WO1998057545A1 - Compositions hypocholesterolemiques tirees de pousses de bambou - Google Patents

Compositions hypocholesterolemiques tirees de pousses de bambou Download PDF

Info

Publication number
WO1998057545A1
WO1998057545A1 PCT/US1998/012556 US9812556W WO9857545A1 WO 1998057545 A1 WO1998057545 A1 WO 1998057545A1 US 9812556 W US9812556 W US 9812556W WO 9857545 A1 WO9857545 A1 WO 9857545A1
Authority
WO
WIPO (PCT)
Prior art keywords
cholesterol
extract
composition
bamboo shoot
phytosterols
Prior art date
Application number
PCT/US1998/012556
Other languages
English (en)
Inventor
Paul A. Lachance
Yi H. He
Original Assignee
Rutgers, The State University Of New Jersey
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Rutgers, The State University Of New Jersey filed Critical Rutgers, The State University Of New Jersey
Priority to AU82578/98A priority Critical patent/AU8257898A/en
Publication of WO1998057545A1 publication Critical patent/WO1998057545A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/88—Liliopsida (monocotyledons)
    • A61K36/899—Poaceae or Gramineae (Grass family), e.g. bamboo, corn or sugar cane
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/56—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • A61K31/575—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of three or more carbon atoms, e.g. cholane, cholestane, ergosterol, sitosterol

Definitions

  • the present invention is a composition for lowering cholesterol levels in a
  • the present invention is a phytosterol-containing extract
  • compositions are also provided.
  • LDL low density lipoprotein
  • lipoproteins are lipoproteins, blood platelets, arterial endothelium, arterial smooth muscle cells, and
  • LDL particles are particularly atherogenic because either or both
  • foam cells develop a diminished motility.
  • HDL High density lipoprotein
  • Mammalian cells have a variety of mechanisms for regulating the metabolism of
  • cholesterol can be obtained from cellular metabolism via
  • liver which is the dominate location for synthesizing cholesterol from acetyl-CoA
  • Cholesterol homeostasis is regulated and maintained by three interrelated feed back
  • HMG-CoA reductase 3-hydroxy-3-methylglutaryl-CoA reductase and other enzymes in the
  • Drug therapies are based on the fundamental mechanism of cholesterol metabolism
  • cholestyramine and colestipol are two common drugs (bile
  • peripheral tissues is another mechanism for treating hypercholesteremia.
  • hypercholesteremia For example,
  • lovastatin, pravastatin and simvastatin are drugs that inhibit HMG-CoA reductase synthesis
  • the body can become resistant to the drugs over time and may require
  • phytochemical is a family of plant or vegetable sterols known as
  • phytosterols which are generally classified into three groups: 4-desmethylsterols, 4-
  • cholesterol levels in a mammal that includes a phytosterol-containing extract isolated from
  • compositions and dietary supplements that include phytosterol-containing extracts isolated
  • Another object of the present invention to provide methods of making and using such
  • compositions for lowering cholesterol levels in a mammal are provided.
  • the present invention is
  • the present invention is a composition for reducing cholesterol levels in a
  • composition includes a phytosterol-containing extract isolated from
  • a further embodiment of the invention is a pharmaceutically useful composition
  • This method includes administering to a mammal a composition that
  • the present invention also includes a method of making a composition for lowering
  • This method includes obtaining an extract of phytosterols
  • This composition includes an extract containing one or more phytosterols isolated from
  • Another embodiment of the present invention is a method for reducing cholesterol
  • This method includes in combination inhibiting cholesterol
  • cholesterol levels in a mammal by reducing or inhibiting cholesterol synthesis
  • This method is achieved by administering to the mammal
  • FIG. 1 is an outline of the cholesterol biosynthesis pathway.
  • FIG. 2 is an outline of the pathway by which cholesterol is converted into the
  • FIG. 3 is a table showing the formulation of two embodiments of the present
  • FIG. 4 is a table showing the cholesterol-lowering effects of two embodiments of
  • the present invention vs. control formulations in a hypercholesterolemic model in rat.
  • FIG. 5 is a table showing the effects on rat liver weights and liver lipid profile of
  • FIG. 6 is graph of total cholesterol levels measured in rats comparing the
  • FIG. 7 is a table showing TDF, SDF, IDF and certain phytosterols contained in the
  • FIG. 8 is a table showing the effects of the formulations of FIG. 3 on fecal bile acid
  • FIG. 9 is a table showing the effects of the formulations of FIG. 3 on output of
  • FIG. 10 is a table showing the effects of the formulations of FIG. 3 on output of
  • FIG 11 is a table showing the effects of the formulations of FIG. 3 on output of
  • FIG. 12 is a table showing the effects of the formulations of FIG. 3 on certain fecal
  • FIG. 13 is a process flow chart for the extraction and fractionation of compositions
  • FIG. 14 is a preparative reverse phase HPLC chromatogram of a crude bamboo
  • FIG. 15 is a preparative normal phase HPLC chromatogram of a methanol insoluble
  • FIG. 16 is a graph showing a dose response curve of the crude bamboo shoot
  • FIG. 17 is a graph showing a time course study on the effect of the crude bamboo
  • FIG. 18 is a graph showing the effect of various fractions of FIG. 12 on Hep G2
  • FIG. 19 is an HPLC chromatogram of the methanol soluble fraction of FIG. 12.
  • FIG. 20 is a gas chromatogram of the total crude extract of FIG. 12.
  • FIG. 21 is a gas chromatogram of the total methanol insoluble fraction of the total
  • FIG. 22 is a table listing the phytosterols identified in the chromatogram of FIG 21.
  • FIG. 23 is a table listing major peak mass spectra of the phytosterols identified in
  • FIG. 24 is an electron ionization mass spectrum of the FI fraction of the total
  • FIG. 25 is the electron ionization mass spectrum of the F5 fraction of the total
  • FIG. 26 is a graph showing the effect of various fractions of the extract of FIG. 12
  • the present invention includes a composition for reducing cholesterol levels in a
  • composition includes a phytosterol-containing extract isolated from
  • phytosterol includes the entire group of free phytosterols, phytosterol fatty acid esters and (acylated) phytosterol glucosides.
  • reducing cholesterol levels means that the present compositions
  • total liver lipids cholesterol and total liver lipids.
  • total liver lipids total liver lipids
  • liver cholesterol includes liver cholesterol, as well as liver triglycerides.
  • compositions are derived from a crude extract of bamboo shoots.
  • the crude extract is derived from a crude extract of bamboo shoots. The crude extract
  • phytosterols have been identified in various fractions of the crude extract using
  • GC-MS spectrometry
  • LC-MS liquid chromatography-mass spectrometry
  • each fraction of the crude extract contains one or more
  • Useful extracts of the present compositions contain a mixture of phytosterols
  • sitosterol sitastanol, stigmasterol and derivatives and
  • the extracts of the present invention can also include, for example, beta- sitosterol, stigmasta-3,5-dien-7 one, stigmast-4-en-3-one, stigmasta-5,22-dien-3-ol,
  • campesterol and derivatives and isomers thereof.
  • campesterol and derivatives and isomers thereof.
  • esterified glycosidic, saturated or
  • the clump forming types of bamboo produce underground stems called
  • the clump-forming bamboos generally
  • bamboo shoots are underground sprouts of bamboo. Bamboo shoots are divided
  • compositions include phytosterols derived from bamboo shoot
  • compositions which lower cholesterol are provided.
  • pharmaceutical compositions which lower cholesterol are provided.
  • levels in mammals can be formed from phytosterols extracted from bamboo shoot.
  • Such a carrier includes but is not
  • compositions of the present invention can also be selected from the group consisting of the following compounds:
  • compositions can take various forms including, for example, solutions, suspensions,
  • compositions can be formulated as a suppository with traditional binders and carriers, such
  • Oral formulations are also contemplated and can include standard carriers,
  • compositions can be formulated for intravenous administration to mammals.
  • compositions for intravenous administration are solutions in sterile isotonic
  • compositions may also include
  • solubilizing agent and a local anesthetic, such as lidocaine to ease pain at the site of the
  • ingredients are supplied either separately or mixed together in
  • unit dosage form for example, as a dry lyophilized powder or water free concentrate in a
  • hermetically sealed container such as an ampule or sachette indicating the quantity of
  • composition is to be administered by infusion, it can be dispensed
  • composition is administered by injection, an ampule of sterile water or saline for injection
  • compositions of the present invention can be formulated as neutral or salt
  • compositions include those formed with free amino groups,
  • hypercholesteremia will depend on
  • disorder or “condition” can include, for example hypercholesteremia, cancer, in particular colon cancer, benign prostatic hyperplasia,
  • Atherosclerosis caused by platelet aggregation and/or smooth muscle cell proliferation
  • Suitable dosage ranges for intranasal administration are generally about 0.01 pg/kg body
  • Suppositories generally contain active ingredient in the range of 0.5% to 10% by
  • oral formulations preferably contain 10% to 95% active ingredient.
  • compositions can also be incorporated into dietary supplements.
  • the dietary supplements of the present invention vary depending upon a number of factors, including the sex and weight of the patient, as well as the severity of the disease.
  • the dietary supplements of the present invention vary depending upon a number of factors, including the sex and weight of the patient, as well as the severity of the disease.
  • liver cholesterol and liver triglycerides for example, liver cholesterol and liver triglycerides.
  • the dietary supplement includes a crude extract that
  • sitosterol include, for example, sitosterol, sitastanol, stigmasterol and derivatives and isomers
  • the present extracts can also include, for example, a mixture of phytosterols
  • beta-sitosterol including beta-sitosterol, stigmasta-3,5-dien-7 one, stigmast-4-en-3-one, stigmasta-5,22-
  • derivatives is intended to include chemically modified phytosterols
  • Such derivatives include for
  • the present invention also includes a method for lowering cholesterol levels in a
  • mamal includes humans, as well as other species.
  • Another embodiment of the present invention includes a method of making the compositions for lowering cholesterol levels in mammals as set forth above. This-method
  • the delivery vehicle can be any material that can be used to deliver cholesterol-lowering amounts of the extract to a mammal.
  • the delivery vehicle can be any
  • hypercholesteremic rats significantly increase fecal cholesterol, coprostanol,
  • bamboo shoot phytosterols appear to be absorbed while the rest were recovered in the
  • compositions also decrease cholesterol absorption while decreasing hepatic cholesterol
  • compositions significantly decrease the ratio of secondary bile acids to total bile
  • compositions also play a key role in the health of the colon.
  • Another embodiment of the present invention includes a method of
  • This method includes administering to a mammal an effective
  • composition having as its primary active agent one or more phytosterols having as its primary active agent one or more phytosterols
  • compositions of the present invention can be in any form
  • compositions can be conveniently administered to a mammal.
  • the compositions can be any convenient administered to a mammal.
  • the compositions can be any convenient administered to a mammal.
  • the compositions can be any convenient administered to a mammal.
  • the compositions can be any convenient administered to a mammal.
  • the compositions can be any convenient administered to a mammal.
  • the compositions can be any convenient administered to a mammal.
  • the compositions can be any convenient administered to a mammal.
  • compositions administered according to this method decrease serum total and
  • LDL cholesterol as well as total liver lipids, including for example, liver cholesterol and
  • liver triglycerides liver triglycerides.
  • this composition includes an
  • bamboo shoot To further elucidate the biochemistry of the present compositions, bamboo shoot
  • Hep G2 human hepatoma cells
  • HMG-CoA reductase was significantly decreased.
  • reductase is the rate limiting enzyme in the cholesterol biosynthetic pathway which
  • extract may function synergistically or act at multiple sites in the cholesterol biosynthetic
  • the phytosterols in the crude extract are structurally diverse. For example,
  • beta-sitosterol and campesterol are common sterols in plant leaves. Stigmasta-3, 5-dien-7-
  • one and stigmast-4-en-3-one are sterol derivative products which are post mevalonate
  • a further embodiment of the present invention includes a method for reducing
  • This method includes in combination, inhibiting
  • this composition includes an extract of one or more phytosterols isolated from
  • compositions for example by inhibiting HMG-CoA reductase mRNA activity.
  • This method includes administering to a mammal a cholesterol lowering
  • the bamboo shoots are ground
  • bamboo shoots are administered to a mammal in any convenient form, such as for
  • liver lipids under hypercholesterolemic diet conditions liver lipids under hypercholesterolemic diet conditions.
  • the rats were assigned to four dietary treatment groups (7 rats per dietary treatment group).
  • the four treatment groups consisted of (1) a wheat
  • bran diet (containing 15%) wheat bran); (2) an oat bran diet (containing 15% oat bran); (3)
  • bamboo shoot diet I containing 15% by weight bamboo shoots
  • bamboo shoots containing 15% by weight bamboo shoots
  • diet II (containing 30% bamboo shoots by weight).
  • diets (1) and (2) For this experiment diets (1) and (2)
  • the experimental design is also based on a proximate analysis of the
  • Bile salt and cholesterol are necessary to enhance hypercholesterolemia in the
  • cholesterol was fed to the
  • liver samples were then divided into several one gram
  • tissues such as kidney, heart,
  • spleen, adipose pad were also excised, rinsed, blotted, weighed and recorded.
  • HDL high density lipoprotein
  • triglycerides were determined by enzymatic colorimetric methods for cholesterol, HDL and
  • LDL low density lipoprotein
  • FIG. 5 heart, kidney, adipose pad, lung and spleen. As documented in FIG. 5, only
  • bamboo shoot diet II (30% bamboo shoot) significantly lowered liver weight.
  • Serum lipid profiles as a result of the four experimental diets are shown in FIG. 5.
  • the high dosage bamboo shoot diet (30% bamboo
  • liver weights were not attributable to lower feed intake or feed efficiency. The mean liver
  • the total liver lipid does not change with high dosage bamboo shoot diet II, the cholesterol
  • bran and oat bran diets elevated serum cholesterol levels were observed, but bamboo shoot diets I and II inhibited this elevation.
  • Rat feces were collected for 7 consecutive days of the last week of the experiment
  • sterols 2 ml of n-decane was added to the sample, centrifuged and a 1.0 ml aliquot was
  • sitosterol, and campesterol, stigmasterol and acidic steroids (deoxycholic acid,
  • lithocholic acid chenodeoxycholic acid, cholic acid
  • the average daily output of feces (dry weight) at the fourth week was 1.42 ⁇ 0.21
  • the bamboo shoot diet II had a
  • FIGS. 8-12 indicate that phytosterols rather than insoluble dietary fiber in bamboo shoot
  • fecal cholesterol increased from 26.0 mg/day to 30.0
  • the high dosage bamboo shoot diet Compared to oat bran diet, the high dosage bamboo shoot diet.
  • bamboo shoot diet II had a higher daily output of the bacterial metabolite coprostanone.
  • bamboo shoot has a different cholesterol absorption pattern compared to wheat bran
  • FIG. 9 shows the phytosterol profile of three major plant sterols in feces. Rats in
  • campesterol were major components in the feces of the four diet groups.
  • phytosterol level in bamboo shoot diet II is twice that of bamboo shoot diet II. This
  • the wheat bran diet had the lowest fecal neutral steroid concentration
  • insoluble dietary fiber which in return, dilutes the intestinal contents.
  • Rats fed the oat diets were compared to rats fed the control diets. This effect was dose dependent. Rats fed the oat
  • bran diet had the lowest cholic acid output (2.67 mg/d), but had the highest
  • bamboo shoot at a low dose (15%) may-be at a
  • FIG. 12 shows the ratio of secondary bile acids (SB A) to total bile acid (TBA);
  • bamboo shoot affects both cholesterol absorption and hepatic cholesterol synthesis.
  • bamboo shoot appears to play a minor role in lower cholesterol in the present model.
  • bamboo shoot diets I and II significantly decreased the ratio of secondary
  • Hep G2 human hepatoma cell line
  • bamboo shoots were extracted and fractionated.
  • tissue culture reagents including, RPMI 1640, fetal calf serum and
  • antibiotics - antimycotic were purchased from Gibco BRL (Gaithersburg, MD).
  • Hep-G2 cells were cultured in RPMI 1640 containing 10% fetal bovine serum, 292
  • the cells were seeded at a density of 20-30 x 10 3 /cm 2 and were allowed to attach
  • the control group received the
  • the petroleum ether extract was condensed by evaporation and dried
  • TMS total methanol soluble fraction
  • TMIS methylene chloride soluble fraction
  • TMS was further fractionated into FI, F2, F3, F4 and F5 fractions and dried under
  • the equipment used for fractionating the bamboo shoots is set forth below:
  • Corona discharge 3.0 KV Source temperature: 150 °C Probe temperature: 450 °C Analyzer Pressure: 4.3 x 10 "5 torr Mode: AP +
  • Varian 3400 GC Parameters Column: DB-1, 30 m x 320 (i.d.) capillary column
  • Hep G2 cell media was removed and the cells were washed with 2 ml of ice-cold
  • alpha- cholestane was added to the cell suspension before extraction.
  • Carrier Gas Helium (20 ml/min) Temp. Program: 100°C for 3 min, 300°C @ 10°C/min, holding at 300 °C for 20 minutes Injection Temperature: 265 °C
  • the PT-PCR method used in the present invention is based on the method of Tian
  • PCR oligonucleotide primers used are set forth below:
  • HMG Co A reductase-2 (AGAACACAGCACGGAAAGAAC) These sequences correspond to the gene-specific primer pairs for human HMG-
  • RNAse H reverse transcriptase
  • PCR products were separated on 1.5% agarose gels and visualized by
  • FIG. 13 Fractions within a cut were combined to yield semi-crude fractions and were
  • FIG. 19 shows the HPLC chromatogram of the methanol soluble fraction of
  • bamboo shoot Many compounds of intermediate polarity are evident.
  • FIGS. 20 and 21 are the GC chromatograms of total crude bamboo shoot extract
  • phytosterols include sitosterol and stigmasterol, their
  • phytosterols major fatty acids, such as for example, linoleic and palmitic acid are present.
  • insoluble bamboo shoot fraction (FIG. 20) indicate that there are significant differences in
  • FI is a phytosterol with M + at 414(100%)), the major peaks are at 55 (56%), 81
  • FIG. 25 is a phytosterol with M + is at 414 (30%), the major peaks are at 396 (20%), 385
  • the methylene chloride fraction may be affecting other enzymes in the cholesterol
  • mass spectra data indicate that the identified compounds are a
  • active compounds are likely a series of ester forms of phytosterols. Only the crude bamboo
  • the polar (water fraction) fraction had no effect on Hep G2 cell cholesterol activity.
  • phytosterols exist in the hydrophobic form.
  • methanol soluble fraction part of the
  • sterols likely exist as an ester form (MSF1) and part of the sterols (methanol soluble
  • fraction F5 exist as a straight hydrophobic form.
  • reductase transcription level was observed for the individual fractions tested.
  • hypocholesterolemic agent compared with fractions thereof.

Landscapes

  • Health & Medical Sciences (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Public Health (AREA)
  • Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Alternative & Traditional Medicine (AREA)
  • Biotechnology (AREA)
  • Botany (AREA)
  • Medical Informatics (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Medicines Containing Plant Substances (AREA)

Abstract

Cette invention se rapporte à une composition permettant de réduire les niveaux de cholestérol chez un mammifère. Cette composition contient un extrait à teneur en phytostérol, isolé de pousses de bambou. Des compléments pharmaceutiques et alimentaires dans lesquels sont incorporées ces compositions, ainsi que des procédés de fabrication et d'utilisation de ces compositions sont également décrits.
PCT/US1998/012556 1997-06-17 1998-06-16 Compositions hypocholesterolemiques tirees de pousses de bambou WO1998057545A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU82578/98A AU8257898A (en) 1997-06-17 1998-06-16 Hypocholesterolemic compositions from bamboo shoots

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US4986197P 1997-06-17 1997-06-17
US60/049,861 1997-06-17
US5181897P 1997-07-07 1997-07-07
US60/051,818 1997-07-07

Publications (1)

Publication Number Publication Date
WO1998057545A1 true WO1998057545A1 (fr) 1998-12-23

Family

ID=26727630

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1998/012556 WO1998057545A1 (fr) 1997-06-17 1998-06-16 Compositions hypocholesterolemiques tirees de pousses de bambou

Country Status (2)

Country Link
AU (1) AU8257898A (fr)
WO (1) WO1998057545A1 (fr)

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0916342A1 (fr) * 1997-11-06 1999-05-19 The Institute Of Physical & Chemical Research Un médicament pour traiter l'obésité et améliorer le métabolisme lipidique
WO2002043506A2 (fr) * 2000-12-01 2002-06-06 N.V. Nutricia Complement servant faire diminuer le taux de cholesterol
EP1274319A2 (fr) * 2000-04-14 2003-01-15 Mars, Incorporated Compositions et methodes permettant d'ameliorer la sante vasculaire
US6531462B2 (en) 1997-11-06 2003-03-11 Riken Medicament for treating obesity and improving lipid metabolism
WO2003079998A2 (fr) 2002-03-21 2003-10-02 Mars, Incorporated Traitement de maladies impliquant la communication defectueuse de la jonction lacunaire
US6677327B1 (en) 1999-11-24 2004-01-13 Archer-Daniels-Midland Company Phytosterol and phytostanol compositions
CN102492632A (zh) * 2011-12-27 2012-06-13 重庆工商大学 一种黑曲霉及其发酵竹笋或竹笋残渣提高植物甾醇含量的方法
WO2015109299A3 (fr) * 2014-01-20 2015-10-22 Hangzhou Bamdion Biotech Co. Ltd. Extraits de bambou, compositions et utilisations de ceux-ci
RU2756946C2 (ru) * 2001-01-26 2021-10-07 Мерк Шарп И Доум Корп. Применение замещенных азетидинонов для лечения ситостеролемии
CN113397085B (zh) * 2021-06-30 2023-04-25 中国大熊猫保护研究中心 一种长途运输大熊猫食用竹笋的方法

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5466453A (en) * 1992-04-02 1995-11-14 Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo Method for improving the taste of pine extract, and orally administrable product obtained thereby
US5494667A (en) * 1992-06-04 1996-02-27 Kabushiki Kaisha Hayahibara Topically applied hair restorer containing pine extract

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5466453A (en) * 1992-04-02 1995-11-14 Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo Method for improving the taste of pine extract, and orally administrable product obtained thereby
US5494667A (en) * 1992-06-04 1996-02-27 Kabushiki Kaisha Hayahibara Topically applied hair restorer containing pine extract

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6046184A (en) * 1997-11-06 2000-04-04 The Institute Of Physical And Chemical Research, And Kunio Suzuki Medicament for treating obesity and improving lipid metabolism
EP0916342A1 (fr) * 1997-11-06 1999-05-19 The Institute Of Physical & Chemical Research Un médicament pour traiter l'obésité et améliorer le métabolisme lipidique
US6531462B2 (en) 1997-11-06 2003-03-11 Riken Medicament for treating obesity and improving lipid metabolism
US6677327B1 (en) 1999-11-24 2004-01-13 Archer-Daniels-Midland Company Phytosterol and phytostanol compositions
EP1274319B1 (fr) * 2000-04-14 2009-08-12 Mars, Incorporated Compositions et methodes permettant d'ameliorer la sante vasculaire
EP1274319A2 (fr) * 2000-04-14 2003-01-15 Mars, Incorporated Compositions et methodes permettant d'ameliorer la sante vasculaire
WO2002043506A3 (fr) * 2000-12-01 2002-10-03 Nutricia Nv Complement servant faire diminuer le taux de cholesterol
US6933291B2 (en) 2000-12-01 2005-08-23 N.V. Nutricia Cholesterol lowering supplement
WO2002043506A2 (fr) * 2000-12-01 2002-06-06 N.V. Nutricia Complement servant faire diminuer le taux de cholesterol
RU2756946C2 (ru) * 2001-01-26 2021-10-07 Мерк Шарп И Доум Корп. Применение замещенных азетидинонов для лечения ситостеролемии
WO2003079998A2 (fr) 2002-03-21 2003-10-02 Mars, Incorporated Traitement de maladies impliquant la communication defectueuse de la jonction lacunaire
CN102492632A (zh) * 2011-12-27 2012-06-13 重庆工商大学 一种黑曲霉及其发酵竹笋或竹笋残渣提高植物甾醇含量的方法
WO2015109299A3 (fr) * 2014-01-20 2015-10-22 Hangzhou Bamdion Biotech Co. Ltd. Extraits de bambou, compositions et utilisations de ceux-ci
CN113397085B (zh) * 2021-06-30 2023-04-25 中国大熊猫保护研究中心 一种长途运输大熊猫食用竹笋的方法

Also Published As

Publication number Publication date
AU8257898A (en) 1999-01-04

Similar Documents

Publication Publication Date Title
Ghule et al. Hypolipidemic and antihyperlipidemic effects of Lagenaria siceraria (Mol.) fruit extracts
Zhang et al. Hawthorn fruit is hypolipidemic in rabbits fed a high cholesterol diet
RU2241453C2 (ru) Гидроксиматаирезинол в профилактике рака
Berger et al. Cholesterol-lowering properties of Ganoderma lucidum in vitro, ex vivo, and in hamsters and minipigs
Zhang et al. Hypocholesterolemic activity of hawthorn fruit is mediated by regulation of cholesterol-7α-hydroxylase and acyl CoA: cholesterol acyltransferase
Moreau et al. Phytosterols, phytostanols, and their conjugates in foods: structural diversity, quantitative analysis, and health-promoting uses
Visavadiya et al. Hypocholesteremic and antioxidant effects of Withania somnifera (Dunal) in hypercholesteremic rats
JP3340135B2 (ja) ３―ヒドロキシ―３―メチルグルタリルＣｏＡ（ＨＭＧ―ＣｏＡ）レダクターゼ阻害剤としての柑橘類果皮抽出物
Hodis et al. Cholesterol feeding increases plasma and aortic tissue cholesterol oxide levels in parallel: further evidence for the role of cholesterol oxidation in atherosclerosis
Vaidya et al. Swertiamarin: a lead from Enicostemma littorale Blume. for anti-hyperlipidaemic effect
Farkas et al. Studies on the compartmentation of lipid in adipose cells. II. Cholesterol accumulation and distribution in adipose tissue components
Man et al. Cholestin inhibits cholesterol synthesis and secretion in hepatic cells (HepG2)
Patil et al. Hypolipidemic effect of Terminalia arjuna (L.) in experimentally induced hypercholesteremic rats
WO1998057545A1 (fr) Compositions hypocholesterolemiques tirees de pousses de bambou
Yang et al. Acute administration of red yeast rice (Monascus purpureus) depletes tissue coenzyme Q10 levels in ICR mice
Patel et al. Assessment of lipid lowering effect of Sida rhomboidea. Roxb methanolic extract in experimentally induced hyperlipidemia
Lütjohann et al. Phytosterolaemia in a Norwegian family: diagnosis and characterization of the first Scandinavian case
Duane Serum lathosterol levels in human subjects reflect changes in whole body cholesterol synthesis induced by lovastatin but not dietary cholesterol.
Ruíz-Gutiérrez et al. Oleuropein on lipid and fatty acid composition of rat heart
Batta et al. Hydrophilic 7β-hydroxy bile acids, lovastatin, and cholestyramine are ineffective in the treatment of cerebrotendinous xanthomatosis
Castellaneta et al. A targeted GC-MS/MS approach for the determination of eight sterols in microgreen and mature plant material
Sindhu et al. Phytosterols: Physiological functions and therapeutic applications
Yalcinkaya et al. Sterols in Inflammatory Diseases: Implications and Clinical Utility
Moghadasian et al. Anti-atherogenic effects of phytosteryl oleates in apo-E deficient mice
Ntanios et al. Effect of 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitor on sterol absorption in hypercholesterolemic subjects

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM GW HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

WWE Wipo information: entry into national phase

Ref document number: 09242524

Country of ref document: US

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

NENP Non-entry into the national phase

Ref country code: CA

NENP Non-entry into the national phase

Ref country code: JP

Ref document number: 1999504708

Format of ref document f/p: F

122 Ep: pct application non-entry in european phase