WO1998054202A1 - Human tumor necrosis factor receptor tr10 - Google Patents

Human tumor necrosis factor receptor tr10 Download PDF

Info

Publication number
WO1998054202A1
WO1998054202A1 PCT/US1998/010981 US9810981W WO9854202A1 WO 1998054202 A1 WO1998054202 A1 WO 1998054202A1 US 9810981 W US9810981 W US 9810981W WO 9854202 A1 WO9854202 A1 WO 9854202A1
Authority
WO
WIPO (PCT)
Prior art keywords
trio
polypeptide
amino acid
seq
receptor
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US1998/010981
Other languages
English (en)
French (fr)
Inventor
Jian Ni
Craig A. Rosen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Human Genome Sciences Inc
Original Assignee
Human Genome Sciences Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Human Genome Sciences Inc filed Critical Human Genome Sciences Inc
Priority to AU77051/98A priority Critical patent/AU7705198A/en
Priority to CA002292790A priority patent/CA2292790A1/en
Priority to JP50095499A priority patent/JP2002511070A/ja
Priority to EP98925009A priority patent/EP1003767A4/en
Publication of WO1998054202A1 publication Critical patent/WO1998054202A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70578NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00Uses of viruses
    • C12N2799/02Uses of viruses as vector
    • C12N2799/021Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/026Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a baculovirus

Definitions

  • the present invention relates to a novel member of the tumor necrosis factor family of receptors. More specifically, isolated nucleic acid molecules are provided encoding a novel human tumor necrosis factor receptor, TRIO. TRIO polypeptides are also provided, as are vectors, host cells, and recombinant methods for producing the same. The invention further relates to screening methods for identifying agonists and antagonists of TR 10 activity.
  • cytokines Many biological actions, for instance, response to certain stimuli and natural biological processes, are controlled by factors, such as cytokines. Many cytokines act through receptors by engaging the receptor and producing an intra-cellular response.
  • tumor necrosis factors (TNF) alpha and beta are cytokines, which act through TNF receptors to regulate numerous biological processes, including protection against infection and induction of shock and inflammatory disease.
  • the TNF molecules belong to the "TNF-ligand” superfamily, and act together with their receptors or counter-ligands, the "TNF-receptor” superfamily. So far, nine members of the TNF ligand superfamily have been identified and ten members of the TNF-receptor superfamily have been characterized.
  • TNF- lymphotoxin-
  • LT- lymphotoxin-
  • LT- lymphotoxin-
  • NGF nerve growth factor
  • the superfamily of TNF receptors includes the p55TNF receptor, ⁇ 75TNF receptor, TNF receptor-related protein, FAS antigen or APO-1, CD40, CD27, CD30, 4-1BB, OX40, low affinity p75 and NGF-receptor (A. Meager, Biologicals 22:291-295 (1994)).
  • TNF-ligand superfamily Many members of the TNF-ligand superfamily are expressed by activated T- cells, implying that they are necessary for T-cell interactions with other cell types which underlie cell ontogeny and functions. (A. Meager, supra).
  • TNF and LT- are capable of binding to two TNF receptors (the 55- and 75-kd TNF receptors).
  • a large number of biological effects elicited by TNF and LT- acting through their receptors, include hemorrhagic necrosis of transplanted tumors, cytotoxicity, a role in endotoxic shock, inflammation, immunoregulation, proliferation and anti-viral responses, as well as protection against the deleterious effects of ionizing radiation.
  • TNF and LT- are involved in the pathogenesis of a wide range of diseases, including endotoxic shock, cerebral malaria, tumors, autoimmune disease, AIDS and graft-host rejection (B. Beutler and C. Von Huffel, Science 264:661-66% ( 1994)). Mutations in the p55 receptor cause increased susceptibility to microbial infection.
  • Apoptosis or programmed cell death, is a physiologic process essential to the normal development and homeostasis of multicellular organisms (H. whilr, Science 267: 1445-1449 (1995)). Derangements of apoptosis contribute to the pathogenesis of several human diseases including cancer, neurodegenerative disorders, and acquired immune deficiency syndrome (C.B. Thompson, Science 267: 1456-1462 (1995)). Recently, much attention has focused on the signal transduction and biological function of two cell surface death receptors, Fas/APO-1 and TNFR-1 (J.L. Cleveland etal, Cell 81:479-482 (1995); A. Fraser et al, Cell 85:781-784 (1996); S.
  • TNF receptor family Both are members of the TNF receptor family, which also include TNFR-2, low affinity NGFR, CD40, and CD30, among others (CA. Smith et al, Science 248: 1019-23 (1990); M. Tewari et al, in Modular Texts in Molecular and Cell Biology M. Purton, Heldin, Carl, Ed. (Chapman and Hall, London, 1995). While family members are defined by the presence of cysteine-rich repeats in their extracellular domains, Fas/APO-1 and TNFR-1 also share a region of intracellular homology, appropriately designated the "death domain," which is distantly related to the Drosophila suicide gene, reaper (P.
  • TNFR-1 can signal an array of diverse biological activities-many of which stem from its ability to activate NF-kB (L. A. Tartaglia et al, Immunol Today 75: 151-153 (1992)).
  • TNFR-1 recruits the multivalent adapter molecule TRADD, which like FADD, also contains a death domain (H. Hsu et al, Cell 57:495-504 (1995); H. Hsu et al, Cell 84:299-30% (1996)).
  • TRADD can signal both apoptosis and NF-kB activation (H. Hsu et al, Cell 84:299-30% (1996); H. Hsu et al, Immunity 4:387-396 (1996)).
  • TRADD can signal both apoptosis and NF-kB activation (H. Hsu et al, Cell 84:299-30% (1996); H. Hsu et al, Immunity 4:387-396 (1996)).
  • TRAIL apoptosis-inducing ligand
  • This molecule was also disclosed in co-pending U.S. provisional patent application no. 60/013405. For convenience, this molecule will be referred to herein as TRAIL.
  • TRAIL acts independently from the FAS ligand (S.R. Wiley et al, supra). It has also been shown that TRAIL activates apoptosis rapidly, within a time frame that is similar to death signaling by Fas/Apo-IL, but much faster than TNF- induced apoptosis. S.A. Marsters et al, Current Biology 6:150-152 (1996). The inability of TRAIL to bind TNFR-1, Fas, or the recently identified DR3, suggests that TRAIL may interact with a unique receptor(s).
  • TNF family ligands and receptors are varied and influence numerous functions, both normal and abnormal, in the biological processes of the mammalian system. There is a clear need, therefore, for identification and characterization of such receptors and ligands that influence biological activity, both normally and in disease states. In particular, there is a need to isolate and characterize additional novel receptors that bind TRAIL.
  • the present invention provides isolated nucleic acid molecules comprising a polynucleotide encoding the TRIO receptor having the amino acid sequence shown in
  • SEQ ID NO:2 or the amino acid sequence encoded by the cDNA clone deposited as American Type Culture Collection ("ATCC") Deposit No. 209040 on May 15, 1997.
  • ATCC American Type Culture Collection
  • the ATCC is located at 10801 University Boulevard, Manassas, Virginia 20110-2209.
  • the present invention also relates to recombinant vectors, which include the isolated nucleic acid molecules of the present invention, and to host cells containing the recombinant vectors, as well as to methods of making such vectors and host cells and for using them for production of TRIO polypeptides or peptides by recombinant techniques.
  • the invention further provides an isolated TRIO polypeptide having an amino acid sequence encoded by a polynucleotide described herein.
  • the present invention also provides diagnostic assays such as quantitative and diagnostic assays for detecting levels of TRIO protein.
  • diagnostic assays such as quantitative and diagnostic assays for detecting levels of TRIO protein.
  • a diagnostic assay in accordance with the invention for detecting over-expression of TRIO, or soluble form thereof, compared to normal control tissue samples may be used to detect the presence of tumors.
  • Tumor Necrosis Factor (TNF) family ligands are known to be among the most pleiotropic cytokines, inducing a large number of cellular responses, including cytotoxicity, anti-viral activity, immunoregulatory activities, and the transcriptional regulation of several genes.
  • Cellular response to TNF-family ligands include not only normal physiological responses, but also diseases associated with increased apoptosis or the inhibition of apoptosis.
  • Apoptosis-programmed cell death-is a physiological mechanism involved in the deletion of peripheral T lymphocytes of the immune system, and its dysregulation can lead to a number of different pathogenic processes.
  • Diseases associated with increased cell survival, or the inhibition of apoptosis include cancers, autoimmune disorders, viral infections, inflammation, graft vs. host disease, acute graft rejection, and chronic graft rejection.
  • Diseases associated with increased apoptosis include AIDS, neurodegenerative disorders, myelodysplastic syndromes, ischemic injury, toxin-induced liver disease, septic shock, cachexia, and anorexia.
  • the invention further provides a method for inhibiting apoptosis induced by a TNF-family ligand, which involves administering to a cell which expresses the TRIO polypeptide an effective amount of an agonist capable of increasing TRIO mediated signaling.
  • TRIO mediated signaling is increased to treat a disease wherein increased apoptosis is exhibited.
  • the present invention is directed to a method for enhancing apoptosis induced by a TNF-family ligand, which involves administering to a cell which expresses the TRIO polypeptide an effective amount of an antagonist capable of decreasing TRIO mediated activity.
  • TRIO mediated activity is decreased to treat a disease wherein decreased apoptosis is exhibited.
  • any candidate "agonist" or "antagonist” of the present invention can enhance or inhibit apoptosis can be determined using art-known TNF-family ligand/receptor cellular response assays, including those described in more detail below.
  • a screening method for determining whether a candidate agonist or antagonist is capable of enhancing or inhibiting a cellular response to a TNF-family ligand.
  • the method involves contacting cells which express the TRIO polypeptide with a candidate compound and a TNF-family ligand, assaying a cellular response, and comparing the cellular response to a standard cellular response, the standard being assayed when contact is made with the ligand in absence of the candidate compound, whereby an increased cellular response over the standard indicates that the candidate compound is an agonist of the ligand/receptor signaling pathway and a decreased cellular response compared to the standard indicates that the candidate compound is an antagonist of the ligand/receptor signaling pathway.
  • a cell expressing the TRIO polypeptide can be contacted with either an endogenous or exogenously administered TNF-family ligand.
  • Figure 1 shows the nucleotide (SEQ ID NO: 1) and deduced amino acid sequence (SEQ ID NO:2) of the TRIO receptor.
  • Predicted amino acids 1-55 constitute the signal peptide (amino acid residues from about -55 to about -1 in SEQ ID NO:2); amino acids 56-212 constitute the extracellular domain (amino acid residues from about
  • amino acids 213-230 constitute the transmembrane domain (amino acid residues from about 158 to about 175 in SEQ ID NO:2); and amino acids 231-386 constitute the intracellular domain (amino acid residues from about 176 to about 331 in SEQ ID NO:2), of which amino acids 353-363 constitute the partial death domain (amino acid residues from about 298 to about 308 in SEQ ID NO:2).
  • Figure 2 shows the regions of similarity between the amino acid sequences of the TRIO receptor protein (SEQ ID NO:2), and the Fas receptor (SEQ ID NO:3), NGFR p75 (SEQ ID NO:4), human TNFR 1 (SEQ ID NO:5), and DR4 (SEQ ID NO:6).
  • Figure 3 shows an analysis of the TRIO amino acid sequence. Alpha, beta, turn and coil regions; hydrophilicity and hydrophobicity; amphipathic regions; flexible regions; antigenic index and surface probability are shown.
  • amino acid residues about 57 to about 1 13, about 130 to about 197, and about 250 to about 283 in Figure 1 correspond to the shown highly antigenic regions of the TRIO protein.
  • These highly antigenic fragments in Figure 1 correspond to the following fragments, respectively, in SEQ ID NO:2: amino acid residues from about 2 to about 58, from about 75 to about 142, and from about 195 to about 228.
  • the present invention provides isolated nucleic acid molecules comprising a polynucleotide encoding a TRIO polypeptide having the amino acid sequence shown in FIG. 1 (SEQ ID NO:2), which was determined by sequencing a cloned cDNA.
  • the TRIO polypeptide of the present invention shares sequence homology with human NGFR, TNFRI, DR4, and Fas (FIG. 2).
  • the nucleotide sequence shown in FIG. 1 (SEQ ID NO:l) was obtained by sequencing a cDNA clone, which was deposited on May 15, 1997 at the American Type Culture Collection, 12301 Park Lawn Drive, Rockville, Maryland 20852, and given Accession Number 209040.
  • the deposited clone is inserted in the pCMVSport 2.0 plasmid (Life Technologies, Rockville, MD) using the Sal I Not I restriction endonuclease cleavage sites.
  • nucleic Acid Molecules Unless otherwise indicated, all nucleotide sequences determined by sequencing a DNA molecule herein were determined using an automated DNA sequencer (such as the Model 373 from Applied Biosystems, Inc.), and all amino acid sequences of polypeptides encoded by DNA molecules determined herein were predicted by translation of a DNA sequence determined as above. Therefore, as is known in the art for any DNA sequence determined by this automated approach, any nucleotide sequence determined herein may contain some errors. Nucleotide sequences determined by automation are typically at least about 90% identical, more typically at least about 95% to at least about 99.9% identical to the actual nucleotide sequence of the sequenced DNA molecule.
  • the actual sequence can be more precisely determined by other approaches including manual DNA sequencing methods well known in the art.
  • a single insertion or deletion in a determined nucleotide sequence compared to the actual sequence will cause a frame shift in translation of the nucleotide sequence such that the predicted amino acid sequence encoded by a determined nucleotide sequence will be completely different from the amino acid sequence actually encoded by the sequenced DNA molecule, beginning at the point of such an insertion or deletion.
  • a nucleic acid molecule of the present invention encoding a TRIO polypeptide may be obtained using standard cloning and screening procedures, such as those for cloning cDNAs using mRNA as starting material.
  • the nucleic acid molecule described in SEQ ID NO:l was discovered in a cDNA library derived from keratinocytes.
  • the gene of the present invention has also been identified in cDNA libraries from the following tissues: fetal liver, peripheral blood lymphocytes (PBL), lung, kidney, small intestine, colon, endothelial cells, and monocyte activated tissue.
  • the following cancer cell lines express TRIO: Hela cell S3, SW480 (colorectal adenocarcinoma), and A549 (lung carcinoma).
  • the determined nucleotide sequence of the TR 10 cDNA of SEQ ID NO: 1 contains an open reading frame encoding a protein of about 331 amino acid residues, with a predicted leader sequence of about 55 amino acid residues, and a deduced molecular weight of about 42 kDa.
  • the amino acid sequence of the predicted mature TRIO receptor is shown in SEQ ID NO:2 from amino acid residue about 1 to residue about 331.
  • the TRIO polypeptide of the invention shares the greatest degree of homology with human DR4 (See FIG. 2), including significant sequence homology over multiple cysteine rich domains.
  • TRIO Owing to the sequence homology exhibited between TRIO and DR4 (and other death domain containing receptors), it was immediately recognized that TRIO would likely also bind to TRAIL.
  • the cytoplasmic domain interestingly, contains only a partial (or truncated) death domain.
  • TRIO binds TRAIL but does not appear to cause cell death.
  • TRIO binding of TRAIL to the contrary, antagonizes apoptosis.
  • Such antagonistic effect on TRAIL induced apoptosis can be achieved both through ectopic expression of TRIO and through exogenous administration of soluble TRIO.
  • Northern blot analysis was performed.
  • a single transcript was detected in multiple human tissues at varying levels of expression, including, heart, lung, brain, placenta, liver, skeletal muscle, kidney, pancreas, spleen, thymus, prostate, testis, ovary, small intestine, colon, PBLs, lymph node, bone marrow and fetal liver. TRIO expression was not observed in most cancer cell lines tested. See Example 4, below.
  • the present invention also provides the mature form(s) of the TRIO receptor of the present invention.
  • proteins secreted by mammalian cells have a signal or secretory leader sequence which is cleaved from the mature protein once export of the growing protein chain across the rough endoplasmic reticulum has been initiated.
  • Most mammalian cells and even insect cells cleave secreted proteins with the same specificity.
  • cleavage of a secreted protein is not entirely uniform, which results in two or more mature species on the protein.
  • the cleavage specificity of a secreted protein is ultimately determined by the primary structure of the complete protein, that is, it is inherent in the amino acid sequence of the polypeptide.
  • the present invention provides a nucleotide sequence encoding the mature TRIO polypeptide having the amino acid sequence encoded by the cDNA clone contained in the host identified as ATCC Deposit No. 209040, and as shown in Figure 1 (SEQ ID NO:2).
  • the mature TRIO protein having the amino acid sequence encoded by the cDNA clones contained in the host identified as ATCC Deposit No. 209040 is meant the mature form(s) of the TRIO receptor produced by expression in a mammalian cell (e.g., COS cells, as described below) of the complete open reading frame encoded by the human DNA sequence of the clone contained in the vector in the deposited host.
  • the mature TRIO receptor having the amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 209040 may or may not differ from the predicted mature TRIO protein shown in SEQ ID NO:2 (amino acids from about 1 to about 331) depending on the accuracy of the predicted cleavage site based on computer analysis.
  • Methods for predicting whether a protein has a secretory leader as well as the cleavage point for that leader sequence are available. For instance, the method of McGeoch (Virus Res. 5:271-286 (1985)) and von Heinje (Nucleic Acids Res. 74:4683- 4690 (1986)) can be used.
  • the analysis by the PSORT program predicted the cleavage site between amino acids -land 1 in SEQ ID NO:2. Thereafter, the complete amino acid sequences were further analyzed by visual inspection, applying a simple form of the (-1,-3) rule of von Heinje. von Heinje, supra.
  • the leader sequence for the TRIO protein is predicted to consist of amino acid residues from about -55 to about -1 in SEQ ID NO:2, while the mature TRIO protein is predicted to consist of residues from about 1-331 in SEQ ID NO:2.
  • the predicted TRIO polypeptide encoded by the deposited cDNA comprises about 386 amino acids, but may be anywhere in the range of 376-396 amino acids; and the predicted leader sequence of this protein is about 55 amino acids, but may be anywhere in the range of about 45 to about 65 amino acids.
  • nucleic acid molecules of the present invention may be in the form of RNA, such as mRNA, or in the form of DNA, including, for instance, cDNA and genomic DNA obtained by cloning or produced synthetically.
  • the DNA may be double-stranded or single-stranded.
  • Single-stranded DNA may be the coding strand, also known as the sense strand, or it may be the non-coding strand, also referred to as the anti-sense strand.
  • isolated nucleic acid molecule(s) is intended a nucleic acid molecule, DNA or RNA, which has been removed from its native environment For example, recombinant DNA molecules contained in a vector are considered isolated for the purposes of the present invention.
  • isolated DNA molecules include recombinant DNA molecules maintained in heterologous host cells or purified (partially or substantially) DNA molecules in solution.
  • isolated RNA molecules include in vivo or in vitro RNA transcripts of the DNA molecules of the present invention.
  • Isolated nucleic acid molecules according to the present invention further include such molecules produced synthetically.
  • Isolated nucleic acid molecules of the present invention include DNA molecules comprising an open reading frame (ORF) shown in SEQ ID NO: 1 ; DNA molecules comprising the coding sequence for the mature TRIO protein; and DNA molecules which comprise a sequence substantially different from those described above, but which, due to the degeneracy of the genetic code, still encode the TRIO protein.
  • ORF open reading frame
  • DNA molecules comprising the coding sequence for the mature TRIO protein and DNA molecules which comprise a sequence substantially different from those described above, but which, due to the degeneracy of the genetic code, still encode the TRIO protein.
  • the genetic code is well known in the art. Thus, it would be routine for one skilled in the art to generate such degenerate variants.
  • the invention provides nucleic acid molecules having nucleotide sequences related to extensive portions of SEQ ID NO: 1 which have been determined from the following related cDNA clones: HSABD50R (SEQ ID NO:7), HGBDL20R(SEQ ID NO:8), and HELDL61R (SEQ ID NO:9), and AA150849 (SEQ ID NO: 15).
  • the invention provides isolated nucleic acid molecules encoding the TRIO polypeptide having an amino acid sequence as encoded by the cDNA clone contained in the plasmid deposited as ATCC Deposit No. 209040 on May 15, 1997.
  • nucleic acid molecules are provided that encode the mature TRIO polypeptide or the full length TRIO polypeptide lacking the N-terminal methionine.
  • the invention further provides an isolated nucleic acid molecule having the nucleotide sequence shown in SEQ ID NO: 1 or the nucleotide sequence of the TRIO cDNA contained in the above-described deposited clone, or a nucleic acid molecule having a sequence complementary to one of the above sequences.
  • isolated molecules particularly DNA molecules, are useful as probes for gene mapping by in situ hybridization with chromosomes, and for detecting expression of the TRIO gene in human tissue, for instance, by Northern blot analysis.
  • the present invention is further directed to fragments of the isolated nucleic acid molecules described herein.
  • a fragment of an isolated DNA molecule having the nucleotide sequence of the deposited cDNA or the nucleotide sequence shown in SEQ ID NO: 1 is intended DNA fragments at least about 15nt, and more preferably at least 20 nt, still more preferably at least about 30 nt, and even more preferably, at least about 40 nt in length which are useful as diagnostic probes and primers as discussed herein.
  • larger fragments 50-1500 nt in length are also useful according to the present invention, as are fragments corresponding to most, if not all, of the nucleotide sequence of the deposited cDNA or as shown in SEQ ID NO: 1.
  • a fragment at least 20 nt in length for example, is intended fragments which include 20 or more contiguous bases from the nucleotide sequence of the deposited cDNA or the nucleotide sequence as shown in SEQ ID NO: 1.
  • Preferred nucleic acid fragments of the present invention include nucleic acid molecules encoding: a polypeptide comprising the TRIO receptor extracellular domain (amino acid residues from about 56 to about 212 in FIG. 1 or from about 1 to about 157 in SEQ ID NO:2); a polypeptide comprising the TRIO transmembrane domain (amino acid residues from about 213 to about 230 in FIG. 1 or from about 158 to about 175 in SEQ ID NO:2); a polypeptide comprising the TRIO intracellular domain (amino acid residues from about 231 to about 386 in FIG. 1 or from about 176 to about 331 in SEQ ID NO:2); and a polypeptide comprising the incomplete TRIO death domain
  • amino acid residues from about 353 to about 363 in FIG. 1 or from about 298 to about 308 in SEQ ID NO:2). Since the location of these domains have been predicted by computer analysis, one of ordinary skill would appreciate that the amino acid residues constituting these domains may vary slightly (e.g., by about 1 to 15 amino acid residues) depending on the criteria used to define each domain.
  • Preferred nucleic acid fragments of the invention encode a full-length TRIO polypeptide lacking the nucleotides encoding the amino terminal methionine (nucleotides 109-111 in SEQ ID NO: 1), as it is known that the methionine is cleaved naturally and such sequences may be useful in genetically engineering TRIO expression vectors.
  • Polypeptides encoded by such polynucleotides are also contemplated by the invention.
  • nucleic acid fragments of the present invention further include nucleic acid molecules encoding epitope-bearing portions of the TRIO receptor protein.
  • nucleic acid fragments of the present invention include nucleic acid molecules encoding: a polypeptide comprising amino acid residues from about 57 to about 113 in Figure 1 (corresponding to about amino acid 2 to about 58 in SEQ ID NO:2); a polypeptide comprising amino acid residues from about 130 to about 197 in Figure 1 (corresponding to about amino acid 75 to about 142 in SEQ ID NO:2); and a polypeptide comprising amino acid residues from about 250 to about 283 in Figure 1 (corresponding to about amino acid 195 to about 228 in SEQ ID NO:2).
  • the inventors have determined that the above polypeptide fragments are antigenic regions of the TRIO protein. Methods for determining other such epitope-bearing portions of the TRIO protein are described in detail below.
  • the invention provides an isolated nucleic acid molecule comprising a polynucleotide which hybridizes under stringent hybridization conditions to a portion of the polynucleotide in a nucleic acid molecule of the invention described above, for instance, the cDNA clones contained in ATCC Deposit No. 209040.
  • stringent hybridization conditions is intended overnight incubation at 42°C in a solution comprising: 50% formamide, 5x SSC (150 mM NaCl, 15mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 g/ml denatured, sheared salmon sperm DNA, followed by washing the filters in O.lx SSC at about 65°C.
  • a polynucleotide which hybridizes to a "portion" of a polynucleotide is intended a polynucleotide (either DNA or RNA) hybridizing to at least about 15 nucleotides (nt), and more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably about 30-70 nt of the reference polynucleotide. These are useful as diagnostic probes and primers as discussed above and in more detail below.
  • a portion of a polynucleotide of "at least 20 nt in length,” for example, is intended 20 or more contiguous nucleotides from the nucleotide sequence of the reference polynucleotide (e.g., the deposited cDNA or the nucleotide sequence as shown in SEQ ID NO: 1).
  • a polynucleotide which hybridizes only to a poly A sequence such as the 3' terminal poly(A) tract of the TRIO cDNA shown in SEQ ID NO: 1), or to a complementary stretch of T (or U) resides, would not be included in a polynucleotide of the invention used to hybridize to a portion of a nucleic acid of the invention, since such a polynucleotide would hybridize to any nucleic acid molecule containing a poly (A) stretch or the complement thereof (e.g., practically any double-stranded cDNA clone).
  • nucleic acid molecules of the present invention which encode a TRIO polypeptide may include, but are not limited to the coding sequence for the mature polypeptide, by itself; the coding sequence for the mature polypeptide and additional sequences, such as those encoding a leader or secretary sequence, such as a pre-, or pro- or prepro- protein sequence; the coding sequence of the mature polypeptide, with or without the aforementioned additional coding sequences, together with additional, non-coding sequences, including for example, but not limited to introns and non-coding 5' and 3' sequences, such as the transcribed, non-translated sequences that play a role in transcription, mRNA processing - including splicing and polyadenylation signals, for example - ribosome binding and stability of mRNA; additional coding sequence which codes for additional amino acids, such as those which provide additional functionalities.
  • the polypeptide may be fused to a marker sequence, such as a peptide, which facilitates purification of the fused polypeptide.
  • the marker sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector (Qiagen, Inc.), among others, many of which are commercially available.
  • hexa- histidine provides for convenient purification of the fusion protein.
  • the "HA” tag is another peptide useful for purification which corresponds to an epitope derived from the influenza hemagglutinin protein, which has been described by Wilson et al, Cell 37:161-11% (1984).
  • other such fusion proteins include the TRIO receptor fused to Fc at the N- or C-terminus.
  • the present invention further relates to variants of the nucleic acid molecules of the present invention, which encode portions, analogs, or derivatives of the TRIO receptor. Variants may occur naturally, such as a natural allelic variant.
  • an "allelic variant” is intended one of several alternate forms of a gene occupying a given locus on a chromosome of an organism. Genes II, Lewin, B., ed., John Wiley & Sons, New York (1985). Non-naturally occurring variants may be produced using art-known mutagenesis techniques.
  • variants include those produced by nucleotide substitutions, deletions or additions which may involve one or more nucleotides.
  • the variants may be altered in coding or non-coding regions or both. Alterations in the coding regions may produce conservative or non-conservative amino acid substitutions, deletions, or additions. Especially preferred among these are silent substitutions, additions, and deletions, which do not alter the properties and activities of the TRIO receptor or portions thereof. Also especially preferred in this regard are conservative substitutions.
  • nucleic acid molecules comprising a polynucleotide having a nucleotide sequence at least 90% identical, and more preferably at least 95%, 96%, 97%, 98%, or 99% identical to: (a) a nucleotide sequence encoding the polypeptide having the amino acid sequence in SEQ ID NO:2; (b) a nucleotide sequence encoding the polypeptide having the amino acid sequence in SEQ ID NO: 2, but lacking the amino terminal methionine; (c) a nucleotide sequence encoding the polypeptide having the amino acid sequence at positions about 1 to about 331 in SEQ ID NO:2; (d) a nucleotide sequence encoding the polypeptide having the amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No.
  • a polynucleotide having a nucleotide sequence at least, for example, 95% "identical" to a reference nucleotide sequence encoding a TRIO polypeptide is intended that the nucleotide sequence of the polynucleotide is identical to the reference sequence except that the polynucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence encoding the TRIO polypeptide.
  • nucleotide having a nucleotide sequence at least 95% identical to a reference nucleotide sequence up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence.
  • mutations of the reference sequence may occur at the 5' or 3' terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence.
  • whether any particular nucleic acid molecule is at least
  • the parameters are set, of course, such that the percentage of identity is calculated over the full length of the reference nucleotide sequence and that gaps in homology of up to 5% of the total number of nucleotides in the reference sequence are allowed.
  • the present application is directed to nucleic acid molecules at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence shown in SEQ ID NO: 1 , or to the nucleic acid sequence of the deposited cDNA, irrespective of whether they encode a polypeptide having TRIO receptor activity. This is because even where a particular nucleic acid molecule does not encode a polypeptide having TRIO activity, one of skill in the art would still know how to use the nucleic acid molecule, for instance, as a hybridization probe or a polymerase chain reaction (PCR) primer.
  • PCR polymerase chain reaction
  • nucleic acid molecules of the present invention that do not encode a polypeptide having TRIO receptor activity include, wter alia: (1) isolating the TRIO receptor gene or allelic variants thereof in a cDNA library; (2) in situ hybridization (e.g., "FISH") to metaphase chromosomal spreads to provide precise chromosomal location of the TRIO receptor gene, as described in Verma et al, Human Chromosomes: A Manual of Basic Techniques, Pergamon Press, New York (1988); and (3) Northern Blot analysis for detecting TRIO receptor mRNA expression in specific tissues.
  • FISH in situ hybridization
  • nucleic acid molecules having sequences at least 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequence shown in SEQ ID NO: 1 , or to the nucleic acid sequence of the deposited cDNA which do, in fact, encode a polypeptide having TRIO receptor activity.
  • a polypeptide having TRIO receptor activity is intended polypeptides exhibiting activity similar, but not necessarily identical, to an activity of the TRIO receptor of the invention (either the full-length protein or, preferably, the mature protein), as measured in a particular biological assay.
  • TRIO receptor activity can be measured using the cell death assays performed essentially as previously described (A.M.
  • TRIO-induced apoptosis is blocked by the inhibitors of ICE-like proteases, CrmA and z-VAD-fmk.
  • apoptosis induced by TRIO is also blocked by dominant negative versions of FADD (FADD-DN) or FLICE (FLICE- DN MACHalC360S).
  • nucleic acid molecules having a sequence at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of the deposited cDNA or the nucleic acid sequence shown in SEQ ID NO: 1 will encode a polypeptide "having TRIO receptor activity.”
  • degenerate variants of these nucleotide sequences all encode the same polypeptide, this will be clear to the skilled artisan even without performing the above described comparison assay.
  • This invention is also related to the use of TRIO polynucleotides to detect complementary polynucleotides such as, for example, as a diagnostic reagent. Detection of a mutated form of TRIO associated with a dysfunction will provide a diagnostic tool that can add or define a diagnosis of a disease or susceptibility to a disease which results from under-expression over-expression or altered expression of TRIO or a soluble form thereof, such as, for example, tumors or autoimmune disease.
  • Nucleic acids for diagnosis may be obtained from a patient's cells, such as from blood, urine, saliva, tissue biopsy and autopsy material.
  • the genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR prior to analysis. (Saiki et al, Nature 524: 163-166 (1986)).
  • RNA or cDNA may also be used in the same ways.
  • PCR primers complementary to the nucleic acid encoding TRIO can be used to identify and analyze TRIO expression and mutations. For example, deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype.
  • Point mutations can be identified by hybridizing amplified DNA to radiolabeled TRIO RNA or alternatively, radiolabeled TRIO antisense DNA sequences. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures. Sequence differences between a reference gene and genes having mutations also may be revealed by direct DNA sequencing. In addition, cloned DNA segments may be employed as probes to detect specific DNA segments. The sensitivity of such methods can be greatly enhanced by appropriate use of PCR or another amplification method. For example, a sequencing primer is used with double- stranded PCR product or a single-stranded template molecule generated by a modified PCR. The sequence determination is performed by conventional procedures with radiolabeled nucleotide or by automatic sequencing procedures with fluorescent-tags.
  • DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels, with or without denaturing agents. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis. DNA fragments of different sequences may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al, Science 230:1242 (1985)).
  • Sequence changes at specific locations also may be revealed by nuclease protection assays, such as RNase and SI protection or the chemical cleavage method (e.g., Cotton et al, Proc. Natl. Acad. Sci. USA 85: 4397-4401 (1985)).
  • the detection of a specific DNA sequence may be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes, (e.g., restriction fragment length polymorphisms ("RFLP”) and Southern blotting of genomic DNA.
  • restriction enzymes e.g., restriction fragment length polymorphisms ("RFLP") and Southern blotting of genomic DNA.
  • mutations also can be detected by in situ analysis.
  • the present invention also relates to vectors which include the isolated DNA molecules of the present invention, host cells which are genetically engineered with the recombinant vectors of the invention and the production of TRIO polypeptides or fragments thereof by recombinant techniques.
  • the polynucleotides may be joined to a vector containing a selectable marker for propagation in a host.
  • a plasmid vector is introduced in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid. If the vector is a virus, it may be packaged in vitro using an appropriate packaging cell line and then transduced into host cells.
  • the DNA insert should be operatively linked to an appropriate promoter, such as the phage lambda PL promoter, the E. coli lac, trp and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs, to name a few.
  • an appropriate promoter such as the phage lambda PL promoter, the E. coli lac, trp and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs, to name a few.
  • Other suitable promoters will be known to the skilled artisan.
  • the expression constructs will further contain sites for transcription initiation, termination and, in the transcribed region, a ribosome binding site for translation.
  • the coding portion of the mature transcripts expressed by the constructs will preferably include a translation initiating at the beginning and a termination codon (UAA, UGA or UAG) appropriately positioned at the end of the polypeptide to be translated.
  • the expression vectors will preferably include at least one selectable marker.
  • markers include dihydrofolate reductase or neomycin resistance for eukaryotic cell culture and tetracycline or ampicillin resistance genes for culturing in E. coli and other bacteria.
  • Representative examples of appropriate hosts include, but are not limited to, bacterial cells, such as E. coli, Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast cells; insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS and Bowes melanoma cells; and plant cells. Appropriate culture mediums and conditions for the above-described host cells are known in the art.
  • vectors preferred for use in bacteria include pQ ⁇ 70, pQE60 and pQE-9, available from Qiagen; pBS vectors, Phagescript vectors, Bluescript vectors, pNH8A, pNHl ⁇ a, pNH18A, pNH46A, available from Stratagene; and ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia.
  • preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTl and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available from Pharmacia.
  • the construct into the host cell can be effected by calcium phosphate transfection, DEAE-dextran mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection or other methods. Such methods are described in many standard laboratory manuals, such as Davis et al, Basic Methods In Molecular Biology (1986).
  • the polypeptide may be expressed in a modified form, such as a fusion protein, and may include not only secretion signals but also additional heterologous functional regions. Thus, for instance, a region of additional amino acids, particularly charged amino acids, may be added to the N-terminus of the polypeptide to improve stability and persistence in the host cell, during purification or during subsequent handling and storage.
  • peptide moieties may be added to the polypeptide to facilitate purification. Such regions may be removed prior to final preparation of the polypeptide.
  • a preferred fusion protein comprises a heterologous region from immunoglobulin that is useful to solubilize proteins.
  • EP-A-O 464 533 (Canadian counte ⁇ art 2045869) discloses fusion proteins comprising various portions of constant region of immunoglobin molecules together with another human protein or part thereof.
  • the Fc part in a fusion protein is thoroughly advantageous for use in therapy and diagnosis and thus results, for example, in improved pharmacokinetic properties (EP-A 0232 262).
  • human proteins such as the hIL5-receptor, have been fused with Fc portions for the purpose of high-throughput screening assays to identify antagonists of hIL-5. See, D. Bennett et al, Journal of Molecular Recognition 8:52-58 (1995) and K. Johanson et al, The Journal of Biological Chemistry 270: 16:9459-9471 (1995).
  • the TRIO receptor can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, high performance liquid chromatography ("HPLC") is employed for purification.
  • Polypeptides of the present invention include naturally purified products, products of chemical synthetic procedures, and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect and mammalian cells.
  • polypeptides of the present invention may be glycosylated or non-glycosylated.
  • polypeptides of the invention may also include an initial modified methionine residue, in some cases as a result of host- mediated processes.
  • TRIO receptor polynucleotides and polypeptides may be used in accordance with the present invention for a variety of applications, particularly those that make use of the chemical and biological properties of TRIO. Among these are applications in treatment of tumors, resistance to parasites, bacteria and viruses, to induce proliferation of T-cells, endothelial cells and certain hematopoietic cells, to treat restenosis, graft vs. host disease, to regulate an ti- viral responses and to prevent certain autoimmune diseases after stimulation of TRIO by an agonist. Additional applications relate to diagnosis and to treatment of disorders of cells, tissues and organisms. These aspects of the invention are discussed further below. TRIO Receptor Polypeptides and Fragments
  • the invention further provides an isolated TRIO polypeptide having the amino acid sequence encoded by the deposited cDNA, or the amino acid sequence in SEQ ID NO:2, or a peptide or polypeptide comprising a portion of the above polypeptides.
  • TRIO TRIO receptor-like protein
  • the invention further includes variations of the TRIO receptor, which show substantial TRIO receptor activity or which include regions of TRIO proteins, such as the protein portions discussed below.
  • Such mutants include deletions, insertions, inversions, repeats, and type substitutions.
  • guidance concerning which amino acid changes are likely to be phenotypically silent can be found in J.U. Bowie et al, Science 247:1306- 1310 (1990).
  • the fragment, derivative, or analog of the polypeptide of SEQ ID NO:2, or that encoded by the deposited cDNA may be (i) one in which at least one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue(s), and more preferably at least one but less than ten conserved amino acid residues) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as an IgG Fc fusion region peptide or leader or secretory sequence or a sequence which is employed for purification of the mature polypeptide or a proprotein
  • the TRIO receptor of the present invention may include one or more amino acid substitutions, deletions, or additions, either from natural mutations or human manipulation.
  • changes are preferably of a minor nature, such as conservative amino acid substitutions that do not significantly affect the folding or activity of the protein (see Table 1).
  • Amino acids in the TRIO protein of the present invention that are essential for function can be identified by methods known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science 244:1081-1085 (1989)). The latter procedure introduces single alanine mutations at every residue in the molecule. The resulting mutant molecules are then tested for biological activity such as receptor binding or in vitro proliferative activity. Sites that are critical for ligand-receptor binding can also be determined by structural analysis such as crystallization, nuclear magnetic resonance or photoaffinity labeling (Smith et al, J. Mol Biol. 224:899-904 (1992) and de Vos et al.
  • polypeptides of the present invention are preferably provided in an isolated form.
  • isolated polypeptide is intended a polypeptide removed from its native environment.
  • a polypeptide produced and/or contained within a recombinant host cell is considered isolated for purposes of the present invention.
  • polypeptides that have been purified, partially or substantially, from a recombinant host cell are polypeptides that have been purified, partially or substantially, from a recombinant host cell.
  • a recombinantly produced version of the TRIO polypeptide can be substantially purified by the one-step method described in Smith and Johnson, Gene (57:3 . 1-40 (1988).
  • polypeptides of the present invention include the polypeptide encoded by the deposited cDNA including the leader; the mature polypeptide encoded by the deposited cDNA minus the leader (i.e., the mature protein); a polypeptide comprising amino acids about - 55 to about 331 in SEQ ID NO:2; a polypeptide comprising amino acids about - 54 to about 331 in SEQ ID NO:2; a polypeptide comprising amino acids about 1 to about 331 in SEQ ID NO:2; a polypeptide comprising the extracellular domain; a polypeptide comprising the transmembrane domain; a polypeptide comprising the intracellular domain; a polypeptide comprising the extracellular and intracellular domains with all or part of the transmembrane domain deleted; and a polypeptide comprising the partial death domain; as well as polypeptides which are at least 80% identical, more preferably at least 90% or 95% identical, still more preferably at least 96%, 97%, 98%, or 99% identical to
  • a polypeptide having an amino acid sequence at least, for example, 95% "identical" to a reference amino acid sequence of a TRIO polypeptide is intended that the amino acid sequence of the polypeptide is identical to the reference sequence except that the polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the reference amino acid of the TRIO receptor.
  • up to 5% of the amino acid residues in the reference sequence may be deleted or substituted with another amino acid, or a number of amino acids up to 5% of the total amino acid residues in the reference sequence may be inserted into the reference sequence.
  • alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.
  • whether any particular polypeptide is at least 90%, 95%,
  • the parameters are set, of course, such that the percentage of identity is calculated over the full length of the reference amino acid sequence and that gaps in homology of up to 5% of the total number of amino acid residues in the reference sequence are allowed.
  • N-terminal deletions of the TRIO polypeptide can be described by the general formula m-157, where m is a number from 1-156, corresponding to the position of amino acid identified in SEQ ID NO:2.
  • N-terminal deletions of the TRIO polypeptide of the invention shown as SEQ ID NO: 2 include polypeptides comprising the amino acid sequence of residues: T-2 to Y-157; 1-3 to Y-157; P-4 to Y-157; R-5 to Y-157; Q-6 to Y-157; D-7 to Y-157; E-8 to Y-157; V-9 to Y-157; P-10 to Y-157; Q-11 to Y-157; Q-12 to Y-157; T-13 to Y-157; V-14 to Y-157; A-15 to Y-157; P-16 to Y-157; Q-17 to Y-157; Q-18 to Y-157; Q-19 to Y-157; R-20 to Y-157; R-21 to Y-157; S-22 to Y-157; L-23 to Y-157; K-24 to Y-157; E-25 to Y-157; E-26 to Y-157; E-27 to Y-157; C
  • C-terminal deletions of the TRIO polypeptide can also be described by the general formula 1-n, where n is a number from 2-156, corresponding to the position of amino acid identified in SEQ ID NO:2.
  • C-terminal deletions of the TRIO polypeptide of the invention shown as SEQ ID NO: 2 include polypeptides comprising the amino acid sequence of residues: A-l to H-156; A-l to Y-155; A-l to P-154; A-l to S-153; A-l to A-152; A-l to L- 151; A-l to M-150; A-l to G-149; A-l to L-148; A-l to 1-147; A-l to T-146; A-l to T-145; A- 1 to V-144; A-l to T-143; A-l to E-142; A-l to E-141; A-l to A-140; A-l to A-139; A-l to P- 138; A-l to
  • any of the above listed N- or C-terminal deletions can be combined to produce a N- and C-terminal deleted TRIO polypeptide.
  • the invention also provides polypeptides having one or more amino acids deleted from both the amino and the carboxyl termini, which may be described generally as having residues n-m of SEQ ID NO:2, where n and m are integers as described above.
  • polypeptide of the present invention could be used as a molecular weight marker on SDS-PAGE gels or on molecular sieve gel filtration columns using methods well known to those of skill in the art.
  • the invention provides a peptide or polypeptide comprising an epitope-bearing portion of a polypeptide of the invention.
  • the epitope of this polypeptide portion is an immunogenic or antigenic epitope of a polypeptide described herein.
  • An "immunogenic epitope” is defined as a part of a protein that elicits an antibody response when the whole protein is the immunogen.
  • a region of a protein molecule to which an antibody can bind is defined as an "antigenic epitope.”
  • the number of immunogenic epitopes of a protein generally is less than the number of antigenic epitopes. See, for instance, Geysen et al, Proc. Natl. Acad. Sci. USA 57:3998- 4002 (1983).
  • peptides or polypeptides bearing an antigenic epitope i.e., that contain a region of a protein molecule to which an antibody can bind
  • relatively short synthetic peptides that mimic part of a protein sequence are routinely capable of eliciting an antiserum that reacts with the partially mimicked protein. See, for instance, J.G. Sutcliffe et al, "Antibodies That React With Predetermined Sites on Proteins, " Science 219:660-666 (1983).
  • Peptides capable of eliciting protein-reactive sera are frequently represented in the primary sequence of a protein, can be characterized by a set of simple chemical rules, and are confined neither to immunodominant regions of intact proteins (i.e., immunogenic epitopes) nor to the amino or carboxyl terminals.
  • Antigenic epitope-bearing peptides and polypeptides of the invention are therefore useful to raise antibodies, including monoclonal antibodies, that bind specifically to a polypeptide of the invention. See, for instance, Wilson et al, Cell 37:161-11% (1984) at 777.
  • Antigenic epitope-bearing peptides and polypeptides of the invention preferably contain a sequence of at least seven, more preferably at least nine, and most preferably between at least about 15 to about 30 amino acids contained within the amino acid sequence of a polypeptide of the invention.
  • Non-limiting examples of antigenic polypeptides or peptides that can be used to generate TRIO receptor-specific antibodies include: a polypeptide comprising amino acid residues from about 57 to about 113 in Figure 1 (2 to 58 in SEQ ID NO:2); a polypeptide comprising amino acid residues from about 130 to about 197 in Figure 1 (75 to 142 in SEQ ID NO:2); and a polypeptide comprising amino acid residues from about 250 to about 283 in Figure 1 (195 to 228 in SEQ ID NO:2).
  • the inventors have determined that the above polypeptide fragments are antigenic regions of the TRIO receptor protein.
  • the epitope-bearing peptides and polypeptides of the invention may be produced by any conventional means.
  • R.A. Houghten "General Method for the Rapid Solid-phase Synthesis of Large Numbers of Peptides: Specificity of Antigen- Antibody Interaction at the Level of Individual Amino Acids," Proc. Natl. Acad. Sci. USA 52:5131-5135 (1985).
  • SMPS Simultaneous Multiple Peptide Synthesis
  • TRIO receptor polypeptides of the present invention and the epitope-bearing fragments thereof, described above can be combined with parts of the constant domain of immunoglobulins (IgG), resulting in chimeric polypeptides.
  • IgG immunoglobulins
  • These fusion proteins facilitate purification and show an increased half-life in vivo. This has been shown, e.g., for chimeric proteins consisting of the first two domains of the human CD4-polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins (EPA 394,827; Traunecker et al, Nature 557:84- 86 (1988)).
  • Fusion proteins that have a disulfide-linked dimeric structure due to the IgG part can also be more efficient in binding and neutralizing other molecules than the monomeric TRIO protein or protein fragment alone (Fountoulakis et al, J. Biochem. 270:3958-3964 (1995)).
  • the present invention also relates to diagnostic assays such as quantitative and diagnostic assays for detecting levels of TRIO receptor protein, or the soluble form thereof, in cells and tissues, including determination of normal and abnormal levels.
  • diagnostic assays such as quantitative and diagnostic assays for detecting levels of TRIO receptor protein, or the soluble form thereof, in cells and tissues, including determination of normal and abnormal levels.
  • a diagnostic assay in accordance with the invention for detecting over-expression of TRIO, or soluble form thereof, compared to normal control tissue samples may be used to detect the presence of tumors, for example.
  • Assay techniques that can be used to determine levels of a protein, such as a TRIO protein of the present invention, or a soluble form thereof, in a sample derived from a host are well-known to those of skill in the art.
  • Such assay methods include radioimmunoassays, competitive- binding assays, Western Blot analysis and ELISA assays.
  • Assaying TRIO protein levels in a biological sample can occur using any art- known method.
  • biological sample is intended any biological sample obtained from an individual, cell line, tissue culture, or other source containing TRIO receptor protein or mRNA.
  • Preferred for assaying TRIO protein levels in a biological sample are antibody-based techniques.
  • TRIO protein expression in tissues can be studied with classical immunohistological methods. (M. Jalkanen et al, J. Cell. Biol. 707/976-985 (1985); M. Jalkanen et al, J. Cell. Biol. 705:3087-3096 (1987)).
  • Other antibody -based methods useful for detecting TRIO receptor gene expression include immunoassays, such as the enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay (RIA).
  • Suitable labels are known in the art and include enzyme labels, such as glucose oxidase, radioisotopes, such as iodine ( 125 I, l2l I), carbon ( l4 C), sulphur ( 5 S), tritium ( 3 H), indium ( l l 2 In), and technetium ( 99m Tc), and fluorescent labels, such as fluorescein and rhodamine, and biotin.
  • enzyme labels such as glucose oxidase, radioisotopes, such as iodine ( 125 I, l2l I), carbon ( l4 C), sulphur ( 5 S), tritium ( 3 H), indium ( l l 2 In), and technetium ( 99m Tc)
  • fluorescent labels such as fluorescein and rhodamine, and biotin.
  • TNF Tumor Necrosis Factor family ligands
  • TNF Tumor Necrosis Factor family ligands
  • cytotoxicity including cytotoxicity, anti-viral activity, immunoregulatory activities, and the transcriptional regulation of several genes
  • D.V. Goeddel et al "Tumor Necrosis Factors: Gene Structure and Biological Activities," Symp. Quant. Biol. 51:591- 609 (1986), Cold Spring Harbor; B. Beutler and A. Cerami, Annu. Rev. Biochem. 57:505-518 (1988); L.J. Old, Sci. Am. 258:59-15 (1988); W. Fiers, FEBS Lett.
  • the TNF-family ligands induce such various cellular responses by binding to TNF- family receptors, including the TRIO of the present invention.
  • Cells which express the TRIO polypeptide and are believed to have a potent cellular response to TRIO ligands include fetal liver, PBL, lung, kidney, small intestine, colon, keratinocytes, endothelial cells, and monocyte activated tissue.
  • a cellular response to a TNF-family ligand is intended any genotypic, phenotypic, and/or morphologic change to a cell, cell line, tissue, tissue culture or patient that is induced by a TNF-family ligand.
  • Such cellular responses include not only normal physiological responses to TNF-family ligands, but also diseases associated with increased apoptosis or the inhibition of apoptosis.
  • Apoptosis-programmed cell death-is a physiological mechanism involved in the deletion of peripheral T lymphocytes of the immune system, and its dysregulation can lead to a number of different pathogenic processes (J.C. Ameisen, A7DS 5: 1197- 1213 (1994); P.H. Krammer et al, Curr. Opin. Immunol. 6:279-289 (1994)).
  • cancers such as follicular lymphomas, carcinomas with p53 mutations, and hormone-dependent tumors, such as breast cancer, prostrate cancer, Kaposi's sarcoma and ovarian cancer
  • autoimmune disorders such as systemic lupus erythematosus and immune-related glomerulonephritis rheumatoid arthritis
  • viral infections such as herpes viruses, pox viruses and adenoviruses
  • inflammation graft vs. host disease
  • acute graft rejection and chronic graft rejection such as herpes viruses, pox viruses and adenoviruses
  • AIDS dementia
  • neurodegenerative disorders such as Alzheimer's disease, Parkinson's disease, Amyotrophic lateral sclerosis, Retinitis pigmentosa, Cerebellar degeneration
  • myelodysplastic syndromes such as aplastic anemia
  • ischemic injury such as that caused by myocardial infarction, stroke and reperfusion injury
  • toxin- induced liver disease such as that caused by alcohol
  • septic shock cachexia and anorexia.
  • the present invention is directed to a method for enhancing apoptosis induced by a TNF-family ligand, which involves administering to a cell which expresses the TRIO polypeptide an effective amount of TRIO ligand, analog or an agonist capable of increasing TRIO mediated signaling.
  • TRIO mediated signaling is increased to treat a disease wherein decreased apoptosis or decreased cytokine and adhesion molecule expression is exhibited.
  • An agonist can include soluble forms of TRIO and monoclonal antibodies directed against the TRIO polypeptide.
  • the present invention is directed to a method for inhibiting apoptosis induced by a TNF-family ligand, which involves administering to a cell which expresses the TRIO polypeptide an effective amount of an antagonist capable of decreasing TRIO mediated signaling.
  • TRIO mediated signaling is decreased to treat a disease wherein increased apoptosis or NFkB expression is exhibited.
  • An antagonist can include soluble forms of TRIO and monoclonal antibodies directed against the TRIO polypeptide.
  • agonist is intended naturally occurring and synthetic compounds capable of enhancing or potentiating apoptosis.
  • antagonist is intended naturally occurring and synthetic compounds capable of inhibiting apoptosis. Whether any candidate
  • agonist or antagonist of the present invention can enhance or inhibit apoptosis can be determined using art-known TNF-family ligand/receptor cellular response assays, including those described in more detail below.
  • One such screening procedure involves the use of melanophores which are transfected to express the receptor of the present invention.
  • a screening technique is described in PCT WO 92/01810, published February 6, 1992.
  • Such an assay may be employed, for example, for screening for a compound which inhibits (or enhances) activation of the receptor polypeptide of the present invention by contacting the melanophore cells which encode the receptor with both a TNF-family ligand and the candidate antagonist (or agonist). Inhibition or enhancement of the signal generated by the ligand indicates that the compound is an antagonist or agonist of the ligand/receptor signaling pathway.
  • Other screening techniques include the use of cells which express the receptor (for example, transfected CHO cells) in a system which measures extracellular pH changes caused by receptor activation.
  • compounds may be contacted with a cell which expresses the receptor polypeptide of the present invention and a second messenger response, e.g., signal transduction or pH changes, may be measured to determine whether the potential compound activates or inhibits the receptor.
  • a second messenger response e.g., signal transduction or pH changes
  • Another such screening technique involves introducing RNA encoding the receptor into Xenopus oocytes to transiently express the receptor.
  • the receptor oocytes may then be contacted with the receptor ligand and a compound to be screened, followed by detection of inhibition or activation of a calcium signal in the case of screening for compounds which are thought to inhibit activation of the receptor.
  • Another screening technique well known in the art involves expressing in cells a construct wherein the receptor is linked to a phospholipase C or D.
  • Exemplary cells include endothelial cells, smooth muscle cells, embryonic kidney cells, etc.
  • the screening may be accomplished as hereinabove described by detecting activation of the receptor or inhibition of activation of the receptor from the phospholipase signal.
  • Another method involves screening for compounds which inhibit activation of the receptor polypeptide of the present invention antagonists by determining inhibition of binding of labeled ligand to cells which have the receptor on the surface thereof.
  • Such a method involves transfecting a eukaryotic cell with DNA encoding the receptor such that the cell expresses the receptor on its surface and contacting the cell with a compound in the presence of a labeled form of a known ligand.
  • the ligand can be labeled, e.g., by radioactivity.
  • the amount of labeled ligand bound to the receptors is measured, e.g., by measuring radioactivity of the receptors. If the compound binds to the receptor as determined by a reduction of labeled ligand which binds to the receptors, the binding of labeled ligand to the receptor is inhibited.
  • a screening method for determining whether a candidate agonist or antagonist is capable of enhancing or inhibiting a cellular response to a TNF-family ligand.
  • the method involves contacting cells which express the TRIO polypeptide with a candidate compound and a TNF-family ligand, assaying a cellular response, and comparing the cellular response to a standard cellular response, the standard being assayed when contact is made with the ligand in absence of the candidate compound, whereby an increased cellular response over the standard indicates that the candidate compound is an agonist of the ligand/receptor signaling pathway and a decreased cellular response compared to the standard indicates that the candidate compound is an antagonist of the ligand/receptor signaling pathway.
  • saying a cellular response is intended qualitatively or quantitatively measuring a cellular response to a candidate compound and/or a TNF-family ligand (e.g., determining or estimating an increase or decrease in T cell proliferation or tritiated thymidine labeling).
  • a cell expressing the TRIO polypeptide can be contacted with either an endogenous or exogenously administered TNF-family ligand.
  • Antagonist according to the present invention include naturally occurring and synthetic compounds such as, for example, TNF family ligand peptide fragments, transforming growth factor, neurotransmitters (such as glutamate, dopamine, N- methyl-D-aspartate), tumor suppressors (p53), cytolytic T cells and antimetabolites.
  • Preferred agonists include chemo therapeutic drugs such as, for example, cisplatin, doxorubicin, bleomycin, cytosine arabinoside, nitrogen mustard, methotrexate and vincristine. Others include ethanol and -amyloid peptide. (Science 267:1457-1458 (1995)).
  • agonists include polyclonal and monoclonal antibodies raised against the TRIO polypeptide, or a fragment thereof.
  • Such agonist antibodies raised against a T ⁇ F-family receptor are disclosed in L.A. Tartaglia et al, Proc. Natl. Acad. Sci. USA 55:9292-9296 (1991); and L.A.Tartaglia and DN.Goeddel, J. Biol. Chem. 267:4304- 4307(1992). See, also, PCT Application WO 94/09137.
  • Agonists according to the present invention include naturally occurring and synthetic compounds such as, for example, the CD40 ligand, neutral amino acids, zinc, estrogen, androgens, viral genes (such as Adenovirus ElB, Baculovirus p35 and IAP, Cowpox virus crmA, Epstein-Barr virus BHRF1, LMP-1, African swine fever virus LMW5-HL, and Herpesvirus yl 34.5), calpain inhibitors, cysteine protease inhibitors, and tumor promoters (such as PMA, Phenobarbital, and -Hexachlorocyclohexane).
  • viral genes such as Adenovirus ElB, Baculovirus p35 and IAP, Cowpox virus crmA, Epstein-Barr virus BHRF1, LMP-1, African swine fever virus LMW5-HL, and Herpesvirus yl 34.5
  • calpain inhibitors such as cysteine protease inhibitors
  • Antisense technology can be used to control gene expression through antisense D ⁇ A or R ⁇ A or through triple-helix formation.
  • Antisense techniques are discussed, for example, in Okano, J. Neurochem. 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988).
  • Triple helix formation is discussed in, for instance Lee et al, Nucleic Acids Research 10-1513 (1979); Cooney et al, Science 247:456 (1988); and Dervan et al, Science 251:1360 (1991).
  • the methods are based on binding of a polynucleotide to a complementary DNA or RNA.
  • the 5' coding portion of a polynucleotide that encodes the mature polypeptide of the present invention may be used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length.
  • a DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription thereby preventing transcription and the production of the receptor.
  • the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into receptor polypeptide.
  • the oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of the receptor.
  • An agonists according to the present invention include soluble forms of TRIO, i.e., TRIO fragments that include the ligand binding domain from the extracellular region of the full length receptor.
  • TRIO soluble forms of TRIO
  • Such soluble forms of the receptor which may be naturally occurring or synthetic, antagonize TRIO mediated signaling by competing with the cell surface TRIO for binding to TNF-family ligands.
  • soluble TRIO may bind to apoptosis inducing ligands such as TRAIL and more effectively compete for TRAIL binding reducing the available TRAIL for binding to receptors with functional death domains.
  • soluble forms of the receptor that include the ligand binding domain are novel cytokines capable of inhibiting apoptosis induced by TNF- family ligands.
  • Fas B a soluble form of the mouse Fas receptor
  • Fas ligand D.P. Hughes and I.N. Crispe, /. Exp. Med. 752:1395-1401 (1995)
  • antibody or “monoclonal antibody” (mAb) as used herein is meant to include intact molecules as well as fragments thereof (such as, e.g., Fab and F(ab') 2 fragments) which are capable of binding an antigen.
  • Fab and F(ab') 2 fragments lack the Fc fragment of intact antibody, clear more rapidly from the circulation, and may have less non-specific tissue binding of an intact antibody (Wahl et al, J. Nucl. Med. 24:316-325 (1983)).
  • Antibodies according to the present invention may be prepared by any of a variety of methods using TRIO immunogens of the present invention.
  • TRIO immunogens include the full length TRIO polypeptide (which may or may not include the leader sequence) and TRIO polypeptide fragments such as the ligand binding domain, the transmembrane domain, the intracellular domain and the incomplete death domain.
  • Proteins and other compounds which bind the TRIO domains are also candidate agonists and antagonists according to the present invention.
  • Such binding compounds can be "captured” using the yeast two-hybrid system (Fields and Song, Nature 540:245-246 (1989)).
  • a modified version of the yeast two- hybrid system has been described by Roger Brent and his colleagues (J. Gyuris, Cell 75:791-803 (1993); A.S. Zervos et al, Cell 72:223-232 (1993)).
  • the yeast two-hybrid system is used according to the present invention to capture compounds which bind to either the TRIO ligand binding domain or to the TRIO intracellular domain.
  • Such compounds are good candidate agonists and antagonists of the present invention.
  • TNF-family ligand is intended naturally occurring, recombinant, and synthetic ligands that are capable of binding to a member of the TNF receptor family and inducing the ligand/receptor signaling pathway.
  • TNF ligand family include, but are not limited to TRIO ligands including TRAIL, TNF- ⁇ , lymphotoxin- ⁇ (LT- ⁇ , also known as TNF- ⁇ ), LT- ⁇ (found in complex heterotrimer LT- ⁇ 2- ⁇ ), FasL, CD40, CD27, CD30, 4-1BB, OX40, and nerve growth factor (NGF).
  • apoptosis and CD4 + T-lymphocyte depletion is tightly correlated in different animal models of AIDS (T. Brunner et al, Nature 373:441-444 (1995); M.L. Gougeon et al, AIDS Res. Hum. Retroviruses 9:553-563 (1993)) and, apoptosis is not observed in those animal models in which viral replication does not result in AIDS. Id. Further data indicates that uninfected but primed or activated T lymphocytes from HIV-infected individuals undergo apoptosis after encountering the TNF-family ligand FasL.
  • the immune system of the recipient animal In rejection of an allograft, the immune system of the recipient animal has not previously been primed to respond because the immune system for the most part is only primed by environmental antigens. Tissues from other members of the same species have not been presented in the same way that, for example, viruses and bacteria have been presented.
  • immunosuppressive regimens are designed to prevent the immune system from reaching the effector stage.
  • the immune profile of xenograft rejection may resemble disease recurrence more that allograft rejection.
  • the immune system In the case of disease recurrence, the immune system has already been activated, as evidenced by destruction of the native islet cells. Therefore, in disease recurrence, the immune system is already at the effector stage.
  • Antagonists of the present invention are able to suppress the immune response to both allografts and xenografts because lymphocytes activated and differentiated into effector cells will express the TRIO polypeptide, and thereby are susceptible to compounds which enhance apoptosis.
  • the present invention further provides a method for creating immune privileged tissues.
  • TRIO antagonists of the invention can further be used in the treatment of inflammatory diseases, such as inflammatory bowel disease, rheumatoid arthritis, osteoarthritis, psoriasis, and septicemia.
  • inflammatory diseases such as inflammatory bowel disease, rheumatoid arthritis, osteoarthritis, psoriasis, and septicemia.
  • TRIO due to lymphoblast expression of TRIO, soluble TRIO agonist or antagonist mABs may be used to treat this form of cancer.
  • the agonist or antagonists described herein can be administered in vitro, ex vivo, or in vivo to cells which express the receptor of the present invention.
  • administration of an "effective amount" of an agonist or antagonist is intended an amount of the compound that is sufficient to enhance or inhibit a cellular response to a TNF-family ligand and include polypeptides.
  • administration of an "effective amount” of an agonist or antagonists is intended an amount effective to enhance or inhibit TRIO mediated apoptosis.
  • an agonist according to the present invention can be co- administered with a TNF-family ligand.
  • an agonist or antagonist can be determined empirically and may be employed in pure form or in pharmaceutically acceptable salt, ester or prodrug form.
  • the agonist or antagonist may be administered in compositions in combination with one or more pharmaceutically acceptable excipients. It will be understood that, when administered to a human patient, the total daily usage of the compounds and compositions of the present invention will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular patient will depend upon factors well known in the medical arts.
  • the total pharmaceutically effective amount of TRIO polypeptide administered parenterally per dose will be in the range of about 1 g/kg/day to 10 mg/kg/day of patient body weight, although, as noted above, this will be subject to therapeutic discretion. More preferably, this dose is at least 0.01 mg/kg/day, and most preferably for humans between about 0.01 and 1 mg/kg/day for the hormone.
  • the TRIO polypeptide is typically administered at a dose rate of about 1 g/kg/hour to about 50 g/kg/hour, either by 1-4 injections per day or by continuous subcutaneous infusions, for example, using a mini-pump. An intravenous bag solution may also be employed.
  • Dosaging may also be arranged in a patient specific manner to provide a predetermined concentration of an agonist or antagonist in the blood, as determined by the RIA technique.
  • patient dosaging may be adjusted to achieve regular on-going trough blood levels, as measured by RIA, on the order of from 50 to 1000 ng/ml, preferably 150 to 500 ng/ml.
  • compositions containing the TRIO polypeptide of the invention may be administered orally, rectally, parenterally, intracistemally, intravaginally, intraperitoneally, topically (as by powders, ointments, drops or transdermal patch), bucally, or as an oral or nasal spray.
  • pharmaceutically acceptable carrier is meant a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.
  • parenteral refers to modes of administration which include intravenous, intramuscular, intraperitoneal, intrastemal, subcutaneous and intraarticular injection and infusion.
  • compositions of the present invention for parenteral injection can comprise pharmaceutically acceptable sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions as well as sterile powders for reconstitution into sterile injectable solutions or dispersions just prior to use.
  • TRIO polypeptides containing the transmembrane region can also be used when appropriately solubilized by including detergents, such as CHAPS or NP-40, with buffer.
  • the nucleic acid molecules of the present invention are also valuable for chromosome identification.
  • the sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome.
  • the mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with disease.
  • the cDNA herein disclosed is used to clone genomic DNA of a TRIO receptor gene. This can be accomplished using a variety of well known techniques and libraries, which generally are available commercially. The genomic DNA is then used for in situ chromosome mapping using well known techniques for this purpose.
  • sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis of the 3' untranslated region of the gene is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes.
  • Fluorescence in situ hybridization of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step.
  • This technique can be used with cDNA as short as 50 or 60 bp.
  • Verma et al Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).
  • the bacterial expression vector pQE60 is used for bacterial expression in this example. (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 9131 1). pQE60 encodes ampicillin antibiotic resistance ("Amp r ”) and contains a bacterial origin of replication ("ori"), an IPTG inducible promoter, a ribosome binding site (“RBS”), six codons encoding histidine residues that allow affinity purification using nickel-nitrilo- tri-acetic acid (“Ni-NTA”) affinity resin sold by QIAGEN, Inc., supra, and suitable single restriction enzyme cleavage sites.
  • a DNA fragment encoding a polypeptide may be inserted in such as way as to produce that polypeptide with the six His residues (i.e., a "6 X His tag") covalently linked to the carboxyl terminus of that polypeptide.
  • the polypeptide coding sequence is inserted such that translation of the six His codons is prevented and, therefore, the polypeptide is produced with no 6 X His tag.
  • the DNA sequence encoding the desired portion of the TRIO protein lacking the hydrophobic leader sequence is amplified from the deposited cDNA clone using PCR oligonucleotide primers which anneal to the amino terminal sequences of the desired portion of the TRIO protein and to sequences in the deposited construct 3' to the cDNA coding sequence. Additional nucleotides containing restriction sites to facilitate cloning in the pQE60 vector are added to the 5' and 3' sequences, respectively.
  • the 5' primer has the sequence: 5'-CGCCCATGGCCACCATCCCCCGGCAG-3' (SEQ ID NO: 10) containing the underlined Ncol restriction site followed by nucleotides complementary to the amino terminal coding sequence of the mature TRIO sequence in Figure 1.
  • SEQ ID NO: 10 the sequence: 5'-CGCCCATGGCCACCATCCCCCGGCAG-3' (SEQ ID NO: 10) containing the underlined Ncol restriction site followed by nucleotides complementary to the amino terminal coding sequence of the mature TRIO sequence in Figure 1.
  • the point in the protein coding sequence where the 5' primer begins may be varied to amplify a desired portion of the complete protein shorter or longer than the mature form.
  • the 3' primer has the sequence: 5'-CGCAAGCTTTTAGTAGTGATAGGGAGAGGC-3' (SEQ ID NO: l 1) containing the underlined Hindlll site followed by nucleotides complementary to the 3' end of the non-coding sequence in the TRIO DNA sequence in Figure 1.
  • the amplified TRIO DNA fragments and the vector pQE60 are digested with
  • E. coli strain M15/rep4 containing multiple copies of the plasmid pREP4, which expresses lac repressor and confers kanamycin resistance ("Kan r "), is used in carrying out the illustrative example described herein.
  • This strain which is only one of many that are suitable for expressing TRIO protein, is available commercially from Qiagen, Inc., supra. Transformants are identified by their ability to grow on LB plates in the presence of ampicillin and kanamycin. Plasmid DNA is isolated from resistant colonies and the identity of the cloned DNA confirmed by restriction analysis, PCR, and DNA sequencing.
  • Clones containing the desired constructs are grown overnight ("O/N") in liquid culture in LB media supplemented with both ampicillin (100 g/ml) and kanamycin (25 g/ml).
  • the O/N culture is used to inoculate a large culture, at a dilution of approximately 1:100 to 1:250.
  • the cells are grown to an optical density at 600nm ("OD600") of between 0.4 and 0.6.
  • Isopropyl-B-D-thiogalactopyranoside (“IPTG”) is then added to a final concentration of 1 mM to induce transcription from the lac repressor sensitive promoter, by inactivating the lad repressor.
  • Cells subsequently are incubated further for 3 to 4 hours. Cells then are harvested by centrifugation.
  • the cells are then stirred for 3-4 hours at 4°C in 6M guanidine-HCl, pH8.
  • the cell debris is removed by centrifugation, and the supernatant containing the TRIO is loaded onto a nickel-nitrilo-tri-acetic acid (“NiNTA”) affinity resin column (available from QIAGEN, Inc., supra).
  • NiNTA nickel-nitrilo-tri-acetic acid
  • Proteins with a 6 x His tag bind to the NI-NTA resin with high affinity and can be purified in a simple one-step procedure (for details see: The QIAexpressionist, 1995, QIAGEN, Inc., supra).
  • the column is first washed with 10 volumes of 6 M guanidine-HCl, pH8, then washed with 10 volumes of 6 M guanidine- HCl pH6, and finally the TRIO is eluted with 6 M guanidine-HCl, pH5.
  • the purified protein is then renatured by dialyzing it against phosphatebuffered saline (PBS) or 50 mM Na-acetate, pH 6 buffer plus 200 mM NaCl.
  • PBS phosphatebuffered saline
  • 50 mM Na-acetate pH 6 buffer plus 200 mM NaCl.
  • the protein can be successfully refolded while immobilized on the Ni-NTA column.
  • the recommended conditions are as follows: renature using a linear 6M-1M urea gradient in 500 mM NaCl, 20% glycerol, 20 mM Tris/HCl pH7.4, containing protease inhibitors.
  • the renaturation should be performed over a period of 1.5 hours or more.
  • the proteins can be eluted by the addition of 250 mM immidazole.
  • Immidazole is removed by a final dialyzing step against PBS or 50 mM sodium acetate pH6 buffer plus 200 mM NaCl.
  • the purified protein is stored at 4°C or frozen at - 80°C.
  • the plasmid shuttle vector pA2 is used to insert the cloned DNA encoding the complete protein, including its naturally associated secretary signal (leader) sequence, into a baculovims to express the mature TRIO protein, using standard methods as described in Summers et al, A Manual of Methods for Baculovirus Vectors and Insect Cell Culture Procedures, Texas Agricultural Experimental Station Bulletin No. 1555 (1987).
  • This expression vector contains the strong polyhedrin promoter of the Autographa califomica nuclear polyhedrosis virus (AcMNPV) followed by convenient restriction sites such as BamHI and Asp718.
  • the polyadenylation site of the simian virus 40 (“SV40") is used for efficient polyadenylation.
  • the plasmid contains the beta-galactosidase gene from E. coli under control of a weak Drosophila promoter in the same orientation, followed by the polyadenylation signal of the polyhedrin gene.
  • the inserted genes are flanked on both sides by viral sequences for cell-mediated homologous recombination with wild-type viral DNA to generate viable virus that express the cloned polynucleotide.
  • baculovirus vectors could be used in place of the vector above, such as pAc373, pVL941 and pAcIMl, as one skilled in the art would readily appreciate, as long as the construct provides appropriately located signals for transcription, translation, secretion and the like, including a signal peptide and an in-frame AUG as required.
  • Such vectors are described, for instance, in Luckow et al, Virology 170:31- 39 ( 1989).
  • the cDNA sequence encoding the mature TRIO receptor protein in the deposited clone, lacking the AUG initiation codon and the naturally associated leader sequence shown in Figure 1 is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene.
  • the 5' primer has the sequence 5' CGCGGATCC GCCATCATGGGACTTTGGGGACAA 3' (SEQ ID NO: 12) containing the underlined BamHI restriction enzyme site, an efficient signal for initiation of translation in eukaryotic cells, as described by M. Kozak, J. Mol Biol 196:941- 950 (1987), followed by bases of the sequence of the mature TRIO protein shown in Figure 1, beginning with the indicated N-terminus of the mature protein.
  • the 3' primer for TRIO has the sequence 5' CGCGGTACCTTAGTAGTGATAGGGAGAGGC 3' (SEQ ID NO: 13) containing the underlined Asp718 restriction site followed by nucleotides complementary to the 3' noncoding sequence in Figure 1.
  • the amplified fragment is isolated from a 1 % agarose gel using a commercially available kit ("Geneclean, " BIO 101 Inc., La Jolla, Ca.) The fragment then is digested with BamHI and Asp718 and again is purified on a 1% agarose gel. This fragment is designated “FI .”
  • the plasmid is digested with the restriction enzyme Bam HI and optionally can be dephosphorylated using calf intestinal phosphatase, using routine procedures known in the art.
  • the DNA is then isolated from a 1 % agarose gel using a commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.).
  • the vector DNA is designated herein "VI .”
  • E. coli HB lOl or other suitable E. coli hosts such as XL-1 Blue (Stratagene Cloning Systems, La Jolla, CA) cells are transformed with the ligation mixture and spread on culture plates.
  • Bacteria are identified that contain the plasmid with the human TRIO gene using the PCR method, in which one of the primers that is used to amplify the gene and the second primer is from well within the vector so that only those bacterial colonies containing the TRIO gene fragment will show amplification of the DNA. The sequence of the cloned fragment is confirmed by DNA sequencing.
  • This plasmid is designated herein pBacTRlO.
  • Five g of the plasmid pBacTRlO is co-transfected with 1.0 g of a commercially available linearized baculovirus DNA ("BaculoGoldTM baculovirus DNA", Pharmingen, San Diego, CA.), using the lipofectin method described by Feigner et al, Proc. Natl. Acad. Sci. USA 54:7413-7417 (1987).
  • 1 g of BaculoGoldTM virus DNA and 5 g of the plasmid pBacTRlO are mixed in a sterile well of a microliter plate containing 50 1 of serum free Grace's medium (Life Technologies, Inc., Rockville, MD).
  • plaque assay After four days, the supernatant is collected and a plaque assay is performed, as described by Summers and Smith, cited above.
  • An agarose gel with "Blue Gal” (Life Technologies, Inc., Rockville, MD) is used to allow easy identification and isolation of gal-expressing clones, which produce blue-stained plaques.
  • a detailed description of a "plaque assay” of this type can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies, Inc., Rockville, MD, pages 9- 10). After appropriate incubation, blue stained plaques are picked with the tip of a micropipettor (e.g., Eppendorf).
  • the agar containing the recombinant viruses is then resuspended in a microcentrifuge tube containing 200 1 of Grace's medium and the suspension containing the recombinant baculovirus is used to infect Sf9 cells seeded in 35 mm dishes. Four days later the supernatants of these culture dishes are harvested and then they are stored at 4°C The recombinant virus is called V-TR10.
  • Sf9 cells are grown in Grace's medium supplemented with 10% heat inactivated FBS. The cells are infected with the recombinant baculovirus V-TR10 at a multiplicity of infection ("MOI") of about 2.
  • MOI multiplicity of infection
  • SF900 II medium minus methionine and cysteine available from Life Technologies, Inc., Rockville, MD. If radiolabeled proteins are desired, 42 hours later, 5 Ci of 35 S -methionine and 5 Ci 35 S- cysteine (available from Amersham) are added. The cells are further incubated for 16 hours and then they are harvested by centrifugation. The proteins in the supernatant as well as the intracellular proteins are analyzed by SDS-PAGE followed by autoradiography (if radiolabeled). Microsequencing of the amino acid sequence of the amino terminus of purified protein may be used to determine the amino terminal sequence of the mature protein and thus the cleavage point and length of the secretory signal peptide.
  • a typical mammalian expression vector contains the promoter element, which mediates the initiation of transcription of mRNA, the protein coding sequence, and signals required for the termination of transcription and polyadenylation of the transcript. Additional elements include enhancers, Kozak sequences and intervening sequences flanked by donor and acceptor sites for RNA splicing. Highly efficient transcription can be achieved with the early and late promoters from SV40, the long terminal repeats (LTRs) from Retroviruses, e.g. RSV, HTLVI, HIVI and the early promoter of the cytomegalovirus (CMV). However, cellular signals can also be used (e.g., the human actin promoter).
  • Suitable expression vectors for use in practicing the present invention include, for example, vectors such as pSVL and pMSG (Pharmacia, Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2dhfr (ATCC 37146) and pBC12MI (ATCC 67109).
  • Mammalian host cells that could be used include, human Hela 293, H9 and Jurkat cells, mouse NIH3T3 and C127 cells, Cos 1, Cos 7 and CV1, quail QC1-3 cells, mouse L cells, and Chinese hamster ovary (CHO) cells.
  • the gene can be expressed in stable cell lines that contain the gene integrated into a chromosome. Co-transfection with a selectable marker such as dhfr, gpt, neomycin, or hygromycin allows the identification and isolation of the transfected cells.
  • the transfected gene can also be amplified to express large amounts of the encoded protein.
  • the dihydrofolate reductase (DHFR) marker is useful to develop cell lines that carry several hundred or even several thousand copies of the gene of interest.
  • Another useful selection marker is the enzyme glutamine synthase (GS) (Murphy et al, Biochem. J. 227:211-219 (1991); Bebbington et al, Bio/Technology 70: 169-175 (1992)). Using these markers, the mammalian cells are grown in selective medium and the cells with the highest resistance selected. These cell lines contain the amplified gene(s) integrated into a chromosome. Chinese hamster ovary (CHO) cells are often used for the production of proteins.
  • the expression vectors pCl and pC4 contain the strong promoter (LTR) of the Rous Sarcoma Virus (Cullen et al, Molecular and Cellular Biology 5:438- 447 (March 1985)), plus a fragment of the CMV-enhancer (Boshart et al, Cell 47:521-530 (1985)). Multiple cloning sites, e.g., with the restriction enzyme cleavage sites BamHI, Xbal and Asp718, facilitate the cloning of the gene of interest.
  • the vectors contain in addition the 3' intron, the polyadenylation and termination signal of the rat preproinsulin gene.
  • the expression plasmid, pTRlO-HA is made by cloning a cDNA encoding TRIO into the expression vector pcDNAI/Amp or pcDNAIII (which can be obtained from Invitrogen, Inc.).
  • the expression vector pcDNAI/amp contains: (1) an E. coli origin of replication effective for propagation in E.
  • coli and other prokaryotic cell (2) an ampicillin resistance gene for selection of plasmid-containing prokaryotic cells; (3) an SV40 origin of replication for propagation in eukaryotic cells; (4) a CMV promoter, a polylinker, an SV40 intron, and a polyadenylation signal arranged so that a cDNA conveniently can be placed under expression control of the CMV promoter and operably linked to the SV40 intron and the polyadenylation signal by means of restriction sites in the polylinker.
  • a DNA fragment encoding the entire TRIO precursor and a HA tag fused in frame to its 3' end is cloned into the polylinker region of the vector so that recombinant protein expression is directed by the CMV promoter.
  • the HA tag corresponds to an epitope derived from the influenza hemagglutinin protein described by Wilson et al,
  • the fusion of the HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
  • the plasmid construction strategy is as follows:
  • TRIO cDNA of the deposited clone is amplified using primers that contain convenient restriction sites, much as described above regarding the construction of expression vectors for expression of TRIO in E. coli..
  • HA tag hemagglutinin tag
  • the 5' primer contains the underlined BamHI site, an ATG start codon and 5 codons thereafter.
  • the 3' primer for TRIO which contains the underlined Xbal site, stop codon, hemagglutinin tag, and the last 19 nucleotides of the 3' coding sequence (at the 3' end), has the following sequence:
  • the PCR amplified DNA fragment and the vector, pcDNAI/Amp, are digested with BamHI and Xbal and then ligated.
  • the ligation mixture is transformed into E. coli strain SURE (available from Stratagene Cloning Systems, 11099 North Torrey Pines Road, La Jolla, CA 92037) the transformed culture is plated on ampicillin media plates which then are incubated to allow growth of ampicillin resistant colonies. Plasmid DNA is isolated from resistant colonies and examined by restriction analysis and gel sizing for the presence of the TRIO-encoding fragment.
  • COS cells are transfected with an expression vector, as described above, using DEAE-DEXTRAN, as described, for instance, in Sambrook et al, Molecular Cloning: a Laboratory Manual, Cold Spring Laboratory Press, Cold Spring Harbor, NY (1989). Cells are incubated under conditions for expression of TRIO by the vector.
  • TR10-HA fusion protein Expression of the TR10-HA fusion protein is detected by radiolabelling and immunoprecipitation, using methods described in, for example Harlow et al, Antibodies: a Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press,
  • the cells are labeled by incubation in media containing 3, S-cysteine for 8 hours.
  • the cells and the media are collected, and the cells are washed and then lysed with detergent-containing RIPA buffer: 150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM TRIS, pH 7.5, as described by Wilson et al. cited above.
  • Proteins are precipitated from the cell lysate and from the culture media using an HA-specific monoclonal antibody.
  • the precipitated proteins then are analyzed by SDS-PAGE gels and autoradiography.
  • Plasmid pC4 is used for the expression of the TRIO polypeptide.
  • Plasmid pC4 is a derivative of the plasmid pSV2-dhfr (ATCC Accession No. 37146).
  • the plasmid contains the mouse DHFR gene under control of the SV40 early promoter.
  • Chinese hamster ovary- or other cells lacking dihydrofolate activity that are transfected with these plasmids can be selected by growing the cells in a selective medium (alpha minus MEM, Life Technologies, Rockville, MD) supplemented with the chemotherapeutic agent methotrexate (MTX).
  • MTX methotrexate
  • Plasmid pC4 contains, for expressing the gene of interest, the strong promoter of the long terminal repeat (LTR) of the Rous Sarcoma Virus (Cullen et al, Molecular and Cellular Biology 5:438-447 (March 1985)), plus a fragment isolated from the enhancer of the immediate early gene of human cytomegalovirus (CMV) (Boshart et al, Cell 47:521-530 (1985)). Downstream of the promoter are the following single restriction enzyme cleavage sites that allow the integration of the genes: BamHI, Xbal, and Asp718. Behind these cloning sites, the plasmid contains the 3' intron and the polyadenylation site of the rat preproinsulin gene.
  • LTR long terminal repeat
  • CMV cytomegalovirus
  • High efficiency promoters can also be used for the expression, e.g., the human B-actin promoter, the SV40 early or late promoters or the long terminal repeats from other retroviruses, e.g., HIV and HTLVI.
  • Clontech' s Tet-Off and Tet-On gene expression systems and similar systems can be used to express the TRIO polypeptide in a regulated way in mammalian cells.
  • other signals e.g., from the human growth hormone or globin genes, can be used as well.
  • Stable cell lines carrying a gene of interest integrated into the chromosomes can also be selected upon co-transfection with a selectable marker such as gpt, G418, or hygromycin. It is advantageous to use more than one selectable marker in the beginning, e.g., G418 plus methotrexate.
  • the plasmid pC4 is digested with the restriction enzyme BamHI and then dephosphorylated using calf intestinal phosphates, by procedures known in the art.
  • the vector is then isolated from a 1% agarose gel.
  • the DNA sequence encoding the complete TRIO polypeptide is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the desired portion of the gene.
  • the 5' oligonucleotide primer for TRIO containing the underlined BamHI restriction site, a Kozak sequence, and an AUG start codon, has the sequence: 5' CGCGGATCCGCCATCATGGGACTTTGGGGACAA 3' (SEQ ID NO: 12).
  • the 3' primer for TRIO containing the underlined Asp718 restriction site, has the sequence: 5' CGCGGTACCTTAGTAGTGATAGGGAGAGGC 3' (SEQ ID NO: 13).
  • the amplified fragment is digested with BamHI and then purified again on a 1% ' agarose gel.
  • the isolated fragment and the dephosphorylated vector are then ligated with T4 DNA ligase.
  • E. coli HBlOl or XL-1 Blue cells are then transformed and bacteria are identified that contain the fragment inserted into plasmid pC4 using, for instance, restriction enzyme analysis.
  • Chinese hamster ovary cells lacking an active DHFR enzyme are used for transfection.
  • Five g of the expression plasmid pC4 are cotransfected with 0.5 g of the plasmid pSVneo using the lipofectin method (Feigner et al, supra).
  • the plasmid pSV2-neo contains a dominant selectable marker, the neo gene from Tn5 encoding an enzyme that confers resistance to a group of antibiotics including G418.
  • the cells are seeded in alpha minus MEM supplemented with 1 mg/ml G418.
  • the cells are trypsinized and seeded in hybridoma cloning plates (Greiner, Germany) in alpha minus MEM supplemented with 10, 25, or 50 ng/ml of MTX plus 1 mg/ml G418.
  • hybridoma cloning plates Gibcos, Germany
  • single clones are trypsinized and then seeded in 6-well petri dishes or 10 ml flasks using different concentrations of methotrexate (50 nM, 100 nM, 200 nM, 400 nM, 800nM). Clones growing at the highest concentrations of methotrexate are then transferred to new 6-well plates containing even higher concentrations of methotrexate ( 1 M, 2 M, 5 M, 10 M, 20 M). The same procedure is repeated until clones are obtained which grow at a concentration of 100- 200 M. Expression of the desired gene product is analyzed, for instance, by Western blot analysis and SDS-PAGE, or by reversed phase HPLC analysis.
  • Tissue distribution of TRIO mRNA expression was carried out to examine TRIO gene expression in human tissues, using methods described by, among others, Sambrook et al, cited above.
  • a cDNA probe containing the entire nucleotide sequence of the TRIO protein (SEQ ID NO: 1) was labeled with 32 P using the reJ ⁇ rimeTM DNA labeling system (Amersham Life Science), according to manufacturer's instructions. After labeling, the probe was purified using a CHROMA SPIN- 100 column (Clontech Laboratories, Inc.), according to manufacturer's protocol number PT1200-1. The purified labeled probe was then used to examine various human tissues for TRIO mRNA.
  • MTN Multiple Tissue Northern
  • H human tissues
  • IM human immune system tissues
  • CD 19+, CD4+ and CD8+ cells were isolated with cell type specific immunomagnetic beads (Drynal, Lake Success, NY).
  • RNA of adult tissues were purchased from Clonetech (Palo Alto, CA). Total RNA was extracted from cell lines (in exponential growth phase) and primary cells with TriReagent (Molecular Research Center, Inc., Cincinnati, OH). 5 to 7.5 g of total RNA was fractionated in a 1 % agarose gel containing formaldehyde cast in a Wide Mini-Sub Cell gel tray (Bio-Rad, Hercules, CA) as described (Sambrook, et al.) with slight modifications. The formaldehyde concentration was reduced to 0.5M and the RNA was stained prior to electrophoresis with 100 g/ml of etidium bromide that was added to the loading buffer.
  • cDNA inserts labeled with 32 P-dCTP by random priming (Stratagene, La Jolla, CA), were denatured with 0.25M NaOH (10 min at 37°C) and added to the prehybridization solution. After 24-65 hr at 42°C, the blots were washed under high stringency conditions (Sambrook, et al.) and exposed to X-ray films.
  • TRIO TRIO-induced adenocarcinoma
  • HL60 promyelocytic leukemia
  • Hela cell S3, K562 chronic myelogeneous leukemia
  • MOLT4 lymphoblast leukemia
  • Raji Burkitt's lymphoma
  • SW480 colonrectal adenocarcinoma
  • A549 lung carcinoma
  • G361 melanoma
  • TRIO Since the entire sequence of TRIO, especially its extracellular cysteine-rich domains, is highly homologous to that of other TRAIL receptors, the ability to TRAIL to bind TRIO and induce apoptosis was assessed.
  • TRIO amino acids 56-386
  • pCMV2FLAG IBI Kodak
  • the cDNA encoding the extracellular domain of TRIO was obtained by PCR, similar to the methods described above, and subcloned into a modified pCMVlFLAG vector that allowed for in-frame fusion with the Fc portion of human IgG.
  • DR4-Fc, TNRFl-Fc, Fc and soluble TRAIL and TNF alpha expression constructs have been described previously, Pan, G.
  • TRIO extracellular domain of TRIO was expressed as a secreted chimera fused to the Fc portion of human IgG in 293 cells.
  • Conditioned medium from transfected cells was mixed with bacterially expressed soluble His-FLAG-tagged TRAIL.
  • the resulting complex was precipitated with protein G-Sepharose and bound TRAIL detected by Western blotting with anti-FLAG antibody.
  • TRIO-Fc like DR4-Fc, could efficiently block TRAIL-induced apoptosis.
  • TRIO possessing a truncated non-functional death domain was the observation that TRIO overexpression did not cause cell death in Hela cells, and as might be expected, could act as a dominant negative receptor antagonizing TRAIL- induced apoptosis. Therefore, ectopic expression of TRIO, like that of the decoy receptor TR5, is capable of substantially attenuating TRAIL-induced cell death, suggesting that TRIO antagonizes TRAIL signaling.
  • ADDRESSEE HUMAN GENOME SCIENCES, INC.
  • NAME BROOKES, ANDERS A.
  • MOLECULE TYPE DNA (genomic)
  • GAG CAG GAA ATC CAA GGT CAG GAG CTG GCA GAG CTA ACA GGT GTG ACT 1029 Glu Gin Glu He Gin Gly Gin Glu Leu Ala Glu Leu Thr Gly Val Thr 240 245 250
  • AACTCTTCTC CACAGTAGCC CAGTCGTGGT AGGATAAATT ACGGATATAG TCATTCTAGG 3006
  • MOLECULE TYPE DNA (genomic)
  • CTCTTCTCCA CAGTAGCCCA GTCGTGGTAG GATAAATTAC GGATATAGTC ATTCTAGGGG 120
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • xi SEQUENCE DESCRIPTION: SEQ ID NO: 9:
  • CTTTCAATCC ACCCTCCTCC CTTCTAATGG GACTTTGGGG ACAAAGGTCC GACCGCCTCG 120
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Gastroenterology & Hepatology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Animal Behavior & Ethology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Public Health (AREA)
  • Molecular Biology (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/US1998/010981 1997-05-30 1998-05-29 Human tumor necrosis factor receptor tr10 Ceased WO1998054202A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
AU77051/98A AU7705198A (en) 1997-05-30 1998-05-29 Human tumor necrosis factor receptor tr10
CA002292790A CA2292790A1 (en) 1997-05-30 1998-05-29 Human tumor necrosis factor receptor tr10
JP50095499A JP2002511070A (ja) 1997-05-30 1998-05-29 ヒト腫瘍壊死因子受容体tr10
EP98925009A EP1003767A4 (en) 1997-05-30 1998-05-29 HUMAN TUMORNESCROSE FACTOR RECEPTOR TR10

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US5093697P 1997-05-30 1997-05-30
US60/050,936 1997-05-30
US6911297P 1997-12-09 1997-12-09
US60/069,112 1997-12-09

Publications (1)

Publication Number Publication Date
WO1998054202A1 true WO1998054202A1 (en) 1998-12-03

Family

ID=26728870

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1998/010981 Ceased WO1998054202A1 (en) 1997-05-30 1998-05-29 Human tumor necrosis factor receptor tr10

Country Status (6)

Country Link
US (2) US6214580B1 (https=)
EP (1) EP1003767A4 (https=)
JP (1) JP2002511070A (https=)
AU (1) AU7705198A (https=)
CA (1) CA2292790A1 (https=)
WO (1) WO1998054202A1 (https=)

Cited By (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000073321A1 (en) * 1999-05-28 2000-12-07 Human Genome Sciences, Inc. Human tumor necrosis factor receptor tr10
WO2002002641A1 (en) 2000-06-16 2002-01-10 Human Genome Sciences, Inc. Antibodies that immunospecifically bind to blys
WO2002097033A2 (en) 2001-05-25 2002-12-05 Human Genome Sciences, Inc. Antibodies that immunospecifically bind to trail receptors
US6506569B1 (en) 1997-05-30 2003-01-14 Human Genome Sciences, Inc. Antibodies to human tumor necrosis factor receptor TR10
US6607726B1 (en) 1997-05-30 2003-08-19 Human Genome Sciences, Inc. Human tumor necrosis factor receptor TR10
US6635743B1 (en) 1996-03-22 2003-10-21 Human Genome Sciences, Inc. Apoptosis inducing molecule II and methods of use
EP1210370A4 (en) * 1999-08-12 2004-06-09 Human Genome Sciences Inc HUMAN TUMORNESCROSE FACTOR RECEPTOR TR16
KR100436089B1 (ko) * 2000-07-06 2004-06-14 설대우 분비성 재조합 트라이머형의 트레일 단백질 생산을 위한 디엔에이 카세트, 테트라사이클린/독시사이클린-유도성아데노-관련 바이러스 벡터, 이 둘의 조합, 및 이들을이용한 유전자 치료
EP0998561A4 (en) * 1997-07-15 2004-08-18 Immunex Corp RECEPTOR DES TRAIL PROTEIN
US7429646B1 (en) 1995-06-05 2008-09-30 Human Genome Sciences, Inc. Antibodies to human tumor necrosis factor receptor-like 2
EP1997829A1 (en) 2001-12-21 2008-12-03 Human Genome Sciences, Inc. Albumin fusion proteins
US7597886B2 (en) 1994-11-07 2009-10-06 Human Genome Sciences, Inc. Tumor necrosis factor-gamma
EP2206720A1 (en) 2000-04-12 2010-07-14 Human Genome Sciences, Inc. Albumin fusion proteins
US7964190B2 (en) 1996-03-22 2011-06-21 Human Genome Sciences, Inc. Methods and compositions for decreasing T-cell activity
EP2357192A1 (en) 1999-02-26 2011-08-17 Human Genome Sciences, Inc. Human endokine alpha and methods of use
EP2431054A2 (en) 2000-06-15 2012-03-21 Human Genome Sciences, Inc. Human tumor necrosis factor delta and epsilon
US9133273B2 (en) 2010-11-19 2015-09-15 Eisai R&D Management Co., Ltd. Nucleic acids encoding neutralizing anti-CCL20 antibodies
EP3037544A1 (en) 2005-10-13 2016-06-29 Human Genome Sciences, Inc. Methods and compositions for use in treatment of systemic lupus erythematosus (sle) patients with autoantibody positive diseases
EP3502256A2 (en) 2008-09-26 2019-06-26 Tocagen Inc. Recombinant vectors
EP3623478A1 (en) 2012-10-25 2020-03-18 Tocagen Inc. Retroviral vector with mini-promoter cassette
US11103579B2 (en) 2013-03-14 2021-08-31 Bristol-Myers Squibb Company Combination of DR5 agonist and anti-PD-1 antagonist and methods of use

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030143632A1 (en) * 1997-08-04 2003-07-31 Millennium Pharmaceuticals, Inc. Novel genes encoding proteins having prognostic, diagnostic, preventive, therapeutic and other uses
US20030175856A1 (en) * 1997-08-26 2003-09-18 Genetech, Inc. Rtd receptor
ES2331900T3 (es) * 1997-08-26 2010-01-19 Genentech, Inc. Receptor rtd.
US20030059850A1 (en) * 2001-09-26 2003-03-27 Psychiatric Genomics, Inc. Fluorescence proximity assay
JP2009150799A (ja) * 2007-12-21 2009-07-09 Sysmex Corp 分析装置、コンピュータプログラムおよび分析方法

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5705379A (en) * 1996-10-23 1998-01-06 Cornell Research Foundation, Inc. Nucleotide sequences encoding a thermostable alkaline protease
US6342363B1 (en) * 1997-01-28 2002-01-29 Human Genome Sciences, Inc. Death domain containing receptor 4 nucleic acids and methods
US6313269B1 (en) * 1997-03-14 2001-11-06 Smithkline Beecham Corporation Tumor necrosis factor related receptor, TR6
US6342369B1 (en) * 1997-05-15 2002-01-29 Genentech, Inc. Apo-2-receptor
CA2292790A1 (en) 1997-05-30 1998-12-03 Human Genome Sciences, Inc. Human tumor necrosis factor receptor tr10
EP0998561A4 (en) 1997-07-15 2004-08-18 Immunex Corp RECEPTOR DES TRAIL PROTEIN
JP2001512681A (ja) 1997-08-06 2001-08-28 ミレニウム バイオセラピューティクス インク. Tango−71、Tango−73、Tango−74、Tango−76およびTango−83核酸分子およびポリペプチド
ES2331900T3 (es) 1997-08-26 2010-01-19 Genentech, Inc. Receptor rtd.

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
MARSTERS S A, ET AL.: "A NOVEL RECEPTOR FOR APO2L/TRAIL CONTAINS A TRUNCATED DEATH DOMAIN", CURRENT BIOLOGY, CURRENT SCIENCE, GB, vol. 07, no. 12, 1 January 1997 (1997-01-01), GB, pages 1003 - 1006, XP002911224, ISSN: 0960-9822, DOI: 10.1016/S0960-9822(06)00422-2 *
PAN G., ET AL.: "TRUNDD, A NEW MEMBER OF THE TRAIL RECEPTOR FAMILY THAT ANTAGONIZES TRAIL SIGNALLING.", FEBS LETTERS., ELSEVIER, AMSTERDAM., NL, vol. 424., 1 January 1998 (1998-01-01), NL, pages 41 - 45., XP002911225, ISSN: 0014-5793, DOI: 10.1016/S0014-5793(98)00135-5 *
See also references of EP1003767A4 *
WALCZAK H, ET AL.: "TRAIL-R2: A NOVEL APOPTOSIS-MEDIATING RECEPTOR FOR TRAIL", EMBO JOURNAL., OXFORD UNIVERSITY PRESS, SURREY., GB, vol. 16, no. 17, 1 January 1997 (1997-01-01), GB, pages 5386 - 5397, XP002911223, ISSN: 0261-4189, DOI: 10.1093/emboj/16.17.5386 *

Cited By (41)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7597886B2 (en) 1994-11-07 2009-10-06 Human Genome Sciences, Inc. Tumor necrosis factor-gamma
US7429646B1 (en) 1995-06-05 2008-09-30 Human Genome Sciences, Inc. Antibodies to human tumor necrosis factor receptor-like 2
US6635743B1 (en) 1996-03-22 2003-10-21 Human Genome Sciences, Inc. Apoptosis inducing molecule II and methods of use
US7964190B2 (en) 1996-03-22 2011-06-21 Human Genome Sciences, Inc. Methods and compositions for decreasing T-cell activity
US6969599B2 (en) 1997-05-30 2005-11-29 Human Genome Sciences, Inc. Nucleic acids encoding tumor necrosis factor receptor TR10
US7465707B2 (en) 1997-05-30 2008-12-16 Human Genome Sciences, Inc. Methods of treatment with TR10 polypeptides
US6607726B1 (en) 1997-05-30 2003-08-19 Human Genome Sciences, Inc. Human tumor necrosis factor receptor TR10
US6506569B1 (en) 1997-05-30 2003-01-14 Human Genome Sciences, Inc. Antibodies to human tumor necrosis factor receptor TR10
EP0998561A4 (en) * 1997-07-15 2004-08-18 Immunex Corp RECEPTOR DES TRAIL PROTEIN
EP2357192A1 (en) 1999-02-26 2011-08-17 Human Genome Sciences, Inc. Human endokine alpha and methods of use
EP1187842A4 (en) * 1999-05-28 2004-03-03 Human Genome Sciences Inc Human tumor necrosis factor receptor tr10
WO2000073321A1 (en) * 1999-05-28 2000-12-07 Human Genome Sciences, Inc. Human tumor necrosis factor receptor tr10
EP1210370A4 (en) * 1999-08-12 2004-06-09 Human Genome Sciences Inc HUMAN TUMORNESCROSE FACTOR RECEPTOR TR16
EP2206720A1 (en) 2000-04-12 2010-07-14 Human Genome Sciences, Inc. Albumin fusion proteins
EP2267026A1 (en) 2000-04-12 2010-12-29 Human Genome Sciences, Inc. Albumin fusion proteins
EP2298355A2 (en) 2000-04-12 2011-03-23 Human Genome Sciences, Inc. Albumin fusion proteins
EP2213743A1 (en) 2000-04-12 2010-08-04 Human Genome Sciences, Inc. Albumin fusion proteins
EP2216409A1 (en) 2000-04-12 2010-08-11 Human Genome Sciences, Inc. Albumin fusion proteins
EP2236152A1 (en) 2000-04-12 2010-10-06 Human Genome Sciences, Inc. Albumin fusion proteins
EP2295456A1 (en) 2000-04-12 2011-03-16 Human Genome Sciences, Inc. Albumin fusion proteins
EP2357008A1 (en) 2000-04-12 2011-08-17 Human Genome Sciences, Inc. Albumin fusion proteins
EP2275557A1 (en) 2000-04-12 2011-01-19 Human Genome Sciences, Inc. Albumin fusion proteins
EP2311872A1 (en) 2000-04-12 2011-04-20 Human Genome Sciences, Inc. Albumin fusion proteins
EP2431054A2 (en) 2000-06-15 2012-03-21 Human Genome Sciences, Inc. Human tumor necrosis factor delta and epsilon
EP2281842A1 (en) 2000-06-16 2011-02-09 Human Genome Sciences, Inc. Antibodies that immunospecifically bind to BLyS
EP2281843A1 (en) 2000-06-16 2011-02-09 Human Genome Sciences, Inc. Antibodies that immunospecifically bind to blys
WO2002002641A1 (en) 2000-06-16 2002-01-10 Human Genome Sciences, Inc. Antibodies that immunospecifically bind to blys
KR100436089B1 (ko) * 2000-07-06 2004-06-14 설대우 분비성 재조합 트라이머형의 트레일 단백질 생산을 위한 디엔에이 카세트, 테트라사이클린/독시사이클린-유도성아데노-관련 바이러스 벡터, 이 둘의 조합, 및 이들을이용한 유전자 치료
WO2002097033A2 (en) 2001-05-25 2002-12-05 Human Genome Sciences, Inc. Antibodies that immunospecifically bind to trail receptors
EP2277888A2 (en) 2001-12-21 2011-01-26 Human Genome Sciences, Inc. Fusion proteins of albumin and erythropoietin
EP2261250A1 (en) 2001-12-21 2010-12-15 Human Genome Sciences, Inc. Albumin fusion proteins
EP2277910A1 (en) 2001-12-21 2011-01-26 Human Genome Sciences, Inc. Albumin fusion proteins
EP1997829A1 (en) 2001-12-21 2008-12-03 Human Genome Sciences, Inc. Albumin fusion proteins
EP2277889A2 (en) 2001-12-21 2011-01-26 Human Genome Sciences, Inc. Fusion proteins of albumin and interferon beta
EP2990417A1 (en) 2001-12-21 2016-03-02 Human Genome Sciences, Inc. Albumin insulin fusion protein
EP3037544A1 (en) 2005-10-13 2016-06-29 Human Genome Sciences, Inc. Methods and compositions for use in treatment of systemic lupus erythematosus (sle) patients with autoantibody positive diseases
EP3502256A2 (en) 2008-09-26 2019-06-26 Tocagen Inc. Recombinant vectors
US9133273B2 (en) 2010-11-19 2015-09-15 Eisai R&D Management Co., Ltd. Nucleic acids encoding neutralizing anti-CCL20 antibodies
US9809647B2 (en) 2010-11-19 2017-11-07 Eisai R&D Management Co., Ltd. Neutralizing anti-CCL20 antibodies
EP3623478A1 (en) 2012-10-25 2020-03-18 Tocagen Inc. Retroviral vector with mini-promoter cassette
US11103579B2 (en) 2013-03-14 2021-08-31 Bristol-Myers Squibb Company Combination of DR5 agonist and anti-PD-1 antagonist and methods of use

Also Published As

Publication number Publication date
AU7705198A (en) 1998-12-30
EP1003767A1 (en) 2000-05-31
JP2002511070A (ja) 2002-04-09
US6214580B1 (en) 2001-04-10
CA2292790A1 (en) 1998-12-03
EP1003767A4 (en) 2003-01-02
US6607726B1 (en) 2003-08-19

Similar Documents

Publication Publication Date Title
US6607726B1 (en) Human tumor necrosis factor receptor TR10
EP0970213B1 (en) Death domain containing receptor 5
US6342363B1 (en) Death domain containing receptor 4 nucleic acids and methods
US6261801B1 (en) Nucleic acids encoding tumor necrosis factor receptor 5
US6759513B2 (en) Death domain containing receptors
CA2295991A1 (en) Human tumor necrosis factor receptor tr9
WO1998018824A9 (en) Human tumor necrosis factor receptor-like 2
US6667390B2 (en) Human tumor necrosis factor receptor TR9
EP1788086A1 (en) Death Domain Containing Receptor 5
HK1025352B (en) Death domain containing receptor 5
AU2006246525A1 (en) Death Domain Containing Receptor 5
EP0898576A1 (en) Death domain containing receptors

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM GW HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
ENP Entry into the national phase

Ref document number: 2292790

Country of ref document: CA

Ref country code: CA

Ref document number: 2292790

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 1998925009

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 1998925009

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1998925009

Country of ref document: EP