WO1998028431A1 - Regulation de la transcription chez les plantes - Google Patents

Regulation de la transcription chez les plantes Download PDF

Info

Publication number
WO1998028431A1
WO1998028431A1 PCT/GB1997/003546 GB9703546W WO9828431A1 WO 1998028431 A1 WO1998028431 A1 WO 1998028431A1 GB 9703546 W GB9703546 W GB 9703546W WO 9828431 A1 WO9828431 A1 WO 9828431A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
promoter
plant
gene
construct
Prior art date
Application number
PCT/GB1997/003546
Other languages
English (en)
Inventor
Jonathan Dallas George Jones
Victor Ivanovich Klimyuk
Robert Dirks
Original Assignee
Plant Bioscience Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Plant Bioscience Limited filed Critical Plant Bioscience Limited
Priority to EP97950332A priority Critical patent/EP0948633A1/fr
Priority to GB9914211A priority patent/GB2335195B/en
Priority to AU53330/98A priority patent/AU5333098A/en
Publication of WO1998028431A1 publication Critical patent/WO1998028431A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
    • C12N15/823—Reproductive tissue-specific promoters
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8287—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for fertility modification, e.g. apomixis
    • C12N15/8289—Male sterility
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Definitions

  • the present invention relates to meiosis in plants and more particularly the identification of regulatory sequences for meiosis-specific transcription of genes of interest and uses thereof .
  • Meiosis provides a mechanism by which a heterozygous individual can create large numbers of genotypically unique recombinant gametes. Chromosomes replicate during interphase, as in mitosis, and enter meiosis with two chromatids. During meiotic prophase I, chromosomes condense from the dispersed state typical of interphase, to form long thin threads in leptotene, and each acquires a proteinaceous axial core to which the two sister chromatids are attached.
  • homologous chromosomes become aligned, forming the synaptonemal complex and, at pachytene, non-sister chromatids of the completely paired chromosomes recombine forming the chiasmata which become visible during diplotene.
  • Two cell divisions follow - reductional and equational - resulting in four gametes, with each single chromosome as a potentially recombinant chromatid.
  • Phi suppresses pairing of nonhomologous chromosomes in wheat and a Phi -mutant background was used for the transfer and introgression of alien chromosome segments into wheat (Riley et al . , 1968) .
  • Plants have also provided an excellent cytological system for the study of meiosis (Gillies, 1984; Albini and
  • Lily anthers have offered the best system to study biochemical events that are correlated with the different stages of meiosis, because these stages are protracted and synchronised in adjacent flower buds, permitting the isolation of temporally regulated cDNA clones (Kobayashi et al . , 1994).
  • One such gene, LIM15 was expressed specifically in prophase I of meiotic cells and is extremely homologous to the yeast DMC1 gene (Kobayashi et al. , 1993) .
  • the promoters of plant meiotic genes are of extreme interest as they may provide transcriptional regulation of their genes during this very restricted developmental period.
  • the isolation and characterization of these promoters enables the study and modification of fundamental processes taking place during early sporogenesis, as well as to study the impact of such modifications on more advanced stages of sexual reproduction in plants.
  • Work by the present inventors outlining their objectives has been shown as a poster display (Klimyuk, V.I. et al . "The isolation and characterisation of the meiosis-specific Arabidopsis thaliana DMC1 gene" . Abstracts of the 6th International Conference on Arabidopsis Research.
  • the primary aim of the inventors was to identify and isolate a plant promoter which confers meiosis-specific transcriptional regulation in plants . They used the homologies between the lily LIM15 and the yeast DMCl genes to design degenerate PCR (polymerase chain reaction) primers that amplified the Arabidopsis meiosis-specific DMCl gene (designated AtDMCl) .
  • the AtDMCl gene was completely sequenced and the transcript was characterised by RT (reverse transcriptase) -PCR. In situ hybridisation analysis showed that AtDMCl expression is restricted to pollen mother cells in anthers and megaspore mother cells in ovules.
  • AtDMCl and ArLIM15 (Sato et al . , 1995) revealed that these genes, isolated from Landsberg erecta and Columbia ecotypes respectively, encode the same protein but are different in their promoter regions. We determined that the difference was caused by the insertion of a 1874 bp transposon-like element, designated Limpetl, into the promoter of ArLIM15. This finding revealed that previously published putative promoter region of ArLIM15 (Sato et al . , 1995) predominantly contains Limpetl sequences and would not be expected to be sufficient to confer meiosis-specific expression of the GUS reporter gene.
  • AtDMCl promoter as well as the alignment of the promoter regions of the AtDMCl and ArLIM15 genes upstream of their transcription start sites are shown in Figure 4A and B, respectively.
  • a part (fragment), variant or derivative of the promoter sequence shown should be sufficient to confer meiosis-specific expression on a heterologous sequence operatively linked, i.e.
  • One or more fragments of the sequence may be included in a promoter according to the present invention, for instance one or more motifs may be coupled to a "minimal" promoter. Such motifs may confer meiosis- specific promoter function on a promoter which otherwise drives expression in a non-meiosis specific fashion.
  • the present invention provides a nucleic acid isolate comprising a promoter as indicated.
  • the present invention provides a nucleic acid isolate comprising a promoter, the promoter comprising a sequence of nucleotides shown in Figure 4 (A) and conferring meiosis specific expression on a sequence operably linked to the promoter. Restriction enzyme or nucleases may be used to digest the full-length nucleic acid shown, followed by an appropriate assay to determine the minimal sequence required for developmental specificity.
  • a preferred embodiment of the present invention provides a nucleic acid isolate with the minimal nucleotide sequence shown in Figure 4 (A) required for such specificity.
  • the promoter may comprise one or more sequence motifs or elements conferring developmental and/or tissue-specific regulatory control of expression.
  • Other regulatory sequences may be included, for instance as identified by a mutation or digestion assay in an appropriate expression system or by sequence comparison with available information, e.g. using a computer to search on-line databases .
  • promoter is meant a sequence of nucleotides from which transcription of DNA operably linked downstream (i.e. in the 3' direction on the sense strand of double-stranded DNA) may be initiated.
  • operably linked means joined as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter.
  • DNA operably linked to a promoter is "under transcriptional initiation regulation" of the promoter.
  • the present invention extends to a promoter which has a nucleotide sequence which is allele, mutant, variant or derivative, by way of nucleotide addition, insertion, substitution or deletion of a promoter sequence as provided herein.
  • Systematic or random mutagenesis of nucleic acid to make an alteration to the nucleotide sequence may be performed using any technique known to those skilled in the art .
  • One or more alterations to a promoter sequence according to the present invention may increase or decrease promoter activity, or increase or decrease the magnitude of the effect of a substance able to modulate the promoter activity.
  • Promoter activity is used to refer to ability to initiate transcription.
  • the level of promoter activity is quantifiable for instance by assessment of the amount of mRNA produced by transcription from the promoter or by assessment of the amount of protein product produced by translation of mRNA produced by transcription from the promoter.
  • the amount of a specific mRNA present in an expression system may be determined for example using specific oligonucleotides which are able to hybridise with the mRNA and which are labelled or may be used in a specific amplification reaction such as the polymerase chain reaction.
  • Use of a reporter gene facilitates determination of promoter activity by reference to protein production. Therefore there is provided a nucleic acid molecule comprising
  • a promoter which has a sequence that is a fragment, mutant, allele, derivative or variant, by way of addition, insertion, deletion or substitution of one or more nucleotides, of the sequence of the promoter shown in Figure 4 (A) has homology with the shown sequence which is at least about 5% greater than the homology that the ArLIM15 promoter sequence (Sato et al . ) has with the sequence shown herein, preferably at least about 10% greater homology, more preferably at least about 20% homology, more preferably at least about 25% greater homology.
  • the sequence in accordance with an embodiment of the invention may hybridise with the shown sequence but not the ArLIM15 promoter sequence under appropriately stringent selective hybridisation conditions.
  • a promoter according to the invention may include one or more motifs that appear in Figure 4 (A) and are able to confer meiosis-specificity on a promoter which contains them, and which are not present in the ArLIM15 promoter of Sato et al .
  • the present invention also includes meiosis-specific promoters that are homologous to the AtDMCl gene promoter. Further, the present invention includes meiosis-specific promoters of the gene of a homologous DMCl protein from another plant species.
  • An homologous promoter or nucleic acid encoding an homologous DMCl protein may show greater than 55% homology with the sequence of Fig. 4A or Fig. 5A or Fig.
  • nucleic acid construct comprising a promoter region or a fragment, mutant, allele, derivative or variant thereof as discussed able to promote transcription in a plant in a meiosis- specific manner, operably linked to a heterologous nucleic acid sequence, preferably a gene, e.g. a coding sequence.
  • heterologous is meant a gene other than the AtDMCl coding sequence. Modified forms of AtDMCl coding sequence may be excluded. Generally, the gene may be transcribed into mRNA which may be translated into a peptide or polypeptide product which may be detected and preferably quantitated following expression. A gene whose encoded product may be assayed following expression is termed a “reporter gene”, i.e. a gene which "reports" on promoter activity.
  • the present invention also provides a nucleic acid vector comprising a promoter as disclosed herein.
  • a nucleic acid vector comprising a promoter as disclosed herein.
  • Such a vector may comprise a suitably positioned restriction site or other means for insertion into the vector of a sequence heterologous to the promoter to be operably linked thereto.
  • Suitable vectors can be chosen or constructed, containing appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate.
  • appropriate regulatory sequences including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate.
  • a further aspect of the present invention provides a host cell (which may be microbial or plant) containing a nucleic acid construct comprising a promoter element, as disclosed herein, operably linked to a heterologous nucleic acid sequence or gene.
  • a still further aspect provides a method comprising introducing such a construct into a host cell. The introduction may employ any available technique well known to the person skilled in the art.
  • the introduction may be followed by causing or allowing expression of the heterologous nucleic acid sequence or gene under the control of the promoter.
  • the construct comprising promoter and nucleic acid sequence or gene integrated into the genome (e.g. chromosome) of the host cell. Integration may be promoted by including in the construct sequences which promote recombination with the genome, in accordance with standard techniques.
  • Nucleic acid molecules, constructs and vectors according to the present invention may be provided isolated and/or purified (i.e. from their natural environment), in substantially pure or homogeneous form, free or substantially free of a coding sequence, or free or substantially free of nucleic acid or genes of the species of interest or origin other than the promoter sequence. Nucleic acid according to the present invention may be wholly or partially synthetic. The term “isolate” encompasses all these possibilities.
  • An aspect of the present invention is the use of nucleic acid according to the invention in the production of a transgenic plant.
  • nucleic acid to be inserted should be assembled within a construct which contains effective regulatory elements which will drive transcription. There must be available a method of transporting the construct into the cell. Once the construct is within the cell membrane, integration into the endogenous chromosomal material either will or will not occur. Finally, as far as plants are concerned the target cell type must be such that cells can be regenerated into whole plants.
  • Plants transformed with the DNA segment containing the sequence may be produced by standard techniques which are already known for the genetic manipulation of plants.
  • DNA can be transformed into plant cells using any suitable technology, such as a disarmed Ti-plasmid vector carried by
  • Microprojectile bombardment, electroporation and direct DNA uptake are preferred where Agrobacterium is inefficient or ineffective.
  • a combination of different techniques may be employed to enhance the efficiency of the transformation process, eg bombardment with Agrobacterium coated microparticles (EP.-A-486234) or microprojectile bombardment to induce wounding followed by co-cultivation with Agrobacterium (EP-A-486233) .
  • a plant may be regenerated, e.g. from single cells, callus tissue or leaf discs, as is standard in the art. Almost any plant can be entirely regenerated from cells, tissues and organs of the plant. Available techniques are reviewd in Vasil et al . , Cell Cul ture and Somatic Cel Genetics of Plants, Vol I, II and III, Laboratory Procedures and Their Applications, Academic Press, 1984, and Weissbach and Weissbach, Methods for Plant Molecular Biology, Academic Press, 1989. The particular choice of a transformation technology will be determined by its efficiency to transform certain plant species as well as the experience and preference of the person practising the invention with a particular methodology of choice.
  • a transformation system to introduce nucleic acid into plant cells is not essential to or a limitation of the invention, nor is the choice of technique for plant regeneration.
  • a plant cell having incorporated into its genome nucleic acid, particularly heterologous nucleic acid, as provided by the present invention is provided.
  • a further aspect of the present invention provides a method of making such a plant cell involving introduction of a vector including the sequence of nucleotides into a plant cell and causing or allowing recombination between the vector and the plant cell genome to introduce the sequence of nucleotides into the genome.
  • the invention extends to plant cells containing nucleic acid according to the invention as a result of introduction of the nucleic acid into an ancestor cell .
  • Plants which include a plant cell according to the invention are also provided, along with any part or propagule thereof, seed, selfed or hybrid progeny and descendants.
  • a plant according to the present invention may be one which does not breed true in - one or more properties. Plant varieties may be excluded, particularly registrable plant varieties according to Plant Breeders' Rights. It is noted that a plant need not be considered a "plant variety” simply because it contains stably within its genome a transgene, introduced into a cell of the plant or an ancestor thereof .
  • the present invention provides any clone of such a plant, seed, selfed or hybrid progeny and descendants, and any part of any of these, such as cuttings or seeds.
  • the invention provides any plant propagule, that is any part which may be used in reproduction or propagation, sexual or asexual, including cuttings, seed and so on.
  • the AtDMCl promoter may be used in meiosis-specific expression of a heterologous sequence, including a variety of cytotoxic genes, eg ribosome inactivating proteins (Lord et al . , 1991) or cytotoxic RNase barnase (Goldman et al . , 1994) , DNA modifying enzymes including rare-cutting site- specific endonucleases, eg Xbal , I-Scel, HO endonuclease (Brenneman et al . , 1996; Puchta et al . , 1996; Chiurazzi et al .
  • cytotoxic genes eg ribosome inactivating proteins (Lord et al . , 1991) or cytotoxic RNase barnase (Goldman et al . , 1994)
  • DNA modifying enzymes including rare-cutting site- specific endonucleases, eg Xbal , I-Scel
  • recombinases eg FLP recombinase (Kilby et al . , 1995), recombinase from Zygosacharomyces rouxii (Onouchi et al . , 1995), bacteriophage PI ere recombinase (Osborne et al . , 1995) as well as different transcription factors (Meshi & Iwabuchi, 1995; Ramachandran et al . , 1994), protein kinases and phosphatases (Stone & Walker, 1995) , cell cycle regulators
  • AtDMCl promoter under control of AtDMCl promoter may be used as markers for detection of early meiotic events in plants, especially for the analysis of different mutations affecting meiosis.
  • the AtDMCl promoter may be used for improving transposon tagging efficiency.
  • the main factors determining the efficiency of transposon-based system in the tagging of host genes are the frequencies of transposon excision and reinsertion, and the independence of transposition events. The last factor is crucial for a system with high level of excision and reinsertion events, as such system often yield clonal transpositions.
  • the present invention provides a method of transposon tagging comprising the steps of creating construct comprising a promoter as described above operably linked to a transposase required for transposition of a transposable element; transforming a plant cell with said construct such that the transposase is driven by said promoter; and determining transposition events.
  • the AtDMCl promoter may be used in searching for apomictic mutants or used by seed producers to produce seeds apomictically.
  • Apomixis is the definition of asexual reproductive processes that occur in ovules of flowering plants (Koltunow, 1993) . Mutants with fertilisation- independent seed development have been recently described for Arabidopsis (Ohad et al . , 1996; Chaudhury et al.,1997). Apomictically produced plants are genetically identical with the female parental plants. Apomictic reproduction may therefore be beneficial for agriculture, as- it may be an inexpensive way to preserve given genotype through successive generations.
  • the construct carries meiosis-specific promoter (msp) fused through a DNA insertion sequence (DNA ins) to a modification nucleic acid sequence, preferably a gene (tx) encoding a cytotoxic protein.
  • the DNA insertion sequence may be any DNA sequence (another gene, eg transformation marker or counter selectable marker) which does not confer transcription of cytotoxic gene and is sufficiently long to prevent transcription of cytotoxic gene from the meiosis- specific promoter.
  • DNA insertion is preferably flanked with DNA sequences which are the target sequences (ts) for an activator, preferably a DNA recombinase (r-se) , under control of inducible promoter (ip) .
  • the target sequences may be, for example, lox recombination sites with the same orientation in the case of the ere recombinase, or the 5' and 3' Ac ends for the Ac transposase.
  • the transcription of DNA recombinase gene may be controlled by an inducible promoter (ip) , for example, promoter of heat shock inducible gene (Yoshida et al . , 1995) .
  • any other inducible system may be used, for example, copper-controllable (Mett et al . , 1993), or glucocorticoid-controllable (Aoyama et al . , 1995) gene expression system, but in this case the constructs design will be more complex, as such systems are transcription factor mediated.
  • This system may be useful, firstly for apomictic seed production, as the induction of recombinase gene will lead to the ablation meiotic cells and viable seeds may be produced as the result of apomictic reproduction; and secondly, for the detection of apomictic mutants, especially in genotypes which are predisposed to apomixis when reproduction is not successful, e.g. citrus and grass species (Koltunow, 1993) .
  • seeds or plants or plant parts eg pollen carrying a construct as described in Figure 1A, may be mutagenised and the site- specific recombinase gene expression can be induced in self-progeny derived from mutagenised seeds. In this situation viable seeds will only be produced apomictically in an appropriate mutant background.
  • Fig. 1A Fig. 1A. These genes catalyse conversion of pro-herbicides into herbicides and any seedlings (potentially false positives) with inactive cytotoxic gene (tx) (because of the presence of DNA insertion) will be easily removed by the treatment appropriate pro-herbicide.
  • cre/lox -like system i.e. one involving site-specific recombination
  • the present invention provides a method for producing seeds apomictically comprising the steps of modifying plant cells by incorporating into their genome a nucleic acid construct as described above so that the modification nucleic acid sequence is expressed in said meiotic cells thereby eliminating sexually produced seeds in a plant regenerated therefrom.
  • the nucleic acid construct may be incorporated into the cell genome by breeding techniques well known to the person skilled in the art or by standard transformation techniques.
  • a method of detecting apomictic mutants comprising the steps of generating a plant or plant part carrying a nucleic acid construct as described above; creating a variation for apomixis either in accordance with a breeding programme or in accordance with a mutagenesis programme; deriving a suitable self progeny population; inducing the activating gene in the self progeny as described above and detecting viable seeds produced apomictically.
  • a suitable self progeny population will be understood by those skilled in the art to mean one where the phenotype of the mutation can be revealed e.g. where individuals are at least partially homozygous by selfing. Genetic variation could be created from breeding and selection of existing genetic stocks or by inducing such genetic variation, for example by mutagenesis.
  • Figure IB we present an exemplary construct permitting the removal of any unwanted DNA sequences from transgenic plants. It may be useful, for example, for eliminating genes conferring antibiotic resistance, which are required for selection of transformed plants, but are not necessary needed afterwards. Moreover, the presence of such genes can be damaging for the release of transgenic crops (or at least controversial, given the current political climate and food scares) .
  • Cre/lox recombination system to remove selected- genes from transgenic plants was already reported (Dale & Ow, 1991) .
  • the system described by Dale and Ow (1991) required the second round of transformation in order to introduce recombinase source under the control of constitutive promoter.
  • meiosis specific promoter msp drives the transcription of site specific recombinase gene
  • DNA of interest through the mechanism of homologous recombination during the first cycle of sexual reproduction in transgenic plant unlike the cre/lox-system. It will not require any additional rounds of transformation as well as the use of inducible promoters to drive recombinase gene.
  • the recombination event can be easily monitored in progeny of the primary transformant by placing DNA insertion between constitutive promoter (cp) and reporter gene (rg) or by using PCR screening.
  • an aspect of the present invention is to prevent seed derived from sexual reproduction so that only apomictic seed are set (in plants where apomixis can occur) .
  • the hybrid seed may be made on a small scale and then be multiplied apomictically to produce large scale quantities of hybrid seed.
  • Hybrid seed is desirable because hybrids generally perform better then inbreds .
  • Another aspect of the present invention is to identify plants with a tendency to form apomictic seed. This can be achieved in connection with a mutagenesis or breeding programme (see Fig. 1A) .
  • the present invention also relates to a method for removing pieces of nucleic acid from transgenic plants (e.g. sequences just needed to transform/select transgenic cells/plants) .
  • Figure 1 shows schematic representation of uses of meiosis-specific promoter in searching for apomictic mutants, maintaining the apomictic mechanism of seeds production and in removing of unwanted DNA sequences from transgenic plants.
  • Figure 2 shows the restriction map (A) of the AtDMCl gene and T-DNA region of binary vector carrying pAtDMCl:GUS fusion.
  • the positions of degenerate primers used to produce AtDMCl-specific probe A are shown by arrows.
  • Probe B which was used for RFLP mapping, corresponds to the 5.9 kb EcoRV fragment of genomic clone.
  • the positions and sizes of 15 exons are shown by open boxes ; the ATG and the TGA translation initiation and translation termination codons are also shown.
  • the promoter region used for pAtDMCl:GUS translational fusion is shown as solid line.
  • Figure 2(B) shows the schematic representation of the plasmid SLJ7753 T-DNA region introduced into A. thaliana in order to assess the specificity of the AtDMCl promoter.
  • the construct carries a pAtDMCl:GUS translational fusion and the NPT gene as a transformation marker.
  • Figure 3 shows nucleotide sequence of the AtDMCl promoter and adjacent region.
  • the nucleotide sequence from -450 to +330 is shown.
  • the transcription start site is designated +1.
  • the putative TATA box sequence is boxed.
  • the alternative putative TATA box is overlined. Two nearly complete and two complete direct repeats are underlined. Consensus sequences of splicing are indicated by double underlining.
  • the ATG codon in the second exon (shown in bold) was mutagenised in order to introduce an Ncol site for translational fusion with the GUS gene.
  • Figure 4 shows (A) DNA sequence of the AtDMCl promoter including part of the transcribed region. Transcription start site located at the position 4691. (B) Alignment of the promoter regions of the AtDMCl (top strand) and ArLIM15 (bottom strand) genes upstream of their transcription start sites. Only identical sequences in the alignment are shown.
  • Figure 5 shows DNA sequences of plant DMCl homologues .
  • Figure 5 (A) shows partial genomic DNA sequence of barley DMCl homologue (HvDMCl) . Putative promoter region is located upstream of the translation start site (position 1599) . Genomic DNA region amplified by the primers MEI1 and MEI4 is located between the positions 4001 - 4707.
  • Figure 5 shows partial genomic DNA sequence of tomato DMCl homologue (LeDMCl) . Genomic DNA region amplified by the primers MEI1 and MEI4 is located between the positions 466 - 1240.
  • Figure 6 shows a schematic presentation of the T-DNA regions of constructs SLJ11332 (A) and SLJ112315 (B) .
  • Figure 7 shows alignment of the amino acid sequences of the AtDMCl, LIM15 and DMCl proteins. Identical and conserved amino acid residues are boxed in black and grey, respectively. Gaps in the alignment are shown by dots. The positions and orientations of primers are shown by arrows. The vertical open arrowheads indicate the positions of introns in the AtDMCl gene. The A and B motifs of the consensus sequence for the purine nucleotide binding site, detected by visual inspection, are underlined.
  • Figure 8 shows the restriction map of the promoter region of the ArLIM15 gene. The positions of the first five exons are shown by open boxes. The insertion of transposon- like element, Limpetl, flanked by two 9 bp direct repeats is also shown.
  • the plants used in this study were Arabidopsis thaliana Columbia and Landsberg erecta ecotypes . Plants were grown in the greenhouse at 25oC under 16 hrs of illumination and automatic watering conditions.
  • Plant transformation of Arabidopsis thaliana was performed as described (Bechtold et al . , 1993). Seeds were harvested three weeks after the vacuum- infiltration, sterilised and screened for transformants on GM + 1% glucose medium (Valvekens et al . , 1988) containing 50 mg 1-1 kanamycin.
  • Genomic and cosmid DNA isolation from the plant tissue and E. coli respectively was performed as described (Klimyuk et al . , 1995; Sambrook et al . , 1989).
  • the DNA was digested with restriction enzymes and DNA fragments were separated on 1% agarose gel, transferred to Hybond-N membranes (Sambrook et al . , 1989), immobilised on the membranes by UV crosslinking (UV Stratagene stratalinker 2400) and subsequently baked on the membranes for 1 hour at 80oC.
  • the hybridisation procedure was performed as described by Church and Gilbert (1984) . DNA fragments for use as probes were gel -purified and were labelled using commercially available oligolabelling kit (Pharmacia) .
  • pAtDMCl GUS fusion
  • the Ncol site was introduced by site-directed mutagenesis (Kunkel, 1985) at the position of the first ATG codon (shown in bold in Figure 3) in the second exon of 5.9 kb EcoRV subclone of the AtDMCl gene to make plasmid SLJ7731.
  • the sequence of the primer designated MUTA used for mutagenesis is: 5'- TAG AGC TGA AGALACTOSYL IGG AAC GAG CCC CAT GGA GCT CGT TGA GCG TGA-3' .
  • the Ncol site is shown in bold.
  • the final construct SLJ7731 was digested with Ncol and Pstl restriction enzymes, gel purified and ligated with small Ncol-Pstl fragment of SLJ4D4.
  • the final plasmid SLJ7744, carrying pAtDMCl :GUS 3'ocs fusion in pBS(KS + ) vector was digested with Hpal and Smal restriction enzymes. The large fragment, released by this digest, was gel purified and subcloned into Hpal site of binary vector
  • Transformed plants carrying T-DNA of SLJ7753 were XGluc stained at the different stages of development as previously described (Klimyuk et al . , 1995) . Squashes of X- Gluc stained, pigment -washed flower buds were prepared as described below. Specimens were placed in eppendorf tubes and vacuum-infiltrated with immersion oil in SpeedVac concentrator SVC100H (Savant) . Then buds with remains of immersion oil were placed on slide and gently -squashed with cover slip. The squashes were examined with a Zeiss Axiophot microscope.
  • stage 9 petal primordia stalked at base
  • pistil length (from the top of the stigma to the point of attachment to the receptacles) is 0.15 - 0.4 mm
  • stage 10 - stamen filaments begin to elongate
  • pistil length is 0.4 - 0.5 mm
  • stage 11 - stigmatic papillae appear, pistil length is 0.5 - 1.5 mm.
  • RT-PCR analysis of AtDMCl expression was performed with MEIIU (5' -GGA GGG AAT GGA AAA GTG-3') primers using l ⁇ g of total RNA from 12 day-old seedlings, leaves and floral buds as a template.
  • the positions and orientations of the primers coincide with those of their degenerate homologues, MEI1 and MEI4 ( Figure 2A) .
  • RNA probes Digoxigenin-labeling of RNA probes, tissue preparation and in si tu hybridization were performed as described by Bradley et al . (1993) and Coen et al . (1990).
  • RNA samples were separated on 1.4% agarose- formaldehyde gels as described by Ausebel et al . (1987) .
  • Agarose gel was rinsed in several changes of sterile DEP-treated distilled water in order to remove formaldehyde and blotted overnight in lOxSSC to Hybond-N membrane.
  • Membrane was carefully rinsed with deionized sterile water and RNA was immobilized to membrane and hybridized with probe as described above for DNA gel blot analysis.
  • the major 679 bp PCR band obtained after the reamplification with MEI1 and MEI4 primers of the first round PCR product (MEI1 and MEI5 primers) , was blunt-ended by treatment with T 4 polymerase, subcloned into the EcoRV site of pBS(KS + ) and sequenced.
  • the fragment designated as probe A ( Figure 2A) , encoded 111 amino acid sequence with 93% of identity to the homologous part of LIM15 15 protein (Kobayashi et al . , 1993) .
  • MEIIU Two unique primers, MEIIU (5' GGA GGG AAT GGA AAA GTG 3') and MEI4U (5' GCA ACG TTG AAC TCC TCT GCA AT 3') , that annealed to the same location as their degenerate homologues ( Figure 2A) , were synthesised and used for the PCR screening of DNA pools prepared from 68 plates (384 clones per plate) of an four genomic equivalents Arabidopsis cosmid library. The library was made on the basis of CLD04541 binary vector and was kindly provided by C. Lister and C. Dean (Cambridge Laboratory, JIC, Norwich) . The probing of filter replicas from positive plates with probe A recovered five cosmid clones.
  • One of the clones was used for the restriction mapping and subcloning of 5.9 kb EcoRV and 3.6 kb Clal overlapping fragments into the pBS (KS+) vector. Both strands of two overlapping fragments, encompassing 8 kb of cosmid insert, were completely sequenced.
  • AtDMCl a gene within this region, designated AtDMCl, whose highest homology was to the ArLIM15 protein followed by LIM15 and its human and mouse homologues as well as several RAD51 homologues and other RecA-like proteins, including yeast DMCl, from different eukaryotic organisms.
  • GenBank accession number for the AtDMCl gene is U76670.
  • DNA gel blot analysis of AtDMCl revealed that this is a single copy gene .
  • AtDMCl genomic clone ( designated as probe B; Figure 2A) was initially used to probe Southern blot of Arabidopsis thaliana (ecotypes Landsberg erecta and Columbia) DNA to detect specific RFLPs.
  • AtDMCl was shown to be polymorphic with EcoRI , EcoRV, Xbal, Hindlll, Hpal and BstEI enzymes between A. thaliana Landsberg erecta and Columbia ecotypes.
  • the RFLP for the AtDMCl was mapped to the top arm of chromosome 3 between the m560B2 and g4711 molecular markers at the distances of 4.8 cM and 7.7 cM from each of the markers respectively.
  • mapping of AtDMCl using recombinant inbred lines of Landsberg erecta and Columbia ecotypes led to the identification of a single locus, and the conclusion that AtDMCl and ArLIM15 are allelic.
  • Total RNA was prepared from Arabidopsis 0.1 - 1 mm floral buds and young leaves by a standard method (Harpster et al . , 1988) or by method described by Napoli et al . , (1990). Both methods produced good quality RNA, but the last one was preferred when small quantities of total RNA were required.
  • RT-PCR complementary DNA synthesis was carried out with 2 ⁇ g of total RNA and primer MEI6U (5' ATC CTT CGC GTC AGC AAT GCC 3'). Second strand synthesis and PCR were carried out with primers 5RN (5' ATG CAG CTC GTT GAG CGT GAA 3') and MEI6U. PCR mixture was heated for 5 min at 95oC, followed by 35 cycles of amplifications (94°C, 40 sec; 56°C, 1 min; 72°C, 2 min) and 10 min final extension at 72°C.
  • the primers should amplify 996 bp and 2586 bp fragments from the cDNA and genomic DNA respectively. Two expected bands were observed after the electrophoretic separation of RT-PCR products and the 996 bp fragment was cloned and sequenced. The sequence confirmed the prediction, except that minor corrections were necessary to the predicted boundaries of some exons.
  • Max-Planck Institute, Martinsried predicted an additional short exon 5' to the first of the 14 exons that were initially identified.
  • 5' RACE complementary DNA synthesis was performed with 5 ⁇ g of total RNA and primer 5R2 (5' TCA GCA GCT TCA CAG ATT TTG 3') .
  • Second strand cDNA synthesis and first PCR amplification were done with QI , QT (Frohman, 1989) and 5R2N (5' TCA ACT TTG GCC TCA GAT AAA C 3') primers.
  • Reamplification was done with QI and 5R2N1 (5' TTC TTG GTA TGC ATC ATG AGALACTOSYL IGG 3 ' ) primers .
  • the promoter contains some interesting motifs upstream of the putative TATA box.
  • Four direct repeats were found at the positions -285 to -397 ( Figure 3) .
  • Two nearly complete repeats, 9 bp and 11 bp, are flanked by two complete 15 bp repeats.
  • three of the repeats contain the short palindromic repeat ATGCAT at their 3' ends.
  • Transfac v 3.2 database search for homology with known transcription factor binding sites using TESS - Transcription Element Search Software http/ /agave, humgen. upenn. edu/ tess/ index, html) revealed that these repeats contain putative transcription factor binding domains.
  • the repeats contain 6 - 11 bp long sequences that show homology to the transcription factor binding sites for quail transcription factor EFII (Sealey & Chalkley. 1987) , human glucocorticoid receptor (Haerd et al . , 1990) and Xenopus octamer-binding factor (Tebb & Mattaj , 1989).
  • EFII quail transcription factor binding sites
  • human glucocorticoid receptor Haerd et al . , 1990
  • Xenopus octamer-binding factor Tebb & Mattaj , 1989.
  • 3' RACE complementary DNA synthesis was carried out with 5 ⁇ g of total RNA and QT primer (Frohman, 1989) .
  • Second-strand cDNA synthesis and first PCR were done with QO and GSP1 (5' TCT GGG AAA ACC CAA TAA 3') primers.
  • This transcript codes 344 amino acids putative AtDMCl protein which exhibits significant sequence similarity to lily LIM15 (Kobayashi et al . , 1993) and yeast DMCl (Bishop et al . , 1992) meiotic proteins.
  • the optimal alignment showed 84.3% of amino acid identity and 93.6% amino acid similarity between AtDMCl and LIM15 and 51.8% of amino acid identity and 71.1% similarity between AtDMCl and DMCl.
  • AtDMCl exhibits a somewhat lower level of homology with the yeast RAD51, a protein required for mitotic and meiotic recombination and resistance to ionising radiation, (48.5% and 70.6% of identity and similarity respectively) .
  • AtDMCl like other RecA-like DNA strand-exchange proteins (Kowalczykowski and Eggleston, 1994) , possesses consensus ATP binding sites (Walker et al . , 1982).
  • AtDMCl transcription start site is 4 bp upstream of that for the ArLIM15 and the last exon is 75 bp longer.
  • AtDMCl gene is expressed at the time of meiosis
  • in situ hybridisation analysis using cross-sections of the whole inflorescence and DIG-labelled antisense AtDMCl RNA as - a probe was carried out. Digoxigenin-labelling of RNA probes, tissue preparation and in situ hybridisation were performed as described by Bradley et al . (1993) and Coen et al . (1990) .
  • the expression of AtDMCl gene in whorl 3 is restricted to pollen mother cells. No expression was detected in tapetum.
  • whorl 4 hybridisation signal was restricted to megaspore mother cells of ovules.
  • DIG-labelled sense AtDMCl RNA was used as a negative control and did not reveal any hybridisation signal at the stages of flower development at which the expression of AtDMCl might take place. Weak nonspecific signal was detected in the mature pollen grains following hybridization with sense and antisense AtDMCl RNAs (data not shown) . No signals were detected in postmeiotic ovules and developing embryos as well as in the analysed vegetative tissues.
  • the meiosis-associated expression of the AtDMCl led us to investigate whether the AtDMCl promoter could direct meiosis-associated expression of the GUS reporter gene.
  • a translational fusion was made between the putative AtDMCl promoter and coding sequences of the GUS reporter gene (see: Construction of pAtDMCl .- GUS fusion in Materials and Methods) .
  • the fusion consists of a 3.3 kb DNA fragment containing the AtDMCl promoter fused in frame with GUS at the position of the methionine residue located in the second exon ( Figures 2b and 3) .
  • the sequence of the 3.3 kb DNA fragment of the AtDMCl gene used to drive meiosis- specific expression of a GUS reporter gene and its alignment with previously published sequence of the ArLIM15 gene are shown in Figure 3.
  • the GUS protein carries 13 AtDMCl amino acid residues at its amino terminus. These residues appear to be neutral with respect to GUS activity.
  • a schematic representation of the T-DNA region carrying the pAtDMCl:GUS fusion is shown in Figure 2b.
  • the GUS expression initially appears in the anthers of approximately 0.2 mm long inflorescence buds and later in the carpels of more advanced, approximately 1 mm long, buds. Meiosis in anthers and carpels does not coincide (Bowman, 1994) . The beginning of meiotic prophase I in anthers takes place at stage 9 of flower development, while the meiotic events in carpels do not occur until stage 11 (Bowman, 1994) . Cross-sections of X-Gluc-stained buds at the different stages of development showed that GUS expression first appeared in pollen mother cells of anthers from inflorescence buds early in stage 9. In late stage 9 GUS staining increased dramatically. GUS expression in ovaries was first detected at stage 11 of flower development .
  • AtDMCl and ArLIMl ⁇ genes are different wi thin the promoter regions
  • AtDMCl and ArLIM15 Alignment of the AtDMCl and ArLIM15 (Sato et al . , 1995) gene sequences revealed that these genes, isolated from ecotypes Landsberg erecta and Columbia respectively, are virtually identical throughout their respective coding regions, but there are significant differences in the 5' sequences. The sequences diverge 219 bp upstream of the transcriptional start site of AtDMCl gene.
  • Primers Tl (5' GGG AAT GTT CCA ATA TAA G 3 ' ) and T2 (5 ' GAG AAT ATT ACA CTC TTA AA 3') were used for amplification of Limpetl sequences .
  • the set of primers AR2 - ATM2 produced the expected 446 bp PCR band for Columbia ecotype, but nothing for Landsberg erecta, whereas primers ATMl - ATM2 produced the expected 342 bp PCR product for Landsberg erecta and 2.2 kb PCR product from Columbia ecotype.
  • the positions and orientations of primers are shown in Figure 8.
  • AtDMCl and ArLIM15 sequences described above are not derived from chimeric clones and reflect genuine differences in gene structure.
  • sequence of the ArLIM15 promoter region was extended. This indicated that the difference between the AtDMCl and ArLIM15 promoter regions was caused by a 1874 bp DNA fragment present in the ArLIM15 gene but absent in the AtDMCl ( Figure 8) .
  • the fragment is flanked by two 9 bp direct repeats and has 26 bp imperfect inverted repeats, with 73% of identity, at its termini; internal to these are two shorter inverted repeats (GenBank accession number U76697) .
  • the general structure of the fragment suggests that it is a transposable element and that it is probably a member of the class of transposons that exhibit DNA-mediated transposition.
  • the two 9 bp direct repeats at the ends of the element probably represent a target site duplication. Consistent with this suggestion such a duplication is absent within the AtDMCl promoter.
  • the element which we have designated Limpetl (LIM promoter entrenched transposon- like element) , was used as a probe to blots of genomic DNA from three different ecotypes of Arabidopsis thaliana.
  • Primers Tl and T2 were used to produce Limpetl hybridisation probe by reamplification of the ATMl - ATM2 PCR product from ecotype Columbia.
  • DNA gel blot analysis indicated that Columbia ecotype contains Limpetl and at least two additional closely related elements, but no Limpetl or related sequences were found in Landsberg erecta .
  • RT-PCR was performed with MEIIU and MEI4U primers, using equal amount of total RNA isolated from floral buds and leaves of both ecotypes.
  • the results of DNA gel blot analysis of RT-PCR products suggest that two ecotypes exhibit very similar and relatively high levels of expression in inflorescence tissue and similar but much lower levels of expression in the leaves.
  • LeDMCl and HvDMCl genes were used to screen the tomato cosmid (Dixon et al . , 1996) and barley lambda (Stratagene) genomic libraries, respectively. Partial sequences of genomic clones recovered from the screens are shown in
  • HvDMCl genomic clone was sequenced far enough upstream of the coding region to confer at least 1.5 kb of the putative promoter sequences
  • the plasmid SLJ7744 carrying pAtDMCl:GUS 3 ' ocs fusion in pBS(KS+) vector, was digested with Ncol and EcoRV, large fragment was gel -purified and ligated with Ncol - EcoRV fragment of pJB142 carrying barnase-barstar- CaMV polyA fusion.
  • the final construct was Xbal digested and 6 kb gel-purified fragment, carrying pAtDMCl :barnase- barstar-CaMV polyA signal, was cloned into the Xbal site of the binary vector SLJ755I5.
  • the final construct SLJ11332 ( Figure 6a) was mobilised into Agrobacterium tumefaciens C58C1 strain and used in transformation experiments .
  • the first 450 bp of the AtDMCl cDNA were amplified with Clal/1 (5'- CAAAATTCTATCGATCTCACTCTTCCAAGCTTA-3 ' ) and Clal/2 (5'- CAAAAGCCTCTGTGATCGATGAGGTTTCAATTCCACC - 3') primers with introduced Clal sites (shown in bold) .
  • PCR fragment was digested with Clal, gel-purified and cloned into the Clal site of binary vector pVDH401 carrying PVX amplicon (Angell & Baulcombe, 1997) .
  • the final construct SLJ112315 ( Figure 6b) was mobilised into Agrobacterium strain and used in transformation experiments as it described in Materials and Methods .
  • amplicon-mediated gene silencing can be used as an efficient tool to suppress endogenous RNA sharing homology with the transgene (Angell & Baulcombe, 1997) .
  • yeast dmcl mutant fails to form normal synaptonemal complex and, as a result, produces a very low percentage of viable spores
  • AtDMCl expression can be an alternative way to switch off the mechanism of sexual reproduction in Arabidopsis. Coding sequences of Arabidopsis, tomato, barley and rice (Database accession number U85613, direct submission 16 January 1997) homologues share 70 - 80% of homology. Considering this, it is possible that amplicon- based AtDMCl cDNA can efficiently silence DMCl homologues expression in other plant species. Alternatively, host DMCl homologue cDNA can be used in amplicon to switch off the mechanism of sexual reproduction and to achieve apomictic seed production.
  • AtDMCl which confers tight developmental regulation of reporter gene expression in whorl 3 and whorl 4
  • the remarkable specificity of the AtDMCl which confers tight developmental regulation of reporter gene expression in whorl 3 and whorl 4, may serve as a model system to study the mechanism of such regulation.
  • Figure 3 may play an important role in developmental regulation of AtDMCl gene expression. Functional dissection of the promoter and site-directed mutagenesis may help to identify cis-regulatory sequences controlling the transcription of the AtDMCl gene and to clarify possible involvement of direct repeats in such regulation. Such sequences may be used as "baits" in one- hybrid system. Identification of the minimal region of the AtDMCl promoter possessing all the sequences necessary to drive meiosis-specific transcription can be achieved by preparing constructs carrying truncated AtDMCl promoter fused to the GUS reporter gene, transforming them into Arabidopsis and testing them for the ability to confer meiosis-specific GUS expression.
  • Meiosis-specific enhancers may be fused to any heterologous "minimal" promoter, for example, with -67 bp 35S promoter, which is not able to drive transcription, but contains RNA polymerase binding site .
  • the present inventors have made constructs carrying different types of fusion of the AtDMCl promoter to different transposase genes (Ac, Spm) as well as to the Tntl tobacco retrotransposon.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Pregnancy & Childbirth (AREA)
  • Reproductive Health (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention concerne des séquences régulatrices pour la transcription spécifique à la méiose de séquences nucléotidiques ou de gènes étudiés et leurs utilisations. L'invention a pour objet un promoteur qui provoque la régulation de la transcription spécifique à la méiose chez les plantes. De tels promoteurs peuvent être utilisés pour améliorer l'efficacité du marquage par transposons, rechercher des mutants apomictiques et/ou produire des plantes stériles. L'invention porte également sur un produit de recombinaison comprenant un promoteur de la présente invention qui permet la recherche de mutants apomictiques et la production de graines apomictiques.
PCT/GB1997/003546 1996-12-24 1997-12-24 Regulation de la transcription chez les plantes WO1998028431A1 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
EP97950332A EP0948633A1 (fr) 1996-12-24 1997-12-24 Regulation de la transcription chez les plantes
GB9914211A GB2335195B (en) 1996-12-24 1997-12-24 Transcriptional regulation in plants
AU53330/98A AU5333098A (en) 1996-12-24 1997-12-24 Transcriptional regulation in plants

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB9626858.6A GB9626858D0 (en) 1996-12-24 1996-12-24 Transcriptional regulation in plants
GB9626858.6 1996-12-24

Publications (1)

Publication Number Publication Date
WO1998028431A1 true WO1998028431A1 (fr) 1998-07-02

Family

ID=10805009

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB1997/003546 WO1998028431A1 (fr) 1996-12-24 1997-12-24 Regulation de la transcription chez les plantes

Country Status (4)

Country Link
EP (1) EP0948633A1 (fr)
AU (1) AU5333098A (fr)
GB (2) GB9626858D0 (fr)
WO (1) WO1998028431A1 (fr)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000017365A2 (fr) * 1998-09-23 2000-03-30 E.I. Du Pont De Nemours And Company Systeme binaire d'expression virale dans des plantes
WO2002010415A2 (fr) * 2000-07-28 2002-02-07 University Of Connecticut Methodes d'excision controlees et automatiques d'adn heterologue issu de plantes transgeniques et cassettes de genes d'excision d'adn
WO2003000923A2 (fr) * 2001-06-25 2003-01-03 University Of Zurich Polynucleotide de regulation de gametophyte a effet maternel
WO2002008432A3 (fr) * 2000-07-27 2003-03-13 Rhobio Composition et procede permettant d'augmenter la frequence de la recombinaison meiotique dans des plantes
US6632980B1 (en) 1997-10-24 2003-10-14 E. I. Du Pont De Nemours And Company Binary viral expression system in plants
WO2004046361A1 (fr) 2002-11-20 2004-06-03 Icon Genetics Ag Procede pour reguler le processus cellulaire dans un organisme multicellulaire
US7264964B2 (en) 2001-06-22 2007-09-04 Ceres, Inc. Chimeric histone acetyltransferase polypeptides
US7476777B2 (en) 2002-09-17 2009-01-13 Ceres, Inc. Biological containment system
US7638680B2 (en) 1997-02-05 2009-12-29 Utah State University Methods for stabilizing and controlling apomixis

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1990008825A1 (fr) * 1989-01-26 1990-08-09 Imperial Chemical Industries Plc Sequences de genes specifiques a des fleurs males
WO1997043427A1 (fr) * 1996-05-14 1997-11-20 Novartis Ag Production de graines apomictiques

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EG23907A (en) * 1994-08-01 2007-12-30 Delta & Pine Land Co Control of plant gene expression

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1990008825A1 (fr) * 1989-01-26 1990-08-09 Imperial Chemical Industries Plc Sequences de genes specifiques a des fleurs males
WO1997043427A1 (fr) * 1996-05-14 1997-11-20 Novartis Ag Production de graines apomictiques

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DALE E C ET AL: "GENE TRANSFER WITH SUBSEQUENT REMOVAL OF THE SELECTION GENE FROM THE HOST GENOME", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, vol. 88, December 1991 (1991-12-01), pages 10558 - 10562, XP002043803 *
KLIMYUK V. AND JONES J.: "AtDMC1, the Arabidopsis homologue of the yeast DMC1 gene: characterization, transposon-induced allelic variation and meiosis-associated expression", THE PLANT JOURNAL, vol. 11, no. 1, January 1997 (1997-01-01), pages 1 - 14, XP002064286 *
KOBAYASHI T. ET AL.: "Characterization of cDNAs induced in meiotic prophase in lily microspores", DNA RESEARCH, vol. 1, no. 1, 1994, pages 15 - 26, XP002064285 *
SATO S. ET AL.: "Structural analysis of a recA-like gene in the genome of Arabidopsis thaliana", DNA RESEARCH, vol. 2, no. 2, 1995, pages 89 - 93, XP002064284 *

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7638680B2 (en) 1997-02-05 2009-12-29 Utah State University Methods for stabilizing and controlling apomixis
US6632980B1 (en) 1997-10-24 2003-10-14 E. I. Du Pont De Nemours And Company Binary viral expression system in plants
WO2000017365A2 (fr) * 1998-09-23 2000-03-30 E.I. Du Pont De Nemours And Company Systeme binaire d'expression virale dans des plantes
WO2000017365A3 (fr) * 1998-09-23 2000-08-24 Du Pont Systeme binaire d'expression virale dans des plantes
WO2002008432A3 (fr) * 2000-07-27 2003-03-13 Rhobio Composition et procede permettant d'augmenter la frequence de la recombinaison meiotique dans des plantes
WO2002010415A2 (fr) * 2000-07-28 2002-02-07 University Of Connecticut Methodes d'excision controlees et automatiques d'adn heterologue issu de plantes transgeniques et cassettes de genes d'excision d'adn
WO2002010415A3 (fr) * 2000-07-28 2002-06-20 Univ Connecticut Methodes d'excision controlees et automatiques d'adn heterologue issu de plantes transgeniques et cassettes de genes d'excision d'adn
US7264964B2 (en) 2001-06-22 2007-09-04 Ceres, Inc. Chimeric histone acetyltransferase polypeptides
WO2003000923A2 (fr) * 2001-06-25 2003-01-03 University Of Zurich Polynucleotide de regulation de gametophyte a effet maternel
WO2003000923A3 (fr) * 2001-06-25 2003-10-16 Univ Zuerich Polynucleotide de regulation de gametophyte a effet maternel
US7476777B2 (en) 2002-09-17 2009-01-13 Ceres, Inc. Biological containment system
WO2004046361A1 (fr) 2002-11-20 2004-06-03 Icon Genetics Ag Procede pour reguler le processus cellulaire dans un organisme multicellulaire

Also Published As

Publication number Publication date
GB2335195B (en) 2001-09-19
GB9914211D0 (en) 1999-08-18
AU5333098A (en) 1998-07-17
EP0948633A1 (fr) 1999-10-13
GB9626858D0 (en) 1997-02-12
GB2335195A (en) 1999-09-15

Similar Documents

Publication Publication Date Title
Klimyuk et al. AtDMC1, the Arabidopsis homologue of the yeast DMC1 gene: characterization, transposon‐induced allelic variation and meiosis‐associated expression
US7115798B1 (en) Methods for regulated expression of triats in plants using multiple site-specific recombination systems
AU2020202241B2 (en) Manipulation of dominant male sterility
US20030074699A1 (en) Genetic control of flowering
Cardon et al. Mobility of the maize transposable element En/Spm in Arabidopsis thaliana
AU2019240727A1 (en) Compositions and methods comprising male fertility sequences
CA2281862C (fr) Procede de production de graines hybrides utilisant la fertilite femelle conditionnelle
MXPA99008098A (en) Method of hybrid seed production using conditional female sterility
US7525015B2 (en) Prevention of transgene escape in genetically modified perennials
EP0948633A1 (fr) Regulation de la transcription chez les plantes
WO1994025593A2 (fr) Procede permettant d'obtenir des plantes males steriles
JP4603882B2 (ja) 子孫への形質分配が制御されているトランスジェニック植物
CA3226793A1 (fr) Procedes et compositions se rapportant a des lignees de mainteneurs pour la sterilite male
AU2000270487B2 (en) Reduction of transmission of transgenes in plants
US6815577B1 (en) Method of hybrid seed production using conditional female sterility
Firek et al. Gametophyte‐specific transposition of the maize Ds element in transgenic tobacco
MXPA05011893A (es) Fragmento de dna especifico para el pimiento esteril masculin o citoplasmico y uso del mismo.
CA2200496C (fr) Transformation genetique a l'aide d'un inhibiteur de la parp
Masterson et al. Transgenic plants and the study of plant development
Llewellyn et al. WD Sutton”
AU1157399A (en) Methods for obtaining plant varieties

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM GW HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW AM AZ BY KG KZ MD RU TJ TM

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SZ UG ZW AT BE CH DE DK ES FI FR GB GR IE

121 Ep: the epo has been informed by wipo that ep was designated in this application
ENP Entry into the national phase

Ref country code: GB

Ref document number: 9914211

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 1997950332

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 09331539

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 1997950332

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWW Wipo information: withdrawn in national office

Ref document number: 1997950332

Country of ref document: EP