WO1998054330A1 - Procedes de modification in situ de phytogenes - Google Patents

Procedes de modification in situ de phytogenes Download PDF

Info

Publication number
WO1998054330A1
WO1998054330A1 PCT/GB1998/001499 GB9801499W WO9854330A1 WO 1998054330 A1 WO1998054330 A1 WO 1998054330A1 GB 9801499 W GB9801499 W GB 9801499W WO 9854330 A1 WO9854330 A1 WO 9854330A1
Authority
WO
WIPO (PCT)
Prior art keywords
ala
gly
leu
gene
thr
Prior art date
Application number
PCT/GB1998/001499
Other languages
English (en)
Inventor
Timothy Robert Hawkes
Andrew James Greenland
Ian Jeffrey Evans
Original Assignee
Zeneca Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zeneca Limited filed Critical Zeneca Limited
Priority to EP98922954A priority Critical patent/EP1017825A1/fr
Priority to AU75414/98A priority patent/AU7541498A/en
Priority to JP50036099A priority patent/JP2002503101A/ja
Publication of WO1998054330A1 publication Critical patent/WO1998054330A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
    • C12N9/1092—3-Phosphoshikimate 1-carboxyvinyltransferase (2.5.1.19), i.e. 5-enolpyruvylshikimate-3-phosphate synthase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8213—Targeted insertion of genes into the plant genome by homologous recombination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8274—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8274—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
    • C12N15/8275—Glyphosate
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8274—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
    • C12N15/8278—Sulfonylurea
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination

Definitions

  • the present invention relates to the production of plants which exhibit certain desirable agronomic traits and which are produced by a non-biological process not obligatorily involving transformation or transgenesis (although these techniques can be used).
  • a method of producing plants which exhibit an agronomically desirable trait comprising mutating or otherwise modifying in situ in a plant cell at least one gene which when modified is responsible for providing the said trait and regenerating from a cell exhibiting the said trait fertile morphologically normal whole plants, characterised in that a polynucleotide is introduced into the plant cell, the said polynucleotide comprising at least one region which is substantially complementary to at least one region in the gene, which gene region when mutated or otherwise modified provides for the agronomically desirable trait, the region in the said polynucleotide containing at least one base mismatch in comparison with the like region in the said gene, so that the region in the said gene is altered by the DNA repair/replication system of the cell to include the said mismatch.
  • gene is meant a polynucleotide comprising - contiguously - a sequence to which an RNA polymerase is capable of binding (promoter), an RNA encoding sequence and a transcription termination sequence. At least one of the following regions of the gene may be mutated or otherwise modified: promoter, RNA encoding sequence or transcription terminator. In a preferred embodiment of the method a transcription enhancing region associated with the gene is mutated or otherwise modified in situ.
  • the said trait could be an improved resistance to insects and/or fungal or bacterial infections, it is particularly preferred that the trait is herbicide resistance.
  • the herbicides to which plants resulting from the method according to the invention are rendered resistant, or to which the said plants are tolerant or exhibit relatively improved resistance are selected from the group consisting of paraquat; glyphosate; glufosinate; photosystem II inhibiting herbicides; dinitroanalines or other tubuli ⁇ binding herbicides; herbicides which inhibit imidazole glycerol phosphate dehydratase: herbicides which inhibit acetolactate synthase; herbicides which inhibit acetyl CoA carboxylase; herbicides which inhibit protoporphyrinogen oxidase; herbicides which inhibit phytoene desaturase; herbicides which inhibit hydroxyphenylpyruvate dioxygenase and herbicides which inhibit the biosynthesis of cellulose.
  • Plants which are substantially "tolerant” to a herbicide when they are subjected to it provide a dose/response curve which is shifted to the right when compared with that provided by similarly subjected non tolerant like plants.
  • Such dose/response curves have "dose” plotted on the x-axis and “percentage kill", "herbicidal effect” etc. plotted on the y-axis.
  • Tolerant plants will require more herbicide than non tolerant like plants in order to produce a given herbicidal effect.
  • Plants which are substantially "resistant” to the herbicide exhibit few, if any, necrotic, lytic.
  • the plant material in which the in situ modification is performed may have been prior transformed with a gene providing for resistance to insects, fungi, and/or herbicides, or with a gene capable of providing plants regenerated from such material with, for example, an increased capacity to withstand adverse environmental conditions (improved drought and/or salt tolerance, for example) in comparison with plants regenerated from non-transformed like material.
  • At least one region of the polynucleotide may consist of RNA.
  • the polynucleotide other than that comprised by the said at least one region may consist of DNA.
  • the polynucleotide may consist of between about 30 and 250 nucleotides. In a more preferred embodiment of the polynucleotide it consists of between 50 and 200 nucleotides.
  • the protein encoding region of the gene may encode an enzyme selected from the group consisting of EPSPS, GOX, PAT, HPPD, ACC, A S, BNX and protox and known mutated or variant forms thereof.
  • the said gene may encode an EPSPS enzyme as depicted, for example, in SEQ ID Nos. 1 or 10. It is preferred that the EPSPS enzyme has least the residues Thr, Pro, Gly and Ala at positions corresponding to 174, 178, 173 and 264 with respect to the EPSPS depicted in SEQ ID No. 2, and that the said mismatch results in at least one of the following modifications in the EPSPS enzyme in comparison with the native sequence: - J
  • the mismatch may result in replacement of the terminal Gly residue within the sequence motif Glu-Arg-Pro-AA 1 -AA2-AA3-Leu-Val-
  • the plant cell to which the method of the invention is applied may be a cell of a plant selected from the group consisting of canola, sunflower, tobacco, sugar beet, cotton, maize. wheat, barley, rice, sorghum, tomato, mango, peach, apple, pear, strawberry, banana, melon, potato, carrot, lettuce, cabbage, onion, soya spp, sugar cane, pea, field beans, poplar, grape, citrus, alfalfa, rye, oats, turf and forage grasses, flax and oilseed rape, and nut producing plants insofar as they are not already specifically mentioned
  • the plant cell may be converted into a protoplast prior to the in situ mutation or modification of the gene - or transcriptional enhancing regions associated therewith - which when modified provides for the agronomically desirable trait.
  • the invention further includes plants which result from the method disclosed herein. as well as the progeny and seeds of such plants, and plant material derived from such plants, progeny and seeds.
  • the invention still further includes a method of selectively controlling weeds in a field, the field comprising plants as disclosed in the preceding paragraph and weeds, the method comprising application to the field of a herbicide to which the said plants have been rendered resistant. Insecticidally effective amounts of insecticides and/or fungicidally effective amounts of fungicides may optionally be applied to the said plants, preferably after the herbicide has been applied to the field.
  • SEQ ID No. 1 shows the cDNA from Petunia encoding an EPSPS enzyme.
  • Nucleotides 28 to 243 encode the transit peptide responsible for targeting the EPSPS enzyme encoded by nucleotides 244 to 1578 to the chloroplast.
  • SEQ ID No. 2 shows the translational product of the sequence depicted in SEQ ID No. 1. Protein having the sequence of amino acid residues 1 to 72 constitutes the chloroplast transit peptide: protein having the sequence of amino acids 73 to 516 constitutes the EPSPS enzyme.
  • SEQ ID Nos 3 and 4 depict peptides encoded by sequences (SEQ ID Nos 5 and 7) within exons 2 and 4 respectively of the Brassica napus EPSPS gene.
  • Sequence ID Nos. 6 and 8 are mixed ribo- deoxyribonucleic acid sequences which are capable of forming duplexes with the sequences depicted in SEQ ID Nos. 5 and 7 respectively.
  • SEQ ID Nos. 28 and 29 are sequences which are comprised by the sequences depicted in SEQ ID Nos. 5 and 7 respectively.
  • SEQ ID Nos 1 1 - 27 depict mixed oligonucleotides (ie containing both ribo and deoxyribonucleotides) comprising sequences (marked with asterixes in the reiteration of the sequences in the corresponding Examples) capable of causing mutations in the gene to which the oligonucleotide is targeted.
  • the oligonucleotides depicted in SEQ ID Nos 11 to 27 are all designed to cause plant material into which they are incorporated to become resistant to herbicides, such as glyphosate and chlorsulfuron, by causing the gene encoding the proteinaceous target for the herbicide to become mutated so that the target is no longer sensitive to the herbicide. Should there by a discrepancy between the sequences depicted in the sequence listings and those corresponding sequences depicted in the Examples, the Example sequences are definitive. In the Examples sequences depicted in lower case are RNA and those in upper case are DNA.
  • Polvnucleotides Mixed ribo-deoxyribonucleic acids are synthesised by synthetic and semisynthetic methods known to those skilled in the art (for example Scaringe, S.A. et al (1990), Nucleic Acids Research 18:5433-5441; Usman, N. et al (1992) Nucleic Acids Research 20:665-6699 and Swiderski, P.M. et al (1994) Anal. Biochem. 216:83-88. Eric B. Kmiec (1996) United States Patent 5,565,350).
  • ribo-deoxyribonucleic acids are synthesised using natural nucleotides, or, in some cases, preferably with 2'-0 methylated ribonucleotides. Additionally or alternatively the phosphodiester bonds of the nucleic acid are replaced by phosphorothiodiesters or methylphosphonodiesters. Additionally or alternatively arabinose-containing nucleotides are also used.
  • a duplex nucleic acid in which deoxyribonucleotides and ribonucleotides correspond with each other is termed a hybrid-duplex.
  • a hybrid-duplex When two strands form a region of duplex nucleic acid for less than all of their bases the resultant molecule is termed a heteroduplex.
  • Two strands of a duplex can be linked by an oligonucleotide linker region to form a single polymer. The bases in the linker region are not Watson-Crick paired.
  • a heteroduplex in which the first and second strands are portions of a single polymer is termed a hairpin duplex.
  • the mixed ribo-deoxyribonucleic acid useful in the present invention has at most one
  • the 3' end and one 5' end is constructed to contain at least one region of at least one or more - usually three to four - bases that are not Watson-Crick paired. These unpaired regions form linker regions between two strands of Watson-Crick paired bases. It is preferred that the bases of the linker regions are deoxyribonucleotides.
  • the mixed ribo-deoxyribonucleic acid is constructed having two linkers arranged a) such that substantially all of the remaining bases are Watson- Crick paired and b) such that the 3' and 5 ' ends of the polymer are Watson-Crick paired to adjacent nucleotides of the complementary strand.
  • the mixed ribo-deoxyribonucleic acid is used for the purpose of specifically introducing alterations (a mutation) into a target gene.
  • the genetic site of alteration is determined by selecting a portion of the mixed ribo-deoxyribonucleic acid to have the same sequence as (to be homologous with) the sequence of the target site, hereinafter termed a homologous region.
  • the area of differences between the sequence of the mixed ribo-deoxyribonucleic acid and the target gene is termed the heterologous region.
  • each homologous region contains a portion of hybrid duplex nucleic acid.
  • the portion of each hybrid-duplex is at least 4 base pairs, preferably 8 base pairs and more preferably about 20 to 30 base pairs.
  • a dinucleotide base pair of homo-duplex may be placed within a region of hybrid duplex to allow ligation of the 3' and 5" ends to each other.
  • the total length of the two homologous regions is at least 20 base pairs and preferably is between 40 and 60 base pairs.
  • a region of homo-duplex can be disposed between the hybrid-duplex/ homologous regions of the vector.
  • the interposed homo-duplex can contain the heterologous region.
  • the heterologous region is less than about 50 base pairs and preferably less than about 20 base pairs, the presence of an interposed homo-duplex is optional.
  • the heterologous region exceeds about 20 base pairs, an interposed homo-duplex is preferred.
  • the change to be introduced into the target gene is encoded by the heterologous region.
  • the change to be introduced may be a change in one or more bases of the target gene sequence or the addition of one or more bases.
  • the glycine residue occurs within exon 2 (part of which is shown below and is depicted as SEQ ID No. 5), the DNA coding sequence in the region being:
  • the mixed ribo-deoxyribonucleic acid designed to elicit this change includes, for example, on one of its strands, a sequence comprising mainly of RNA which is complementary to all or part of the above DNA sequence.
  • This RNA is interposed by a short region of DNA also complementary with the corresponding region of the above DNA sequence except for the inclusion of the specific mismatch of having a guanosine base opposite the guanosine base within the target GGA codon.
  • a suitable mixed ribo- deoxyribonucleic acid could thus include all or part of the following sequence (depicted as SEQ ID No. 6 in the sequence listing). Note that RNA sequence is marked in bold. TTGTACCTTGGGAATGCAGGAACAGCCATGCGTCCACTC AACAUGG A ACCCUU A CGTCGTTGUCGGUACGCAGGUGAG
  • the mixed ribo- deoxyribonucleic acid designed to elicit this change includes, for example, on one of its strands, a sequence comprising mainly of RNA which is complementary to all or part of the above DNA sequence.
  • This RNA is interposed by a short region of DNA also complementary with the corresponding region of the above DNA sequence except for the inclusion of the specific mismatch of having a thymine base opposite the guanosine base within the target GCT codon.
  • the desired polynucleotide thus includes all or part of the RNA sequence depicted below and in SEQ ID No. 8. Note that RNA sequence is marked in bold.
  • genomic sequences may be isolated directly using heterologous probes and/or combinations of degenerate " and inverse PCR.
  • cultivars or plant cells with the appropriate unselected controls the specific mutation(s) responsible for conferring high expression of EPSP synthase will be identified.
  • Another example of a suitable method for identifying mutations potentially useful for increasing the expression of EPSP synthase is to directly select various lines of cultured plant cells or protoplasts from plant species of interest (e.g. Brassica napus) on increasing concentrations of glyphosate. This can be done with or without the addition of a suitable chemical mutagen.
  • Glyphosate-tolerant lines so obtained are analysed for expression of EPSP synthase, for the level of translatable EPSP synthase gene transcript (e.g by Northern analysis) and for possible amplification of the EPSPS gene (e.g. by Southern and dot blot analysis).
  • Cell lines of particular interest would be those where EPSP synthase was overexpressed and where this increase could not be accounted for through gene amplification. Identification of the specific mutation(s) responsible for conferring high expression of EPSP synthase are then identified as described in (1) above.
  • a further example of a method useful to specify mutations causing high expression of EPSPS comprises (a) subcloning the plant EPSP synthase promoter, 5' upstream sequence region, translational start region and sequence encoding the N-terminus region of EPSP synthase into a translational fusion construct directing the synthesis of a suitable and easily measurable reporter gene such as (Beta glucuronidase) (b) further cloning this into a shuttle vector containing an origin for replication in E. coli and also designed for site specific integration into the yeast genome (YIP), or the genome of any other suitable test cell, such that integration into a specific location can be positively selected, by for example, complementation of an auxotrophic mutation.
  • a suitable and easily measurable reporter gene such as (Beta glucuronidase)
  • YIP yeast genome
  • a library of many variants specifically within the promoter and 5' upstream region of the so-designed shuttle vector is then created by mutagenesis through, for example, Mn2+-poisoned PCR of the region and maintained in E.coli.
  • Members of the library are then tested by transformation into yeast.
  • the best expressers in yeast are identified by increased expression of the reporter gene.
  • the integrated DNA from these high expresser lines is then extracted, sequenced and compared with the original sequence in order to identify those specific mutation(s) which conferred increased expression.
  • Such mutations may affect conserved domains within the promoter which bind the transcriptional activators required for gene expression. Studies of this sort may teach those skilled in the art to modify the equivalent conserved regions in other crop plant species, thus enabling the technology to be applied broadly.
  • the polynucleotides comprising the RNA sequences disclosed above are transfected into protoplasts of Brassica napus which are then cultured and subjected to the herbicide glyphosate at concentrations which are sufficient to kill like protoplasts which have not been transfected and like protoplasts which have been transfected but with a polynucleotide not comprising regions designed to elicit a mutation in the Brassica genome.
  • Those transfected protoplasts which survive the herbicide at concentrations which kill the control protoplasts are regenerated into plants using known means.
  • the increased resistance to the herbicide of the thus regenerated plants is inherited in a Mendelian manner amongst the progeny of these plants.
  • RNA and DNA elements of the polynucleotides can easily be designed by a method directly analogous to that described for B. napus. Polynucleotides comprising these RNA and DNA elements can then be introduced into regeneratable plant material from other species. Moreover, the skilled man is capable of designing:
  • napus EPSP synthase gene may be improved in situ by designing mixed ribo-deoxyribonucleic oligonucleotides to make the desired mutational changes, at positions -3 and + 6 as shown below. Note that conserved consensus sequences are underlined.
  • Plant Consensus TCACTATATATAG In both cases highly conserved bases are underlined. Comparisons between the consensus and native sequences of target EPSP synthase genes will enable bases suitable for mutational change to be identified.
  • Such designed polynucleotides can be introduced into totipotent plant material by known means which is then regenerated into plants which are subjected to a selection procedure to isolate those that exhibit the desired trait.
  • oligonucleotides shown below are all synthesised according to Yoon et al. (1996).
  • sequence comprising such bases is to be understood as being RNA.
  • sequences comprising bases depicted in upper case as being DNA.
  • Example 1 This Example demonstrates the production of corn (maize) which is resistant to the herbicide chlorsulfuron. *
  • the above oligonucleotide (SEQ ID No. 11) conveniently may be introduced into corn using silicon carbide whiskers, pollen harbouring the oligonucleotide or via pollen tubes. Whiskers The so called whiskers technique is performed essentially as described by Frame et al, (1994 Plant J. 6 941 -948). The oligonucleotide (1-100 ⁇ g) depicted in SEQ ID No.l 1 is added to the whiskers and used to transform A188 x b73 cell suspensions.
  • the oligonucleotide(s) may be co-incubated with plasmids comprising sequences encoding proteins capable of forming recombinase complexes in plant cells such that recombination is catalysed between the oligonucleotide and the target sequence.
  • Plant regeneration is performed using selective concentrations of chlorsulfuron in place of bialophos. Plants are transferred to pots and matured in the green house. Kernals from these plants are germinated in soil and sprayed with a selecting concentration of chlorsulfuron 9 to 14 days post emergence.
  • Pollen transformation Maize pollen is bombarded with gold particles by techniques * known to the skilled man.
  • Gold particles are coated with the oligonucleotide depicted in SEQ ID No. 1 1.
  • the oligonucleotides may be co-incubated with plasmids comprising sequences encoding proteins capable of forming recombinase complexes in plant cells such that recombination is catalysed between the oligonucleotide and the target sequence.
  • Suitable bombardment methods vary in precise detail but the basic procedure is well known to the skilled man and it is thus not necessary to describe it here. Bombarded pollen is applied to receptive silks of detassled plants. Sufficient replicas are performed to pollinate a large number of plants (typically up to 500). Progeny of the plants are screened for chlorsulfuron resistant members of the population by spraying with selecting concentrations of chlorsulfuron.
  • Pollen tube mediated transformation Emasculated corn plants are used. W'ild type pollen is applied to pollination receptive silks. After between 30 min to 6 hours the silks are cut to within one cm of the base.
  • the above SEQ ID No. 1 1 oligonucleotide (1-100 ⁇ g/ 10 ⁇ l in TE) is applied to the cut surface using a 1 ml syringe and needle such that the surface is completely covered.
  • the oligonucleotides may be co-incubated with plasmids comprising sequences encoding proteins capable of forming recombinase complexes in plant cells such that recombination is catalysed between the oligonucleotide and the target sequence.
  • the plants are then grown in a green house with an initial humidity of about 75 %. Progeny of the plants are screened for chlorsulfuron resistant members of the population by spraying with selecting concentrations of the herbicide.
  • Plants derived from material into which the oligonucleotides have been incorporated are resistant, more resistant or tolerant to the herbicide, when compared to plants derived from material not containing the said oligonucleotide.
  • Example 2 This Example demonstrates the production of Arabidopsis thaliana which is resistant to the herbicide glyphosate (and suitable salts thereof).
  • the following oligonucleotides (depicted as SEQ ID Nos 12 to 16 in the sequence listing) are prepared using standard technology. Ttol
  • oligonucleotides are introduced into Arabidopsis by microprojectile bombardment or protoplast uptake.
  • Arabidopsis is transformed essentially using a modified procedure as described by Seki et al. ((1991) Appl. Microbiol. Biotechnol.36228-230). Arabidopsis thaliana genotype C24 seeds are surface sterilised and sown on B-5 medium (Gamborg et al ., 1968) solidified with 0.6 % agarose. The plants are grown aseptically for 4- - 6 weeks under 16 h light 8 h dark at 26 °C.
  • Roots are harvested and cut into sections that are 0.5 - 1.0 cm long and placed onto a filter paper on medium containing B5 salts and vitamins, 3 % sucrose, 0.5 mg/ml 2,4-dichloropheonoxyacetic acid, 0.05 mg/1 kinetin and 0.8 % agarose (0.5 - 0.05 medium). After two to five days the roots are ready for bombardment. Gold particles (10 mg; Hereus. 0.4-1.2 um diameter) are coated with 1 - 100 ⁇ g of oligonucleotide as follows.
  • the oligonucleotides may be co-incubated with plasmids comprising sequences encoding proteins capable of forming recombinase complexes in plant cells such that recombination is catalysed between the oligonucleotide and the target sequence.
  • the particles are suspended in 1 ml of absolute ethanol and incubated for three hours at room temperature then stored at -20oc. Twenty to thirty-five ⁇ l of sterile resuspended particles are collected by centrifugation in a microcentrifuge. The particles are washed with one ml of sterile distilled water and re-collected by centrifugation.
  • Microprojectiles are then resuspended in 30 ⁇ l oligonucleotide solution (1 -100 ⁇ g), 25 ⁇ l of 1M CaC12 is added followed by 10 ⁇ l of 0J M spermidine (free base). The mixture is incubated on ice for 10 minutes. 1 -10 ⁇ l of this solution is used per bombardment.
  • a suitable mixture or combination of oligonucleotides is introduced into plant material either simultaneously or sequentially. If the oligonucleotides are introduced sequentially, they must be introduced in such a way that the mutation governed by the first oligonucleotide is not negated by the mutation governed by a subsequently introduced oligonucleotide.
  • the oligonucleotide depicted by SEQ ID No. 12 is introduced first, the oligonucleotide depicted by SEQ ID No. 15 should be used subsequently.
  • a single oligonucleotide comprising regions providing for multiple mutations may be used.
  • the roots are bombarded with oligonucleotide-coated particles by a helium-driven biolistics PDS 1000 system (BioRad) with a 300 mm Hg vacuum.
  • the levels between the rupture disk and the macrocarrier and the macro-carrier and sample are varied for maximal transformation efficiency. Rupture disks of between 1000 and 2000 psi are used.
  • Two suitable oligonucleotides are introduced into Arabidopsis plant material either simultaneously or sequentially.
  • the oligonucleotides are used in equal molar concentrations and may be introduced into the material by multiple firings into the same tissue.
  • the roots receive at least one bombardment with each oligonucleotide but multiple firings of each oligonucleotide are used- if necessary to optimise transformation efficiencies.
  • the plant material is transferred to 0.5 - 0.05 medium and incubated at 26oc for one to 5 days.
  • Regeneration of transformed material into Arabidopsis plants is performed as Seki et al 1991 with the exception that kanamycin or gentamycin are not included in any of the media. Instead the transformed material is selected by its resistance or tolerance to glyphosate, present in the selection medium at a concentration suff i cient to kill control material which has been subjected to a like transformation procedure with H i e proviso that it does not contain the oligonucleotides specified above. DNA uptake by protoplasts incubated in PEG The protocol of Dam et al. (1989 Mol Gen. Genet 217 6-12) is followed.
  • an equal molar ratio mix of the two oligonucleotides (SEQ ID Nos 12 and 15) are used (1- 100 ⁇ g) with 50 -100 ⁇ g calf thymus carrier DNA.
  • the oligonucleotides may be co-incubated with plasmids comprising sequences encoding proteins capable of forming recombinase complexes in plant cells such that recombination is catalysed between the oligonucleotide and the target sequence.
  • Glyphosate selection instead of hygromycin selection is applied at the same stage during callus formation. The concentration of glyphosate used is varied to give optimum selection of transformed Arabidopsis plants, but is determined by reference to suitable control experiments.
  • Plants derived from material into which the oligonucleotides have been incorporated are resistant, more resistant or tolerant to the herbicide, when compared to plants derived from material not containing the said oligonucleotide.
  • Example 3 This Example demonstrates the provision of glyphosate resistant Brassica napus
  • oligonucleotides are designed to target the Brassica napus EPSPS gene.
  • the oligonucleotides provide for two changes in the sequence of the protein encoded by the gene, viz. at T 102 and PI 06 of the Brassica mature enzyme such that the mutant gene (via an altered protein product) confers resistance to glyphosate.
  • the oligonucleotides are introduced into Brassica napus using known methods which includes microprojectile bombardment or uptake of DNA by protoplasts.
  • Seeds of B. napus cv Westar are surface sterilised in 1% sodium hypochlorite for 20 minutes. The seeds are then washed in sterile water three times and planted at a density of about 10 seeds per plate on Murashige Skoog (MS) minimal organics medium (GibcoBrl) with 3% sucrose and 0.7% phytagar (Gibco) pH 5.8. Seeds are germinated at 24 °C in 16 h light/8h dark. After five days the cotyledons are excised in such a way that they include approximately 2 mm of petiole at the base. Care is taken to exclude the- apical meristem.
  • the excised cotyledons are placed on MS medium, 3 % sucrose and 0.7 % phytagar enriched with 20 ⁇ M bezyladenine with the petioles imbedded to a depth of 2 mm in the medium at a density of about ten cotyledons per plate.
  • Gold particles (10 mg; Hereus, 0.4-1.2 um diameter) are coated with 1 - 100 ⁇ g of oligonucleotide (SEQ ID No. 22 for example, or SEQ ID Nos. 18 and 20) in plant cells.
  • the oligonucleotides may be co-incubated with plasmids comprising sequences encoding proteins capable of forming recombinase complexes in plant cells such that recombination is catalysed between the oligonucleotide and the target sequence.
  • the particles are suspended in 1 ml of absolute ethanol and incubated for three hours at room temperature then stored at - 20oc. Twenty to thirty five ⁇ l of sterile resuspended particles are collected by centrifugation in a microcentrifuge. The particles are washed with one ml of sterile distilled water and recollected by centrifugation.
  • Microprojectiles are then resuspended in 30 ⁇ l solution (containing oligonucleotides depicted in SEQ ID Nos. 18 and 20, for example in an amount of about 1 -100 ug).
  • 25 ⁇ l of IM CaC12 is added followed by 10 ⁇ l of 0J M spermidine (free base). The mixture is incubated on ice for 10 minutes. 1 -10 ⁇ l of this solution is used per bombardment.
  • the cotyledons are bombarded with oligonucleotide-coated particles by a helium- driven biolistics PDS 1000 system (BioRad) with a 300 mm Hg vacuum.
  • the levels between the rupture disk and the macrocarrier and the macro-carrier and sample are varied for maximal transformation efficiency. Rupture disks of between 1000 and 2000 psi are used.
  • the two oligonucleotides are introduced into the Brassica plant material either simultaneously or sequentially.
  • the oligonucleotides are used in equal molar concentrations and may be introduced into the explant by multiple firings into the same tissue.
  • the explants receive at least one bombardment with each oligonucleotide but multiple firings of each oligonucleotide are used as necessary to optimise transformation efficiencies.
  • the explants After bombardment the explants are placed onto regeneration medium comprising MS medium supplemented with 20 ⁇ M benzyladenine, 3% sucrose 0.7% phytagar pH 5.8. After 2 - 5 days the cotyledons are transferred to plates containing the same media but including selective concentrations of glyphosate. The petioles remain embedded in the media. The explants are left for 2 - 6 weeks and then transferred onto MS medium supplemented with 3 % sucrose, 0.7% phytagar pH 5.8 and selecting concentrations of glyphosate. One to three weeks later surviving shoots are transferred to rooting media which comprises MS medium, 3% sucrose, 2 mg/ml indole butyric acid, 0.7% phytagar with no glyphosate. Once roots are visible the plants are transferred to pots and propagated in the greenhouse.
  • regeneration medium comprising MS medium supplemented with 20 ⁇ M benzyladenine, 3% sucrose 0.7% phytagar pH 5.8.
  • Protoplast uptake The method of Golz et al. ((1990) Plant Mol Biol 15 475 - 483) is followed. Brassica napus genotype HI is used. Instead of using plasmid DNA in the transformation an equal molar ratio mix of the two oligonucleotides (SEQ ID Nos 18 and 20) are used (1- 100 ⁇ g) and 20 -100 ⁇ g calf thymus carrier DNA. The oligonucleotides may be co-incubated with plasmids comprising sequences encoding proteins capable of forming recombinase complexes in plant cells such that recombination is catalysed between the oligonucleotide and the target sequence.
  • Glyphosate selection instead of hygromycin selection is applied at the same stage during callus formation.
  • concentration of glyphosate used is varied to give optimum selection of transformed Brassica plants. Plants derived from material into which the oligonucleotides have been incorporated are resistant, more resistant or tolerant to the herbicide, when compared to plants derived from material not containing the said oligonucleotide.
  • Example 4 This Example demonstrates the provision of corn resistant to the herbicide glyphosate (and salts thereof). T to l
  • oligonucleotides which are designated as SEQ ID Nos 22-26 in the sequence listing and which are produced by means known to the skilled man, may be introduced into corn using silicon carbide whiskers, pollen harbouring oligonucleotides or via pollen tubes. Silicon carbide whiskers This transformation is performed essentially as described by Frame et al. (1994 Plant J. 6 941-948). The oligonucleotide depicted as SEQ ID No 26 (1- 100 ⁇ g) is added to the whiskers and used to transform Al 88 x B73 cell suspensions.
  • the oligonucleotides may be co-incubated with plasmids comprising sequences encoding proteins capable of forming recombinase complexes in plant cells such that recombination is catalysed between the oligonucleotide and the target sequence.
  • Plant regeneration is performed using selective concentrations of glyphosate in place of bialophos. Plants are transferred to pots and are then matured in the green house. Caryopsis from these plants are germinated in soil and sprayed with a selecting concentration of glyphosate 9 to 14 days post emergence.
  • Maize pollen is bombarded with gold particles (essentially as described in the above Examples) coated with a mixture of the above oligonucleotides (SEQ ID Nos 23 and 25).
  • the oligonucleotides may be co-incubated with plasmids comprising sequences encoding proteins capable of forming recombinase complexes in plant cells such that recombination is catalysed between the oligonucleotide and the target sequence.
  • Bombarded pollen is applied to receptive silks of detassled plants. Sufficient replicas are performed to pollinate a large number (typically up to 300) of plants. Progeny of the plants are screened for glyphosate resistant members of the population by spraying with selecting concentrations of glyphosate.
  • Pollen tube mediated transformation Emasculated corn plants are used. Wild type pollen is applied to pollination receptive silks. After between 30 min to 6 hours the silks are cut to within one cm of the base. Suitable mixtures of the above oligonucleotides (l-100 ⁇ g/ 10 ⁇ l in TE) are applied to the cut surface using a 1 ml syringe and needle such that surface is completely covered. The oligonucleotides may be co-incubated with plasmids comprising sequences encoding proteins capable of forming recombinase complexes in plant cells such that recombination is catalysed between the oligonucleotide and the target sequence. The plants are then grown in a green house with an initial humidity of about 75 %. Progeny of the plants are screened for glyphosate resistant members of the population by spraying with selecting concentrations of glyphosate.
  • Example 5 This Example demonstrates the provision of tomato plants resistant to a bleaching herbicide designated as R390244.
  • This oligonucleotide (SEQ ID No. 27) is designed to target the codon for arginine 307 of the tomato phytoene desaturase (PDS) gene and introduce a mutation such that the mutant PDS is resistant to the herbicide R390244.
  • the oligonucleotides may be co-incubated with plasmids comprising sequences encoding proteins capable of forming recombinase complexes in plant cells such that recombination is catalysed between the oligonucleotide and the target sequence.
  • the oligonucleotide is introduced into tomato Mill cv H722 via microprojectile bombardment essentially as described by Eck et al. (1995 Plant Cell Reports 14, 299-304) and as outlined above for the other crops subjected to this transformation procedure.
  • Regenerable cotyledon explant material (as described by Fillati et al. (1997 Bio/technology 5 726-730) suspensions are bombarded with SEQ ID No. C oligonucleotide- coated particles by a helium-driven biolistics PDS 1000 system (BioRad) with a 300 mm Hg vacuum.
  • the levels between the rupture disk and the macrocarrier and the macro-carrier and sample are varied for maximal transformation efficiency.
  • Rupture disks of between 1000 and 2000 psi are used.
  • the oligonucleotide may be introduced into the explant by multiple firings into the same tissue as necessary to optimise transformation efficiencies.
  • regenerable cotyledons are bombarded at the same stage as when Agrobacterium is used in the method of Beaudoin and Rothstein (1997 Plant Mol Biol 33 835 -846). Regeneration of tomato plants is as described by Beaudoin and Rothstein except that no selection agent is used.
  • Primary putative transformants are grown in the greenhouse and cuttings are propagated in soil. These cuttings, once established, are sprayed with selecting concentrations of R390244 and allow transformed herbicide resistant plants to be identified. These transformed plants are grown to maturity and seeds resulting from self pollination are collected.
  • Mutation events in individuals is confirmed by amplifying the particular mutant gene sequence from herbicide resistant individuals spanning the region of mutation by PCR and sequencing individually isolated and cloned sequences.
  • Plants derived from material into which the oligonucleotides have been incorporated are resistant, more resistant or tolerant to the herbicide, when compared to plants derived from material not containing the said oligonucleotide.
  • MOLECULE TYPE protein
  • MOLECULE TYPE other nucleic acid
  • HYPOTHETICAL NO
  • CTGTTCGTGT CAATGCTAAT GGTGGCCTTC CCGGTGGAAA GGTGATCTTC ACATTTACTC 1220 TATGAATTGT TTGCAGCAGT CTTTGTTCAT CACAGCCTTT GCTTCACATT ATTTCATCTT 1330
  • AAAAATTAGA AAAACTTTTA ATAAATCGTC TACAGTCCCN NAAATCTTAG AGCCGGCCCT 1623 GCTTGTATGG TTTCTCGATT GATATATTAG ACTATGTTTT GAATTTTCAG GTGAAGCTTT 1653
  • TCAAATATTA TTCTCCCTCC GTTTTATGTT AAGTGTCATT AGCTTTTAAA.
  • CTTGAAAGTA TCACAAAGCA TTAAAAGACC CTTTCCTCTG ATCCAAATGT GAGAATCTGT 3120 TGCTTTCTCT TTGTTGCCAC TGTAACATTT ATTAGAAGAA CAAAGTGTGT GTGTTAAGAG 3180
  • MOLECULE TYPE other nucleic acid
  • HYPOTHETICAL NO
  • MOLECULE TYPE other nucleic acid
  • HYPOTHETICAL NO
  • MOLECULE TYPE other nucleic acid
  • HYPOTHETICAL NO
  • MOLECULE TYPE other nucleic acid
  • HYPOTHETICAL NO
  • ANTI-SENSE NO

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Mycology (AREA)
  • Medicinal Chemistry (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un procédé de production de plantes qui présentent une caractéristique souhaitable du point de vue agronomique. Ce procédé consiste à réaliser la mutation in situ d'au moins un gène d'une cellule de plante, ou à le modifier d'une autre manière, gène qui, lorsqu'il est modifié, est responsable de ladite caractéristique; et à régénérer à partir d'une cellule présentant ladite caractéristique des plantes entières fertiles et normales du point de vue morphologique. Ce procédé est caractérisé en ce qu'un polynucléotide est introduit dans la cellule de la plante, ce polynucléotide comportant au moins une région sensiblement complémentaire à au moins une région du gène, ladite région du gène, lorsqu'elle a subi la mutation, ou qu'elle a été modifiée d'une autre manière, portant la caractéristique souhaitable du point de vue agronomique. La région dudit polynucléotide comporte au moins un mauvais appariement des bases par rapport à la région comparable dudit gène qui doit donc être modifiée par l'intermédiaire du système de réparation/duplication de l'ADN de la cellule dans laquelle il faut introduire ledit mauvais appariement des bases.
PCT/GB1998/001499 1997-05-28 1998-05-22 Procedes de modification in situ de phytogenes WO1998054330A1 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
EP98922954A EP1017825A1 (fr) 1997-05-28 1998-05-22 Procedes de modification in situ de phytogenes
AU75414/98A AU7541498A (en) 1997-05-28 1998-05-22 Methods of (in situ) modification of plant genes
JP50036099A JP2002503101A (ja) 1997-05-28 1998-05-22 植物遺伝子のインサイチュ改変法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB9711015.9 1997-05-28
GBGB9711015.9A GB9711015D0 (en) 1997-05-28 1997-05-28 Improvements in or relating to organic compounds

Publications (1)

Publication Number Publication Date
WO1998054330A1 true WO1998054330A1 (fr) 1998-12-03

Family

ID=10813182

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB1998/001499 WO1998054330A1 (fr) 1997-05-28 1998-05-22 Procedes de modification in situ de phytogenes

Country Status (5)

Country Link
EP (1) EP1017825A1 (fr)
JP (1) JP2002503101A (fr)
AU (1) AU7541498A (fr)
GB (2) GB9711015D0 (fr)
WO (1) WO1998054330A1 (fr)

Cited By (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999025853A1 (fr) * 1997-11-18 1999-05-27 Pioneer Hi-Bred International, Inc. Manipulation ciblee sur des vegetaux de genes de resistance aux herbicides
WO2000009727A2 (fr) * 1998-08-12 2000-02-24 Maxygen, Inc. Rearrangement d'adn destine a la production de plantes tolerant aux herbicides
EP1007712A1 (fr) * 1997-08-05 2000-06-14 Kimeragen Inc. Utilisation d'oligonucleotides a double helice melanges pour effectuer des modifications genetiques localisees dans des plantes
WO2001066704A2 (fr) * 2000-03-09 2001-09-13 Monsanto Technology Llc Procedes permettant de rendre des plantes tolerantes au glyphosate et compositions associees
EP1223799A1 (fr) * 1999-10-07 2002-07-24 Valigen (US), Inc. Plantes non transgeniques resistant a un herbicide
US6458594B1 (en) 1997-11-18 2002-10-01 Pioneer Hi-Bred International, Inc. Compositions and methods for the targeted removal of a nucleotide sequence from the genome of a plant
WO2003013226A2 (fr) * 2001-08-09 2003-02-20 Cibus Genetics Plantes non transgeniques resistant aux herbicides
WO2003076574A2 (fr) * 2002-03-05 2003-09-18 Pioneer Hi-Bred International, Inc. Manipulation ciblee de genes dans des plantes
US6929917B2 (en) 2002-11-18 2005-08-16 Pregentis Method for cloning of a rare, specifically mutated cell
EP1582583A2 (fr) * 2000-03-09 2005-10-05 Monsanto Technology LLP Contructs d'ADN comprenant un promoteur d'EPSP synthase et leurs utilisations
US7102055B1 (en) 1997-11-18 2006-09-05 Pioneer Hi-Bred International, Inc. Compositions and methods for the targeted insertion of a nucleotide sequence of interest into the genome of a plant
US20070028318A1 (en) * 2003-08-29 2007-02-01 Instituto Nacional De Technologia Agropecuaria Rice plants having increased tolerance to imidazolinone herbicides
US7560622B2 (en) 2000-10-06 2009-07-14 Pioneer Hi-Bred International, Inc. Methods and compositions relating to the generation of partially transgenic organisms
US7723575B2 (en) * 2003-02-18 2010-05-25 Monsanto Technology Llc Glyphosate resistant class I 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS)
EP2266627A1 (fr) 1999-08-27 2010-12-29 Valigen (US), Inc. Vecteurs mutationnels à oligonucléotides à brin simple.
WO2011078665A1 (fr) 2009-12-21 2011-06-30 Keygene N.V. Techniques améliorées de transfection de protoplastes
US8106259B2 (en) 1999-10-07 2012-01-31 Cibus Us Llc Compositions and methods for plant genetic modification
US8268622B2 (en) 2006-01-12 2012-09-18 Cibus Us Llc EPSPS mutants
US20120284812A1 (en) * 2009-09-01 2012-11-08 Basf Agrochemical Products, B.V. Herbicide-Tolerant Plants
US20140082772A1 (en) * 2010-03-17 2014-03-20 Herve Vantieghem Herbicide-Tolerant Plants
EP2809148A4 (fr) * 2012-02-01 2015-12-09 Dow Agrosciences Llc Peptides synthétiques de transit des chloroplastes dérivés de brassica
US20170265469A1 (en) * 2009-09-01 2017-09-21 Basf Se Method for treating post-emergent rice
US9994862B2 (en) 2011-07-22 2018-06-12 Ricetec, Inc. Rice resistant to HPPD and ACCase inhibiting herbicides
WO2020011985A1 (fr) 2018-07-12 2020-01-16 Keygene N.V. Système crispr/nucléase de type v pour édition de génome dans des cellules végétales
WO2020089448A1 (fr) 2018-11-01 2020-05-07 Keygene N.V. Arn guide double pour édition de génome crispr/cas dans des cellules végétales
US11130959B2 (en) 2016-08-05 2021-09-28 Ricetec, Inc. Methods and compositions for combinations of mutations associated with herbicide resistance/tolerance in rice
US20220135993A1 (en) * 2017-05-31 2022-05-05 S&W Seed Company Mutations conferring acetyl-coa carboxylase (acc) inhibiting herbicide tolerance in sorghum

Families Citing this family (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1173581A1 (fr) * 1999-04-29 2002-01-23 Syngenta Limited Plantes resistant aux herbicides
ES2262514T3 (es) * 1999-04-29 2006-12-01 Syngenta Limited Plantas resistentes a herbicidas.
BR0010169A (pt) * 1999-04-29 2002-02-05 Syngenta Ltd Polinucleotìdeo isolado, vetor, material de planta, plantas completas férteis, morfologicamente normais, plantas de milho, trigo e arroz, métodos para controlar seletivamente ervas daninhas no campo, para produzir plantas que são substancialmente tolerantes ou substancialmente resistentes a glifosato, para selecionar material biológico e para regenerar uma planta transformada fértil para conter dna estranho, e, uso do polinucleotìdeo
EP1284985A2 (fr) * 2000-05-17 2003-02-26 University Of Delaware Ciblage de genes vegetaux faisant appel a des nucleotides
US6639124B2 (en) * 2001-02-14 2003-10-28 Natural Genes, Inc. Production of genetically-controlled herbicide resistance in cotton plants in the absence if genetic engineering
US7135626B2 (en) 2002-04-10 2006-11-14 Natural Genes, Inc. Soybean seeds and plants exhibiting natural herbicide resistance
US7045684B1 (en) * 2002-08-19 2006-05-16 Mertec, Llc Glyphosate-resistant plants
JP2007521810A (ja) * 2004-01-21 2007-08-09 オメガ ジェネティックス， エルエルシー グリホサート耐性植物ならびにグリホサート耐性植物を作製および使用する方法
CA2639900C (fr) * 2006-01-23 2014-08-26 Board Of Trustees Of Michigan State University Procedes de reproduction de plantes resistant au glyphosate et compositions correspondantes
EP2511373B1 (fr) 2006-12-07 2017-08-23 Kansas State University Research Foundation Sorgho résistant aux herbicides de synthase d'acétolactate
ES2634795T3 (es) * 2007-01-12 2017-09-29 Kansas State University Research Foundation Sorgo resistente a herbicidas inhibidores de acetil-CoA-carboxilasa
DK2700721T3 (en) * 2007-10-05 2019-04-01 Cibus Europe Bv MUTERATED ACETOH HYDROXY ACID SYNTHASIC GENES IN BRASSICA

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991004323A1 (fr) * 1989-07-17 1991-04-04 Monsanto Company Synthases de 5-enolpyruvyl-3-phosphoshikimate tolerant les glyphosates
WO1991019796A1 (fr) * 1990-06-12 1991-12-26 Baylor College Of Medicine Procede de recombinaison homologue dans des cellules animales et vegetales
WO1992006201A1 (fr) * 1990-09-28 1992-04-16 Monsanto Company Synthases de 5-enolpyruvyl-3-phosphoshikimate tolerant le glyphosate
WO1995015972A1 (fr) * 1993-12-09 1995-06-15 Thomas Jefferson University Composes et procedes pour realiser des mutations dirigees sur le site dans des cellules eucaryotes
WO1997004103A2 (fr) * 1995-07-19 1997-02-06 Rhone-Poulenc Agrochimie 5-enol pyruvylshikimate-3-phosphate synthase mutee, gene codant pour cette proteine et plantes transformees contenant ce gene
WO1997048714A1 (fr) * 1996-06-17 1997-12-24 Thomas Jefferson University Vecteurs mutationnels chimeres a nucleotides non naturels

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991004323A1 (fr) * 1989-07-17 1991-04-04 Monsanto Company Synthases de 5-enolpyruvyl-3-phosphoshikimate tolerant les glyphosates
WO1991019796A1 (fr) * 1990-06-12 1991-12-26 Baylor College Of Medicine Procede de recombinaison homologue dans des cellules animales et vegetales
WO1992006201A1 (fr) * 1990-09-28 1992-04-16 Monsanto Company Synthases de 5-enolpyruvyl-3-phosphoshikimate tolerant le glyphosate
WO1995015972A1 (fr) * 1993-12-09 1995-06-15 Thomas Jefferson University Composes et procedes pour realiser des mutations dirigees sur le site dans des cellules eucaryotes
WO1997004103A2 (fr) * 1995-07-19 1997-02-06 Rhone-Poulenc Agrochimie 5-enol pyruvylshikimate-3-phosphate synthase mutee, gene codant pour cette proteine et plantes transformees contenant ce gene
WO1997048714A1 (fr) * 1996-06-17 1997-12-24 Thomas Jefferson University Vecteurs mutationnels chimeres a nucleotides non naturels

Cited By (70)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1007712A1 (fr) * 1997-08-05 2000-06-14 Kimeragen Inc. Utilisation d'oligonucleotides a double helice melanges pour effectuer des modifications genetiques localisees dans des plantes
EP1007712A4 (fr) * 1997-08-05 2004-06-30 Kimeragen Inc Utilisation d'oligonucleotides a double helice melanges pour effectuer des modifications genetiques localisees dans des plantes
US7094606B2 (en) 1997-08-05 2006-08-22 Arntzen Charles J Use of mixed duplex oligonucleotides to effect localized genetic changes in plants
US8143504B2 (en) 1997-11-18 2012-03-27 Pioneer Hi-Bred International, Inc. Compositions and methods for genetic modification of plants
US7462766B2 (en) 1997-11-18 2008-12-09 Pioneer Hi-Bred International, Inc. Compositions comprising non-identical recombination sites
WO1999025853A1 (fr) * 1997-11-18 1999-05-27 Pioneer Hi-Bred International, Inc. Manipulation ciblee sur des vegetaux de genes de resistance aux herbicides
US8735158B2 (en) 1997-11-18 2014-05-27 Pioneer Hi-Bred International, Inc. Compositions and methods for the targeted insertion of a nucleotide sequence of interest into the genome of a plant
US6458594B1 (en) 1997-11-18 2002-10-01 Pioneer Hi-Bred International, Inc. Compositions and methods for the targeted removal of a nucleotide sequence from the genome of a plant
US8536420B2 (en) 1997-11-18 2013-09-17 Pioneer Hi-Bred International, Inc. Compositions and methods for genetic modification of plants
US6528700B1 (en) 1997-11-18 2003-03-04 Pioneer Hi-Bred International, Inc. Targeted manipulation of genes in plants
US7102055B1 (en) 1997-11-18 2006-09-05 Pioneer Hi-Bred International, Inc. Compositions and methods for the targeted insertion of a nucleotide sequence of interest into the genome of a plant
US7361508B2 (en) 1997-11-18 2008-04-22 Pioneer Hi-Bred International, Inc. Compositions and methods for the targeted insertion of a nucleotide sequence of interest into the genome of a plant
US6911575B1 (en) 1997-11-18 2005-06-28 Pioneer Hi-Bred International, Inc. Targeted manipulation of genes in plants
US7405079B2 (en) 1997-11-18 2008-07-29 Pioneer Hi-Bred International, Inc. Compositions and methods to reduce the complexity of transgene integration into the genome of a plant
US7820880B2 (en) 1997-11-18 2010-10-26 Pioneer Hi-Bred Int'l. Inc. Compositions and methods to stack multiple nucleotide sequences of interest in the genome of a plant
US7572634B2 (en) 1997-11-18 2009-08-11 Pioneer Hi-Bred International, Inc. Compositions and methods for locating preferred integration sites within the genome of a plant
US9222098B2 (en) 1997-11-18 2015-12-29 Christopher L. Baszczynski Compositions for the targeted insertion of a nucleotide sequence of interest into the genome of a plant
WO2000009727A2 (fr) * 1998-08-12 2000-02-24 Maxygen, Inc. Rearrangement d'adn destine a la production de plantes tolerant aux herbicides
WO2000009727A3 (fr) * 1998-08-12 2000-05-18 Maxygen Inc Rearrangement d'adn destine a la production de plantes tolerant aux herbicides
EP2266627A1 (fr) 1999-08-27 2010-12-29 Valigen (US), Inc. Vecteurs mutationnels à oligonucléotides à brin simple.
EP2324856A1 (fr) 1999-08-27 2011-05-25 Valigen (US), Inc. Vecteurs mutationnels d'oligodeoxynucleotides à brin simple
JP2015096068A (ja) * 1999-10-07 2015-05-21 チーブス ヨーロッパ ベー．フェー． 非トランスジェニック除草剤耐性植物
EP1223799A4 (fr) * 1999-10-07 2004-11-17 Valigen Us Inc Plantes non transgeniques resistant a un herbicide
US11160224B2 (en) 1999-10-07 2021-11-02 Cibus Us Llc Non-transgenic herbicide resistant plants
US10035991B2 (en) * 1999-10-07 2018-07-31 Cibus Us Llc Non-transgenic herbicide resistant plants
JP2018027076A (ja) * 1999-10-07 2018-02-22 チーブス ヨーロッパ ベー．フェー． 非トランスジェニック除草剤耐性植物
EP1223799A1 (fr) * 1999-10-07 2002-07-24 Valigen (US), Inc. Plantes non transgeniques resistant a un herbicide
EP2617830A3 (fr) * 1999-10-07 2013-12-11 Cibus Europe B.V. Plantes non transgéniques résistantes aux herbicides
JP2003513618A (ja) * 1999-10-07 2003-04-15 バリゲン（ユーエス） インコーポレイテッド 非トランスジェニック除草剤耐性植物
US6870075B1 (en) 1999-10-07 2005-03-22 Valigen (Us), Inc. Methods of making non-transgenic herbicide resistant plants
EP2135504A1 (fr) * 1999-10-07 2009-12-23 Valigen (US), Inc. Plantes non transgéniques résistantes aux herbicides
US8106259B2 (en) 1999-10-07 2012-01-31 Cibus Us Llc Compositions and methods for plant genetic modification
EP2294914A3 (fr) * 1999-10-07 2011-06-08 Valigen (US), Inc. Plantes non transgéniques résistantes aux herbicides
US6803501B2 (en) 2000-03-09 2004-10-12 Monsanto Technology, Llc Methods for making plants tolerant to glyphosate and compositions thereof using a DNA encoding an EPSPS enzyme from Eleusine indica
EP1582583A2 (fr) * 2000-03-09 2005-10-05 Monsanto Technology LLP Contructs d'ADN comprenant un promoteur d'EPSP synthase et leurs utilisations
WO2001066704A2 (fr) * 2000-03-09 2001-09-13 Monsanto Technology Llc Procedes permettant de rendre des plantes tolerantes au glyphosate et compositions associees
WO2001066704A3 (fr) * 2000-03-09 2002-02-21 Monsanto Technology Llc Procedes permettant de rendre des plantes tolerantes au glyphosate et compositions associees
EP1582583A3 (fr) * 2000-03-09 2005-10-12 Monsanto Technology LLP Contructs d'ADN comprenant un promoteur d'EPSP synthase et leurs utilisations
US7560622B2 (en) 2000-10-06 2009-07-14 Pioneer Hi-Bred International, Inc. Methods and compositions relating to the generation of partially transgenic organisms
WO2003013226A2 (fr) * 2001-08-09 2003-02-20 Cibus Genetics Plantes non transgeniques resistant aux herbicides
WO2003013226A3 (fr) * 2001-08-09 2005-06-02 Cibus Genetics Plantes non transgeniques resistant aux herbicides
WO2003076574A2 (fr) * 2002-03-05 2003-09-18 Pioneer Hi-Bred International, Inc. Manipulation ciblee de genes dans des plantes
WO2003076574A3 (fr) * 2002-03-05 2005-05-12 Pioneer Hi Bred Int Manipulation ciblee de genes dans des plantes
US6929917B2 (en) 2002-11-18 2005-08-16 Pregentis Method for cloning of a rare, specifically mutated cell
US8436159B2 (en) * 2003-02-18 2013-05-07 Monsanto Technology Llc Glyphosate resistant class I 5-endolpyruvylshikimate-3-phosphate synthase (EPSPS)
US20100197499A1 (en) * 2003-02-18 2010-08-05 Alibhai Murtaza F Glyphosate resistant class i 5-endolpyruvylshikimate-3-phosphate synthase (epsps)
US7723575B2 (en) * 2003-02-18 2010-05-25 Monsanto Technology Llc Glyphosate resistant class I 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS)
US20070028318A1 (en) * 2003-08-29 2007-02-01 Instituto Nacional De Technologia Agropecuaria Rice plants having increased tolerance to imidazolinone herbicides
US8268622B2 (en) 2006-01-12 2012-09-18 Cibus Us Llc EPSPS mutants
US10694694B2 (en) * 2009-09-01 2020-06-30 Basf Se Method for treating post-emergent rice
US11096345B2 (en) 2009-09-01 2021-08-24 Basf Se Method for treating post-emergent rice
US12048281B2 (en) 2009-09-01 2024-07-30 Basf Se Method for treating post-emergent rice
US20120284812A1 (en) * 2009-09-01 2012-11-08 Basf Agrochemical Products, B.V. Herbicide-Tolerant Plants
US20160244780A1 (en) * 2009-09-01 2016-08-25 Basf Agrochemical Products, B.V. Herbicide-tolerant plants
US20140045686A1 (en) * 2009-09-01 2014-02-13 Basf Argochemical Products, B.V. Herbicide-tolerant plants
EP3178312A1 (fr) 2009-09-01 2017-06-14 BASF Agrochemical Products, B.V. Plantes tolérantes aux herbicides
US20170265469A1 (en) * 2009-09-01 2017-09-21 Basf Se Method for treating post-emergent rice
US20180020666A1 (en) * 2009-09-01 2018-01-25 Basf Se Method for treating post-emergent rice
US11096346B2 (en) 2009-09-01 2021-08-24 Basf Se Method for treating post-emergent rice
US20130111618A1 (en) * 2009-09-01 2013-05-02 Basf Agrochemical Products, B.V, Herbicide-tolerant plants
WO2011078665A1 (fr) 2009-12-21 2011-06-30 Keygene N.V. Techniques améliorées de transfection de protoplastes
EP2813572A2 (fr) 2009-12-21 2014-12-17 Keygene N.V. Techniques améliorées de transfection de protoplastes
US20140082772A1 (en) * 2010-03-17 2014-03-20 Herve Vantieghem Herbicide-Tolerant Plants
US9994862B2 (en) 2011-07-22 2018-06-12 Ricetec, Inc. Rice resistant to HPPD and ACCase inhibiting herbicides
US9540654B2 (en) 2012-02-01 2017-01-10 Dow Agrosciences Llc Synthetic brassica-derived chloroplast transit peptides
EP2809148A4 (fr) * 2012-02-01 2015-12-09 Dow Agrosciences Llc Peptides synthétiques de transit des chloroplastes dérivés de brassica
US11130959B2 (en) 2016-08-05 2021-09-28 Ricetec, Inc. Methods and compositions for combinations of mutations associated with herbicide resistance/tolerance in rice
US20220135993A1 (en) * 2017-05-31 2022-05-05 S&W Seed Company Mutations conferring acetyl-coa carboxylase (acc) inhibiting herbicide tolerance in sorghum
WO2020011985A1 (fr) 2018-07-12 2020-01-16 Keygene N.V. Système crispr/nucléase de type v pour édition de génome dans des cellules végétales
WO2020089448A1 (fr) 2018-11-01 2020-05-07 Keygene N.V. Arn guide double pour édition de génome crispr/cas dans des cellules végétales

Also Published As

Publication number Publication date
GB9811138D0 (en) 1998-07-22
AU7541498A (en) 1998-12-30
JP2002503101A (ja) 2002-01-29
GB2326163A (en) 1998-12-16
GB9711015D0 (en) 1997-07-23
EP1017825A1 (fr) 2000-07-12

Similar Documents

Publication Publication Date Title
WO1998054330A1 (fr) Procedes de modification in situ de phytogenes
US5426041A (en) Binary cryptocytotoxic method of hybrid seed production
JP3523657B2 (ja) イミダゾリノン耐性ａｈａｓ変異体
US4975374A (en) Expression of wild type and mutant glutamine synthetase in foreign hosts
US5188642A (en) Glyphosate-resistant plants
US5767366A (en) Mutant acetolactate synthase gene from Ararbidopsis thaliana for conferring imidazolinone resistance to crop plants
AU610825B2 (en) Herbicide tolerant plants containing gluthathione S-transferase gene
US20020061570A1 (en) Anthranilate synthase gene and method of use thereof for conferring tryptophan overproduction
US5145777A (en) Plant cells resistant to herbicidal glutamine synthetase inhibitors
MX2013001299A (es) Genes de protoporfirinogen ix oxidasa (ppx) mutados.
MXPA97009310A (en) Dna sequence of a hydroxypenyl-piruvate-dioxygenase gene and obtaining plants containing a gene of hydroxypenyl-piruvate-dioxygenase, tolerants at certain herbici
US5073677A (en) Herbicidal tolerant plants containing rat glutathione S-transferase gene
EP0258410A1 (fr) Cellules vegetales resistant aux inhibiteurs de glutamine synthetase utilises en tant qu'herbicides
AU576402B2 (en) Plant cells resistant to herbicidal glutamine synthetase inhibitors
US5098838A (en) Expression of wild type and mutant glutamine synthetase in foreign hosts
EP0492113A2 (fr) Mutants de détection de AHAS résistants aux herbicides
US7241878B1 (en) Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants
WO2023031885A1 (fr) Procédés et compositions pour la tolérance à l'herbicide ppo
WO2024047605A1 (fr) Procédés et compositions pour la tolérance à l'herbicide ppo
CN118345098A (zh) 一种具有除草剂抗性的玉米ACCase突变型基因及其应用
WO2024233111A2 (fr) Compositions et procédés pour modifier le déterminisme d'une plante
AU609391C (en) Plant cells resistant to herbicidal glutamine synthetase inhibitors

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM GW HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 1998922954

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 09424344

Country of ref document: US

ENP Entry into the national phase

Ref country code: JP

Ref document number: 1999 500360

Kind code of ref document: A

Format of ref document f/p: F

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 1998922954

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: CA

WWW Wipo information: withdrawn in national office

Ref document number: 1998922954

Country of ref document: EP