the 'dyad symmetry response element' cloned upstream of a 'CAT-TATA' sequence derived from the cytomegalovirus immediate early promoter.
  • the plasmid also contains a bovine growth hormone poly-A sequence.
  • the plasmid, pDSElOO was constructed as follows.
  • a restriction fragment encoding the SEAP coding sequence was cut out of the plasmid pSEAP2-Basic using the restriction enzymes EcoRl and Hpal. The ends of the linear DNA fragments were filled in with the Klenow fragment of E. coli DNA Polymerase I. The 'blunt ended' DNA containing the SEAP gene was isolated by electrophoresing the digest in an agarose gel and cutting out the 1694 base pair fragment.
  • the vector plasmid pCMV-RE-AKI was linearized with the restriction enzyme Bgl-II and the ends filled in with Klenow DNA Polymerase I.
  • the SEAP DNA fragment was blunt end ligated into the pCMV-RE-AKI vector and the ligation products were transformed into DH5-alpha E.
  • coli cells (Gibco-BRL). Transformants were screened for the proper insert and then mapped for restriction fragment orientation. Properly oriented recombinant constructs were sequenced across the cloning junctions to verify the correct sequence. The resulting plasmid contains the SEAP coding sequence downstream of the DSE and CAT-TATA promoter elements and upstream of the BGH poly-A sequence.
  • the SEAP repotrer plasmid, pDSElOl is also constructed by ligating a restriction fragment containing the SEAP coding sequence into the plasmid pCMV-RE-AKI.
  • the SEAP gene is derived from plasmid pGEM7zf(-)/SEAP.
  • the plasmid pCMV-RE-AKI is derived from plasmid pCMVIE-AKI-DHFR (Whang , Y., Silberklang, M., Morgan, A., Munshi, S., Lenny, A.B., Ellis, R.W., and Kieff, E. (1987) J. Virol., 61, 1796-1807) by removing an EcoRI fragment containing the DHFR and Neomycin markers.
  • Sense strand N-terminal SEAP 5' GAGAGGGAATTCGGGCCCTTCCTGCAT
  • Antisense strand N-terminal SEAP 5' GAGAGAGCTCGAGGTTAACCCGGGT GCGCGGCGTCGGTGGT 3' (SEQ.ID.NO.:5)
  • Sense strand C-terminal SEAP 5' GAGAGAGTCTAGAGTTAACCCGTGGTCC CCGCGTTGCTTCCT 3' (SEQ.ID.NO.:6)
  • Antisense strand C-terminal SEAP 5' GAAGAGGAAGCTTGGTACCGCCACTG GGCTGTAGGTGGTGGCT 3' (SEQ.ID.NO. :7)
  • the N-terminal oligos (SEQ.ID.NO.: 4 and SEQ.ID.NO.: 5) were used to generate a 1560 bp N-terminal PCR product that contained EcoRI and Hpal restriction sites at the ends.
  • the Antisense N-terminal oligo introduces an internal translation STOP codon within the SEAP gene along with the Hpal site.
  • SEQ.ID.NO.: 6 and SEQ.ID.NO.: 7 were used to amplify a 412 bp C-terminal PCR product containing Hpal and Hindlll restriction sites.
  • the sense strand C-terminal oligo (SEQ.ID.NO.: 6) introduces the internal STOP codon as well as the Hpal site.
  • the N-terminal amplicon was digested with EcoRI and Hpal while the C-terminal amplicon was digested with Hpal and Hindlll.
  • the two fragments comprising each end of the SEAP gene were isolated by electrophoresing the digest in an agarose gel and isolating the 1560 and 412 base pair fragments.
  • An expression plasmid constitutively expressing the SEAP protein was created by placing the sequence encoding a truncated SEAP gene downstream of the cytomegalovirus (CMV) IE-1 promoter.
  • the expression plasmid also includes the CMV intron A region 5' to the SEAP gene as well as the 3' untranslated region of the bovine growth hormone gene 3' to the SEAP gene.
  • the plasmid pCMVIE-AKI-DHFR (Whang , Y., Silberklang, M., Morgan, A., Munshi, S., Lenny, A.B., Ellis, R.W., and Kieff, E. (1987) J. Virol., 61: 1796-1807) containing the CMV immediate early promoter was cut with EcoRI generating two fragments. The vector fragment was isolated by agarose electrophoresis and religated. The resulting plasmid is named pCMV-AKI. Next, the cytomegalovirus intron A nucleotide sequence was inserted downstream of the CMV IE1 promter in pCMV-AKI.
  • the intron A sequence was isolated from a genomic clone bank and subcloned into pBR322 to generate plasmid pl6T-286.
  • the intron A sequence was mutated at nucleotide 1856 (nucleotide numbering as in Chapman, B.S., Thayer, R.M., Vincent, K.A. and Haigwood, N.L., Nuc.Acids Res. 19, 3979- 3986) to remove a Sad restriction site using site directed mutagenesis.
  • the mutated intron A sequence was PCRed from the plasmid pl6T-287 using the following oligos.
  • Sense strand 5' GGCAGAGCTCGTTTAGTGAACCGTCAG 3' (SEQ.ID.NO.: 8)
  • Antisense strand 5' GAGAGATCTCAAGGACGGTGACTGCAG 3' (SEQ.ID.NO.: 9)
  • oligos generate a 991 base pair fragment with a Sad site inco ⁇ orated by the sense oligo and a Bgl-II fragment inco ⁇ orated by the antisense oligo.
  • the PCR fragment is trimmed with Sad and Bgl-II and isolated on an agarose gel.
  • the vector pCMV-AKI is cut with Sad and Bgl-II and the larger vector fragment isolated by agarose gel electrophoresis.
  • the two gel isolated fragments are ligated at their respective Sad and Bgl-II sites to create plasmid pCMV-AKI- InA.
  • the DNA sequence encoding the truncated SEAP gene is inserted into the pCMV- AKI-InA plasmid at the Bgl-II site of the vector.
  • the SEAP gene is cut out of plasmid pGEM7zf(-)/SEAP (described above) using EcoRI and Hindlll. The fragment is filled in with Klenow DNA polymerase and the 1970 base pair fragment isolated from the vector fragment by agarose gel electrophoresis.
  • the pCMV- AKI-InA vector is prepared by digesting with Bgl-II and filling in the ends with Klenow DNA polymerase. The final construct is generated by blunt end ligating the SEAP fragment into the pCMV- AKI-InA vector.
  • Transformants were screened for the proper insert and then mapped for restriction fragment orientation. Properly oriented recombinant constructs were sequenced across the cloning junctions to verify the correct sequence.
  • the resulting plasmid named pCMV-SEAP-A (deposited in the ATCC under Budapest Treaty on August 27, 1998, and designated ATCC), contains a modified SEAP sequence downstream of the cytomegalovirus immediately early promoter IE- 1 and intron A sequence and upstream of the bovine growth hormone poly-A sequence.
  • the plasmid expresses SEAP in a constitutive manner when transfected into mammalian cells.
  • An expression plasmid constitutively expressing the SEAP protein can be created by placing the sequence encoding a truncated SEAP gene downstream of the cytomegalovirus (CMV) IE- 1 promoter and upstream of the 3' unstranslated region of the bovine growth hormone gene.
  • CMV cytomegalovirus
  • the plasmid pCMVIE-AKI-DHFR (Whang , Y., Silberklang, M., Morgan, A., Munshi, S., Lenny, A.B., Ellis, R.W., and Kieff, E. (1987) J. Virol., 61: 1796-1807) containing the CMV immediate early promoter and bovine growth hormone poly-A sequence can be cut with EcoRI generating two fragments. The vector fragment can be isolated by agarose electrophoresis and religated. The resulting plasmid is named pCMV-AKI.
  • the DNA sequence encoding the truncated SEAP gene can be inserted into the pCMV-AKI plasmid at a unique Bgl-II in the vector.
  • the SEAP gene is cut out of plasmid pGEMzf(-)/SEAP (described above) using EcoRI and Hindlll. The fragments are filled in with Klenow DNA polymerase and the 1970 base pair fragment is isolated from the vector fragment by agarose gel electrophoresis.
  • the pCMV-AKI vector is prepared by digesting with Bgl-II and filling in the ends with Klenow DNA polymerase. The final construct is generated by blunt end ligating the SEAP fragment into the vector and transforming the ligation reaction into E. coli DH5 ⁇ cells.
  • a DNA fragment containing viral-H-ras can be PCRed from plasmid "HB-11 (deposited in the ATCC under Budapest Treaty on August 27, 1997, and designated ATCC 209,218) using the following oligos.
  • the sense strand oligo also optimizes the 'Kozak' translation initiation sequence immediately 5' to the ATG start site.
  • cysteine 186 would be mutated to a serine by substituting a G residue for a C residue in the C-terminal antisense oligo.
  • the PCR primer oligos introduce an Xhol site at the 5' end and a Xbal site at the 3 'end.
  • the Xhol-Xbal fragment can be ligated into the mammalian expression plasmid pCI (Promega) cut with Xhol and Xbal. This results in a plasmid, pSMS600, in which the recombinant myr-viral-H-ras gene is constitutively transcribed from the CMV promoter of the pCI vector.
  • a viral-H-ras clone with a C-terminal sequence encoding the amino acids CVLL can be cloned from the plasmid "HB-11" by PCR using the following oligos.
  • Antisense strand 5 ' C ACTCTAGACTGGTGTC AGAGC AGC AC AC ACTTGC AGC-3 ' (SEQ.ID.NO.: 13)
  • the sense strand oligo optimizes the 'Kozak' sequence and adds an Xhol site.
  • the antisense strand mutates serine 189 to leucine and adds an Xbal site.
  • the PCR fragment can be trimmed with Xhol and Xbal and ligated into the Xhol-Xbal cut vector pCI (Promega).
  • CVLL gene is constitutively transcribed from the CMV promoter of the pCI vector.
  • the human cellular-H-ras gene can be PCRed from a human cerebral cortex cDNA library (Clontech) using the following oligonucleotide primers.
  • Antisense strand
  • the primers will amplify a c-H-Ras encoding DNA fragment with the primers contributing an optimized 'Kozak' translation start sequence, an EcoRI site at the N-terminus and a Sal I site at the C-terminal end.
  • the c-H-ras fragment can be ligated ligated into an EcoRI -Sal I cut mutagenesis vector p Alter- 1 (Promega). Mutation of glutamine-61 to a leucine can be accomplished using the manufacturer's protocols and the following oligonucleotide:
  • the mutated c-H-ras-Leu61 can be excised from the pAlter-
  • the primers will amplify a c-N-Ras encoding DNA fragment with the primers contributing an optimized 'Kozak' translation start sequence, an EcoRI site at the N-terminus and a Sal I site at the C-terminal end.
  • the c-N-ras fragment can be ligated into an EcoRI -Sal I cut mutagenesis vector p Alter- 1 (Promega). Mutation of glycine-12 to a valine can be accomplished using the manufacturer's protocols and the following oligonucleotide: 5'-GTTGGAGCAGTTGGTGTTGGG-3' (SEQ.ID.NO.: 19)
  • Antisense strand 5 ' -CTCTGTCG ACGTATTTAC AT AATT AC AC ACTTTGTC-3 ' (SEQ.ID.NO.: 21)

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Hematology (AREA)
  • Toxicology (AREA)
  • Food Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Cell Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Epidemiology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne un procédé pour inhiber les prényl-protéine-transférases et traiter le cancer, qui consiste à administrer à un mammifère un inhibiteur de prényl-protéine-transférase constituant un inhibiteur du traitement cellulaire des protéines H-Ras et K4B-Ras. En particulier, l'invention concerne un procédé permettant d'inhiber la farnésyl-protéine-transférase et la géranylgéranyl-protéine-transférase de type I en administrant un composé qui est un double inhibiteur pour ces deux prényl-protéine-transférases. L'invention concerne aussi un procédé permettant d'identifier le composé susmentionné, par le biais d'un essai dont l'indication correspond à l'activité biologique de la protéine Ras ou à l'inhibition de ladite activité, moyennant quoi on identifie aisément les composés qui inhibent le traitement cellulaire des protéines H-Ras et K4B-Ras.
EP98941069A 1997-08-27 1998-08-26 Procede pour le traitement du cancer Withdrawn EP1019529A4 (fr)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US5710297P 1997-08-27 1997-08-27
US57102P 1997-08-27
GBGB9724299.4A GB9724299D0 (en) 1997-11-18 1997-11-18 A method of treating cancer
GB9724299 1997-11-18
PCT/US1998/017699 WO1999010525A1 (fr) 1997-08-27 1998-08-26 Procede pour le traitement du cancer

Publications (2)

Publication Number Publication Date
EP1019529A1 true EP1019529A1 (fr) 2000-07-19
EP1019529A4 EP1019529A4 (fr) 2002-09-11

Family

ID=26312616

Family Applications (1)

Application Number Title Priority Date Filing Date
EP98941069A Withdrawn EP1019529A4 (fr) 1997-08-27 1998-08-26 Procede pour le traitement du cancer

Country Status (5)

Country Link
EP (1) EP1019529A4 (fr)
JP (1) JP2001514191A (fr)
AU (1) AU8921398A (fr)
CA (1) CA2301880A1 (fr)
WO (1) WO1999010525A1 (fr)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001066144A2 (fr) 2000-03-08 2001-09-13 Rhode Island Hospital, A Lifespan Partner Therapie d'association de medicaments
US6939540B1 (en) 2000-07-31 2005-09-06 Cornell Research Foundation, Inc. Method of enhancing bone density

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996030343A1 (fr) * 1995-03-29 1996-10-03 Merck & Co., Inc. Inhibiteurs de farnesyl-proteine transferase
WO1996034113A2 (fr) * 1995-04-27 1996-10-31 Board Of Regents, The University Of Texas System Procedes d'identification d'inhibiteurs de transferases de farnesyl
WO1997030992A1 (fr) * 1996-02-26 1997-08-28 Bristol-Myers Squibb Company Inhibiteurs de la farnesyl-transferase
WO1997038664A2 (fr) * 1996-04-18 1997-10-23 Merck & Co., Inc. Methode de traitement de cancer

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5185248A (en) * 1990-05-08 1993-02-09 E. R. Squibb & Sons, Inc. Farnesyl-protein transferase assay for identifying compounds that block neoplastic transformation

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996030343A1 (fr) * 1995-03-29 1996-10-03 Merck & Co., Inc. Inhibiteurs de farnesyl-proteine transferase
WO1996034113A2 (fr) * 1995-04-27 1996-10-31 Board Of Regents, The University Of Texas System Procedes d'identification d'inhibiteurs de transferases de farnesyl
WO1997030992A1 (fr) * 1996-02-26 1997-08-28 Bristol-Myers Squibb Company Inhibiteurs de la farnesyl-transferase
WO1997038664A2 (fr) * 1996-04-18 1997-10-23 Merck & Co., Inc. Methode de traitement de cancer

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of WO9910525A1 *

Also Published As

Publication number Publication date
CA2301880A1 (fr) 1999-03-04
AU8921398A (en) 1999-03-16
EP1019529A4 (fr) 2002-09-11
WO1999010525A1 (fr) 1999-03-04
JP2001514191A (ja) 2001-09-11

Similar Documents

Publication Publication Date Title
US6387903B1 (en) Inhibitors of prenyl-protein transferase
US6358956B1 (en) Inhibitors of prenyl-protein transferase
US20020052363A1 (en) Inhibitors of prenyl-protein transferase
WO2000051614A1 (fr) Inhibiteurs de prenyl-proteine transferases
AU741725B2 (en) Inhibitors of prenyl-protein transferase
WO2001060368A1 (fr) Inhibiteurs de la prenyle proteine transferase
US6103487A (en) Method of treating cancer
US6376496B1 (en) Inhibitors of prenyl-protein transferase
WO2001060458A2 (fr) Inhibiteurs de la prenyl-proteine transferase
US6335343B1 (en) Inhibitors of prenyl-protein transferase
US6355643B1 (en) Inhibitors of prenyl-protein transferase
EP1019529A1 (fr) Procede pour le traitement du cancer
WO1999010329A1 (fr) Inhibiteurs de prenyl-proteine-transferase
EP1009854A1 (fr) Procede de traitement du cancer
WO2000016626A1 (fr) Methode de traitement du cancer
EP1019530A1 (fr) Procede pour le traitement du cancer

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20000327

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU NL PT SE

AX Request for extension of the european patent

Free format text: AL PAYMENT 20000327;LT PAYMENT 20000327;LV PAYMENT 20000327;MK PAYMENT 20000327;RO PAYMENT 20000327;SI PAYMENT 20000327

A4 Supplementary search report drawn up and despatched

Effective date: 20020731

AK Designated contracting states

Kind code of ref document: A4

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU NL PT SE

17Q First examination report despatched

Effective date: 20030115

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20030527