WO1998050544A1 - Fragments de recombinaison du recepteur d'acetylcholine humain et leur utilisation pour traiter la myasthenie - Google Patents

Fragments de recombinaison du recepteur d'acetylcholine humain et leur utilisation pour traiter la myasthenie Download PDF

Info

Publication number
WO1998050544A1
WO1998050544A1 PCT/IL1998/000211 IL9800211W WO9850544A1 WO 1998050544 A1 WO1998050544 A1 WO 1998050544A1 IL 9800211 W IL9800211 W IL 9800211W WO 9850544 A1 WO9850544 A1 WO 9850544A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
sequence
depicted
amino acid
acid residues
Prior art date
Application number
PCT/IL1998/000211
Other languages
English (en)
Inventor
Sara Fuchs
Dora Barchan
Miriam C. Souroujon
Original Assignee
Yeda Research And Development Co. Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yeda Research And Development Co. Ltd. filed Critical Yeda Research And Development Co. Ltd.
Priority to IL13269798A priority Critical patent/IL132697A0/xx
Priority to EP98919450A priority patent/EP0980430A1/fr
Priority to AU72308/98A priority patent/AU7230898A/en
Publication of WO1998050544A1 publication Critical patent/WO1998050544A1/fr
Priority to US11/777,108 priority patent/US20070269865A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70571—Receptors; Cell surface antigens; Cell surface determinants for neuromediators, e.g. serotonin receptor, dopamine receptor
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • the present invention relates to polypeptides capable of modulating the autoimmune response to acetylcholine receptor, and more particularly to polypeptides corresponding entirely or partially to the extracellular domain of human acetylcholine receptor ⁇ -subunit, which polypeptides are useful in the diagnosis and treatment of myasthenia gravis, and to
  • ABBREVIATIONS AChR - acetylcholine receptor; ⁇ -BTX - ⁇ -bungarotoxin; EAMG - experimental autoimmune myasthenia gravis; GST - glutathione S-transferase; hAChR - human acetylcholine receptor; MG - myasthenia gravis; MIR - main immunogenic region.
  • MG Myasthenia gravis
  • AChR acetylcholine receptor
  • the acetylcholine receptor molecule is a transmembrane glycoprotein consisting of five homologous subunits, organized in a barrel-staves-like structure around a central cation channel, in the stoichiometry of either ot2 ⁇ in fetal, or ⁇ 2 ⁇ in mature, muscle [Karlin, 1980; Changeux et al, 1984].
  • Noda et al. (1983) described the cloning and sequence analysis of human genomic DNA encoding the ⁇ -subunit precursor of muscle acetylcholine receptor, and Schoepfer et al. (1988) reported the cloning of the ⁇ -subunit cDNA from the human cell line TE671.
  • Human muscle AChR ⁇ -subunit exists in two forms, one of which has 25 additional amino acid residues, inserted between positions 58 and 59, that are coded by the 75bp exon p3A [Beeson et al, 1990].
  • the ⁇ -subunit of AChR contains both the site for acetylcholine binding and the main targets for anti-AChR antibodies.
  • the autoimmune response in myasthenia gravis is directed mainly towards the extracellular domain of the AChR ⁇ -subunit (amino acids 1-210), and within it, primarily towards the main immunogenic region (MIR) encompassing amino acids 61-76 [Tzartos and Lindstrom, 1980; Tzartos et al., 1987; Loutrari et al., 1992].
  • MIR main immunogenic region
  • mAbs monoclonal antibodies
  • EMG experimental autoimmune myasthenia gravis
  • mAbs monoclonal antibodies
  • Examples of such antibodies are mAb 198, mAb 195, mAb 202 and mAb 35 directed towards the MIR of the extracellular portion of hAChR ⁇ -subunit [Sophianos and Tzartos, 1989], and mAb 5.5 directed towards the binding site of AChR [Mochly-Rosen and Fuchs, 1981].
  • the anti-MIR antibodies exert their effect by crosslinking AChRs on the muscle surface thereby accelerating their degradation, and the anti-binding site mAbs by blocking and competing with acetylcholine [Souroujon et al., 1986; Asher et al., 1993; Loutrari et al., 1992a].
  • Anti-MIR mAbs have also been shown to accelerate the degradation of AChR in the human cell line TE671 [Loutrari et al., 1992].
  • MG is currently treated by acetylcholinesterase inhibitors and by non-specific immunosuppressive drugs that have deleterious side effects. It would be preferable to treat MG with a method that involves antigen-specific immunotherapy but leaves the overall immune response intact.
  • One such strategy of specific therapy could involve the administration of derivatives of AChR that do not induce myasthenia but are capable of affecting the immunopathogenic antibodies.
  • the anti-AChR antibody repertoire in myasthenia gravis has been shown to be polyclonal and heterogeneous [Drachman, 1994], the regulation of the disease requires modulation of many antibody specificities.
  • Torpedo AChR e.g. the reduced and carboxymethylated derivative, RCM-AChR [Bartfeld and Fuchs, 1978], synthetic peptides corresponding to specific regions of AChR [Souroujon et al., 1992; Souroujon et al., 1993], or mimotopes selected from an epitope library [Balass et al., 1993].
  • the Torpedo RCM-AChR did not induce EAMG in rabbits and was effective in suppressing the disease. However, RCM-AChR did induce EAMG in rats.
  • polypeptides comprising sequences corresponding to the entire extracellular domain of the human AChR ⁇ -subunit, or to fragments thereof, are capable of modulating the autoimmune response to AChR.
  • Said polypeptides herein referred to as "biologically active" polypeptides, were found to affect the antigenic modulation of AChR in TE671 cells in vitro, and to modulate the course of EAMG in vivo; they were effective in suppressing the disease both in EAMG that was passively transferred by monoclonal anti-AChR antibodies, and in EAMG that was actively induced by immunization with AChR, while they did not induce any symptoms of MG in the rat model system; they were further successful in both preventing EAMG and in suppressing an ongoing disesase when administered nasally or orally to model rats .
  • the present invention provides, in one aspect, a polypeptide capable of modulating the autoimmune response of an individual to acetylcholine receptor, said polypeptide being selected from the group consisting of:
  • Preferred polypeptides according to the invention are Hal -121, Ha 122-210 and, in particular, H ⁇ l-210+p3A, H ⁇ l-121+p3A, H ⁇ l-205+p3A optionally fused to an additional polypeptide e.g. glutathione S-transferase (GST), and Hal -210 similarly fused.
  • GST glutathione S-transferase
  • a fragment of H ⁇ l-121 comprises at least the amino acid residues 61-76 of the hAChR ⁇ -subunit sequence depicted in Fig.l
  • a fragment of H ⁇ l22-210 comprises at least the amino acid residues 184-210 of the hAChR ⁇ -subunit sequence depicted in Fig.l
  • the invention encompasses a DNA molecule coding for a biologically active polypeptide according to the invention. Said DNA molecules may be selected from genomic DNA, cDNA or recombinant DNA or may be synthetically produced.
  • the invention provides a DNA molecule comprising a nucleotide sequence coding for a polypeptide of the invention, said DNA molecule being selected from the group consisting of: (i) a DNA molecule comprising the sequence of nucleotides 1 to 630, depicted in Fig.l, in which the sequence of the p3A exon of the hAChR ⁇ -subunit gene, depicted in Fig.2, is inserted between nucleotides 174 and 175;
  • DNA molecules which are degenerate, as a result of the genetic code, to the DNA sequences of (i) to (v) and which code for a polypeptide coded for by any one of the DNA sequences of (i) to (v);
  • (x) a DNA molecule comprising two or more fragments of (ix) fused together with or without a spacer, and which codes for a polypeptide capable of modulating the autoimmune response to acetylcholine receptor;
  • (xi) a DNA molecule comprising a nucleic acid sequence as defined in (i)-(x) or the DNA sequence coding for Hal -210 fused to additional coding DNA sequences at its 3' and/or 5' end.
  • Preferred DNA molecules according to the invention are those comprising the sequences of nucleotides 1-363 and 364-630, depicted in Fig.l, coding for H ⁇ l-121 and Hal 22-210, respectively, and particularly the sequences of nucleotides 1-630, 1-615 and 1-363, depicted in Fig.l, in which the sequence of the p3A exon of the hAChR ⁇ -subunit gene, depicted in Fig.2, is inserted between nucleotides 174 and 175, said DNA molecules coding, respectively, for H ⁇ l-210+p3A, H ⁇ l-205+p3A and H ⁇ l-121+p3A that comprise the additional 25 amino acid residues coded for by the p3A exon of the hAChR ⁇ -subunit gene, as well as a DNA molecule coding for Hal -210 fused to additional coding DNA sequences e.g. the sequence coding for GST.
  • a fragment DNA molecule according to the invention codes for a polypeptide comprising at least the amino acid residues 61-76 and/or 184-210 of the hAChR ⁇ -subunit sequence depicted in Fig.1.
  • the invention provides replicable expression vehicles comprising a DNA molecule of the invention and prokaryotic or eukaryotic host cells transformed therewith.
  • a further aspect of the invention relates to a process for preparation of the polypeptides of the invention comprising culturing, under conditions promoting expression, host cells transformed by replicable expression vehicles comprising the DNA molecules of the invention, and isolating the expressed polypeptides.
  • the present invention provides pharmaceutical compositions comprising a pharmaceutically acceptable carrier and, as active ingredient, a polypeptide selected from the group consisting of the polypeptides of the invention and a polypeptide comprising the amino acid residues 1-210 of the hAChR ⁇ -subunit depicted in Fig. 1 (Hal -210), soluble . forms, denatured forms, salts and chemical derivatives thereof.
  • the polypeptide Hal -210 was previously described in the literature as a polypeptide which induces myasthenia gravis [Lennon et al., 1991], but the use of this polypeptide for alleviation and/or treatment of myasthenia grav
  • the present invention provides methods for diagnosis and for alleviation and/or treatment of myasthenia gravis using the polypeptides and pharmaceutical compositions of the invention.
  • Fig. 1 depicts the nucleotide sequence (upper line) and the amino acid sequence coded thereby (lower line) corresponding to the extracellular domain of the hAChR ⁇ -subunit (amino acid residues 1-210).
  • Fig. 2 depicts the nucleotide sequence (upper line) and amino acid sequence coded thereby (lower line) corresponding to the p3A exon of the hAChR ⁇ -subunit gene.
  • Figs. 3A-C depict Coomassie staining (3 A) and Western blots with mAb 198 (3B) or mAb 5.5 (3C) of H ⁇ l-210+p3A, Hal -210, Hal-121+3pA, Hal-121 and H ⁇ l22-210 fused to glutathione S-transferase (GST) at the N-terminal (lanes 1 to 5, respectively). GST alone (lane 6) served as a control.
  • GST glutathione S-transferase
  • Fig. 4 depicts results of an ELISA assay showing binding of mAb 198 to H ⁇ l-210+p3A (filled squares), H ⁇ l-210 (open squares), H ⁇ l-121+p3A (filled circles) and H ⁇ l-121 (open circles).
  • Fig. 5 depicts results of an ELISA assay showing binding to H ⁇ l-210+3pA of mAb
  • Fig. 6 depicts results of an ELISA assay demonstrating inhibition of mAb 198 (O.l ⁇ g/well) binding to AChR by the following polypeptides: H ⁇ 1-210+3 pA (filled squares), H ⁇ l-210 (open squares), H ⁇ l-121+3pA (filled circles), H ⁇ l-121 (open circles) and GST (filled triangles), at concentrations of 0.05-10 ⁇ g/well.
  • Fig. 7 depicts the inhibition effect of the polypeptides of the invention on AChR degradation induced by mAb 198.
  • TE671 cells were incubated with (a) medium, (b) 1 ⁇ g/ml mAb 198, (c-g) 1 ⁇ g/ml of mAb 198 preincubated with either H ⁇ l-121 (hatched columns) or with H ⁇ l22-210 (dark columns) at concentrations of 10 (c), 25 (d), 50 (e), 100 (f) and 200 (g) ⁇ g/ml. Residual AChR was monitored by measuring ⁇ -bungarotoxin ( ⁇ -BTX) binding sites.
  • ⁇ -BTX ⁇ -bungarotoxin
  • Fig. 8 depicts the effect of H ⁇ l-121+p3A on AChR degradation induced by different mAbs. Residual AChR was monitored by measuring ⁇ -BTX binding sites.
  • TE671 cells were incubated with medium alone (leftmost column) or with added mAb 198 (1 ⁇ g/ml), mAb 35 (1 ⁇ g/ml), mAb 195 (5 ⁇ g/ml) or mAb 202 (5 ⁇ g/ml) either without (dotted columns) or following preincubation of the mAbs with H ⁇ l-121+p3A (hatched columns).
  • Figs. 9A-B depict the effect of nasal administration of H ⁇ l-210+p3A and H ⁇ l-121+p3A on T cell responses to Torpedo AChR (0.25 ⁇ g/ml) (9A), and IL-2 production in culture (9B). Both assays were performed on cells pooled from lymph nodes taken 5 weeks after immunization with AChR from treated and control animals.
  • Figs. 10A-B depict the effect of nasal pretreatment on the antibody titers to H ⁇ l-210+p3A (10A) and to rat AChR (10B), in sera from animals treated with
  • Figs. 11 A-B depict the effect of oral pretreatment with H ⁇ l-210+p3A and H ⁇ l-205+p3A on the mean clinical score of EAMG (11 A) and on body weight (1 IB).
  • Figs. 12A-B depict the effect of oral pretreatment with H ⁇ l-210+p3A and
  • Figs. 13 A-B depict the effect of oral treatment with denatured H ⁇ l-205+p3A on an ongoing EAMG.
  • the mean clinical score (13 A) and the mean body weight change (1 B) were monitored for 7 weeks following the beginning of treatment.
  • Human muscle AChR ⁇ -subunit exists as two isoforms consisting of 437 and 462 amino acid residues [Beeson et al., 1990].
  • the two isoforms are identical in their amino acid composition except for a sequence of 25 additional amino acid residues inserted after position 58 in the extracellular domain of the longer variant. These additional amino acids are encoded by the 75bp exon p3A.
  • H ⁇ l-210 the polypeptides herein designated H ⁇ l-210.
  • H ⁇ l-210+p3A, H ⁇ l-121, H ⁇ l-121+p3A, H ⁇ l-205+p3A and H ⁇ l22-210 are capable of modulating the autoimmune response to AChR and of suppressing experimental myasthenia gravis in animal models.
  • the present invention thus relates to the novel polypeptides Hal -121, Hal-121+p3A, Hal22-210, Hal-205+p3A and H ⁇ l-210+p3A as well as to analogs, fragments, fused derivatives, chemical derivatives and salts thereof, and to novel analogs, fragments, fused derivatives, chemical derivatives and salts of the peptide Hal -210.
  • Analogs according to the invention are polypeptides in which one or more amino acid residues have been added to, replaced in or deleted from the original polypeptide in a manner that the resulting polypeptide retains its biological activity. These analogs may be prepared by
  • RECTIFIED SHEET (RULE 91) known synthesis procedures and/or by genetic engineering methods, for example by expressing a DNA molecule modified by site-directed mutagenesis.
  • Biologically active fragments of the polypeptides encompassed by the present invention include preferably polypeptides comprising at least the amino acid residues 61 to 76 and/or 184 to 210 of the hAChR ⁇ -subunit sequence, representing, respectively, the main immunogenic region (MIR) and the acetylcholine binding site of the hAChR ⁇ -subunit.
  • a fragment comprising at least amino acid residues 61 to 76 is a preferred fragment according to the invention.
  • polypeptides comprising two or more fragments as mentioned above which are fused together with or without a spacer.
  • Chemical derivatives of polypeptides of the invention include modifications of functional groups at side chains of the amino acid residues, or at the N- and/or C-terminal groups. Examples of such derivatives include, but are not limited to, esters of carboxyl and hydroxy groups, amides of carboxyl groups generated by reaction with ammonia or with primary or secondary amines and N-acyl derivatives of free amino groups. Cyclic forms of the polypeptides containing a disulfide bridge between two cysteines residues to stabilize the molecule are also encompassed by the invention.
  • salts of the polypeptides of the invention are pharmaceutically acceptable, i.e. they do not destroy the biological activity of the polypeptide, do not confer toxic properties on compositions containing them and do not induce adverse effects.
  • salts refers to salts of carboxyl groups as well as to acid addition salts of amino groups of the polypeptide molecule.
  • a polypeptide of the invention, or a fragment thereof, may be fused to an additional polypeptide at its N- and or C-terminal.
  • additional polypeptide for example, recombinant polypeptides were prepared where H ⁇ l-210, H ⁇ l-210+p3A, H ⁇ l-121, H ⁇ l-121+p3A or H ⁇ l22-210 were fused to glutathione S-transferase (GST) at the N-terminal, and these molecules were capable of modulating the immune response to AChR.
  • GST glutathione S-transferase
  • Other polypeptides may be fused to the N- and/or
  • a polypeptide according to the invention corresponding entirely or partially to the extracellular domain of the hAChR ⁇ -subunit should be capable of affecting the immunopathogenic response without inducing myasthenia gravis by itself.
  • the polypeptide may be at least partially correctly folded, so that it will be recognized by said antibodies.
  • the recombinant polypeptides according to the invention have, indeed, shown to have a broad specificity as demonstrated by their ability to protect AChR in TE671 cells against antigenic modulation induced by a series of anti-AChR mAbs (Fig 8) or by polyclonal anti-AChR antibodies from myasthenic rats (data not shown).
  • polypeptide of the invention seems to be sometimes of crucial importance for its biological activity. It was shown in several experiments (see Figs. 3B, 3C, 4 and 6) that the polypeptides comprising the additional 25 amino acid residues coded for by the exon p3A, namely H ⁇ l-121+p3A and H ⁇ l-210+p3A, bind to anti-AChR antibodies better than the shorter variants H ⁇ l-121 and Hal -210, and are also more potent in their protection effect in TE671 cells in vitro and in EAMG in vivo. Thus H ⁇ l-121+p3A and H ⁇ l-210+p3A are the most preferred polypeptides according to the invention.
  • the major binding sites of the anti-AChR mAbs inhibited by the polypeptides of the invention do not seem to reside within the stretch of amino acids encoded by the p3A exon. Therefore, it seems likely that the different specificity of these mAbs towards the polypeptides with and without the p3A exon encoded sequence reflects conformational changes due to the presence of said extra encoded sequence. Conformational differences could also explain why mAb 198 binds well to the polypeptides containing the p3A exon encoded sequence, but was unable to immunoprecipitate an oocyte-expressed ⁇ -subunit containing this sequence [Newland et al., 1995].
  • a polypeptide of the invention may be produced by means of recombinant technology or synthetically employing methods well-known in the art.
  • Recombinant polypeptides according to the invention are prepared by culturing host cells transformed by a suitable expression vector containing a DNA molecule of the invention under conditions promoting expression, and isolating the expressed polypeptide, using standard techniques well known in the art (see, for example, Sambrook et al., 1989; Ausubel et al., 1993).
  • Soluble forms of the polypeptides that constitute a preferred embodiment of the invention may be generated by suitable chemical modification of natural amino acid residues in the polypeptide, or by substitution of said natural amino acid residues by suitable hydrophilic natural or non-natural amino acids.
  • solubility may be induced by fusion of a polypeptide of the invention to a highly soluble polypeptide partner, such as GST, immunoglobulin or a fragment thereof, maltose binding protein (MBP), thioredoxin or influenza non-structural protein 1 (NS1).
  • MBP maltose binding protein
  • NS1 influenza non-structural protein 1
  • the additional polypeptide may be fused at the N- or C-terminal of the polypeptide of the invention, and it should not significantly impair the three dimensional structure of the polypeptide corresponding to the hAChR ⁇ -subunit domain.
  • the fused polypeptide of the invention may be used as such, or it may be subjected to further processing in which an active polypeptide of the invention is released. Insertion of a target sequence that is cleavable by specific proteases, such as V8 protease, enterokinase, thrombin or factor Xa, enables the release of the original polypeptide from the recombinant expressed fused polypeptide.
  • specific proteases such as V8 protease, enterokinase, thrombin or factor Xa
  • a DNA molecule according to the invention comprises a nucleotide sequence coding for a biologically active polypeptide of the invention.
  • the DNA molecule may be from any origin including non-human sources, and may be selected from genomic DNA, cDNA, recombinant DNA, PCR-produced or synthetically produced DNA.
  • Preferred DNA molecules are those comprising the sequence of nucleotides 1-363 and 364-630 of the hAChR ⁇ -subunit (depicted in Fig.l) coding for H ⁇ l-121 and H ⁇ l22-210, respectively, and particularly the sequences of nucleotides 1-630, 1-615 and 1-363 of the hAChR ⁇ -subunit in which the sequence of the p3A exon of the hAChR ⁇ -subunit gene (depicted in Fig.2) is inserted between nucleotides 174 and 175, hence coding, respectively, for H ⁇ l-210+p3A, H ⁇ l-205+p3A and H ⁇ l-121+p3A.
  • a fused DNA molecule according to the invention comprises a nucleic acid sequence coding for a polypeptide of the invention in fusion to additional coding DNA sequences at its 3' and/or 5' end.
  • the added DNA sequence may code for a polypeptide endowing the expressed fused polypeptide with favourable characteristics for its purification or for performing its biological activity, i.e. conferring on the original polypeptide molecule a preferred configuration or high solubility.
  • a DNA molecule of the invention may be directly isolated from human genomic DNA or cDNA by standard means known in the art involving subcloning genomic or cDNA fractions into a replicable vector, amplifying the subcloned fragments, detecting the relevant clones by their hybridization to the DNA molecules of the invention or fragments thereof, followed by their isolation, for example as described in Sambrook et al., eds. "Molecular Cloning: A Laboratory Manual", 2nd ed., Cold Spring Harbor Press, 1989; and in “Current Protocols in Molecular Biology” Current Protocols, Ausubel et al., eds., 1993.
  • DNA molecules which are at least 70% homologous to Hal -210, Hal-210+p3A,
  • Hal-205+p3A, Hal-121, Hal-121+p3A or Hal22-210 may be isolated by subjecting a population of cloned genomic DNA or cDNA molecules to hybridization with the above synthesized DNA molecules or fragments thereof under stringent conditions, and isolating the hybridized clones.
  • stringent conditions refers to hybridization and subsequent washing conditions conventionally referred to in the art as “stringent” (see Sambrook et al. and Ausubel et al., supra).
  • a DNA molecule of the invention may be PCR-produced as described for example in Example 1 hereinafter.
  • the PCR-production procedure comprises total RNA purification from relevant cells and generation of first strand cDNA by reverse transcriptase, using either an antisense oligonucleotide mixture or oligo (dT) as a primer.
  • a cDNA fragment may be then amplified in a polymerase chain reaction (PCR) using appropriate sense and antisense primers flanking the target cDNA fragment.
  • the PCR primers may include restriction sites to be used for restriction enzyme digestion followed by cloning into a suitable vector.
  • DNA molecule of the invention within an appropriate expression vehicle and expression in a suitable host cell enables production and isolation of a biologically active polypeptide or fragment thereof.
  • the DNA molecule is incorporated into a plasmid or viral vector preferably capable of autonomous replication in a recipient host cell of choice.
  • the DNA molecule may be cloned into an expression vector in frame with additional coding sequences at its 5' and/or 3' end, e.g. the pGEX plasmid vectors that contain GST coding sequences fused upstream to the cloning site.
  • the recombinant expression vector is then used to transform an appropriate prokaryotic or eukaryotic host cell that, under inducing conditions, expresses the polypeptide itself or fused to an additional sequence.
  • an appropriate prokaryotic or eukaryotic host cell that, under inducing conditions, expresses the polypeptide itself or fused to an additional sequence.
  • insertion of a recognition site for a protease enables at will the release of the cloned polypeptide from the additional fused polypeptide.
  • Vectors used in prokaryotic cells include, but are not limited to, plasmids capable of replication in E. coli, for example, pGEX, and bacteriophage vectors such as ⁇ gtl 1, ⁇ gtl8-23, Ml 3 derived vectors etc.
  • a vector construct containing the DNA molecule of the invention is then introduced into an appropriate host cell by any of a variety of suitable means known in the art, such as transformation, transfection, lipofection, conjugation, protoplast fusion, electroporation, calcium phosphate precipitation, direct microinjection, etc.
  • Suitable host cells useful in the invention are prokaryotic cells which include, but are not limited to E. Coli, and more preferably, eukaryotic hosts which include, but are not limited to, yeast cells such as Saccharomyces cerevisiae, or insect cell lines, for example Spodoptera frugiperda (Sf9) cells which are commonly used with the baculovirus expression system, or mammalian cells such as Chinese hamster ovary (CHO) cell lines.
  • prokaryotic cells which include, but are not limited to E. Coli, and more preferably, eukaryotic hosts which include, but are not limited to, yeast cells such as Saccharomyces cerevisiae, or insect cell lines, for example Spodoptera frugiperda (Sf9) cells which are commonly used with the baculovirus expression system, or mammalian cells such as Chinese hamster ovary (CHO) cell lines.
  • Eukaryotic cells are the preferred hosts in expression systems for producing the polypeptides of the invention since they can perform the correct post-translational processing to confer the right conformation on said polypeptides.
  • partially correctly folded polypeptides may also be biologically active, prokaryotic expression systems may also be useful, especially for the production of large amount of polypeptides.
  • the present invention relates to pharmaceutical compositions comprising a pharmaceutically acceptable carrier and, as active ingredient, a polypeptide selected from a polypeptides of the invention and a polypeptide comprising the amino acid residues 1-210 of the hAChR ⁇ -subunit depicted in Fig.l, soluble and denatured forms, salts and chemical derivatives thereof.
  • compositions are for use in the alleviation and/or treatment of myasthenia gravis and may be in any suitable form for administration of polypeptides known in the art, e.g. by injection, inhalation, orally, nasally, etc.
  • Appropriate pharmaceutically acceptable carriers include physiological carriers, such as water and oils and excipients such as stabilizers and preservative agents. Saline solutions and aqueous dextrose and glycerol solution are suitable for injectable solutions.
  • the active ingredient may also be prepared as a lyophilized dry compound, possibly as a salt, or as a conjugate with a solid carrier/support such as dextran, natural and modified celluloses, etc.
  • the pharmaceutically acceptable carrier of choice will be determined depending on the route the pharmaceutical composition will be administered.
  • the dosage of the polypeptide and the schedule of the treatment should depend on the route of administration, the patient condition, age and genetic background and will be determined by a skilled professional person. For example, based on animal studies, it was found that dosage ranges of about 1.4 ⁇ g - 14 mg and 0.14 ⁇ g - 0.7 mg/ Kg human body weight are suitable for oral and nasal administration, respectively, in humans.
  • the invention further provides a method for alleviation or treatment of myasthenia gravis which comprises administering to an individual in need thereof an effective amount of a polypeptide selected from a polypeptide of the invention and the polypeptide Hal -210, a soluble form, a denatured form, a chemical derivative or a salt thereof.
  • the method of present invention is directed to an antigen-specific immunotherapy strategy thus suppressing only the adverse autoimmune responses while leaving the overall immune system of the patient intact.
  • Preferred routes of administration of the polypeptides according to the invention are the nasal and oral routes.
  • Nasal tolerization has several advantages as a treatment modality in comparison with oral tolerization: it requires smaller doses of antigen, is more convenient to use and does not require soybean trypsin inhibitor (STI) used in oral tolerance to inhibit the degradation of the antigen in the gastrointestinal tract.
  • STI soybean trypsin inhibitor
  • Some successful attempts to modulate experimental autoimmune diseases in animal models by nasal administration of the autoantigen have been recently reported.
  • Weiner et al. [1994] showed that inhalation of aerosols containing myelin basic protein (MBP) abrogated the clinical symptoms of EAE and significantly reduced the CNS inflammation, DTH reaction and antibody titer to MBP; Dick et al.
  • compositions of the present invention are also useful for diagnosis of myasthenia gravis whereby anti-AChR antibodies in the serum of a patient are determined by employing one or more polypeptides of the invention as the test antigen and bound anti-AChR antibody titers indicate the presence of myasthenia gravis.
  • the diagnostic test For the diagnostic test, a serum aliquote of a patient is brought in contact with one or more polypeptides, incubated for about 1 h to overnight at 4°-37°C, followed by the determination of the amount of anti-AChR antibodies bound to the polypeptides by quantitative detection assays known in the art.
  • the diagnostic test is be carried out with immobilized polypeptides in an assay comprising the following steps:
  • the detection of the anti-AChR antibodies may be carried out with labeled anti-human antibodies or labeled Staphilococcus protein A.
  • the label may be a radioactive or fluorescent tag, an enzyme conjugate or another biological recognition tag. Examples of radioactive tags are radioactive isotopes such as 123 1, i S, 32 P, 3 H, l4 C etc, which are detected by a scintillation or a ⁇ -counter or by autoradiography.
  • Fluorescent tags are derived from fluorescent compounds such as fluorescein, isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde and fluorescamine, and are detected by exposure of the bound fluorescent labeled antibody to light of the proper wavelength and monitoring the fluorescence.
  • Enzyme conjugates useful for detection purposes include, but are not limited to, maleate dehydrogenase, yeast alcohol dehydrogenase, horseradish peroxidase, alkaline phosphatase, beta-galactosidase, catalase and glucose-6-phosphate dehydrogenase. These enzymes are conjugated to the antibody or to protein A and can be monitored by the product they produce when exposed to the appropriate substrate. The chemical moiety thus released can be detected, for example, by chemiluminescence reaction or by spectrophotometry, fluorometry or visual means.
  • Diagnostic methods based on recognition of biological tags include, for example, coupling of protein A or of the anti-human antibodies to biotin.
  • the biotinylated molecules then can be detected by avidin or streptavidin coupled to a fluorescent compound, to an enzyme such as peroxidase or to a radioactive isotope and the like.
  • the diagnostic test is carried out with one or more soluble polypeptides pre-labeled by one of the foregoing labels and tags, whereby anti-AChR antibodies of the patient's serum bound to the polypeptides are separated from the free antigen by precipitation of the antigen-antibody complex by Staphilococcus protein A or anti-human antibodies, and anti-AChR titers are determined as described above.
  • the diagnostic assays according to the invention have the advantage of avoiding the need to extract the antigen from human tissues or cells, and also provides a more reproducible and safe way for MG detection.
  • the use as antigens of polypeptides that recognize sub-populations of MG-related antibodies further provides a better means for correlating anti-AChR titers with disease severity.
  • mAb Monoclonal antibodies
  • the following monoclonal antibodies were used: mAb directed towards the main immunogenic region (MIR) of the extracellular portion of the hAchR ⁇ -subunit [Sophianos and Tzartos, 1989]: mAb 198, mAb 195 and mAb 202 elicited in rats against human muscle AChR, and mAb 35 elicited in rats against electric eel AChR, but cross-reacted with AChR from other species, including human; and mAb 5.5 directed towards the binding site of AChR from other species, including human [Mochly-Rosen and Fuchs, 1981], elicited in mouse against Torpedo AChR.
  • MIR main immunogenic region
  • Binding of antibodies to AChR or to recombinant polypeptides corresponding entirely or partially to the extracellular domain of the hAChR ⁇ -subunit was analyzed by ELISA.
  • Wells of microtiter plates (Maxisorb, Nunc, Neptune, NJ) were coated by incubation overnight at 4°C with either Torpedo AChR (l ⁇ g in 100 ⁇ l of phosphate-buffered saline (PBS)), or with one of the recombinant polypeptides of the invention (2 ⁇ g in 100 ⁇ l of 50 mM Tris buffer pH 8.0).
  • Coated plates were washed three times with PBS containing 0.05% Tween-20, then wells were blocked by incubation for 1 h at room temperature (R.T.) with 1% bovine serum albumine (BSA) and 1% hemoglobin in PBS, and the coated blocked plates were then washed and incubated overnight at 4°C with different amounts of antibody.
  • R.T. room temperature
  • BSA bovine serum albumine
  • each well was coated with 1 ⁇ g of Torpedo AChR and a polypeptide of the invention was preincubated with the mAb of choice for 30 min at R.T. before addition to the AChR-coated well. Following a washing step, bound mAb was determined by incubation for 1 h at R.T. with 1 :5000 dilution of alkaline phosphatase (AP)-conjugated goat anti-mouse Igs (Jackson ImmunoResearch Labs, Inc., or Biomakor, Ness-Ziona, Israel).
  • AP alkaline phosphatase
  • the bound antibody was detected by the enzymatic activity of AP using N-para-nitrophenyl-phosphate as a substrate and determining by a microtiter plate reader at 405 nm the color developed after about 40 min. iii) Determination of AChR content
  • AChR content was determined by measuring ⁇ -bungarotoxin ( ⁇ -BTX) binding sites. Tested samples were derived from (a) muscle preparations or from (b) cells grown in a tissue culture. a) For the muscle preparation, the procedure described by Souroujon et al. [1985] was essentially followed. Briefly, muscle tissue was removed and homogenized in a Sorvall omnimixer for 2 min. at full speed. Two volumes of Tris-HCl buffer, pH 7.5, containing 0.1 M NaCl, 1 mM EDTA, 0.1 mM PMSF and 0.5 mM NaN 3 , were used for homogenization.
  • the membrane was preincubated in PBS containing 0.5% hemoglobin for lh at R.T. before addition of lO ⁇ g/ml mAbs and incubation was carried out for additional 3 h at 37°C.
  • the membranes were washed 4 times with PBS, once with PBS containing 0.5 % Triton X-100 and then incubated for lh at 37°C with 125 ⁇ -.g 0a t_ an ti- m0 use Ig. After five washes, the blots were exposed to an X-ray sensitive film.
  • Antigenic modulation experiments were performed in 30-mm 12- well plates using TE671 cell cultures.
  • Cells (2x10 ⁇ ) were plated in Dulbecco Modified Eagles medium (DMEM) containing 2 mM L-glutamine, 10% fetal calf serum (FCS) and antibiotics (100 U/ml penicillin, 100 ⁇ g/ml streptomycin and 250 ng/ml amphotericin B), and grown to confluency for 72 h.
  • DMEM Dulbecco Modified Eagles medium
  • FCS fetal calf serum
  • antibiotics 100 U/ml penicillin, 100 ⁇ g/ml streptomycin and 250 ng/ml amphotericin B
  • 125 ⁇ _ ⁇ _Bj ⁇ was added at a final concentration of 2x10" ⁇ M (10$ cpm) for an additional hour.
  • AChR content was determined by measuring ⁇ l- - TX binding, as described in section (iii) above.
  • the mAbs were preincubated for 1 h at 37°C with said polypeptides (at concentrations of 10-200 ⁇ g/ml, as indicated), before their addition to the cell cultures, and the assay continued as described in section (ii) above, vi) Passive transfer of EAMG to rats.
  • Lewis female rats (6 weeks old, approximate weight 120 g) were used for passive transfer experiments, as previously described [Asher et al., 1993].
  • 80 ⁇ g of the anti-MIR mAb 198 in 1 ml PBS were injected i.p. into each rat.
  • the tested polypeptide (1 mg) was preincubated with mAb 198 for 30 min at R.T., prior to the injection into rats.
  • the rats were observed for myasthenic symptoms and body weight.
  • Clinical EAMG was evaluated as follows: grade 0, no weakness or fatigability; grade 1 , weak grip, fatigability; grade 2, weakness, hunched posture at rest, decrease in body weight, tremolousness; grade 3, severe weakness, marked decrease in body weight, moribund; grade 4: dead. Animals were evaluated weekly up to 7-9 weeks after immunization with Torpedo AChR. Blood samples were obtained from the retroorbital plexus, viii) Lymphocyte proliferation assay
  • Popliteal lymph nodes were aseptically removed and single cell suspensions were prepared in RPMI with 10 mM HEPES.
  • An in vitro T-lymphocyte proliferative assay in response to AChR and the different polypeptides of the invention was performed as follows: Lymph node cells were suspended in RPMI at pH 7.4 containing 10 mM HEPES, supplemented with 2 mM L-glutamine, 1 mM sodium pyruvate, 0.1 mM nonessential amino acids, 5x10"5 M ⁇ -mercaptoethanol and 0.5% normal rat serum, and plated in 96-well flat bottom plates (Coming; 5x10 ⁇ cells/well).
  • Increasing concentrations of antigen (0.25 to 10 ⁇ g/ml of AChR and 10 to 100 ⁇ g/ml of a recombinant polypeptide of the invention), were then added to each well. Plates were incubated at 37°C, in 7.5% C02 and 90% humidity. Proliferation was assayed after 3 days by measuring incorporation of thymidine-methyl-f ⁇ H] into cells. Essentially, the cells were incubated with thymidine-methyl-f ⁇ H] (Rotem Ind. Ltd, Beer Sheva, Israel; 0.5 mCi/2.5ml) for 24 h and then harvested and counted for radioactivity. Results are presented as incorporated cpm following subtraction of cpm in the presence of medium alone.
  • DNA molecules encoding the biologically active polypeptides Hal -210, Hal-121, Hal22-210, Hal-205+p3A, Hal-210+p3A and H ⁇ l-121+p3A were synthesized as follows:
  • RNA was prepared as described [Asher, 1988] from the human TE671 cell line, which expresses the human muscle type nicotinic AChR [Schoepfer et al., 1988].
  • Preparation of cDNA and the polymerase chain reaction (PCR) were performed as described [Barchan et al., 1992].
  • the primer at the 5' end corresponds to amino acid residues 1-5 of the human AChR ⁇ -subunit sequence (nucleotides coding for the first residue are bold), and had a BamHI site (underlined).
  • the primer at the 3' end had an EcoRI site (underlined) and was complementary to the DNA sequence coding for amino acid residues 206-210, CGGAATTCCAGGCGCTGCATGAC.
  • the shorter clones Hal -121, Hal-121+p3A and Hal 22-210 were derived by PCR using the above-mentioned H ⁇ l-210 and H ⁇ l-210+p3A clones as templates.
  • a primer complementary to the DNA sequence coding for amino acid residues 116-121 with an EcoRI site (underlined) CGGAATTCTGGAGGTGTCCACGTGAT. was used at the 3' end.
  • the primer described above corresponding to amino acid residues 1-5 was used.
  • the primer CCGGATCCGCCATCTTTAAAAGC was used at the 5' end. This primer corresponds to amino acid residues 122-126 (nucleotides coding for residue 122 are in bold) and contains a BamHI site (underlined).
  • the primer used at the 3' end was the same as described above for the DNA molecule coding for Hal -210 (complementary to residues 206-210).
  • the PCR amplified DNA sequences were subcloned into the BamHI-EcoRI sites of pGEX-2T expression vector (Pharmacia) [Smith and Johnson, 1988], in frame with the GST-coding DNA sequences at the 5' end.
  • the clone H ⁇ l-205+p3A was derived by PCR, using as template the cDNA of hAChR from the TE671 cell line.
  • the primer at the 5' end (GGCCATGGGCTCCGAACATGAGACC) corresponded to amino acid residues 1-5 was designed in a way that enabled cloning into a pET8C-derived expression vector by adding a restriction site for NCO I (underlined) the initiation codon ATG.
  • the primer at the 3' end corresponded to the complementary sequence of amino acid residues 200-205, and contained a restriction site for BamHI (underlined) and a stop codon.
  • the fused polypeptides were solubilized in 1 ml of 9 M urea, the non-soluble fraction was removed by centrifugation for 45 min at 27,000 x g, and the supematant was diluted in 10 ml of 50 mM Tris buffer, pH 8.0 and dialyzed against the same buffer for 48 h with several changes. After ultracentrifugation for 30 min at 100,000 x g, the supernatant was divided into aliquots for storage at -80 C.
  • the GST-fused polypeptides were isolated using a substrate affinity column according to Smith and Johnson, 1988.
  • a Coomassie brilliant blue staining of the expressed GST-fused polypeptides run on 10%) polyacrylamide gel is shown in Fig. 3A: from left to right, lanes 1-6, H ⁇ l-210+p3A, H ⁇ l-210, H ⁇ l-121+p3A, H ⁇ l-121, H ⁇ l22-210 and GST, appearing to have MW of 52.5, 50.0, 43.7, 41.2, 37.8 and 29.0 kD, respectively, in agreement with the expected MW calculated based on the encoded amino acid sequences of these polypeptides (see Fig.l and Fig.2).
  • Expression of H ⁇ l-205+p3A in the pET8C expression system was performed in a similar procedure using E. coli BL21 strain.
  • Example 2 The recombinant polypeptides of Example 2 were further characterized by their binding to various anti-AChR mAbs as assayed by both Western blots (Fig. 3B- mAb 198; Fig. 3C- mAb 5.5) and by ELISA (Fig. 4 and Fig. 5).
  • Fig. 3B shows that mAb 198, which is directed to the MIR, bound to the polypeptide corresponding to the entire extracellular portion of the hAChR ⁇ -subunit (Hal -210) and to its shorter derivative (Hal -121), that contains the MIR, as well as to their variants including the additional p3A encoded sequence H ⁇ l-210+p3A and H ⁇ l-121+p3A.
  • mAb 198 did not bind to Hal 22-210, which does not include MIR, or to the GST protein itself.
  • the mAb 5.5 which is directed to the binding site of AChR [Mochly-Rosen and
  • mAb 198 The binding of mAb 198 to the polypeptides of the invention was also determined in ELISA carried out as described in Materials and Methods section (ii), and the results are shown in Fig. 4. In this assay, as in the Westem blot, mAb 198 bound better to the polypeptides H ⁇ l-210+p3A and H ⁇ l-121+p3A (filled symbols). Therefore, these longer variants were used in further studies. Three other anti-MIR mAbs (mAb 195, mAb 202 and mAb 35) bound to a lesser extent than mAb 198 to all tested polypeptides (not shown).
  • Fig. 5 illustrates the binding of various mAbs to H ⁇ l-210+p3A:
  • Mab 198 (filled squares) showed a very strong binding.
  • MAb 35 which is directed against the MIR and is known to depend on the native conformation of AChR, showed very low binding to the tested polypeptides of the invention (open circles).
  • MAb 5.5 which also depends on the native conformation of AChR, bound well to the tested polypeptides in Westem blots (Fig. 3C), but to a much lesser extent than mAb 198 in ELISA (open triangles). This poor binding of mAbs 35 and 5.5 may indicate that when bound to ELISA plates only a small fraction of the recombinant polypeptide is properly folded.
  • the next step was to test whether the polypeptides of the invention bind to the mAbs also in solution. For that, the ability of the various recombinant polypeptides to inhibit the binding of mAb 198 to Torpedo AChR was tested in ELISA.
  • Muscle AChR loss in myasthenia gravis is caused by accelerated degradation of the receptor, brought about by anti-AChR antibodies, a great portion of which are directed to the MIR.
  • This activity of the antibodies can be demonstrated in vitro in cell cultures such as the human cell line TE671.
  • This human medulloblastoma-derived cell line expresses a functional AChR which binds ⁇ -BTX and has the ⁇ -subunit of the muscle-type AChR.
  • MAb 198 causes a reduction of 41% in residual AChR following 3 h incubation with the cells (Fig. 7, lane b).
  • Preincubation with increasing concentrations of H ⁇ l-121 had a dose dependent protection effect against the degradation induced by mAb 198 (Fig. 7, c-g, hatched columns).
  • mAb 198 At a concentration of 100 ⁇ g/ml of Hal -121 the TE671 cells were completely protected against the accelerated AChR degradation by mAb 198.
  • Preincubation of mAb 198 with H ⁇ l22-210, which does not contain the MIR, did not affect the antigenic modulation induced by mAb 198 and did not block AChR degradation (Fig. 7, c-g, dark columns).
  • Hal -210 corresponding to the entire extracellular ⁇ -subunit domain, had the same effect as the shorter fragment Hal -121 (data not shown).
  • Example 5 Modulation by the polypeptides of EAMG passively transferred by mAb 198
  • the effect of the polypeptides of the invention was also examined in vivo in a well-established animal model disease for myasthenia gravis, designated experimental autoimmune myasthenia gravis (EAMG) [Lindstrom et al., 1976 and 1976a].
  • EAMG experimental autoimmune myasthenia gravis
  • animals such as rabbits, mice, guinea-pigs, monkeys and rats, EAMG can be either passively transferred by anti-AChR antibodies, or actively induced by AChR. In both cases, the treated animals show chronic symptoms of the MG disease, i.e.
  • Table 1 Recombinant fragments modulate experimental myasthenia passively transferred by a monoclonal anti AChR antibody.
  • Muscle AChR content was determined by ⁇ -bungarotoxin binding to AChR present in Triton X-100 extracts from rat leg muscles, 48 h after Ig administrati
  • the values are averages derived from at least three different animals.
  • EAMG was passively transferred in rats by mAb 198.
  • the disease was induced within 24-48 h following administration of the antibody [Asher et al., 1993].
  • Muscle AChR content was determined by ⁇ -bungarotoxin binding to AChR present in Triton X-100 extracts from rat leg muscles, 48 h after the mAb administration. As previously reported, the myasthenic symptoms were accompanied by a marked reduction in the muscle AChR content (48% of normal control; Table 1).
  • mAb 198 was preincubated with a 30 fold molar excess of recombinant polypeptides of the invention, or with either GST or BSA as controls, prior to its injection into rats.
  • Table 1 the muscle AChR content in the EAMG-induced rats was reduced to 48% of AChR content of control untreated rats.
  • the recombinant polypeptides of the invention were able to modulate in vivo muscle AChR loss and to decrease significantly clinical symptoms of EAMG. It was shown that preincubation of mAb 198 with H ⁇ l-121+p3A prior to its injection into rats, prevented the appearance of myasthenic symptoms.
  • the protected rats had a normal muscle AChR content (97% of control). Similar results were obtained with the H ⁇ l-210+p3A polypeptide (data not shown). On the other hand, preincubation with either H ⁇ l22-210+p3A or with GST or BSA did not affect the muscle AChR content significantly (61, 48 and 53% of control, respectively) and did not prevent myasthenic symptoms. Administration of H ⁇ l-121+p3A and H ⁇ l22-210+p3A alone did not induce any myasthenic symptoms in rats.
  • Example 6 Protective effects of nasal administration of the polypeptides of the invention on actively induced EAMG in rats
  • H ⁇ l-210+p3A, H ⁇ l-121+p3A and Hal 22-210 fused with GST were expressed and solubilized as described in Example 2.
  • Nasal tolerance was induced in rats by administration of a daily dose of 2.5 ⁇ g of each of said fused polypeptides in 30 ⁇ l PBS into each rat nostril, over a period of ten consecutive days. Three days later the rats were immunized with Torpedo AChR (40 ⁇ g/rat) injected into the footpads, in Complete Freund's Adjuvant supplemented with 1 mg of Mycobacterium tuberculosis H37RA (DIFCO). Control rats received GST instead of the recombinant polypeptide. Clinical symptoms of EAMG disease, as well as body weight, were monitored weekly. The results of the experiment are summarized in Table 2, showing that all three tested polypeptides had a protective effect in the rats.
  • all rats in the control, GST-pretreated group were sick.
  • Table 2 there was a marked effect of the treatment on the weight of the rats.
  • Example 7 Suppressive effects of nasal administration of the polypeptides of the invention on an ongoing EAMG.
  • nasal administration of H ⁇ l-210+p3A was initiated 7 days after the induction of EAMG by immunization with Torpedo AChR. At this time rats are known to be at the first, acute phase of EAMG. Other than the time of initiation, the protocol for the nasal administration was as in Example 6.
  • Table 3 The effect of intranasal treatment with human recombinant AChR fragment Hal -210 +p3A on ongoing EAMG in rats.
  • a Nasal administration was initiated 7 days after induction of EAMG by immunization with AChR and was continued for 12 consecutive days.
  • Example 8 Effects of oral administration of the polypeptides of the invention on EAMG in rats.
  • H ⁇ l-205+p3A to modulate an ongoing disease (in rats immunized with AChR) was investigated.
  • a denatured preparation of H ⁇ l-205+p3A (designated denH ⁇ l-215+p3A) was employed for oral treatment of sick rats.
  • Denaturation of H ⁇ l-205+p3A was performed in 6M guanidine HCL, followed by reduction with 0.1M ⁇ -mercaptoethanol and carboxymethylation with 0.15M iodoacetamide.
  • Rats with a mild form of EAMG (clinical score of about 1) were pooled and divided randomly into two groups.
  • Rats in the experimental group were fed 7 times with three days interval, each time with 0.3 mg of denH ⁇ l-205+p3A per rat, and rats in the control group were fed with ovalbumin.
  • the rats were evaluated weekly for clinical symptoms and for their body weight. As seen in Fig. 13, the disease was arrested in the rats treated orally with the recombinant fragment and their body weight increased. On the other hand the disease progressed in rats of the control group and the rats lost weight gradually.
  • the human medulloblastoma cell line TE671 expresses a muscle-like acetylcholine receptor. Cloning of the alpha-subunit cDNA. FEBS Lett 226: 235-40.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Cell Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Neurology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Polypeptides capables de moduler la réaction auto-immune d'un individu au récepteur d'acétylcholine humain (hAChR), plus particulièrement, polypeptides correspondant, en totalité ou en partie, au domaine extracellulaire d'une sous-unité α de hAChR et qui sont utiles pour le diagnostic ou le traitement de la myasthénie. Les polypeptides préférés sont des polypeptides correspondant aux résidus aminoacides 1-121 ou 122-210 de la séquence de la sous-unité α de hAChR, et des polypeptides correspondant aux résidus aminoacides 1-121 ou 1-205 de la séquence de sous-unité α de hAChR dans laquelle est insérée, entre les résidus aminoacides 58 et 59, une séquence de 25 résidus aminoacides codés par l'exon p3A du gène de la sous-unité α de hAChR, ainsi que leurs fragments, analogues ou leurs formes fusionnées, solubles et dénaturées. L'invention concerne également des molécules d'ADN codant lesdits polypeptides.
PCT/IL1998/000211 1997-05-07 1998-05-06 Fragments de recombinaison du recepteur d'acetylcholine humain et leur utilisation pour traiter la myasthenie WO1998050544A1 (fr)

Priority Applications (4)

Application Number Priority Date Filing Date Title
IL13269798A IL132697A0 (en) 1997-05-07 1998-05-06 Recombinant fragments of the human acetylcholine receptor and their use for treatment of myasthenia gravis
EP98919450A EP0980430A1 (fr) 1997-05-07 1998-05-06 Fragments de recombinaison du recepteur d'acetylcholine humain et leur utilisation pour traiter la myasthenie
AU72308/98A AU7230898A (en) 1997-05-07 1998-05-06 Recombinant fragments of the human acetylcholine receptor and their use for treatment of myasthenia gravis
US11/777,108 US20070269865A1 (en) 1997-05-07 2007-07-12 Recombinant fragments of the human acetylcholine receptor and their use for treatment of myasthenia gravis

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
IL120792 1997-05-07
IL12079297A IL120792A0 (en) 1997-05-07 1997-05-07 Polypeptides DNA molecules coding therefor and pharmaceutical compositions comprising the polypeptides for treatment and diagnosis of myasthenia gravis

Related Child Applications (4)

Application Number Title Priority Date Filing Date
US09445602 A-371-Of-International 1998-06-09
US09423398 A-371-Of-International 2000-02-18
US09/820,339 Continuation-In-Part US20020081652A1 (en) 1997-05-07 2001-03-29 Recombinant fragments of the human acetylcholine receptor and their use for treatment of myasthenia gravis
US10/032,482 Division US7118744B2 (en) 1997-06-09 2002-01-02 Immunogenic compositions for induction of anti-tumor immunity

Publications (1)

Publication Number Publication Date
WO1998050544A1 true WO1998050544A1 (fr) 1998-11-12

Family

ID=11070105

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IL1998/000211 WO1998050544A1 (fr) 1997-05-07 1998-05-06 Fragments de recombinaison du recepteur d'acetylcholine humain et leur utilisation pour traiter la myasthenie

Country Status (4)

Country Link
EP (1) EP0980430A1 (fr)
AU (1) AU7230898A (fr)
IL (1) IL120792A0 (fr)
WO (1) WO1998050544A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GR1004240B (el) * 2002-04-17 2003-05-14 Ελληνικο Ινστιτουτο Παστερ (Ν.Π.Ι.Δ.) ΠΑΡΑΓΩΓΗ ΑΝΑΣΥΝΔΥΑΣΜΕΝΩΝ ΤΜΗΜΑΤΩΝ ΤΟΥ ΜΥΙΚΟΥ ΥΠΟΔΟΧΕΑ ΑΚΕΤΥΛΟΧΟΛΙΝΗΣ (AChr) ΚΑΙ ΧΡΗΣΗ ΣΤΗΝ EX VIVO ΑΝΟΣΟΠΡΟΣΡΟΦΗΣΗ ΤΩΝ ΑΝΤΙΣΩΜΑΤΩΝ ΕΝΑΝΤΙ ΤΟΥ AChR ΑΠΟ ΑΣΘΕΝΕΙΣ ΜΕ ΒΑΡΙΑ ΜΥΑΣΘΕΝΕΙΑ
KR100719020B1 (ko) 2005-09-28 2007-05-17 광주과학기술원 재조합 아세틸콜린 수용체 폴리펩티드, 폴리펩티드 유도체및 이를 유효성분으로 포함하는 중증근무력증 치료제
CN105348393A (zh) * 2015-11-17 2016-02-24 中国人民解放军第四军医大学 一种偶联抗体的合成、检测方法和应用
WO2022260579A2 (fr) 2021-06-07 2022-12-15 Toleranzia Ab Protéine de fusion dans la myasthénie grave

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5578496A (en) * 1991-12-19 1996-11-26 Board Of Regents, Baylor College Of Medicine Detection of autoantibodies associated with the disease myasthenia gravis

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5578496A (en) * 1991-12-19 1996-11-26 Board Of Regents, Baylor College Of Medicine Detection of autoantibodies associated with the disease myasthenia gravis

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BARCHAN D ET AL: "Modulation of the anti- acetylcholine receptor response and experimental autoimmune myasthenia gravis by recombinant fragments of the acetylcholine receptor.", EUROPEAN JOURNAL OF IMMUNOLOGY, (1998 FEB) 28 (2) 616-24. JOURNAL CODE: EN5. ISSN: 0014-2980., GERMANY: Germany, Federal Republic of, XP002077786 *
DAVID BEESON ET AL.: "The human muscle nicotinic acetylcholine receptor alpha-subunit exists as two isoforms: a novel exon", EMBO JOURNAL, vol. 9, no. 7, July 1990 (1990-07-01), EYNSHAM, OXFORD GB, pages 2101 - 2106, XP002077782 *
DORA BARCHAN ET AL.: "The binding site of the Nicotinic Acetylcholine receptor in animal species resistant to alpha-Bungarotoxin", BIOCHEMISTRY, vol. 34, no. 28, 18 July 1995 (1995-07-18), EASTON, PA US, pages 9172 - 9176, XP002077785 *
SANO M ET AL: "Identification of three extended antibody-binding segments in recombinant human muscle acetylcholine receptor alpha subunit extracellular domain 1-210.", INTERNATIONAL IMMUNOLOGY, (1991 OCT) 3 (10) 983-9. JOURNAL CODE: AY5. ISSN: 0953-8178., ENGLAND: United Kingdom, XP002077784 *
TALIB S ET AL: "Cloning and expression in Escherichia coli of a synthetic gene encoding the extracellular domain of the human muscle acetylcholine receptor alpha -subunit.", GENE, (1991 FEB 15) 98 (2) 289-93. JOURNAL CODE: FOP. ISSN: 0378-1119., Netherlands, XP002077783 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GR1004240B (el) * 2002-04-17 2003-05-14 Ελληνικο Ινστιτουτο Παστερ (Ν.Π.Ι.Δ.) ΠΑΡΑΓΩΓΗ ΑΝΑΣΥΝΔΥΑΣΜΕΝΩΝ ΤΜΗΜΑΤΩΝ ΤΟΥ ΜΥΙΚΟΥ ΥΠΟΔΟΧΕΑ ΑΚΕΤΥΛΟΧΟΛΙΝΗΣ (AChr) ΚΑΙ ΧΡΗΣΗ ΣΤΗΝ EX VIVO ΑΝΟΣΟΠΡΟΣΡΟΦΗΣΗ ΤΩΝ ΑΝΤΙΣΩΜΑΤΩΝ ΕΝΑΝΤΙ ΤΟΥ AChR ΑΠΟ ΑΣΘΕΝΕΙΣ ΜΕ ΒΑΡΙΑ ΜΥΑΣΘΕΝΕΙΑ
WO2003087373A2 (fr) * 2002-04-17 2003-10-23 Hellenic Pasteur Institute Production de fragments de recombinaison du recepteur d'acetylcholine musculaire et leur utilisation pour une immuno-adsorption ex vivo d'anticorps anti-recepteurs de l'acetylcholine (anti-rach) provenant de patients myastheniques
WO2003087373A3 (fr) * 2002-04-17 2004-06-10 Hellenic Pasteur Inst Production de fragments de recombinaison du recepteur d'acetylcholine musculaire et leur utilisation pour une immuno-adsorption ex vivo d'anticorps anti-recepteurs de l'acetylcholine (anti-rach) provenant de patients myastheniques
KR100719020B1 (ko) 2005-09-28 2007-05-17 광주과학기술원 재조합 아세틸콜린 수용체 폴리펩티드, 폴리펩티드 유도체및 이를 유효성분으로 포함하는 중증근무력증 치료제
CN105348393A (zh) * 2015-11-17 2016-02-24 中国人民解放军第四军医大学 一种偶联抗体的合成、检测方法和应用
WO2022260579A2 (fr) 2021-06-07 2022-12-15 Toleranzia Ab Protéine de fusion dans la myasthénie grave

Also Published As

Publication number Publication date
IL120792A0 (en) 1997-09-30
AU7230898A (en) 1998-11-27
EP0980430A1 (fr) 2000-02-23

Similar Documents

Publication Publication Date Title
US5691448A (en) Reagents and methods for the diagnosis and treatment of diabetes and stiff man syndrome
US7491397B2 (en) Receptor binding polypeptides
US20170080047A1 (en) Compositions And Methods For Modulating The Immune System
WO1994012529A9 (fr) Procedes et reactifs ameliores de diagnostic et de therapie du diabete et du syndrome de moertsch-woltman
KR102501179B1 (ko) 중증 근무력증의 진단 및 치료를 위한 펩티드 및 이의 용도
Bergami et al. Antibodies against the carboxyl‐terminal end of the Trypanosoma cruzi ribosomal P proteins are pathogenic
US6699973B1 (en) Antibodies to peptides that target GIT receptors and related methods
Barchan et al. Modulation of the anti‐acetylcholine receptor response and experimental autoimmune myasthenia gravis by recombinant fragments of the acetylcholine receptor
JP4435422B2 (ja) 炎症疾患の治療
WO2023083092A1 (fr) Antigène polypeptidique de la protéine de spicule de sars-cov-2 et application de celui-ci
US20070269865A1 (en) Recombinant fragments of the human acetylcholine receptor and their use for treatment of myasthenia gravis
JP2000507232A (ja) 慢性関節リウマチの病理発生に必要な関節炎誘発性ペプチドに対して免疫防御を誘発するために有用なワクチン組成物と方法
Kinoshita et al. Spreading of the immune response from 52 kDaRo and 60 kDaRo to calreticulin in experimental autoimmunity
US5958416A (en) Heat shock protein peptides and methods for modulating autoimmune central nervous system disease
Lindstrom et al. Molecular and antigenic structure of nicotinic acetylcholine receptors
WO2022036337A1 (fr) Compositions et méthodes pour un polypeptide recombinant imitant la protéine nucléocapside (np) du sars-cov-2
JP4717213B2 (ja) 新規なアミノ酸配列、そのアミノ酸配列をコードするｄｎａ、かかる配列に向けられた抗体およびその種々の使用
EP0980430A1 (fr) Fragments de recombinaison du recepteur d'acetylcholine humain et leur utilisation pour traiter la myasthenie
JP4733022B2 (ja) 新規ダニアレルゲン
Elkon et al. Antiribosomal antibodies in SLE, infection, and following deliberate immunization
Wauben et al. Inhibition of experimental autoimmune myasthenia gravis by major histocompatibility complex class II competitor peptides results not only in a suppressed but also in an altered immune response
NO341727B1 (no) Vaksine for terapeutisk eller profylaktisk behandling av myastenia gravis
SURI et al. Evaluation of recombinant protein r140, a polypeptide segment of tegumental glycoprotein Sm25, as a defined antigen vaccine against Schistosoma mansoni
Palace et al. Immunogenicity of human recombinant acetylcholine receptor α subunit: cytoplasmic epitopes dominate the antibody response in four mouse strains
AU2013360773B2 (en) Novel recombinant outer membrane proteins from Brachyspira hyodysenteriae and uses thereof

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 132697

Country of ref document: IL

AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA HU IL JP US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 1998919450

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 09423398

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 1998919450

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: JP

Ref document number: 1998547895

Format of ref document f/p: F

NENP Non-entry into the national phase

Ref country code: CA

WWW Wipo information: withdrawn in national office

Ref document number: 1998919450

Country of ref document: EP