WO1999006034A1 - Therapies basees sur coup-tfi pour traiter des maladies - Google Patents
Therapies basees sur coup-tfi pour traiter des maladies Download PDFInfo
- Publication number
- WO1999006034A1 WO1999006034A1 PCT/US1998/015737 US9815737W WO9906034A1 WO 1999006034 A1 WO1999006034 A1 WO 1999006034A1 US 9815737 W US9815737 W US 9815737W WO 9906034 A1 WO9906034 A1 WO 9906034A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- tfi
- coup
- agonist
- mammal
- growth
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/81—Protease inhibitors
- C07K14/8107—Endopeptidase (E.C. 3.4.21-99) inhibitors
- C07K14/811—Serine protease (E.C. 3.4.21) inhibitors
- C07K14/8114—Kunitz type inhibitors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/177—Receptors; Cell surface antigens; Cell surface determinants
- A61K38/1796—Receptors; Cell surface antigens; Cell surface determinants for hormones
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
Definitions
- the present invention relates generally to the field of molecular endocrinology and receptor pharmacology. More specifically, it relates to the use of agonists and antagonists of the COUP-TFI receptor for nerve regeneration, prevention of nerve degeneration, treatment of neurodegenerative, learning and memory disorders, bone-related disorders, and hearing and balance related disorders.
- the steroid/thyroid hormone receptor superfamily of proteins consists of many ligand-activated transcriptional regulators and numerous orphan receptors.
- COUP-TF Chovalbumin Upstream Promoter-Transcription Factor
- COUP-TF Chovalbumin Upstream Promoter-Transcription Factor
- COUP-TF was first identified as a homodimer that binds to a direct repeat regulatory element in the chicken ovalbumin promoter. This element contains an imperfect direct repeat of AGGTCA sequence, which has been shown to be essential for efficient in vi tro transcription.
- the inventors of the present Invention successfully purified COUP-TF from HeLa cell nuclear extracts using a combination of conventional and DNA-affinity column chromatographic techniques. A polyclonal antibody was then generated against the purified material and used to screen a HeLa cell cDNA library. A clone that cross-reacted with both the antibody and the COUP-TF binding site was obtained and designated as human COUP-TFI (hCOUP-TFI) . Sequence analysis revealed that COUP-TFI is a member of the steroid/thyroid superfamily.
- COUP-TFII Two COUP-TF genes were initially cloned from human cells, named hCOUP-TFI and hCOUP-TFII.
- COUP-TFII is the subject of a co-pending U.S. Application Serial No. 09/097,725 filed June 16, 1998, entitled “COUP-TFII: A Nuclear Receptor Required for Angiogenesis . " This was originally filed as a Provisional Application on June 18, 1997, and both are hereby incorporated by reference into the present Application.
- a thorough review of COUP-TF is provided in Tsai, S.
- COUP- TFs Chick Ovalbumin Upstream Promoter-Transcription Factor (COUP- TFs) : Co ing of Age, 18 Endocrinology Rev. 229 (1997) .
- the COUP-TFs compose a family of functionally related transcription factors, 1 Gene Expression 207 (1991); Ritchie, H. H. et al . , COUP- TF gene : a structure unique for the steroid/thyroid receptor superfamily, 18 Nucleic Acid Res. 6857 (1990); and Wang, L.-H., COUP transcription factor is a member of the steroid receptor superfamily, 340 Nature 163 (1989) .
- COUP-TF subfamily Since the initial cloning, the COUP-TF subfamily has expanded rapidly.
- the ammo-acid sequence deduced from the hCOUP-TF cDNAs reveal significant similarities to members of the steroid/thyroid superfamily of genes. Homologues have been cloned from many species, for example from Drosophila to mouse. Most of the species examined have more than one COUP-TF homologue.
- COUP-TF subfamily members share a high degree of homology within and between species, implying that they may serve conserved function (s) .
- COUP-TF a 66-ammo acid region
- DBD DNA-bmd g domain
- COUP-TFs all 20 invariant ammo acids were conserved, and 11 of 12 conserved residues were identical except that a conserved lysine in the second finger is replaced by a glutamme.
- COUP-TFs can be classified as members of the estrogen receptor subfamily, which bind to a Pu-GGTCA repeat. There is only one ammo acid difference within the DBD of COUP-TFI and II, which is a conservative change from Ser to Thr .
- COUP-TFs bind to AGGTCA direct repeats with various spac gs, which include the response elements for the retmoic acid receptors (RAR) , ret oid X receptors (RXR) , vitamin D 3 receptor (VDR) , and thyroid hormone receptors (TR) .
- RAR retmoic acid receptors
- RXR ret oid X receptors
- VDR vitamin D 3 receptor
- TR thyroid hormone receptors
- COUP-TFs When cotransfected, COUP-TFs can inhibit the activation function of the above mentioned receptors m the presence of their cognate ligands. COUP-TFs exert their inhibitory activity mainly by competitive DNA binding of the common response elements and by heterodimerizmg with the common partner RXR. Therefore, COUP-TFs are proposed to modulate vitamin D 3 , the thyroid hormone, and the RA signaling pathways. In addition, COUP-TFs have been shown to negatively regulate the expression of many genes by competing for the same or overlapping response elements with other positive regulators. For instance, COUP-TFs could negatively regulate the expression of several apolipoprotems by antagonizing the positive regulator HNF-4. Thus, COUP-TFs may also function independently of the above mentioned signaling pathways .
- COUP-TFs are expressed at high levels m the developing central nervous system, suggesting that they are involved m neurogenesis .
- COUP-TFs are also highly expressed m many developing organs, and the expression level decreases upon completion of differentiation, suggesting that COUP-TFs may also be involved m organogenesis .
- COUP-TFs Relatively non-selective DNA binding of COUP-TFs are expected to down-regulate the hormonal induction of target genes by VDR, TR, and RAR. Indeed Cotransfection of COUP-TFI expression vectors inhibited the hormonal induction of VDR- , TR- , and RAR-dependent activation of reporter gene activity.
- VDR, TR, and RAR have been demonstrated to activate target genes containing DR3 , DR4 and DR5 response elements, respectively.
- COUP-TFs are expected to downregulate the hormonal induction of target genes by
- VDR, TR, and RAR Cotransfection of COUP-TFI or II expression vectors inhibited the hormonal induction of VDR-, TR- , and RAR-dependent activation of reporter activity.
- the inhibition of transcriptional activity by COUP-TFs is dose-dependent, as the reporter activity is progressively inhibited by increasing concentrations of the transfected COUP-TF expression vector.
- COUP-TFs not only inhibit the hormone response of reporters containing synthetic AGGTCA repeats with various spacmgs; they also inhibit the expression of reporters containing natural vitamin D response element (VDE) , thyroid response element (TRE) , and retinoic acid response element (RARE) sequences as in the respective cases of the osteocalcin, myosin heavy chain, and BRAR promoters.
- VDE vitamin D response element
- TRE thyroid response element
- RARE retinoic acid response element
- COUP-TFs have been shown to antagonize the HNF4-dependent transcriptional activation of many liver-specific genes and to suppress OCT3/4 expression during retinoid- induced differentiation of P19 embryonic carcinoma cells.
- the mechanisms by which COUP-TFs inhibit the transactivation of other members of the steroid receptor superfamily are described in Tsai, S. and Tsai, M.-J., Chick Ovalbumin Upstream Promoter- Transcription Factor (COUP-TFs) : Coming of Age, 18 Endocrinology Rev. 229 (1997) .
- COUP-TFs Chick Ovalbumin Upstream Promoter- Transcription Factor
- the present Invention is based on fundamental new research which uncovers many aspects of COUP-TFI physiology. This knowledge m turn has led to the creation of novel therapies.
- An object of the present invention is a method for enhancing of nerve regeneration in a mammal.
- An additional object of the present invention is a method for the prevention of nerve or neuron degeneration in a mammal .
- Another object of the present invention is a method for the treatment of neurodegenerative diseases.
- Another ob ect of the present invention is a method for enhancement of learning and memory.
- An object of the present invention is a method for treatment of learning and memory diseases.
- An additional object of the present invention is a method for prevention of loss of hearing.
- An additional object of the present invention is a method for the control of motion sickness.
- a further object of the present invention is a method for the prevention of bone loss m mammals.
- An additional object of the present invention is a method for the regeneration of bone formation m mammals .
- a method for treating neurodegenerative diseases m a mammal comprising administering to a mammal affected with said neurodegenerative disease a therapeutic effective amount of an agonist of COUP-TFI, wherein said agonist induces growth of neurological tissue.
- the neurodegenerative disorder is selected from the group consisting of Alzheimer's Disease, Hunt gton's Disease, seizure, Parkinson Disease, stroke, multiple sclerosis, and learning and memory defects.
- Another embodiment of the present invention includes a method of enhancing nerve regeneration m a mammal comprising the step of administering to a mammal an effective amount of an agonist of COUP-TFI, wherein said agonist induces the growth of nerves or neurons.
- said agonist induces or stimulates the growth of the axonal projection.
- the agonist enhances or stimulates axonal differentiation and myelmation.
- the agonist stimulates the growth of the axonal projection between the glossopharyngeal ganglion in the hindbrain.
- the agonist stimulates growth of the IX ganglion.
- a further embodiment of the present invention includes a method for the prevention of nerve and neuron degeneration in mammals comprising the step of administering to a mammal a therapeutically effective amount of an agonist of COUP-TFI, wherein said agonist enhances nerve or nerve growth.
- An additional method of the present invention is a method of treating hearing defects comprising the step of administering to a mammal affected with said hearing defect a therapeutic effect amount of an agonist to COUP-TFI, wherein said agonist induces growth of the inner ear.
- An additional embodiment of the present invention includes a method of treating balance defects in a mammal comprising the step of administering to a mammal affected with said balance defects therapeutic effective amount of an agonist to COUP-TFI, wherein said agonist induces growth in the inner ear.
- Another embodiment of the present invention includes a method of inducing regeneration of bone formation in a mammal comprising the step of administering to said mammal a therapeutic effective amount of agonist of COUP-TFI, wherein said agonist induces bone formation.
- Another embodiment of the present invention includes a method for prevention of bone loss in a mammal an effective amount of an agonist of COUP-TFI, wherein said agonist inhibits the loss of bone.
- a further embodiment of the present invention includes a method of treating to the inner ear in a mammal comprising the step of administering to a mammal with an injured inner ear a therapeutic effective amount of an agonist to COUP-TFI, wherein said agonist induces growth or inhibits degeneration of the inner ear.
- An additional embodiment of the present invention includes a method for enhancing the growth of the cochlear duct, scala tympani or sacculus m a mammal comprising the step of administering a therapeutic effective amount of an agonist to COUP-TFI, wherein said agonist induces growth.
- Another embodiment of the present invention includes a method for treating neurodegenerative diseases m a mammal comprising the step of introducing by genetic therapy a COUP-TFI gene operatively linked to a promoter, wherein said COUP-TFI gene is mducible by the addition of an agonist and said expression of COUP-TFI enhances expression of COUP-TFI increasing the growth of neural and neuronal tissue.
- Another embodiment of the present invention includes a method for treating bone diseases m a mammal comprising the step of introducing by genetic therapy a COUP-TFI gene operatively linked to a promoter, wherein said COUP-TFI gene is mducible by the addition of an agonist and said expression of COUP- TFI enhances expression of COUP-TFI increasing the growth of bone tissue.
- An additional embodiment of the present invention includes a method for treating hearing and balance diseases m a mammal comprising the step of introducing by genetic therapy a COUP-TFI gene operatively linked to a promoter, wherein said COUP-TFI gene is mducible by the addition of an agonist and said expression of COUP-TFI enhances expression of COUP-TFI increasing the growth of inner ear tissue.
- Figure 1 depicts targeted disruption of the mCOUP-TFI locus.
- the mCOUP-TFI locus is shown on top with exons I -III in boxes.
- the targeting vector and targeting locus are shown below.
- Figures 2A and 2B show a representative litter from an mCOUP-TFI heterozygote intercross as seen on Southern blot (Fig. 2A) and Northern blot (Fig. 2B) analysis .
- Figures 3A through 3D depict whole-mount lmmuno- histochemistry on wildtype and homozygote embryos using 2H3 anti-neurofilament antibody showing the progression of cranial ganglion formation (dorsal is to the left, ventral is to the right, scale bar, 100 ⁇ m) .
- Figures 3A and 3C depict the wildtype;
- Figure 3B and 3D depict mutant embryos at E9.5 and E10.5, respectively.
- Figure 3 also shows the ganglion IX two different stages of development.
- Figures 4A through 4F depict the expression of mCOUP-TFI.
- Figures 4A through 4C show whole mount in si tu hybridization of mCOUP-TFI in E8.0 (Figure 4A) , 8.5 ( Figure 4B) , and 9.0 ( Figure 4C) embryos, respectively.
- Figures 4D through 4F show sections of a whole-mount stained E8.5 embryo.
- Figures 5A through 5F show the expression of rhombomere specific genes in mCOUP-TFI mutants.
- Whole- mount in si tu hybridization was performed on wildtype (Figs. 5A through 5C) or mutant embryos (Figs. 4D through 4F) with rhombomere specific markers.
- Figures 7A through 7D show the developmental progression of the formation of the IXth ganglion as visualized by X-gal staining.
- Figures 8A through 8H depict excessive cell death m mCOUP-TFI mutant embryos. mCOUP-TFI wildtype (Figs. 8A through 8D) and mutant (Figs. 8E through 8H) .
- Figures 9A through 91 show whole-mount analysis of axonal projections (scale bars in Figures 9A through 9C, 100 ⁇ ; E-H, 50 ⁇ m; Figure 9D, 20 ⁇ m) . Multiple defects m cranial nerve projections are detected in severely affected embryos.
- Figure 9A shows wildtype E10.5 embryo
- FIG. 9B shows wildtype E10.5 embryo
- FIG. 9C shows enlargement of cranial nerve IX-XII region from Figures 9B and 9C.
- Figure 91 shows an enlargement of wildtype occulomotor nerve.
- Figures 10A through 10D show whole-mount lmmuno- histochemistry of wildtype (Figs. 10A and 10C) and mutant Ell.5 fetuses (Figs. 10B and 10D) using 2H3 anti-neurofilament antibody.
- Figure 10A and Figure 10B show sagittal views at the level of posterior hmdbram and anterior somite region showing arborization of the first several spinal nerves.
- Figures 10C and 10D show the ophthalmic branch of the t ⁇ germmal nerve.
- Figures 11A through 11F show whole-mount views of alizarin red (mineralized bone) and alcian blue (cartilage) stained skulls of newborns (Figs.
- FIG. 11A through 11D and 17 day fetuses (Figs. HE and 11F) of wildtype (Fig. HA), heterozygotes (Figs. 11C and HE) and COUP-TFI mutants (Figs. 11B, 11D, and 11F) .
- Figures 12A through 12D show whole-mount views of cervical vertebrae wildtype (Figs. 12A and 12B) and COUP-TFI mutants (Figs. 12C and 12D) .
- Figures 13A through 13D show whole-mount views of wildtype (Fig. 13A, +/+) and COUP-TFI mutant (Fig. 13C, -/-) cochlea showing approximately 2 5 turns of cochlear duct (line is drawn through the middle of the cochlear duct) in wildtype, but less than 2 turns in mutant.
- Figures 13B and 13D show haematoxylm- and eos -stamed sagittal view through the mid-modiolar plane of wildtype (Fig. 13B) and mutant (Fig. 13D) cochlea. The following symbols are used: basal coil (BC) , median coil (MC) , and apical coil (AC) of the cochlear ducts.
- BC basal coil
- MC median coil
- AC apical coil
- Figures 14A through 14H show whole-mount and sectional views of alizarin red (mineralized bone) and alcian blue (cartilage) stained wildtype (Figs. 14A through 14D) and COUP-TFI mutant (Figs. 14E through 14H) inner ears showing defects m formation of the sacculus .
- the following symbols are used: U ut ⁇ culus, S sacculus, SC semicircular canals, C cochlea, M malleus, I incus, ST stapes, T tympanic ring.
- FIG. 15A through 15D shows that the cortex of
- FIG. 15A and 15B show the cortex (cp) in the (-/-) is thinner than that m the (+/+), especially at the dorsal lateral regions.
- the cortical subplate (sp) is hardly visible m the (-/-) .
- Figure 15C and 15D represents higher magnification of the cortical regions containing the subplate which is poorly formed m the (-/-) as compared to (+/+) .
- cc corpus callosum; cp, cortex; c-p, caudate-putamen; sn, septal nucleus; sp, subplate.
- FIG 16A through 16D show that the cortical subplate is greatly reduced the cortex of COUP-TFI null mice.
- Coronal sections of E17 5 mouse brains are immunohistochemically stained with an antibody against GAP43, a marker for the growth cone of axon.
- GAP43 expression is detected m the subplate and intermediate zone of the cortex of (Figs. 16A and 16C, +/+) .
- m the cortex of (Figs. 16B and 16D, -/-) GAP43 only stains the intermediate zone.
- the subplate m (Figs. 16B and 16D, -/-) appears to be missing which is consistent with histological analysis.
- Figures 16C and 16D are the bright-field view of coronal sections counterstamed with H&E .
- Figures 17A through 17D show that the cerebral cortical layers of COUP-TFI null mice are poorly differentiated. These are coronal sections of 3 -week old mouse brains . Figures 17C and 17D are the higher magnification of the upper panels. The (-/-) cerebral cortex is thinner and the cortical layers are poorly differentiated. The layer IV m (-/-) appears to be missing, while the white matter (WM) layer is thicker in (-/-) than m (+/+) . I-VI, cortical layer I through VI.
- Figures 18A through 18F show that axons in the CNS of COUP-TFI null mice are hypomyelmated. Coronal sections of 3 -week old mouse brains are stained with luxol fast blue and counterstamed with nuclear fast red.
- Figures 18C and 18D are the higher magnification of the white matter of the Figures 18A and 18B.
- Figures 18E and 18F are the higher magnification of the caudate-putamen of the Figures 18A and 18B.
- the axon bundles m both white matter and caudate-putamen of (- /-) are less myelmated indicated by blue staining.
- FIGs 19A through 19F show that myelm basic protein expression is downregulated in the cortex of COUP-TFI null mice. Coronal sections of 3 -week old brains are immunohistochemically stained with an antibody against myelm basic protein.
- Figures 18C and 18D are the higher magnification of the white matter area shown on the Figures 18A and 18B.
- Figures 18E and 18F are the higher magnification of the caudate-putamen area of the Figures 18A and 18B. Expression of myelm basic protein m both white matter and caudate-putamen of (-/-) are greatly reduced.
- Figures 20A through 20D show that Tst-l/SCIP/0ct-6 gene expression is downregulated m the cortex of COUP- TFI null mice.
- Figures 20C and 20D show m si tu hybridization of coronal sections of PI (+/-) and (-/-) mouse brains with antisense probe for Tst-l/SCIP/Oct-6.
- Figures 20A and 20B upper panels are the bright-field view of coronal sections counterstamed with H&E .
- COUP-TFI directed therapies based on a particular protein, COUP-TFI, i.e., "COUP-TFI directed therapies.”
- COUP-TFI directed therapies This Application describes the newly discovered physiological role of this unusual protein, COUP-TFI, whose function is generally related to regulating transcription (e.g., the biosynthesis of proteins) .
- COUP-TFI m mammalian physiology
- the physiological role of COUP-TFI is directed to at least three major areas: neurological development, bone morphogenesis, and inner ear development.
- novel therapies which exploit the biochemistry/molecular biology and physiological role of COUP-TFI to treat neurological disorders, learning and memory, bone-related disorders, and hearing-related disorders—all disorders known to occur in the absence of COUP-TFI.
- COUP-TFI and its agonists are promising therapeutic agents for the types of maladies known to result from the absence of COUP-TF, and are also promising therapeutic agents for related disorders, whether or not caused by COUP-TF deficiency.
- one therapeutic technique disclosed and claimed in the present Invention involves administering to a subject, afflicted with one of the aforementioned disorders, a compound ("agonist"), which is known to bind to COUP-TFI, initiating a cascade of events, culminating eventually m a transc ⁇ ptional response, i.e., the formation of a protein.
- Antagonist is a compound which interacts with the COUP-TFI receptor to induce a transc ⁇ ptional response.
- Antagonist is a compound which, interacts with or binds to the COUP-TFI receptor and thereby inhibits the activity of a receptor agonist.
- Disease or “Disorder” as used herein is generally consonant with the ordinary meaning to the skilled artisan: i.e., any deviation from or interruption of the normal structure or function of any part or system of the body.
- Orphan receptors is a designation given to a series of cloned receptors whose primary sequence is closely related to the steroid hormone receptors, but for which no ligand has been described.
- steroid/thyroid hormone receptor superfamily is a classification of a group of proteins, some of which are known steroid receptors whose primary sequence suggests that they are related to each other.
- Transfected/Transfection is a term describing the process of directly introducing DNA into a mammalian cell.
- the compound will be considered a therapeutic effective amount if it decreases, delays or eliminates the onset of a neurodegenerative disease.
- a compound will be considered therapeutic effective if it enhances nerve growth, learning and memory, bone formation or inhibits or slows down or delays nerve or bone degeneration or breakdown.
- therapeutic effective shall also mean it enhances inner ear growth or slows down or prevents inner ear degeneration.
- the compound may not provide a cure but may only provide partial benefit.
- a physiological change having some benefits is considered therapeutically beneficial.
- an amount of a compound which provides a physiological change is considered an amount of a compound which provides a physiological change.
- a compound or composition is said to be "pharmaceutically acceptable” if its administration can be tolerated by a recipient mammal .
- Such an agent is said to be administered in a "therapeutic effective amount” if the amount administered is physiologically significant.
- An agent is physiologically significant if its presence results in a change in the physiology of a recipient mammal .
- the agonists, antagonists, proteins for inducing expression of COUP-TFI, the COUP-TFI gene, and the COUP-TFI protein itself (active ingredients) of this invention can be formulated and administered to inhibit or decrease the symptoms of a variety of disease states (neurodegenerative, inner ear and bone disease) or enhance or improve the success of treatments (nerve growth, learning and memory, bone growth or inner ear growth) by any means that produces contact of the active ingredient with the agent's site of action in the body of a mammal .
- These compounds can be administered by any conventional means available for use in conjunction with pharmaceuticals, either as individual therapeutic active ingredients or in a combination of therapeutic active ingredients.
- Dosage (composition) suitable for internal administration m the treatment of proliferative disease generally contain from about 1 to about 500 mg of active ingredient per unit. In these pharmaceutical compositions, the active ingredient will ordinarily be present m an amount of about 0.05 to 95% by weight based on the total weight of the composition.
- the active ingredient can be administered orally in solid dosage forms such as capsules, tablets and powders, or m liquid dosage forms such as elixirs, syrups, emulsions and suspensions
- the active ingredient can also be formulated for administration parenterally by injection, rapid infusion, nasopharyngeal absorption or dermoabsorption.
- the agent may be administered intramuscularly, intravenously, or as a suppository They can be given m divided doses or m sustained released form. Additionally, gene therapy may be used to target the compound. The skilled artisan can readily recognize that the dosage for this method must be adjusted depending on the efficacy of delivery.
- Gelatin capsules contain the active ingredient and powdered carriers such as lactose, sucrose, mannitol, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like. Similar diluents can be used to make compressed tablets. Both tablets and capsules can be manufactured as sustained release products to provide for continuous release of medication over a period of hours. Compressed tablets can be sugar coated or film coated to mask any unpleasant taste and protect the tablet from the atmosphere, or enteric coated for selective disintegration in the gastrointestinal tract. Liquid dosage forms for oral administration can contain coloring and flavoring to increase patient's acceptance .
- water a suitable oil, saline, aqueous dextrose (glucose) , and related sugar solutions and glycols such as propylene glycol or polyethylene glycols are suitable carriers for parenteral solutions.
- Solutions for parenteral administration contain preferably a water soluble salt of the active ingredient, suitable stabilizing agents and, if necessary, buffer substances.
- Antioxidizmg agents such as sodium bisulfate, sodium sulfite or ascorbic acid, either alone or combined, are suitable stabilizing agents.
- citric acid and its salts, and sodium EDTA are also used.
- parenteral solutions can contain preservatives such as benzalkonium chloride, methyl- or propyl-paraben, and chlorobutanol .
- Suitable pharmaceutical carriers are described Remington ' s Pharmaceuti cal Sciences, a standard reference text in this field. Additionally, standard pharmaceutical methods can be employed to control the duration of action. These are well known m the art and include control-release preparations, and can include appropriate macromolecules, for example: polymers, polyesters, polyaminoacids, polyvinyl, pyrolidone, ethylenev ylacetate, methyl cellulose, carboxymethyl cellulose or protamine sulfate. The concentration of macromolecules as well as the methods of incorporation can be adjusted in order to control release.
- the agent can be incorporated into particles of polymeric materials such as polyesters, polyaminoacids, hydrogels, poly (lactic acid) or ethylenevmylacetate copolymers . In addition to being incorporated, these agents can also be used to trap the compound m microcapsules .
- Useful pharmaceutical dosage forms for administration of the compounds of this invention can be illustrated as follows.
- Capsules are prepared by filling standard two-piece hard gelatin capsulates eacn with 100 milligram of powdered active ingredient, 175 milligrams of lactose, 24 milligrams of talc and 6 milligrams magnesium stearate.
- Soft Gelatin Capsules A mixture of active ingredient m soybean oil is prepared and injected by means of a positive displacement pump into gelatin to form soft gelatin capsules containing 100 milligrams of the active ingredient. The capsules are then washed and dried.
- Tablets- Tablets are prepared by conventional procedures so that the dosage unit is 100 milligrams of active ingredient. 0.2 milligrams of colloidal silicon dioxide, 5 milligrams of magnesium stearate, 275 milligrams of microcrystallme cellulose, 11 milligrams of cornstarch and 98.8 milligrams of lactose. Appropriate coatings may be applied to increase palatability or to delay absorption
- a parenteral composition suitable for administration by injection is prepared by stirring 1.5% by weight of active ingredients m 10% by volume propylene glycol and water. The solution is made lsotonic with sodium chloride and sterilized.
- aqueous suspension is prepared for oral administration so that each 5 millimeters contain 100 milligrams of finely divided active ingredient, 200 milligrams of sodium carboxymethyl cellulose, 5 milligrams of sodium benzoate, 1.0 grams of sorbitol solution U.S. P. and 0.025 millimeters of vanillin.
- gene therapy it is known that a variety of methods can be used by those skilled in the art.
- the compounds can also be targeted to specific locations depending on the method used. Any other procedures for use in targeting of compounds can be used.
- the compounds can be applied topically or directly to the location in which the intervention is needed.
- a biolistic device is preferably used, such as those described in Morikawa, H., et al., Transient expression of foreign genes in plant cells and tissues obtained by a simple biolistic device (particle-gun) , 31 Appl . Microbiol . Biotechnol. 320 (1989).
- One embodiment of the present invention includes a method for treating neurodegenerative diseases in a mammal, comprising the step of administering to a mammal affected with said neurodegenerative disease a therapeutic effective amount of an agonist of COUP-TFI, wherein said agonist induces growth of neurological tissue .
- the neurodegenerative disorder is selected from the group consisting of Alzheimer's Disease, Huntington's Disease, seizure, Parkinson Disease, stroke, multiple sclerosis, and learning and memory defects.
- Another embodiment of the present invention includes a method of enhancing nerve regeneration in a mammal comprising the step of administering to a mammal an effective amount of an agonist of COUP-TFI, wherein said agonist induces the growth of nerves or neurons.
- said agonist induces or stimulates the growth of the axonal projection.
- the agonist enhances or stimulates axonal differentiation and myelmation.
- the agonist stimulates the growth of the axonal projection between the glossopharyngeal ganglion m the hmdbram.
- the agonist stimulates growth of the IX ganglion.
- a further embodiment of the present invention includes a method for the prevention of nerve and neuron degeneration m mammals comprising the step of administering to a mammal a therapeutically effective amount of an agonist of COUP-TFI, wherein said agonist enhances nerve or nerve growth
- An additional method of the present invention is a method of treating hearing defects comprising the step of administering to a mammal affected with said hearing defect a therapeutic effect amount of an agonist to COUP-TFI, wherein said agonist induces growth of the inner ear.
- An additional embodiment of the present invention includes a method of treating balance defects m a mammal comprising the step of administering to a mammal affected with said balance defects therapeutic effective amount of an agonist to COUP-TFI, wherein said agonist induces growth m the inner ear.
- Another embodiment of the present invention includes a method of inducing regeneration of bone formation m a mammal comprising the step of administering to said mammal a therapeutic effective amount of agonist of COUP-TFI, wherein said agonist induces bone formation.
- Another embodiment of the present invention includes a method for prevention of bone loss m a mammal an effective amount of an agonist of COUP-TFI, wherein said agonist inhibits the loss of bone.
- a further embodiment of the present invention includes a method of treating to the inner ear m a mammal comprising the step of administering to a mammal with an injured inner ear a therapeutic effective amount of an agonist to COUP-TFI, wherein said agonist induces growth or inhibits degeneration of the inner ear.
- An additional embodiment of the present invention includes a method for enhancing the growth of the cochlear duct, scala tympani or sacculus in a mammal comprising the step of administering a therapeutic effective amount of an agonist to COUP-TFI, wherein said agonist induces growth.
- Another embodiment of the present invention includes a method for treating neurodegenerative diseases a mammal comprising the step of introducing by genetic therapy a COUP-TFI gene operatively linked to a promoter, wherein said COUP-TFI gene is mducible by the addition of an agonist and said expression of COUP-TFI enhances expression of COUP-TFI increasing the growth of neural and neuronal tissue.
- Another embodiment of the present invention includes a method for treating bone diseases in a mammal comprising the step of introducing by genetic therapy a COUP-TFI gene operatively linked to a promoter, wherein said COUP-TFI gene is mducible by the addition of an agonist and said expression of COUP- TFI enhances expression of COUP-TFI increasing the growth of bone tissue.
- An additional embodiment of the present invention includes a method for treating hearing and balance diseases m a mammal comprising the step of introducing by genetic therapy a COUP-TFI gene operatively linked to a promoter, wherein said COUP-TFI gene is mducible by the addition of an agonist and said expression of
- COUP-TFI enhances expression of COUP-TFI increasing the growth of inner ear tissue. It is demonstrated herein that mCOUP-TFI is essential for postnatal survival and is required for proper development of a subset of neurons m the peripheral nervous system. Evidence of this is provided herein, and includes experimental results showing that mutant embryos displayed a defective morphogenesis of the glossopharyngeal ganglion and nerve. In addition, mactivation of the mCOUP-TFI gene also resulted m defective axonal guidance. Paradoxically, mCOUP-TFI is widely expressed, yet the phenotypes exhibited by the mutants were highly specific.
- mCOUP-TFI might be compensated for by mCOUP-TFII.
- mCOUP-TFI knockout is lethal provides convincing evidence that mCOUP-TFI, beyond question, possesses a distinct physiological function, despite its extensively overlapping expression profile with mCOUP-TFII .
- a mouse 129Sv genomic library was screened with a mouse cDNA fragment containing the complete mCOUP-TFI open reading frame.
- Several of the positive clones contained all three exons of mCOUP-TFI gene.
- a 700 bp fragment containing 59 and primer untranslated region was excised with EcoRl/Sacl and used as the 51 homologous arm m the gene targeting vector. The Sacl site was destroyed during subsequent subclonmgs.
- a 6.5 kb fragment containing part of exon 2 and the entire exon 3 was excised with Sall/SacI and used as the right arm.
- the PGKneobpA gene (neor) (Soriano et al .
- FIG. 1 depicts targeted disruption of the mCOUP-TFI locus.
- the targeting strategy is shown at the top of the
- the mCOUP-TFI locus is shown on top with exons I-III in boxes.
- the targeting vector and targeting locus are shown below.
- the solid region represents open reading frame and open boxes represents the 5' and 3' untranslated regions.
- the hatched regions represent probes used in Southern blot analysis.
- the replacement vector includes a PKG-neo gene and a tk gene.
- the directions of transcription are indicated by arrows.
- the shaded box represents pBluescript vector.
- the left and rights arms are indicated by dashed lines.
- the Sad site at the right end of the left arm was destroyed during subcloning.
- the correctly recombined locus is shown at the bottom. Restriction sites are indicated above the lines. The following symbols are used: P, Pstl ; S, Smal ; X, Xbal ; Rl , EcoRI ; B, BamEI ; SL, Sail.
- Figure 2 shows the results of a Southern blot analysis on a representative litter from a mCOUP-TFI heterozygote intercross. Genomic DNA was digested with Sad and hybridized with the 5' probe. A 1.6 kb and a
- FIG. 2B also shows the results of a Northern analysis of RNA from E13.5 wildtype (+/+), heterozygote (+/-), and homozygote embryos (-/-) .
- a 700 bp Pstl / Seal fragment mainly containing the 3' untranslated region of mCOUP-TFI was used as the probe. Note the absence of mCOUP-TFI mRNA the homozygote.
- GAPDH was used as an internal control and is shown at the lower panel .
- ES cells were cultured and manipulated essentially as described by Robertson (1987) . Briefly, 107 AB 1 ES cells were electroporated with 25 mg targeting construct in 0.9 ml PBS using a Bio-Rad Gene Pulser (500 ⁇ F, 230 V) , and plated on either one or two 10 cm plates containing a monolayer of mitomycin
- the 3' primer was 5'- CTGACGTGAATAGCACGATG -3', located at the end of exon 2, 3' to the Sail site. To detect the mutant allele, the same 3' primer was used.
- the 5' primer was 5'- GCTATCAGGACATAGCGTTG -3 located at the 3' end of the PGKneo gene .
- PCR was performed according to the manufacture's instructions (Promega) , with 1.0 mM MgCl 2 , at the annealing temperature of 55°C.
- the positive clones identified from the screening were thawed, expanded, and injected into embryonic day (E) 3.5 blastocysts derived from C57BL/6 females.
- the embryos were transferred into the uteri of pseudopregnant F I (CBA x C57BL/6) foster mothers.
- Male chimeras with 80% - 100% agouti coat color were backcrossed to C57BL/6 females, and germlme transmission was determined by tne presence of agouti offspring.
- Heterozygotes were determined by Southern analysis and intercrossed to generate homozygotes.
- the washes were similar to post primary antibody washes with an additional 20 mm wash PBT (0.2% BSA, 0.1% Triton X-100 m PBS) at room temperature.
- PBT 0.2% BSA, 0.1% Triton X-100 m PBS
- embryos were incubated with 0.3 mg/ml diammobenzidme tetrahydrochlo ⁇ de (Sigma) m PBT for 30 - 60 mm at room temperature, and visualized by addition of H 2 0 2 to 0.0003% and incubation at room temperature.
- Embryos were then rinsed m PBT to stop the reaction, dehydrated through a methanol series: 30%, 50%, 80%, 100% for 30 - 60 mm each, and cleared m benzyl alcohol : benzyl benzoate (1:2).
- Embryos were photographed on a Zeiss stemi 200° dissecting microscope .
- the embryos were stained with X-gal, then processed and embedded in paraffin. Neurons were counted from every 6th section of 7 mm thick sections In the cases when ganglion IX and X were fused, the cells rostral to ganglion X were counted as cells for ganglion IX. Statistical significance was analyzed by Student's t-test .
- This clone contained the entire mCOUP-TFI gene which spans three exons .
- the N- terminal and the DNA-bmdmg domain are m the first exon, whereas the ligand-bmdmg domain is split into two exons.
- the targeting vector contains a 0.7 kb 5' homologous sequence and a 6.5 kb 3' homologous sequence flanking the neon cassette ( Figure 1) .
- a 4.0 kb genomic region including the N-termmus and the entire DNA-bmdmg domain and two thirds of the ligand-bmdmg domain will be deleted and replaced with the PGK-neobpA gene upon correct recombination. This ensures that the mutation does not generate a functional protein with dominant- negative activity.
- the targeting vector was linearized, electroporated into the AB 1 ES cells and subjected to positive (G418) and negative (FIAU) selections. A total of 850 colonies were screened by Southern blot analysis.
- the restriction enzyme Xbal was used as the diagnostic enzyme and a 0.5 kb Xbal/EcoRI fragment just upstream of the 5' homologous sequence was used as probe.
- ES cells carrying the mutated mCOUP-TFI locus were injected into C57BL/6 blastocysts. Two male chimeras with 100% agouti coat color generated from one ES clone were mated to C57BL/6 females. Germline transmission was obtained, and the resulting heterozygous mice appeared phenotypically normal and were fertile. Heterozygous mice were intercrossed to generate homozygotes . To ensure no normal mCOUP-TFI transcript was generated from the mutated allele, total RNA was isolated from E13.5 embryos from heterozygote intercrosses.
- a 700 bp Sa fragment containing the 3' untranslated region of mCOUP-TFI gene was used as a probe in Northern hybridization analysis. As shown in Fig. 2B, no mCOUP-TFI specific transcripts were detected in the homozygotes.
- COUP-TFs are expressed in restricted regions of the central nervous system (CNS) during embryonic development. COUP-TFI is widely expressed in the CNS and in many organs. Hence the expression pattern overlaps, yet is distinct from, that of COUP-TFII. In general though, COUP-TFI expression is higher in the CNS and lower in internal organs as compared with COUP-TFII.
- Figure 8 shows the excessive cell death m mCOUP-TFI mutant embryos.
- mCOUP-TFI wildtype ( Figures 8A-8D) and mutant ( Figures 8E-8H) embryos at E9.5 were stained with X-gal, sectioned and TUNEL assay was performed. Every other section in the region of interest is presented. Sections at top are more dorsal than the sections at the bottom. Note that the left side of the mutant embryo shows much more pronounced cell death than m the wildtype
- the following symbols are used: ot , otic vesicle; VII/VIII, facial and acoustic ganglia; X, vagus ganglion.
- IX marks a position dorsal to ganglion IX proper which lies further ventral.
- the arrows indicate apoptotic cells .
- the expression of mCOUP-TFI was evident at the 1-2 somite stage. This expression was increased at 4-6 somite stage in the neuroepithelial region corresponding to the presumptive rhombomeres (r) 1-3 in the hmdbram (Fig. 4A) .
- mCOUP-TFI expression was observed m a stripe extending ventrally from the dorsal tip of the middle of the neuroepithelial expression domain
- the posterior boundary of the neuroepithelium corresponded to the posterior boundary of presumptive r3 , as indicated by Krox-20 expression at the same stage suggesting the stripe originated from the presumptive r2.
- mCOUP-TFI transcripts could also be seen m the developing foregut.
- mCOUP-TFI was expressed at high levels in the neuroepithelium and the dorsal edges of the presumptive rl-4 and at low levels in the dorsal edges of the presumptive r5-6.
- mCOUP-TFI transcripts were now detected two stripes extending ventrally from the presumptive r2 and r4 (Fig. 4B) .
- the pattern and timing of the two stripes of mCOUP-Tfl expression from r2 and r4 resemble that of the migrating neural crest cells.
- the neural crest cells (NCC) migrate through well defined pathways and occupy very characteristic positions. Sections of embryos stained by whole-mount m situ hybridization showed that some mCOUP-TFI expressing cells did occupy very characteristic positions of both premigratory and migratory NCC ( Figures 5D, 5E) .
- mCOUP-TFI was highly expressed m the entire mndbrain neuroepithelium and m the migrating NCC from r2 , 4, and 6 to branchial arches 1, 2, and 3, respectively (Fig. 4C) .
- the expression m the midbram, forebram, and other regions was similar to the pattern m later stages as reported previously.
- FIG. 3 depicts a whole-mount lmmunohistochemistry on wildtype and homozygote embryos using 2H3 anti-neurofilament antibody showing the progression of cranial ganglion formation (dorsal is to the left, ventral is to the right, scale bar, 100 ⁇ m) .
- Figures 3A and 3C depict the wildtype;
- Figure 3B and 3D depict mutant embryos at E9.5 and E10.5, respectively.
- Figure 3 shows the ganglion IX m two different stages of embryos.
- Arrows in Figures 3A and 3C point to the nerve projections between the IXth ganglion and the hindbrain; arrows in Figures 3B and 3D point to the absence of nerve projection between the IXth ganglion and the hindbrain. Arrowheads in Figures 3B and 3D also point to the connections between the IXth and the Xth ganglia.
- V trigeminal ganglion, VII, facial ganglion
- IX glossopharyngeal ganglion
- X vagus ganglion
- XI vagus ganglion
- XII accessory ganglion
- XII hypoglossal nerve
- ot otic vesicle.
- ganglion IX and X are well separated with very few nerve fiber connections between the two ganglionic masses. Multiple axonal projections between the glossopharyngeal ganglion and the hindbrain are readily seen in wildtypes (arrows in Figures 3A, 3C) ; however, in mutants, ganglion IX appeared as an isolated mass of neurons (arrowhead in Figure 3B) , or in other cases, a complete fusion or shunt of the axons away from the hindbrain and towards ganglion X (arrowhead in Fig. 3D) .
- the morphogenesis of the glossopharyngeal ganglion and its nerve is defective in mCOUP-TFI mutant embryos as shown by neurofilament staining.
- the glossopharyngeal nerve is the nerve of the 3rd pharyngeal arch. It supplies both sensory and motor innervation to the pharynx and root of the tongue. It also innervates the middle ear and soft palate. Together with the vagus nerve (the Xth cranial nerve) , the IXth nerve registers and regulates blood pressure and pulse rate.
- the cell bodies of the sensory and taste fibers reside in the IXth ganglion and the fibers terminate in the nucleus solitarius in the hindbrain.
- the motor fibers originate from the cranial part of nucleus ambigius and the secretory fibers stem from the inferior salivary nucleus in the hindbrain. These fibers pass through the ganglion and terminate on the target organs.
- proper connection between the ganglion and the appropriate nuclei in the brainstem is crucial for the proper function of the IXth nerve.
- the IXth ganglion either appeared as an isolated ganglionic mass or fused with the Xth ganglion. Indeed, there were no connections to the hindbrain through its normal route. Therefore, the function of the glossopharyngeal nerve appears severely compromised.
- the mutants die from apparent starvation and dehydration, they probably have difficulty in obtaining exogenous nutrients which are critical for their survival.
- the innervation to the pharynx and the root of the tongue might be most important regarding the lethal phenotype of mCOUP-TFI mutants, since proper control of the tongue and the pharynx is required for proper suckling and swallowing behavior.
- wildtype or heterozygotes could easily drink and swallow 30-50 ⁇ l of milk.
- the mutants displayed abnormal throat movements after taking in the milk and soon the milk was expelled from the nasal cavity, suggesting that the mutant pups did exhibit difficulty in swallowing.
- the ganglion of the glossopharyngeal nerve contains two components: the superior and the inferior (petrosal) ganglion.
- both the neurons and the non-neuronal cells are derived from the neural crest cells of r6.
- the neurons originate from the second epibranchial placode, while all the non-neuronal cells are derived from neural crest cells of r6. Since mCOUP-TFI is expressed in premigratory and migratory neural crest cells, it is possible that the neural crest derived component of the IXth ganglion is defective. In fact, the altered morphology of the IXth ganglion in the mutant embryos supports this hypothesis.
- the extent of cell death in these regions was analyzed. There is a limited amount of cell death in specific regions during normal embryonic development . The best known example is the cell death in the interdigital necrotic zones of the vertebrate limb. These cells undergo programmed cell death on a schedule even when explanted into culture. Most of the apoptotic cells in other regions are neural crest m origin. On the other hand, the life or death decision of the neural crest cells is influenced by environment and position. For example, the neural crest cells generated in r3 and r5 do not emigrate, instead, they undergo apoptosis.
- the neural crest cells migrate out perfectly because now they are free from the influence of the even number rhombomeres.
- Cell death has been detected along the migratory routes of neural crest cells, including regions of the developing VH/VIIIth ganglia and the IXth ganglion.
- a few apoptotic cells were observed m a region just dorsal to the developing IXth ganglion m wildtype or heterozygous embryos.
- much more pronounced cell death was observed in a similar region of the mutant embryos.
- the apoptotic cells occupied the same region as the neural crest cells for ganglion IX.
- apoptotic cells are neural crest m origin which m turn shows that the neuron loss is m the superior component of the IX ganglion.
- this evidence proves that the excessive precursor cell death results m a decrease of neurons m the glossopharyngeal ganglia of mCOUP-TFI mutant embryos, and that the defect is m the superior component .
- neural crest cells contribute to all the non-neuronal cells m both superior and inferior ganglion and since non-neuronal cells are present in the IXth ganglia of the mutant embryos, it is clear that not all the neural crest cells for the IXth ganglion undergo apoptosis. It is not known whether the neurons selectively undergo apoptosis. Yet, it is possible that there are also less non-neuronal cells in the mutant IXth ganglion than the wildtype. In addition, it seemed that the apoptotic domain -the mutant embryos extended towards the Xth ganglion. Although the number of neurons in the Xth ganglia of the mutant embryos did not differ significantly from the wildtype or heterozygous embryos, it is possible that the formation of the Xth ganglion is slightly compromised.
- Neural crest cell death during normal embryonic development could either be due to response to an overproduction of the neural crest cells or it could contribute to patterning the neural crest migration pathway. The excess death observed around the mutant
- IXth ganglion is a consequence of the lost of function of the mCOUP-TFI gene. Thus, this group of cells probably did not receive or could not respond to appropriate signal (s) for differentiation and switched to programmed cell death or apoptosis instead.
- the Vth, VH/VIIIth, and Xth ganglia also have neural crest contribution. Yet, obvious defects were only observed on the IXth ganglion. Thus it appears that the formation of the other ganglia does not require mCOUP-TFI function. Alternatively, the lack of mCOUP-TFI function m those regions is compensated by other genes such as mCOUP-TFII which is expressed similarly as mCOUP-TFI although m a less restricted manner.
- Figure 7 shows the development progression of the formation of the IXth ganglion as visualized by X-gal staining.
- V trigeminal ganglion
- VII/VIII facial and acoustic ganglia
- IX glossopharyngeal ganglion
- X vagus ganglion.
- the arrow indicates the fusion between the IXth and the Xth ganglia in the mutant embryo.
- BETA2/NeuroD is a basic helix- loop-hel x transcription factor.
- a lacZ gene with a nuclear localization signal was placed - frame with the BETA2 open-reading- frame when the BETA2 knockout mice were generated.
- BETA2 is expressed early in developing cranial ganglia as visualized by X-gal staining The first few differentiating neurons stained blue were observed at the 17 somite stage m the trigeminal ganglion and subsequently the blue neurons were observed all the differentiating cranial ganglia. Mice heterozygous for the BETA2 gene have no detectable defects. The BETA2 gene expression was thus used as a marker for ganglionic cell bodies m our study. The defect the mutant IXth ganglion was fully manifested at E10.5 ( Figure 7C, 7D) , the number of neurons m both wildtype and mutant IXth ganglia were counted.
- the number of neurons ganglia IX was significantly lower (about 40%) in the mutants than m the wildtypes or heterozygotes .
- neurons m the Xth ganglia of the same embryos were counted and the numbers were not significantly different between the mutant and the wildtype or heterozygous embryos. This shows that some precursor cells of ganglion IX must have prematurely died, changed fate or migrated to a different position.
- Figure 4 depicts the Expression of mCOUP-TFI.
- A-C whole-mount m situ hybridization of mCOUP-TFI in E8.0 ( Figure 4A) , 8.5 ( Figure 4B) , and 9.0 ( Figure 4C) embryos, respectively.
- Figures 4D-4F show sections of a whole-mount stained E8.5 embryo The following symbols are used: al, a2 , and a3 , branchial arch 1, 2, and 3, respectively; drg, dorsal root ganglia; fb, forebra ; h, heart; hb, hmdbram; hf, head fold; fg, foregut ; mb, midbram, ot, otic vesicle; pmnc , premigratory neural crest cells; r2c, r4c, neural crest cells from r2 , r4 respectively; sm, somite.
- Figure 4D point to premigratory neural crest cells (NCC) ; arrows m Figures 4E and 4F indicate migrating NCC that are mCOUP-TFI positive.
- Figure 9 show whole-mount analysis of axonal projections. Multiple defects m cranial nerve "projections are detected m severely affected embryos. A, wildtype E10.5 embryo. The right ( Figure 9B) and the left ( Figure 9C) sides of a E10.5 mutant embryo.
- Figure 9D and 9F show enlargement of cranial nerve IX- XII region from Figures 9B and 9C.
- Figure 5 shows the expression of rhombomere specific genes m mCOUP-TFI mutants.
- Whole-mount m situ hybridization was performed on wildtype (5A-5C) or mutant embryos ( Figures 5D-5F) with rhombomere specific markers. Note that the expression is unchanged for mutants.
- Figures 5A and 5D Krox-20 expression in r3 , r5 of E8.5 embryos.
- Figures 5C and 5F show that CRABP I expression is strong m R4-6, but weak m r2 for E9.5 embryos.
- Figure 6 depicts an analysis of cranial NCC migration m mCOUP-TFI mutants. Wildtype ( Figures 6A, 6C and 6E) or mutant embryos ( Figures 6B, 6D and 6F) were hybridized with CRABP I antisense probe to examine the migration of the neural crest cells. Whole-mount in s tu hybridization on E9.0 ( Figure 6A, 6B) and E9.5 (6C through 6F) embryos. Figures 6E and 6F show m si u hybridization with CRABP I antisense probe on sections of late E9.5 embryos.
- mCOUP-TFI neural crest cells for ganglia IX and X
- fn frontal nasal mesenchyme
- r rhombomere
- r2c r4c
- r6c neural crest cells from r2 , r4 , r6 respectively
- ot otic vesicle
- mCOUP-TFI is expressed in NCC since part of the IXth ganglion is derived front these specialized cells.
- the glossopharyngeal ganglion has two components: the inferior (petrosal) ganglion is derived from the second epibranchial placode, and the superior ganglion is derived from NCC which originate from r6.
- the superior ganglion is derived from NCC which originate from r6.
- analyses must be performed at earlier embryonic stages before the NCC reach their final destination.
- Neural crest cells are prepatterned m the hmdbram and carry the identity of the rhombomere from which they emigrate.
- the identities of the rhombomeres are established at molecular levels via a combinatorial expression of a number of genes at segmentally restricted patterns during hmdbram development.
- the mCOUP-TFI mutant embryos In order to examine whether the segmentation and identities of the rhombomeres were retained m the mCOUP-TFI mutant embryos, several genes that are expressed m a segmentally restricted fashion m the developing hmdbram were used as markers for the respective rhombomeres.
- the region of cell death corresponded to the expression domain of CRABP I and to the known migratory route of NCC for the IXth ganglion (compared to Fig. 7C, 7F) , suggesting that at least some of the apoptotic cells the mutant embryos might be of neural crest origin. In most cases, the excess cell death was only seen on one side of the mutant embryos. This correlates well with the observation that the defective IXth ganglion was commonly seen on one side of a given mutant embryo by neurofilament staining. Collectively, these data show that the excess cell death during the migratory phase of the NCC result a decrease differentiating neurons m the mutant ganglion IX. This in turn shows that the superior component of the glossopharyngeal ganglion is most likely compromised.
- mutant embryos In addition to the aberrant projections, mutant embryos also displayed aberrant arborization at later developmental stages. When older embryos (Ell -5 to E13- 5) were stained with the 2H3 antibody, it was clear that the extent of arborization or branching of the axonal trees was affected in about half of the mutant embryos at the facial and cervical plexus regions . The cervical plexus is formed by the first four spinal nerves. In Ell.5 wildtype embryos, the nerve fibers were extensively arborized ( Figure 9A) , whereas in the mutants, the primary axons appeared thicker and there were less secondary branchings and much less tertiary or higher order branchings (Fig. 9B) .
- Figure 10 shows that mCOUP-TFI mutant embryos display reduced arborization of axonal trees.
- Figure 10A and Figure 10B show sagittal views at the level of posterior hindbrain and anterior somite region showing arborization of the first several spinal nerves. Note the reduced arborization of the mutant fetuses.
- Figures IOC and 10D depict higher magnification of the ophthalmic branch of the trigeminal nerve. Arrowheads point to the corresponding branching points in the wildtype and mutant embryos. Note also the extensive branchings in the wildtype, and the diminished extent of arborization in the bracketed region.
- nerve fibers In developing embryos, nerve fibers have to navigate for long distances before reaching their targets.
- the pathfinding process has high fidelity due to the guidance molecules presented in the surrounding environment which are sensed by the growth cones.
- guidance cues There are several kinds of guidance cues, including long range (diffusible molecules) and short range (contact mediated), both could be positive or negative.
- long range diffusible molecules
- short range contact mediated
- multiple guidance cues in the surrounding environment are presented to a given growth cone. The net outcome is determined by the balance between different forces.
- the nerve fibers in the cervical plexus and facial regions of many mCOUP-TFI null mutants were much less arborized than their wildtype or heterozygous litter mates and can be assigned to defects in axonal guidance.
- Axonal branches could either be formed by collateral initiation of secondary growth cones along the axon shaft or by bifurcation of the primary growth cones. This process involves initiation, stabilization, and outgrow of the secondary growth cones. Many transient branches are formed, but only few are stabilized. The higher order branches are formed in a similar way. Both the initiation and subsequent guidance of the secondary growth cones are believed to be governed by the same forces that guide the primary growth cones .
- This abnormal axonal guidance in mCOUP-TFI mutant embryos could be a result of a loss of mCOUP-TFI in the neurons themselves.
- the connection to the hindbrain was altered or absent in the mutants .
- the loss of neurons in the superior component affects the proper development of the remaining ganglionic cells.
- the apoptotic cells m the mutants included some cells that would themselves present guidance cues for the proper axonal projection to the hmdbram.
- the aberrant arborization in the cervical plexus is probably a defect in the dorsal root ganglionic neurons since they are also derivatives of the NCC.
- a guidance molecule is altered due to lack of mCOUP-TFI function.
- the defects m axonal guidance m the various regions are directly caused by changes m a single guidance molecule or by multiple molecules, is not certain.
- different phenotypes could be manifest because it is the collective information from attractive and repulsive guidance cues in the environment that determine the action of a growth cone.
- one guidance cue could be positive for some axons yet negative for others.
- Figures 11A- 11D show skulls of newborn mice, and 11E-11F show skulls of 17-day fetal mice.
- Figures 11A-11D show whole-mount views of alizarin red (mineralized bone) and alcian blue (cartilage) stained skulls of newborns ;
- Figures HE and HF show 17-day fetuses of wildtype (A);
- Figures HC and HE show heterozygotes ;
- Figures HB, HD and HF show COUP-TFI mutants Note the double (HB) and single (HD) fusion of the basioccipital (bo) and exoccipital (ex) bones m the mutants.
- Figure 11 also clearly shows the malformation in the cartilage (extra hole, marked with arrowhead in HF) between the basioccipital and exoccipital bones in the 17-day mutant skull.
- Figure 12 shows whole-mount views of cervical vertebrae m wildtype (12A and 12B) and COUP-TFI null mutants (12C and 12D) .
- the individual vertebrae are denoted as C1-C7, according to the legend between 12A and 12B.
- Figures 12A and 12C are frontal views and 12B and 12D are dorsal views.
- Figure 12C clearly shows the lack of mineralization m the traberculi anterior at C6 (as evidenced by the arrow) .
- Figure 12D shows bifurcation and duplication of the neural arches m C2 (shown by the arrow) .
- Protocols were established to determine additional physiological roles of COUP-TFI. As before, this involved generating COUP-TFI null mutant mice using homologous recombmant technology, and performing histopathological examinations on the mice after death. In this Example, the development of the structures forming the inner ear m COUP-TFI null mutants was closely examined.
- the COUP-TF null mutants died permatally between 8 and 36 hours post-birth.
- the newborn mutants appeared highly dehydrated, lacked milk in their stomachs, and contained air m their intestines.
- the mice inner ears were examined histopathologically .
- the most striking features are the reduced number of turns of the cochlear duct m the null mutants, the widened chamber of the scala tympani, and defects in the formation of the sacculus.
- Figure 13 is a whole-mount view showing the inner ear of wildtype (+/+) m Figure 13A, and COUP-TFI mutant (-/-) in Figure 13C.
- the cochlea from the wildtype has approximately 2.5 turns of cochlear duct (black line is drawn through the middle of the cochlear duct to better illustrate the number of turns) .
- the cochlea from the null mutant has less than 2 turns.
- Figures 13B and 13D are haematoxylm- and eosm-sta ed sagittal views through the mid-modiolar plane of wildtype (13B) and mutant (13D) cochlea, showing the basal coil (BC) median coil (MC) , and apical coil (AC) of the cochlear ducts. Most prominently, the chamber of the scala tympani (ScT) m the null mutant (right) is much wider than m the wildtype . Further experiments were performed to investigate additional functions of COUP-TFI related to the inner ear. Results from these experiments are shown in Figure 14. In Figure 14 wildtypes are shown along the top row, m Figures 14A-14D.
- Figures 14E-14H are whole-mount and sectional views of alizarin red- (mineralized bone) and alcian blue- (cartilage) stained inner ears showing defects in formation of the sacculus.
- Figure 14G clearly shows the absence of a pink- or black-stained sacculus membrane m mutants.
- Figures 14D (wildtype) and 14H (mutant) illustrate that the middle ear bones of mutants appear unaffected.
- Classical steroid hormone receptors have been extensively characterized in terms of their ligands. Numerous ligand agonists and antagonists have been identified to regulate physiological processes as diverse as inflammation to pregnancy to abortion to cancers.
- An important aspect of the present invention is a method to determine specific ligand agonist (s) and antagonists for the COUP-TFI. These are important tools for regulation—to activate or repress—COUP-TFI specific target genes.
- the ligands for other members of the superfamily comprising COUP-TFI include steroids, retinoids, thyroid hormones, vitamin D, oxysterols, prostaglandms or any lipid-soluble compounds.
- COUP-TFI is a typical member of the superfamily of ligand-activated nuclear transcription factors; it has a typical putative-ligand binding domain (LBD) .
- LBD putative-ligand binding domain
- This LBD is highly conserved within the superfamily and between different members as diverse as from human to Drosophila with the COUP-TF subfamily, from which one can infer the existence of a ligand for the COUP-TF subfamily.
- the LBD has a pocket structure capable of binding a synthetic molecule as a ligand and can be regulated.
- 14 -prostaglandm J2 is a ligand for the adipocyte determination factor PPAR gamma .
- Cell, 83, 803-812 (1995) ligands have been identified for the retmoid (RAR and RXR) , LXR and peroxisome-proliferator activated receptors (PPAR) which include retmoid and cholesterol metabolites, and prostaglandms which have diverse biological functions including teratogenic and anti-diabetic effects.
- a chimeric receptor is created m which the ligand-bmdmg domain of COUP-TFI is fused to the DNA-bmdmg domain of the yeast transcription factor GAL4.
- This technique is described in: Willy P. J. , Umesono K. , Ong E. S., Evans R. M., Heyman R. A., and Mangelsdorf D. J., LXR, a nuclear receptor that defines a distinct retinoid response pathway. Genes & Development, 9, 1033-1045 (1995) .
- the resultant GAL4-COUP-TFI expression plasmid is then cotransfected together with a GAL4 -responsive luciferase reporter plasmid into CV-1 cells and challenged with concentrates from several tissue sources.
- a significant (greater than twofold) induction of luciferase activity indicates the presence of a molecule m the extract capable of controlling the GAL4 -COUP-TFI chimeric protein.
- the lipid extract activity is then fractionated on reverse-phase high-pressure liquid chromatography (HPLC) and the major activating species identified by gas chromatography/mass spectrophotometry (GC/MS) .
- COUP-TFI as an affinity matrix to trap the ligand, based on its characteristic high-affmity and specificity of binding, the ligand is further purified and identified by HPLC and GC/MS methods as above. The functional activity of this COUP-TFI ligand is then analyzed m chimeric receptor-reporter cotransfection assays and other axon guidance- or bone differentiation-specific assays.
- vi tro analysis of conformational changes has several advantages over the classical in vivo cotransfection assay. It is an m vi tro assay that directly detects ligand-receptor binding. In vivo assays cannot distinguish between ligand-dependent and -independent activation processes The amount of potential ligand that is required for the m vi tro assay is low because of the small reaction volume (5 ⁇ l) m comparison to the volumes of culture media and amounts of ligands required for m vivo assays. In addition, if the ligand is a hydrophilic compound, it may not be able to cross the cell membrane and enter the cell without an active transport mechanism.
- the assayed ligand may be toxic to the growth of cells which preclude it from identification by a cell-based assay system.
- the role of COUP-TF ligands on target gene transcription is not determined by the above method—i.e., whether it represses or activate its target gene. Therefore, at least two assay systems are devised to identify COUP- TFI ligands.
- a particular therapy may also exploit the known expression regulators of COUP-TF, either as an alternative to, or in addition to, the ligand agonist/antagonist.
- COUP-TF all trans- and cis- retinoic acids have been shown to induce expression of COUP-TFI.
- RAR and RXR specific ligands are required for COUP-TFI gene expression.
- COUP-TFI is important for the formation of cortical layers COUP-TFI is highly expressed in the central nervous system (CNS) .
- CNS central nervous system
- the effect of mutations of COUP- TFI in mice on the formation of the CNS was determined.
- the cortex of P0 COUP-TFI null mice is less differentiated ( Figure 15).
- the cortex in the mutant is thinner than that in the wildtype mice, especially at the dorsal -lateral regions.
- the cortical subplate (sp) is hardly visible in the mutant.
- Gap43 an axon growth cone marker, was used to label 17.5 day embryos.
- Tst-l/0ct6/SCIP a POU domain transcription factor
- Tst-1 expression is necessary for the myelination of axon.
- si tu hybridization using Tst-1 probe was carried out.
- Tst-1 expression is missing in the cortex of mutant mice. This result clearly suggests that Tst-1 is a target gene of COUP-TFI and myelination defect of COUP-TFI mutant is due to the lack of Tst-1 expression. Since proper myelination of axons is important for axons to transmit neuronal signal, defect in the axon myelination will result in diseases such as multiple sclerosis.
- novel therapies can be directed at various points in the mechanism by which COUP-TF exerts its physiological effects.
- numerous ligands both agonists and antagonists
- COUP-TFI is a member.
- a ligand agonist binds to the COUP-TFI, which induces a conformational change in the COUP-TFI, which then allows the complex to bind to a particular region on the chromosome known as the response element. This event induces expression of an adjacent gene (or, in some instances, it may suppress its expression) .
- ligand agonists of COUP-TFI are important therapeutic agents, as are antagonists, which are useful to modulate the effect of agonists .
- the therapy may also be directed at regulating the expression of COUP-TF, either as an alternative to, or in addition to, the ligand agonist/antagonist .
- COUP-TFI all trans- and cis- retinoic acids have been shown to induce expression of COUP-TFI.
- transfection of the COUP-TFI gene into the mammal is also a therapeutic option, as is direct administration of COUP-TFI.
- the subject could be administered COUP-TFI directly.
- Each of these techniques could, of course, be combined, or used singly. Support for each of these techniques is provided above .
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Veterinary Medicine (AREA)
- Engineering & Computer Science (AREA)
- Animal Behavior & Ethology (AREA)
- Epidemiology (AREA)
- Pharmacology & Pharmacy (AREA)
- Immunology (AREA)
- Endocrinology (AREA)
- Cell Biology (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Neurology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU87602/98A AU8760298A (en) | 1997-08-01 | 1998-07-31 | Coup-tfi directed therapies in the treatment of disease |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US5508397P | 1997-08-01 | 1997-08-01 | |
US60/055,083 | 1997-08-01 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO1999006034A1 true WO1999006034A1 (fr) | 1999-02-11 |
Family
ID=21995472
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1998/015737 WO1999006034A1 (fr) | 1997-08-01 | 1998-07-31 | Therapies basees sur coup-tfi pour traiter des maladies |
Country Status (2)
Country | Link |
---|---|
AU (1) | AU8760298A (fr) |
WO (1) | WO1999006034A1 (fr) |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6838444B1 (en) | 1999-06-01 | 2005-01-04 | Baylor College Of Medicine | Compositions and methods for the therapeutic use of an atonal-associated sequence for deafness, osteoarthritis, and abnormal cell proliferation |
US7053200B1 (en) | 1999-06-01 | 2006-05-30 | Baylor College Of Medicine | Compositions and methods for the therapeutic use of an atonal-associated sequence for deafness, osteoarthritis, and abnormal cell proliferation |
EP2326333A1 (fr) * | 2008-08-13 | 2011-06-01 | Keio University | Agent favorisant la différentiation neuronale et procédé associé |
US9951351B2 (en) | 2014-10-09 | 2018-04-24 | Genvec, Inc. | Adenoviral vector encoding human atonal homolog-1 (HATH1) |
-
1998
- 1998-07-31 WO PCT/US1998/015737 patent/WO1999006034A1/fr active Application Filing
- 1998-07-31 AU AU87602/98A patent/AU8760298A/en not_active Abandoned
Non-Patent Citations (4)
Title |
---|
FENG J.Q., ET AL.: "THE MOUSE BONE MORPHOGENETIC PROTEIN-4 GENE.", JOURNAL OF BIOLOGICAL CHEMISTRY, AMERICAN SOCIETY FOR BIOCHEMISTRY AND MOLECULAR BIOLOGY, US, vol. 270., no. 47., 24 November 1995 (1995-11-24), US, pages 28364 - 28373., XP002914453, ISSN: 0021-9258, DOI: 10.1074/jbc.270.47.28364 * |
QIU Y., ET AL.: "DIFERENTIAL EXPRESSION OF COUP-TF I AND II IN DEVELOPING MOUSE CENTRAL NERVOUS SYSTEM.", JOURNAL OF CELLULAR BIOCHEMISTRY. SUPPLEMENT., JOHN WILEY & SONS, INC., US, vol. 270., no. 47., 21 January 1994 (1994-01-21), US, pages 335., XP002914452, ISSN: 0733-1959 * |
QIU Y., ET AL.: "SPATIOTEMPORAL EXPRESSION PATTERNS OF CHICKEN OVALBUMIN UPSTREAM PROMOTER-TRANSCRIPTION FACTORS IN THE DEVELOPING MOUSE CENTRAL NERVOUS SYSTEM: EVIDENCE FOR A ROLE IN SEGMENTAL PATTERNING OF THE DIENCEPHALON.", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, NATIONAL ACADEMY OF SCIENCES, US, vol. 91., 1 May 1994 (1994-05-01), US, pages 4451 - 4455., XP002914450, ISSN: 0027-8424, DOI: 10.1073/pnas.91.10.4451 * |
RITCHIE H. H., ET AL.: "GENOMIC CLONING OF COUP TRANSCRIPTION FACTOR - A MEMBER OF THE STEROID/THYROID HORMONE RECEPTOR SUPERFAMILY.", JOURNAL OF CELLULAR BIOCHEMISTRY. SUPPLEMENT., JOHN WILEY & SONS, INC., US, no. SUPPL. 14E., 31 March 1990 (1990-03-31), US, pages 112., XP002914451, ISSN: 0733-1959 * |
Cited By (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6838444B1 (en) | 1999-06-01 | 2005-01-04 | Baylor College Of Medicine | Compositions and methods for the therapeutic use of an atonal-associated sequence for deafness, osteoarthritis, and abnormal cell proliferation |
US7053200B1 (en) | 1999-06-01 | 2006-05-30 | Baylor College Of Medicine | Compositions and methods for the therapeutic use of an atonal-associated sequence for deafness, osteoarthritis, and abnormal cell proliferation |
US7442688B2 (en) | 1999-06-01 | 2008-10-28 | Baylor College Of Medicine | Composition and methods for the therapeutic use of an atonal-associated sequence for deafness, osteoarthritis and abnormal cell proliferation |
US7470673B2 (en) | 1999-06-01 | 2008-12-30 | Baylor College Of Medicine | Composition and methods for the therapeutic use of an atonal-associated sequence for deafness, osteoarthritis and abnormal cell proliferation |
EP2326333A1 (fr) * | 2008-08-13 | 2011-06-01 | Keio University | Agent favorisant la différentiation neuronale et procédé associé |
EP2326333A4 (fr) * | 2008-08-13 | 2013-01-23 | Univ Keio | Agent favorisant la différentiation neuronale et procédé associé |
US9951351B2 (en) | 2014-10-09 | 2018-04-24 | Genvec, Inc. | Adenoviral vector encoding human atonal homolog-1 (HATH1) |
Also Published As
Publication number | Publication date |
---|---|
AU8760298A (en) | 1999-02-22 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Jiang et al. | Transcription factor Emx2 controls stereociliary bundle orientation of sensory hair cells | |
Xuan et al. | Winged helix transcription factor BF-1 is essential for the development of the cerebral hemispheres | |
Qiu et al. | Null mutation of mCOUP-TFI results in defects in morphogenesis of the glossopharyngeal ganglion, axonal projection, and arborization | |
Wang et al. | Ataxia and paroxysmal dyskinesia in mice lacking axonally transported FGF14 | |
Wang et al. | Progressive Cerebellar, Auditory, and Esophageal Dysfunction Caused by Targeted Disruption of thefrizzled-4 Gene | |
Heizmann et al. | Calcium regulation by calcium-binding proteins in neurodegenerative disorders | |
Cole et al. | Microform holoprosencephaly in mice that lack the Ig superfamily member Cdon | |
JP2017006119A (ja) | 聴覚障害、変形性関節症および細胞の異常増殖に関するatonal関連配列の治療用途のための組成物および方法 | |
McNeill et al. | Nav2 is necessary for cranial nerve development and blood pressure regulation | |
AU2017245099A1 (en) | Anti-ryk antibodies and methods of using the same | |
Wu et al. | Thoracic patterning by the Drosophila gap gene hunchback | |
US6030794A (en) | Genetically engineered mice and cell lines containing alterations in the genes encoding retinoic acid receptor and retinoid X receptor proteins | |
KR100534556B1 (ko) | 알파1g 단백질의 기능을 억제하여 간질을 일으키지 않게하는 방법 | |
WO1999006034A1 (fr) | Therapies basees sur coup-tfi pour traiter des maladies | |
US6753456B2 (en) | Point mutant mice with hypersensitive alpha 4 nicotinic receptors: dopaminergic pathology and increased anxiety | |
US20090100532A1 (en) | Transgenic mice expressing hypersensitive nicotinic receptors | |
Balu et al. | Behavioral and physiological characterization of PKC-dependent phosphorylation in the Grin2a∆ PKC mouse | |
US6521814B1 (en) | Use of ligands for treatment of diseases responsive to retinoids | |
Hargrove | Endocytosis-Associated Guanine Nucleotide Exchange Factor Rabgef1 Facilitates the Biogenesis of Outer Segments in Mammalian Photoreceptors | |
US20030037354A1 (en) | Animal model with disrupted Fgf14 gene | |
Martinez | Small Rab GTPases regulate distinct cellular processes during development of cerebellar granule cells and Purkinje neurons | |
KR100514090B1 (ko) | Ncx2 단백질의 활성을 억제함으로써 학습능력 및기억력을 증진시키는 방법 | |
AU779476B2 (en) | Modulation of angiogenesis | |
US20070162989A1 (en) | Methods and compositions for treating motor neuron associated disorders | |
Parrish | An investigation in the roles of Spalt homologues during murine development |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AL AM AT AU AZ BB BG BR BY CA CH CN CZ DE DK EE ES FI GB GE HU IL IS JP KE KG KP KR KZ LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TR TT UA UG US UZ VN |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
NENP | Non-entry into the national phase |
Ref country code: KR |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: CA |