WO1998028418A1

WO1998028418A1 - Tailless nuclear hormone receptor (tlx receptor)

Info

Publication number: WO1998028418A1
Application number: PCT/GB1997/003526
Authority: WO
Inventors: Lee James Beeley; Owen Jenkins; Danuta Ewa Irena Mossakowska
Original assignee: Smithkline Beecham Plc
Priority date: 1996-12-23
Filing date: 1997-12-23
Publication date: 1998-07-02
Also published as: GB9626699D0; JP2000506397A; CA2246787A1; EP0902837A1

Abstract

Tailless nuclear hormone polypeptides and polynucleotides and methods for producing such polypeptides by recombinant techniques are disclosed. Also disclosed are methods for utilizing these polypeptides and polynucleotides in therapy, and diagnostic assays for such.

Description

TAILLESS NUCLEAR HORMONE RECEPTOR (TLX RECEPTOR)

FIELD OF INVENTION

This invention relates to newly identified polynucleotides, polypeptides encoded by them and to the use of such polynucleotides and polypeptides, and to their production.

More particularly, the polynucleotides and polypeptides of the present invention relate to a nuclear hormone receptor, hereinafter referred to as tailless nuclear hormone receptor (TLX). The invention also relates to inhibiting or activating the action of such polynucleotides and polypeptides.

BACKGROUND OF THE INVENTION

Nuclear hormone receptors are a large superfamily of proteins found in all vertebrates and invertebrates whose function is to modulate gene transcription, (reviewed in Parker (1993) Curr. Op. Cell. Biol 5:499-504, Laudet et al, (1992) EMBO J. 1 1 : 1003-1013, Mangelsdorf et al, 1995 Cell 83:835-839, Lopes da Silva and Burbach (1995) Trends Neurosci. 18:542-548). These share a similar domain structure which includes a DNA- binding domain and a ligand-binding domain. Based on structural relationships, these receptors can be grouped into sub-families such as the steroid hormone receptors, thyroid hormone receptors and retinoic acid receptors but there is also a large and growing family of a number of receptors that have no known ligands and hence are termed orphan receptors. The DNA-binding domain can interact with cw-acting elements of specific target genes in response to chemical signals and/or signal transduction pathways. In the case of the classical receptors such as the steroid hormone receptors, signals from the endocrine system such as estradiol, testosterone, progesterone can be transduced into cellular responses by direct interaction of the hormones with the ligand-binding domains of these proteins. Other natural ligands for some of these receptors have been identified and include, all-trans retinoic acid, 1,25-dihydroxyvitamin D3, 3,5,3'-L-triodothyronine and 15- deoxy-Δ^{12 r} -prostaglandin J₂ (Mangelsdorf et al, 1995 Cell 83:835-839).

TLX which is also known as tailless (Monaghan et al, 1995, Development, 121 :839-853, Pignoni et al, 1990, Cell, 62: 151- 163) has been found in Drosophila (Pignoni et al, 1990), mouse (Yu et al, 1994, Nature 370:375-379, Monaghan et al, 1995), Xenopus Holleman et al, 1996, GenBank Accession U67886) and chicken (Yu et al, 1994). TLX is expressed in the termini of the developing Drosophila embryo (Pignoni et al, 1990) and in the developing forebrain of chickens and mice (Yu et al, 1994, Monaghan et al, 1995). It has also been shown that loss of tailless function results in the absence of all protocerebral neuroblasts (Younossi-Hartenstein et al, 1997, Developmental Biology 182: 270-283). A mouse knockout of the tailless gene has been published (Monaghan et al, 1997, Nature 390: 515-517) which shows that the mice have a defective and limbic system and show a hyperexcitable, aggressive phenotype. The homozygous mutant mice are viable at birth but have a reduction in the size of rhinencephalic and limbic structures which include the olfactory, infrarhinal and entorhinal cortex, amygdala and dentate gyrus. Modification of TLX/ tailless function could alter diseases of the CNS not restricted to but including depression, anxiety, aggressive disorders, stroke, multiple sclerosis, Alzheimers,

Parkinsons, neuropathic pain, CNS inflammatory disorders and other neurodegenreative diseases, as well as eye defects and CNS developmental problems.

Recently, and after the priority date of the present invention, Jackson et al (Royal Free Hospital, London) have published the sequence of a human TLX gene (GenBank accession no Y 13276).

There remins a need for identification and characterization of further receptors which can play a role in therapy.

SUMMARY OF THE INVENTION In one aspect, the invention relates to tailless nuclear hormone receptor polypeptides and recombinant materials and methods for their production. Another aspect of the invention relates to methods for using such tailless nuclear hormone receptor polypeptides and polynucleotides. Such uses include the treatment of disorders of the central nervous system such as depression, anxiety, aggressive disorders, stroke, multiple sclerosis, Alzheimers, Parkinsons, neuropathic pain, CNS inflammatory disorders and other neurodegenreative diseases, eye defects and CNS developmental problems among others. In still another aspect, the invention relates to methods to identify agonists and antagonists using the materials provided by the invention, and treating conditions associated with tailless nuclear hormone receptor imbalance with the identified compounds. Yet another aspect of the invention relates to diagnostic assays for detecting diseases associated with inappropriate tailless nuclear hormone receptor activity or levels. BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows the nucleotide sequence SEQ ID NO: 1 and deduced amino acid sequence SEQ ID NO: 2 of human tailless nuclear hormone receptor.

DESCRD7TION OF THE INVENTION Definitions

The following definitions are provided to facilitate understanding of certain terms used frequently herein.

"tailless nuclear hormone receptor" refers generally to a polypeptide having the amino acid sequence set forth in SEQ ID NO:2or an allelic variant thereof.

"Receptor Activity" or "Biological Activity of the Receptor" refers to the metabolic or physiologic function of said tailless nuclear hormone receptor including similar activities or improved activities or these activities with decreased undesirable side-effects. Also included are antigenic and immunogenic activities of said tailless nuclear hormone receptor. "tailless nuclear hormone receptor polypeptides" refers to polypeptides with amino acid sequences sufficiently similar to tailless nuclear hormone receptorsequences, preferably exhibiting at least one biological activity of the receptor.

"tailless nuclear hormone receptor gene" refers to a polynucleotide having the nucleotide sequence set forth in SEQ ID NO:l or allelic variants thereof and/or their complements.

"tailless nuclear hormone receptor polynucleotides" refers to polynucleotides containing a nucleotide sequence which encodes a tailless nuclear hormone receptor polypeptide or fragment thereof, or a nucleotide sequence which has at least 92% identity to a nucleotide sequence encoding the polypeptide of SEQ ID NO:2 or the corresponding fragment thereof, or a nucleotide sequence which has sufficient identity to a nucleotide sequence contained in SEQ ID NO: 1 to hybridize under conditions useable for amplification or for use as a probe or marker.

"Antibodies" as used herein includes polyclonal and monoclonal antibodies, chimeric, single chain, and humanized antibodies, as well as Fab fragments, including the products of an Fab or other immunoglobulin expression library.

"Isolated" means altered "by the hand of man" from the natural state. If an "isolated" composition or substance occurs in nature, it has been changed or removed from its original environment, or both. For example, a polynucleotide or a polypeptide naturally present in a living animal is not "isolated," but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is "isolated", as the term is employed herein.

"Polynucleotide" generally refers to any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. "Polynucleotides" include, without limitation single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. In addition, "polynucleotide" refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. The term polynucleotide also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons. "Modified" bases include, for example, tritylated bases and unusual bases such as inosine. A variety of modifications has been made to DNA and RNA; thus, "polynucleotide" embraces chemically, enzymatically or metabolically modified forms of polynucleotides as typically found in nature, as well as the chemical forms of DNA and RNA characteristic of viruses and cells. "Polynucleotide" also embraces relatively short polynucleotides, often referred to as oligonucleotides. "Polypeptide" refers to any peptide or protein comprising two or more amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres. "Polypeptide" refers to both short chains, commonly referred to as peptides, oligopeptides or oligomers, and to longer chains, generally referred to as proteins. Polypeptides may contain amino acids other than the 20 gene-encoded amino acids. "Polypeptides" include amino acid sequences modified either by natural processes, such as posttranslational processing, or by chemical modification techniques which are well known in the art. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature. Modifications can occur anywhere in a polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given polypeptide. Also, a given polypeptide may contain many types of modifications. Polypeptides may be branched as a result of ubiquitination, and they may be cyclic, with or without branching. Cyclic, branched and branched cyclic polypeptides may result from posttranslation natural processes or may be made by synthetic methods. Modifications include acetylation, acylation, ADP- ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cystine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination. See, for instance, PROTEINS - STRUCTURE AND MOLECULAR PROPERTIES, 2nd Ed., T. E. Creighton, W. H. Freeman and Company, New York, 1993 and Wold, F., Posttranslational Protein Modifications: Perspectives and Prospects, pgs. 1-12 in POSTTRANSLATIONAL COVALENT MODIFICATION OF PROTEINS, B. C. Johnson, Ed., Academic Press, New York, 1983; Seifter et al, "Analysis for protein modifications and nonprotein cofactors", Meth Enzymol (1990) 182:626-646 and Rattan et al, "Protein Synthesis: Posttranslational Modifications and Aging", Ann NY Acad Sci (1992) 663:48-62.

"Variant" as the term is used herein, is a polynucleotide or polypeptide that differs from a reference polynucleotide or polypeptide respectively, but retains essential properties. A typical variant of a polynucleotide differs in nucleotide sequence from another, reference polynucleotide. Changes in the nucleotide sequence of the variant may or may not alter the amino acid sequence of a polypeptide encoded by the reference polynucleotide. Nucleotide changes may result in amino acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by the reference sequence, as discussed below. A typical variant of a polypeptide differs in amino acid sequence from another, reference polypeptide. Generally, differences are limited so that the sequences of the reference polypeptide and the variant are closely similar overall and, in many regions, identical. A variant and reference polypeptide may differ in amino acid sequence by one or more substitutions, additions, deletions in any combination. A substituted or inserted amino acid residue may or may not be one encoded by the genetic code. A variant of a polynucleotide or polypeptide may be a naturally occurring such as an allelic variant, or it may be a variant that is not known to occur naturally. Non-naturally occurring variants of polynucleotides and polypeptides may be made by mutagenesis techniques or by direct synthesis.

"Identity" is a measure of the identity of nucleotide sequences or amino acid sequences. In general, the sequences are aligned so that the highest order match is obtained. "Identity" per se has an art-recognized meaning and can be calculated using published techniques. See, e.g.: (COMPUTATIONAL MOLECULAR BIOLOGY, Lesk, A.M., ed., Oxford University Press, New York, 1988; BIOCOMPUTING: INFORMATICS AND GENOME PROJECTS, Smith, D.W., ed., Academic Press, New York, 1993; COMPUTER ANALYSIS OF SEQUENCE DATA, PART I, Griffin, A.M., and Griffin, H.G., eds., Humana Press, New Jersey, 1994; SEQUENCE ANALYSIS IN MOLECULAR BIOLOGY, von Heinje, G., Academic Press, 1987; and SEQUENCE ANALYSIS PRIMER, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991). While there exist a number of methods to measure identity between two polynucleotide or polypeptide sequences, the term "identity" is well known to skilled artisans (Carillo, H., and Lipton, D., SLAM J Applied Math (1988) 48: 1073). Methods commonly employed to determine identity or similarity between two sequences include, but are not limited to, those disclosed in Guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994, and Carillo, H., and Lipton, D., SIAM J Applied Math (1988) 48:1073. Methods to determine identity and similarity are codified in computer programs. Preferred computer program methods to determine identity and similarity between two sequences include, but are not limited to, GCS program package (Devereux, J., et al., Nucleic Acids Research (1984) 12(1):387), BLASTP, BLASTN, FASTA (Atschul, S.F. et al, J Molec Biol (1990) 215:403).

The invention relates to polypeptides and polynucleotides of a novel tailless nuclear hormone receptor, which is related by amino acid sequence identity to mouse orphan nuclear receptor tailless. The invention relates especially to tailless nuclear hormone receptor materials having the nucleotide and amino acid sequences set out in Figure 1 (SEQ ID NOS: 1 and 2)

Polypeptides of the Invention

The tailless nuclear hormone receptor polypeptides of the present invention include the polypeptide of SEQ ID NO:2 (in particular the mature polypeptide) as well as tailless nuclear hormone receptor polypeptides which have at least 99% identity to the polypeptide of SEQ ID NO:2 or the relevant portion thereof.

The tailless nuclear hormone receptor polypeptides may be in the form of the "mature" protein or may be a part of a larger protein such as a fusion protein. It is often advantageous to include additional amino acid sequence which contains secretory or leader sequences, pro-sequences, sequences which aid in purification such as multiple histidine residues, or additional sequence for stability during recombinant production.

Biologically active fragments of the tailless nuclear hormone receptor polypeptides are also included in the invention. A fragment is a polypeptide having an amino acid sequence that entirely is the same as part, but not all, of the amino acid sequence of the aforementioned tailless nuclear hormone receptor polypeptides. As with tailless nuclear hormone receptor polypeptides, fragments may be "free-standing," or comprised within a larger polypeptide of which they form a part or region, most preferably as a single continuous region. Representative examples of polypeptide fragments of the invention, include, for example, fragments from about amino acid number 1 -20, 21 -40, 41 -60, 61 -80, 81 - 100, and 101 to the end of tailless nuclear hormone receptor polypeptide. In this context "about" includes the particularly recited ranges larger or smaller by several, 5, 4, 3, 2 or 1 amino acid at either extreme or at both extremes.

Preferred fragments include, for example, truncation polypeptides having the amino acid sequence of tailless nuclear hormone receptor polypeptides, except for deletion of a continuous series of residues that includes the amino terminus, or a continuous series of residues that includes the carboxyl terminus or deletion of two continuous series of residues, one including the amino terminus and one including the carboxyl terminus. Also preferred are fragments characterized by structural or functional attributes such as fragments that comprise alpha-helix and alpha-helix forming regions, beta-sheet and beta-sheet-forming regions, turn and turn-forming regions, coil and coil-forming regions, hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, flexible regions, surface-forming regions, substrate binding region, and high antigenic index regions. Biologically active fragments are those that mediate receptor activity, including those with a similar activity or an improved activity, or with a decreased undesirable activity. Also included are those that are antigenic or immunogenic in an animal, especially in a human.

Thus, the polypeptides of the invention include polypeptides having an amino acid sequence at least 99% identical to that of SEQ ID NO:2 or fragments thereof with at least 99% identity to the corresponding fragment of SEQ ID NO:2. Preferably, all of these polypeptides retain the biological activity of the receptor, including antigenic activity. Included in this group are variants of the defined sequence and fragments. Preferred variants are those that vary from the referents by conservative amino acid substitutions - i.e., those that substitute a residue with another of like characteristics. Typical such substitutions are among Ala, Val, Leu and He; among Ser and Thr; among the acidic residues Asp and Glu; among Asn and Gin; and among the basic residues Lys and Arg; or aromatic residues Phe and Tyr. Particularly preferred are variants in which several, 5-10, 1-5, or 1-2 amino acids are substituted, deleted, or added in any combination. The tailless nuclear hormone receptor polypeptides of the invention can be prepared in any suitable manner. Such polypeptides include isolated naturally occurring polypeptides, recombinantly produced polypeptides, synthetically produced polypeptides, or polypeptides produced by a combination of these methods. Means for preparing such polypeptides are well understood in the art.

Polynucleotides of the Invention

Another aspect of the invention relates to isolated polynucleotides which encode the tailless nuclear hormone receptor polypeptides and polynucleotides closely related thereto. Tailless nuclear hormone receptor of the invention is structurally related to other proteins of the nuclear hormone receptor, as shown by the results of sequencing the cDNA encoding human tailless nuclear hormone receptor. The cDNA sequence contains an open reading frame encoding a protein of 385 amino acids with a deduced molecular weight of 42.6 kDa. Tailless nuclear hormone receptor of Figure 1 (SEQ ID NO:2) has about 98% identity (using BLAST) identity in 385 amino acid residues with mouse tailless nuclear hormone receptor (Monaghan et al., Development, 121: 839-853, 1995). Tailless nuclear hormone receptor gene of Figure 1 (SEQ ID NO: 1) has about 91% (BLAST) identity in 1158 nucleotide residues with mouse tailless nuclear hormone receptor (Monaghan et al., Development, 121: 839-853, 1995).

Tailless nuclear hormone receptor of the invention differs in one position in the coding sequence, at position 268 from the sequence of Jackson et al (GenBank accession no Y 13276), having a T rather than a C at this position. This translates into a tyrosine at 90, rather than histidine, in the amino acid sequence. This difference could be the result of a polymorphic variation or a error, for instance a PCR error, in cloning the gene, to obtain the sequence. TLX from other species, such as frog, mouse, chicken, are found to have a C residue in the same place as the Jackson sequence.

One polynucleotide of the present invention encoding tailless nuclear hormone receptor may be obtained using standard cloning and screening, from a cDNA library derived from mRNA in cells of human amygdala using the expressed sequence tag (EST) analysis (Adams, M.D., et al. Science (1991) 252:1651-1656; Adams, M.D. et al, Nature, (1992) 355:632-634; Adams, M.D., et al, Nature (1995) 377 Supp:3-174). Polynucleotides of the invention can also be obtained from natural sources such as genomic DNA libraries or can be synthesized using well known and commercially available techniques. Thus, the nucleotide sequence encoding tailless nuclear hormone receptor polypeptides may be identical over its entire length to the coding sequence in Figure 1 (SEQ ID NO: l), or may be a degenerate form of this nucleotide sequence encoding the polypeptide of SEQ ID NO:2, or may be highly identical to a nucleotide sequence that encodes the polypeptide of SEQ ID NO:2. Preferably, the polynucleotides of the invention contain a nucleotide sequence that is at least 92% identical, preferably at least 95% identical, more preferably at least 97% identical, most preferably at least 99% identical with a nucleotide sequence encoding a tailless nuclear hormone receptor polypeptide, or at least 92% identical, preferably at least 95% identical, more preferably at least 97% identical, with the encoding nucleotide sequence set forth in Figure 1 (SEQ ID NO: l), or at least 92% identical, preferably at least 95% identical, more preferably at least 97% identical, to a nucleotide sequence encoding the polypeptide of SEQ ID NO:2.

When the polynucleotides of the invention are used for the recombinant production of tailless nuclear hormone receptor polypeptide, the polynucleotide may include the coding sequence for the mature polypeptide or a fragment thereof, by itself; the coding sequence for the mature polypeptide or fragment in reading frame with other coding sequences, such as those encoding a leader or secretory sequence, a pre-, or pro- or prepro- protein sequence, or other fusion peptide portions. For example, a marker sequence which facilitates purification of the fused polypeptide can be encoded. In certain preferred embodiments of this aspect of the invention, the marker sequence is a hexa-histidine peptide, as provided in the pQE vector (Qiagen, Inc.) and described in Gentz et al, Proc NatlAcadSci USA (1989) 86:821-824, or is an HA tag. The polynucleotide may also contain non-coding 5' and 3' sequences, such as transcribed, non-translated sequences, splicing and polyadenylation signals, ribosome binding sites and sequences that stabilize mRNA. Among particularly preferred embodiments of the invention are polynucleotides encoding tailless nuclear hormone receptor polypeptides having the amino acid sequence set out in Figure 1 (SEQ ID NO:2) and variants thereof.

Further preferred embodiments are polynucleotides encoding tailless nuclear hormone receptor variants that have the amino acid sequence of the tailless nuclear hormone receptor of Figure 1 (SEQ ID NO:2) in which several, 5-10, 1-5, 1-3, 1-2 or 1 amino acid residues are substituted, deleted or added, in any combination.

Further preferred embodiments of the invention are polynucleotides that are at least 92% identical over their entire length to a polynucleotide encoding the tailless nuclear hormone receptor polypeptide having the amino acid sequence set out in Figure 1 (SEQ ID NO:2), and polynucleotides which are complementary to such polynucleotides. Most highly preferred are polynucleotides that comprise a region that is at least 92% identical over their entire length to a polynucleotide encoding the tailless nuclear hormone receptor polypeptide of the human cDNA of the deposited clone and polynucleotides complementary thereto. In this regard, polynucleotides with at least 97% are highly preferred and those with at least 98- 99% are most highly preferred, with at least 99% being the most preferred.

The present invention further relates to polynucleotides that hybridize to the herein above-described sequences. In this regard, the present invention especially relates to polynucleotides which hybridize under stringent conditions to the herein above-described polynucleotides. As herein used, the term "stringent conditions" means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences.

Polynucleotides of the invention, which are sufficiently identical to a nucleotide sequence contained in SEQ ID NO: 1 , may be used as hybridization probes for cDNA and genomic DNA, to isolate full-length cDNAs and genomic clones encoding tailless nuclear hormone receptor and to isolate cDNA and genomic clones of other genes that have a high sequence similarity to the tailless nuclear hormone receptor gene. Such hybridization techniques are known to those of skill in the art. Typically these nucleotide sequences are 70% identical, preferably 80% identical, more preferably 90% identical to that of the referent. The probes generally will comprise at least 15 nucleotides. Preferably, such probes will have at least 30 nucleotides and may have at least 50 nucleotides. Particularly preferred probes will range between 30 and 50 nucleotides. The polynucleotides and polypeptides of the present invention may be employed as research reagents and materials for discovery of treatments and diagnostics to animal and human disease.

Vectors, Host Cells, Expression

The present invention also relates to vectors which comprise a polynucleotide or polynucleotides of the present invention, and host cells which are genetically engineered with vectors of the invention and to the production of polypeptides of the invention by recombinant techniques. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention.

For recombinant production, host cells can be genetically engineered to incorporate expression systems or portions thereof for polynucleotides of the present invention. Introduction of polynucleotides into host cells can be effected by methods described in many standard laboratory manuals, such as Davis et al., BASIC METHODS IN MOLECULAR BIOLOGY (1986) and Sambrook et al., MOLECULAR CLONING: A LABORATORY

MANUAL, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989) such as calcium phosphate transfection, DEAE-dextran mediated transfection, transvection, microinjection, cationic lipid-mediated transfection, electroporation, transduction, scrape loading, ballistic introduction or infection. Representative examples of appropriate hosts include bacterial cells, such as streptococci, staphylococci, E. coli, Streptomyces and Bacillus subtilis cells; fungal cells, such as yeast cells and Aspergillus cells; insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, 293 and Bowes melanoma cells; and plant cells. A great variety of expression systems can be used. Such systems include, among others, chromosomal, episomal and virus-derived systems, e.g., vectors derived from bacterial plasmids, from bacteriophage, from transposons, from yeast episomes, from insertion elements, from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors derived from combinations thereof, such as those derived from plas id and bacteriophage genetic elements, such as cosmids and phagemids. The expression systems may contain control regions that regulate as well as engender expression. Generally, any system or vector suitable to maintain, propagate or express polynucleotides to produce a polypeptide in a host may be used. The appropriate nucleotide sequence may be inserted into an expression system by any of a variety of well-known and routine techniques, such as, for example, those set forth in Sambrook et al, MOLECULAR CLONING, A LABORATORY MANUAL {supra). For secretion of the translated protein into the lumen of the endoplasmic reticulum, into the periplasmic space or into the extracellular environment, appropriate secretion signals may be incorporated into the desired polypeptide. These signals may be endogenous to the polypeptide or they may be heterologous signals.

If the tailless nuclear hormone receptor polypeptide is to be expressed for use in screening assays, generally, it is preferred that the polypeptide be produced at the surface of the cell. In this event, the cells may be harvested prior to use in the screening assay. If tailless nuclear hormone receptor polypeptide is secreted into the medium, the medium can be recovered in order to recover and purify the polypeptide; if produced intracellularly, the cells must first be lysed before the polypeptide is recovered. Tailless nuclear hormone receptor polypeptides can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, high performance liquid chromatography is employed for purification. Well known techniques for refolding proteins may be employed to regenerate active conformation when the polypeptide is denatured during isolation and or purification.

Diagnostic Assays This invention also relates to the use of tailless nuclear hormone receptor polynucleotides for use as diagnostic reagents. Detection of a mutated form of tailless nuclear hormone receptor gene associated with a dysfunction will provide a diagnostic tool that can add to or define a diagnosis of a disease or susceptibility to a disease which results from under-expression, over-expression or altered expression of tailless nuclear hormone receptor. Individuals carrying mutations in the tailless nuclear hormone receptor gene may be detected at the DNA level by a variety of techniques.

Nucleic acids for diagnosis may be obtained from a subject's cells, such as from blood, urine, saliva, tissue biopsy or autopsy material. The genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR or other amplification techniques prior to analysis. RNA or cDNA may also be used in similar fashion. Deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype. Point mutations can be identified by hybridizing amplified DNA to labeled tailless nuclear hormone receptor nucleotide sequences. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase digestion or by differences in melting temperatures. DNA sequence differences may also be detected by alterations in electrophoretic mobility of DNA fragments in gels, with or without denaturing agents, or by direct DNA sequencing. See, e.g., Myers et al, Science (1985) 230: 1242. Sequence changes at specific locations may also be revealed by nuclease protection assays, such as RNase and SI protection or the chemical cleavage method. See Cotton et al, Proc Natl Acad Sci USA (1985) 85: 4397-4401.

The diagnostic assays offer a process for diagnosing or determining a susceptibility to depression, anxiety, aggressive disorders, stroke, multiple sclerosis, Alzheimers, Parkinsons, neuropathic pain, CNS inflammatory disorders and other neurodegenreative diseases, eye defects and CNS developmental problems, through detection of mutation in the tailless nuclear hormone receptor gene by the methods described.

In addition, depression, anxiety, aggressive disorders, stroke, multiple sclerosis, Alzheimers, Parkinsons, neuropathic pain, CNS inflammatory disorders and other neurodegenreative diseases, eye defects and CNS developmental problems, can be diagnosed by methods comprising determining from a sample derived from a subject an abnormally decreased or increased level of tailless nuclear hormone receptor polypeptide or tailless nuclear hormone receptor mRNA. Decreased or increased expression can be measured at the RNA level using any of the methods well known in the art for the quantitation of polynucleotides, such as, for example, PCR, RT-PCR, RNase protection, Northern blotting and other hybridization methods. Assay techniques that can be used to determine levels of a protein, such as an tailless nuclear hormone receptor, in a sample derived from a host are well-known to those of skill in the art. Such assay methods include radioimmunoassays, competitive-binding assays, Western Blot analysis and ELISA assays.

Chromosome Assays

The nucleotide sequences of the present invention are also valuable for chromosome identification. The sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome. The mapping of relevant sequences to chromosomes according to the present invention is an important first step in correlating those sequences with gene associated disease. Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found, for example, in V. McKusick,

Mendelian Inheritance in Man (available on line through Johns Hopkins University Welch Medical Library). The relationship between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes). The differences in the cDNA or genomic sequence between affected and unaffected individuals can also be determined. If a mutation is observed in some or all of the affected individuals but not in any normal individuals, then the mutation is likely to be the causative agent of the disease.

Chromosomal localisation has shown that the gene is localised to 6q21 and is in a region that maps to a translocation associated with a CNS disorder. This localisation has been corroborated by Jackson et al. (vide infra).

Antibodies

The polypeptides of the invention or their fragments or analogs thereof, or cells expressing them can also be used as immunogens to produce antibodies immunospecific for the tailless nuclear hormone receptor polypeptides. The term "immunospecific" means that the antibodies have substantiall greater affinity for the polypeptides of the invention than their affinity for other related polypeptides in the prior art.

Antibodies generated against the tailless nuclear hormone receptor polypeptides can be obtained by administering the polypeptides or epitope-bearing fragments, analogs or cells to an animal, preferably a nonhuman, using routine protocols. For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler, G. and Milstein, C, Nature (1975) 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al, Immunology Today (1983) 4:72) and the EBV-hybridoma technique (Cole et al,

MONOCLONAL ANTIBODIES AND CANCER THERAPY, pp. 77-96, Alan R. Liss, Inc., 1985). Techniques for the production of single chain antibodies (U.S. Patent No. 4,946,778) can also be adapted to produce single chain antibodies to polypeptides of this invention. Also, transgenic mice, or other organisms including other mammals, may be used to express humanized antibodies. The above-described antibodies may be employed to isolate or to identify clones expressing the polypeptide or to purify the polypeptides by affinity chromatography.

Antibodies against tailless nuclear hormone receptor polypeptides may also be employed to treat depression, anxiety, aggressive disorders, stroke, multiple sclerosis, Alzheimers, Parkinsons, neuropathic pain, CNS inflammatory disorders and other neurodegenreative diseases, eye defects and CNS developmental problems, among others.

Vaccines

Another aspect of the invention relates to a method for inducing an immunological response in a mammal which comprises inoculating the mammal with tailless nuclear hormone receptor polypeptide, or a fragment thereof, adequate to produce antibody and/or T cell immune response to protect said animal from depression, anxiety, aggressive disorders, stroke, multiple sclerosis, Alzheimers, Parkinsons, neuropathic pain, CNS inflammatory disorders and other neurodegenreative diseases, eye defects and CNS developmental problems, among others. Yet another aspect of the invention relates to a method of inducing immunological response in a mammal which comprises, delivering tailless nuclear hormone receptor gene via a vector directing expression of tailless nuclear hormone receptor polypeptide in vivo in order to induce such an immunological response to produce antibody to protect said animal from diseases.

Further aspect of the invention relates to an immunological/vaccine formulation (composition) which, when introduced into a mammalian host, induces an immunological response in that mammal to a tailless nuclear hormone receptor polypeptide wherein the composition comprises a tailless nuclear hormone receptor polypeptide or tailless nuclear hormone receptor gene. The vaccine formulation may further comprise a suitable carrier. Since tailless nuclear hormone receptor polypeptide may be broken down in the stomach, it is preferably administered parenterally (including subcutaneous, intramuscular, intravenous, intradermal etc. injection). Formulations suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti- oxidants, buffers, bacteriostats and solutes which render the formulation instonic with the blood of the recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents or thickening agents. The formulations may be presented in unit-dose or multi-dose containers, for example, sealed ampoules and vials and may be stored in a freeze-dried condition requiring only the addition of the sterile liquid carrier immediately prior to use. The vaccine formulation may also include adjuvant systems for enhancing the immunogenicity of the formulation, such as oil-in water systems and other systems known in the art. The dosage will depend on the specific activity of the vaccine and can be readily determined by routine experimentation.

Screening Assays

The tailless nuclear hormone receptor of the present invention may be employed in a screening process for compounds which bind the receptor and which activate (agonists) or inhibit activation of (antagonists) the receptor polypeptide of the present invention. Thus, polypeptides of the invention may also be used to assess the binding of small molecule substrates and ligands in, for example, cells, cell-free preparations, chemical libraries, and natural product mixtures. These substrates and ligands may be natural substrates and ligands or may be structural or functional mimetics. See Coligan et al, Current Protocols in Immunology l(2):Chapter 5 (1991).

Tailless nuclear hormone receptor proteins are ubiquitous in the mammalian host and are responsible for many biological functions, including many pathologies. Accordingly, it is desirous to find compounds and drugs which stimulate tailless nuclear hormone receptor on the one hand and which can inhibit the function of tailless nuclear hormone receptor on the other hand. In general, agonists are employed for therapeutic and prophylactic purposes for such conditions as depression, anxiety, aggressive disorders, stroke, multiple sclerosis, Alzheimers, Parkinsons, neuropathic pain, CNS inflammatory disorders and other neurodegenreative diseases, eye defects and CNS developmental problems. Antagonists may be employed for a variety of therapeutic and prophylactic purposes for such conditions as depression, anxiety, aggressive disorders, stroke, multiple sclerosis, Alzheimers, Parkinsons, neuropathic pain, CNS inflammatory disorders and other neurodegenreative diseases, eye defects and CNS developmental problems,.

In general, such screening procedures involve producing appropriate cells which express the receptor polypeptide of the present invention on the surface thereof. Such cells include cells from mammals, yeast. Drosophila or E. coli. Cells expressing the receptor (or cell membrane containing the expressed receptor) are then contacted with a test compound to observe binding, or stimulation or inhibition of a functional response.

An example of an assay may employ a chimeric receptor comprising the ligand binding domain of the tailless nuclear hormone receptor of the invention and the DNA binding domain of another protein in a reporter gene assay This would take the form of a CIS-TRANS assay. An example of such chimeric receptor comprises a polypeptide corrresponding to amino acid residue 104 to 385 or 83 to 385 of SEQ ID NO: 2. An assay may also be configured by direct expression of the ligand binding domain as an E. coli GST-fusion. This may be used as a ligand binding assay or as a fluorescence capture assay. The assays may simply test binding of a candidate compound wherein adherence to the cells bearing the receptor is detected by means of a label directly or indirectly associated with the candidate compound or in an assay involving competition with a labeled competitor. Further, these assays may test whether the candidate compound results in a signal generated by activation of the receptor, using detection systems appropriate to the cells bearing the receptor at their surfaces. Inhibitors of activation are generally assayed in the presence of a known agonist and the effect on activation by the agonist by the presence of the candidate compound is observed. Standard methods for conducting such screening assays are well understood in the art.

Examples of potential tailless nuclear hormone receptor antagonists include antibodies or, in some cases, oligonucleotides or proteins which are closely related to the ligand of the tailless nuclear hormone receptor, e.g., a fragment of the ligand, or small molecules which bind to the receptor but do not elicit a response, so that the activity of the receptor is prevented.

Prophylactic and Therapeutic Methods

This invention provides methods of treating an abnormal conditions related to both an excess of and insufficient amounts of tailless nuclear hormone receptor activity.

If the activity of tailless nuclear hormone receptor is in excess, several approaches are available. One approach comprises administering to a subject an inhibitor compound (antagonist) as hereinabove described along with a pharmaceutically acceptable carrier in an amount effective to inhibit activation by blocking binding of ligands to the tailless nuclear hormone receptor, or by inhibiting a second signal, and thereby alleviating the abnormal condition. In another approach, soluble forms of tailless nuclear hormone receptor polypeptides still capable of binding the ligand in competition with endogenous tailless nuclear hormone receptor may be administered. Typical embodiments of such competitors comprise fragments of the tailless nuclear hormone receptor polypeptide. In still another approach, expression of the gene encoding endogenous tailless nuclear hormone receptor can be inhibited using expression blocking techniques. Known such techniques involve the use of antisense sequences, either internally generated or separately administered. See, for example, O'Connor, J Neurochem (1991) 56:560 in Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression. CRC Press, Boca Raton, FL (1988). Alternatively, oligonucleotides which form triple helices with the gene can be supplied. See, for example, Lee et al, Nucleic Acids Res (1979) 6:3073; Cooney et al, Science (1988) 241:456; Dervan et al, Science (1991) 251: 1360. These oligomers can be administered er se or the relevant oligomers can be expressed in vivo.

For treating abnormal conditions related to an under-expression of tailless nuclear hormone receptor and its activity, several approaches are also available. One approach comprises administering to a subject a therapeutical ly effective amount of a compound which activates tailless nuclear hormone receptor, i.e., an agonist as described above, in combination with a pharmaceutically acceptable carrier, to thereby alleviate the abnormal condition. Alternatively, gene therapy may be employed to effect the endogenous production of tailless nuclear hormone receptor by the relevant cells in the subject. For example, a polynucleotide of the invention may be engineered for expression in a replication defective retroviral vector, as discussed above. The retroviral expression construct may then be isolated and introduced into a packaging cell transduced with a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention such that the packaging cell now produces infectious viral particles containing the gene of interest. These producer cells may be administered to a subject for engineering cells in vivo and expression of the polypeptide in vivo. For overview of gene therapy, see Chapter 20, Gene Therapy and other Molecular Genetic-based Therapeutic Approaches, (and references cited therein) in Human Molecular Genetics, T Strachan and A P Read, BIOS Scientific Publishers Ltd (1996).

Formulation and Administration

Peptides, such as the soluble form of tailless nuclear hormone receptor polypeptides, and agonists and antagonist peptides or small molecules, may be formulated in combination with a suitable pharmaceutical carrier. Such formulations comprise a therapeutical ly effective amount of the polypeptide or compound, and a pharmaceutically acceptable carrier or excipient. Such carriers include but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. Formulation should suit the mode of administration, and is well within the skill of the art. The invention further relates to pharmaceutical packs and kits comprising one or more containers filled with one or more of the ingredients of the aforementioned compositions of the invention.

Polypeptides and other compounds of the present invention may be employed alone or in conjunction with other compounds, such as therapeutic compounds. Preferred forms of systemic administration of the pharmaceutical compositions include injection, typically by intravenous injection. Other injection routes, such as subcutaneous, intramuscular, or intraperitoneal, can be used. Alternative means for systemic administration include transmucosal and transdermal administration using enetrants such as bile salts or fusidic acids or other detergents. In addition, if properly formulated in enteric or encapsulated formulations, oral administration may also be possible. Administration of these compounds may also be topical and/or localized, in the form of salves, pastes, gels and the like.

The dosage range required depends on the choice of peptide, the route of administration, the nature of the formulation, the nature of the subject's condition, and the judgment of the attending practitioner. Suitable dosages, however, are in the range of 0.1-100 μg/kg of subject. Wide variations in the needed dosage, however, are to be expected in view of the variety of compounds available and the differing efficiencies of various routes of administration. For example, oral administration would be expected to require higher dosages than administration by intravenous injection. Variations in these dosage levels can be adjusted using standard empirical routines for optimization, as is well understood in the art. Polypeptides used in treatment can also be generated endogenously in the subject, in treatment modalities often referred to as "gene therapy" as described above. Thus, for example, cells from a subject may be engineered with a polynucleotide, such as a DNA or RNA, to encode a polypeptide ex vivo, and for example, by the use of a retroviral plasmid vector. The cells are then introduced into the subject.

The example below is carried out using standard techniques, which are well known and routine to those of skill in the art, except where otherwise described in detail. The example illustrates, but does not limit the invention. Example 1

HGS clone 243890 in E.coli host strain SOLR (Stratagene) was obtained from HGS and amplified in 250ml Luria Broth. Phagemid DNA was purified by caesium chloride centrifugation and sequenced on an ABI Prism 377 DNA sequencer using fluorescent dye- terminator cycle sequencing. Nucleotide sequence was obtained from both strands, initially using primers complementary to the T7 and T3 promoters in the pBluescript II SK + phagemid vector (Stratagene) and later using internal primers complementary to the generated sequence. The 5' end of the tailless nuclear hormone receptor gene missing from HGS clone

243890 was PCR amplified from a whole human brain Marathon-Ready™ cDNA library (Clontech) using the following synthetic oligonucleotide primers: 5 'GGCAGCTGATTCACACACCGACTCC3 ' ; and 5'GTGGCCACTTCATAGAGATACATTGGG3 ' according to manfacturer's instructions and cloned into pCRScript™ SK(+) (Stratagene).

Example 2 - tissue distribution

RT-PCR and the Taqman system (Perkin Elmer/Applied Biosystems) has been used to determine the tissue localisation of human tailless nuclear hormone receptor (TLX) in the CNS and peripheral tissues. RNA was obtained from eight different regions of the brain and fourteen peripheral tissues. Human TLX sequence specific primers were designed for RT-PCR and a second set of primers were designed for Taqman. RT-PCR showed that TLX was absent in the aorta, heart, pancreas, skeletal muscle, testes, prostate, lung, kidney, bone marrow, liver and adpiose tissue whereas TLX was present in the amygdala, caudate, hippocampus, thalmus, substansia nigra, cerebellum, hypothalamus, frontal cortex and spinal chord. Taqman data showed TLX was absent in the pancreas, lung, liver, spleen and bowel whereas TLX was present the amygdala, hippocampus, cerebellum, nucleus accumbens, striatum, putamen, para-hippocampal gyrus, medial frontal gyrus. TLX was present in the stomach at levels approximately 2 orders of magnitude less than in the brain regions. SEQUENCE LISTING

(1) GENERAL INFORMATION

(i) APPLICANT: SmithKline Beecham pic

(ii) TITLE OF THE INVENTION: Novel Compounds

(iii) NUMBER OF SEQUENCES: 2

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: SmithKline Beecham

(B) STREET: 2 New Horizons Court, Great West Road (C) CITY: Brentford

(D) STATE:

(E) COUNTRY: England

(F) ZIP: TW8 9EP

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Diskette

(B) COMPUTER: IBM Compatible

(C) OPERATING SYSTEM: DOS

(D) SOFTWARE: FastSEQ for Windows Version 2.0

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER:

(B) FILING DATE:

(C) CLASSIFICATION:

(vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER:

(B) FILING DATE:

(viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: Connell, Anthony C C

(B) REGISTRATION NUMBER: (C) REFERENCE/DOCKET NUMBER: P₃1700

(ix) TELECOMMUNICATION INFORMATION: (A) TELEPHONE :

(B) TELEFAX:

(C) TELEX:

( 2 ) INFORMATION FOR SEQ ID NO : 1 :

(i) SEQUENCE CHARACTERISTICS : (A) LENGTH : 1158 base pairs (B ) TYPE : nucleic acid

(C) STRANDEDNESS : single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 1 :

ATGAGCAAGC CAGCCGGATC AACAAGCCGC ATTTTAGATA TCCCCTGCAA AGTGTGTGGC 60

GACCGCAGCT CGGGGAAGCA CTACGGGGTC TACGCCTGCG ACGGCTGCTC AGGTTTTTTC 120 AAACGGAGCA TCCGAAGGAA TAGGACCTAT GTCTGCAAAT CTGGAAACCA GGGAGGCTGT 180

CCGGTGGACA AGACGCACAG AAACCAGTGC AGGGCGTGTC GGCTGAAGAA GTGTTTGGAA 240

GTCAACATGA ACAAAGACGC CGTGCAGTAC GAGCGGGGGC CTCGGACGTC CACCATCCGC ₃00

AAGCAAGTGG CCCTCTACTT CCGTGGACAC AAGGAGGAGA ACGGGGCCGC CGCGCACTTT 360

CCCTCGGCGG CGCTCCCTGC GCCGGCCTTC TTCACCGCGG TCACGCAGCT GGAGCCGCAC 420 GGCCTGGAGC TGGCCGCGGT GTCCACCACT CCAGAGCGGC AGACCCTCGT GAGCCTGGCT 480

CAGCCCACGC CCAAGTACCC CCATGAAGTG AATGGGACCC CAATGTATCT CTATGAAGTG 540

GCCACGGAGT CGGTGTGTGA ATCAGCTGCC AGACTTCTCT TCATGAGCAT CAAGTGGGCT 600

AAGAGTGTGC CAGCCTTCTC CACGCTGTCT TTGCAAGACC AGCTGATGCT TTTGGAAGAT 660

GCTTGGAGAG AACTGTTTGT TCTAGGAATA GCACAATGGG CCATTCCGGT TGATGCTAAC 720 ACTCTACTGG CTGTATCTGG CATGAACGGT GACAACACAG ATTCCCAGAA GCTGAACAAG 780

ATCATATCTG AAATACAGGC TTTACAAGAG GTGGTGGCTC GATTTAGACA ACTCCGGTTA 840

GATGCTACTG AATTTGCCTG TCTAAAATGC ATCGTCACTT TCAAAGCCGT TCCTACACAT 900

AGTGGTTCTG AACTGAGAAG TTTCCGGAAT GCTGCCGCCA TTGCAGCCCT TCAAGATGAG 960

GCTCAGCTAA CGCTCAACAG CTACATCCAT ACCAGATATC CCACTCAACC CTGTCGCTTT 1020 GGAAAACTCC TGTTGCTTTT GCCAGCTTTA CGTTCTATTA GCCCATCAAC TATAGAAGAA 1080

GTGTTTTTCA AAAAAACCAT CGGCAATGTG CCAATTACAA GACTGCTTTC AGATATGTAC 1140

AAATCCAGTG ATATCTAA 1158

(2) INFORMATION FOR SEQ ID NO : 2 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 385 amino acids

(B) TYPE: amino acid (C) STRANDEDNESS : single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 2 :

Met Ser Lys Pro Ala Gly Ser Thr Ser Arg lie Leu Asp lie Pro Cys

1 5 10 15

Lys Val Cys Gly Asp Arg Ser Ser Gly Lys His Tyr Gly Val Tyr Ala 20 25 30

Cys Asp Gly Cys Ser Gly Phe Phe Lys Arg Ser lie Arg Arg Asn Arg

35 40 45

Thr Tyr Val Cys Lys Ser Gly Asn Gin Gly Gly Cys Pro Val Asp Lys 50 55 60 Thr His Arg Asn Gin Cys Arg Ala Cys Arg Leu Lys Lys Cys Leu Glu 65 70 75 80

Val Asn Met Asn Lys Asp Ala Val Gin Tyr Glu Arg Gly Pro Arg Thr

85 90 95

Ser Thr lie Arg Lys Gin Val Ala Leu Tyr Phe Arg Gly His Lys Glu 100 105 110

Glu Asn Gly Ala Ala Ala His Phe Pro Ser Ala Ala Leu Pro Ala Pro

115 120 125

Ala Phe Phe Thr Ala Val Thr Gin Leu Glu Pro His Gly Leu Glu Leu

130 135 140 Ala Ala Val Ser Thr Thr Pro Glu Arg Gin Thr Leu Val Ser Leu Ala

145 150 155 160

Gin Pro Thr Pro Lys Tyr Pro His Glu Val Asn Gly Thr Pro Met Tyr

165 170 175

Leu Tyr Glu Val Ala Thr Glu Ser Val Cys Glu Ser Ala Ala Arg Leu 180 185 190

Leu Phe Met Ser lie Lys Trp Ala Lys Ser Val Pro Ala Phe Ser Thr

195 200 205

Leu Ser Leu Gin Asp Gin Leu Met Leu Leu Glu Asp Ala Trp Arg Glu

210 215 220 Leu Phe Val Leu Gly lie Ala Gin Trp Ala lie Pro Val Asp Ala Asn

225 230 235 240

Thr Leu Leu Ala Val Ser Gly Met Asn Gly Asp Asn Thr Asp Ser Gin

245 250 255

Lys Leu Asn Lys He He Ser Glu He Gin Ala Leu Gin Glu Val Val 250 265 270

Ala Arg Phe Arg Gin Leu Arg Leu Asp Ala Thr Glu Phe Ala Cys Leu

275 280 285

Lys Cys He Val Thr Phe Lys Ala Val Pro Thr His Ser Gly Ser Glu 290 295 300

Leu Arg Ser Phe Arg Asn Ala Ala Ala He Ala Ala Leu Gin Asp Glu 305 310 315 320

Ala Gin Leu Thr Leu Asn Ser Tyr He His Thr Arg Tyr Pro Thr Gin 325 330 335

Pro Cys Arg Phe Gly Lys Leu Leu Leu Leu Leu Pro Ala Leu Arg Ser

340 345 350

He Ser Pro Ser Thr He Glu Glu Val Phe Phe Lys Lys Thr He Gly 355 360 365 Asn Val Pro He Thr Arg Leu Leu Ser Asp Met Tyr Lys Ser Ser Asp 370 375 380

He 385

Claims

1. An isolated polynucleotide comprising a nucleotide sequence that is at least 92% identical to a nucleotide sequence encoding the polypetide of SEQ ID NO:2 or the corresponding fragment thereof; or a nucleotide sequence complementary to said nucleotide sequence.

2. The polynucleotide of claim 1 wherein said encoding nucleotide sequence encodes the polypeptide of SEQ ID NO:2 or a fragment thereof.

3. An isolated polynucleotide comprising a nucleotide sequence nucleotide which is at least 92% identical to that contained in SEQ ID NO: 1.

4. The polynucleotide of claim 3 wherein said nucleotide sequence is contained in SEQ ID NO:I .

5. A polynucleotide probe or primer comprising at least 15 contiguous nucleotides of the polynucleotide of claim 3.

6. A DNA or RNA molecule comprising an expression system wherein said expression system is capable of producing a tailless nuclear hormone receptor or a fragment thereof having at least 92% identity with a nucleotide sequence encoding the polypeptide of SEQ ID NO:2 or said fragment when said expression system is present in a compatible host cell.

7. A process for producing a cell which produces a tailless nuclear hormone receptor polypeptide or a fragment thereof comprising transforming or transfecting a host cell with the expression system of claim 6 such that the host cell, under appropriate culture conditions, produces a tailless nuclear hormone receptor polypeptide or fragment.

8. A tailless nuclear hormone receptor polypeptide or a fragment thereof comprising an amino acid sequence which is at least 99% identical to the amino acid sequence contained in SEQ ID NO:2.

9. The polypeptide of claim 8 which comprises the amino acid sequence of SEQ ID NO:2, or a fragment thereof.

10. An antibody immunospecific for the tailless nuclear hormone receptor polypeptide of claim 8.

1 1. A method for the treatment of a subject in need of enhanced tailless nuclear hormone receptor activity comprising:

(a) administering to the subject a therapeutical ly effective amount of an agonist to said receptor; and/or

(b) providing to the subject tailless nuclear hormone receptor polynucleotide in a form so as to effect production of said receptor activity in vivo.

12. A method for the treatment of a subject having need to inhibit tailless nuclear hormone receptor activity comprising:

(a) administering to the subject a therapeutical ly effective amount of an antagonist to said receptor; and/or

(b) administering to the subject a nucleic acid molecule that inhibits the expression of the nucleotide sequence encoding said receptor; and/or (c) administering to the subject a therapeutical ly effective amount of a polypeptide that competes with said receptor for its ligand.

13. A process for diagnosing a disease or a susceptibility to a disease in a subject related to expression or activity of tailless nuclear hormone receptor in a subject comprising:

(a) determining the presence or absence of a mutation in the nucleotide sequence encoding said tailless nuclear hormone receptor in the genome of said subject; and/or

(b) analyzing for the presence or amount of the tailless nuclear hormone receptor expression in a sample derived from said subject.

14. A method for identifying compounds which bind to tailless nuclear hormone receptor comprising: (a) contacting cells of claim 11 with a candidate compound; and

(b) assessing the ability of said candidate compound to bind to said cells.

15. The method of claim 14 which further includes determining whether the candidate compound effects a signal generated by activation of the tailless nuclear hormone receptor polypeptide at the surface of the cell, wherein a candidate compound which effects production of said signal is identified as an agonist.

16. An agonist identified by the method of claim 15.

17. The method of claim 14 which further includes contacting said cell with a known agonist for said tailless nuclear hormone receptor; and determining whether the signal generated by said agonist is diminished in the presence of said candidate compound, wherein a candidate compound which effects a diminution in said signal is identified as an antagonist for said tailless nuclear hormone receptor.

18. An antagonist identified by the method of claim 17.