CA2246787A1 - Novel compounds - Google Patents

Abstract

Tailless nuclear hormone polypeptides and polynucleotides and methods for producing such polypeptides by recombinant techniques are disclosed. Also disclosed are methods for utilizing these polypeptides and polynucleotides in therapy, and diagnostic assays for such.

Description

WO 98~28418 PCT/GB97/03526 TAILLESS NUCLEAR HORMONE RECEPTOR (TLX RECEPTOR) FIEI~D OF nNnrErrrION
This invention relates to newly identified polynucleotides~ polypeptides encoded by 5 them and to the use of such polynucleotides and polypeptides, and to their production.
More particularly, the polynucleotides and polypeptides of the present invention relate to a nuclear hormone receptor, hereinafter referred to as taiEless nuclear horrnone receptor (TLX).
The invention also relates to inhibiting or activating the action of such polynucleotides and polypeptides.
BACKGROUND OF rHE INVENTION
Nuclear hormone receptors are a large superfamily of proteins follnd in all vertebrates and inve. Lcbldles whose function is to modulate gene transcription. (reviewed in Parker (1993) C urr. Op. Cell. Biol 5:499-504, Laudet et al, (19923 EMBO J. 11: 1003-1013, Mangelsdorf et al, 1995 Cel~ 83:835-839, Lopes da Silva and Burbach (1995) Trends Neurosci. 18:542-548) These share a similar domain structure which includes a DNA-binding domain and a l igand-binding domain. Based on structural relationships, these receptors can be grouped into sub-families such as the steroid hormone receptors, thyroid hormone receptors and retinoic acid receptors but there is also a large and growing family of a number of receptors that have no known ligands and hence are terrned orphanreceptors. The DNA-binding domain can interact with cis-acting elements of specific target genes in response to chemical signals and/or signal transduction pathways. In the case of the classical receptors such as the steroid horrnone receptors, signals from the endocrine system such as estradiol, testosterone, proge~ rone can be transduced into cellular responses by direct interaction of the horrnones with the ligand-binding domains of these proteins. Other natural ligands for some of these receptors have been identified and include, all-trans retinoic acid, 1,25-dihydroxyvitamin D3, 3,5,3'-L-triodothyronine and 15-deoxy-~l2'l~-prostaglandin J2 (Mangelsdorfetal, 1995 Cell 83:835-839).
TLX which is also known as railless (Monaghan et al, 1995, Development, 121:839-853, Pignoni etal, 1990, Cell, 62:151-163) has been found in Drosophila(Pignoni et al, 1990), mouse (~ u et al, 1994, Nature 370:375-379, Monaghan et al, 1995), Xenopus Holleman et al. 1996. GenBank Accession U67886) and chicken (Yu et al, 1994). TLX is expressed in the termir.i of the developing Drosophila embryo (Pignoni et al, 1990) and in W 0 9~28418 PCT/GB97/03526 the developing forebrain of ~hickens and mice (Yu et al, 1994, Monaghan et al, 1995). It has also been shown that loss of tailless function results in the absence of all protocerebral neuroblasts (Younossi-Hartenstein et al, 1997, Developmental Biology 182: 270-283). A
mouse knockout of the ~illess gene has been published (Monaghan et al, 1997, Nature 3g0:
515-517) which shows that Ihe mice have a defective and iimbic system and show ahyperexcitable, aggressive phenotype. The homozygous mutant mice are viable at birth but have a reduction in the size of rhinencephalic and limbic structures which include the olfactor,v, infrarhinal and enl:orhinal cortex, amygdala and dentate gyrus. Modification of TLX/tailless function could alter diseases of the CNS not restricted to but including depression, anxiety, aggressive disorders, stroke, multiple sclerosis. Alzheimers, Parkinsons, neuropathic pain, CNS inflammator~, disorders and other neurodegen~eati.~e diseases, as well as eye defects and CNS developmental problems.
Recently, and after the priority date of the present invention, Jackson et al (Royal Free Hospital, ~ondon3 have published the se4uence of a human TLX gene (GenBank accession no Y13276).
There remins a need for identification and characterization of iilrther receptors which can play a role in therapy.

SUMl~Y OF THE INVhNTION
In one aspect, the invention relates to tailless nuclear hormone receptor polypeptides and recombinant rnaterials and methods for their production. Another aspect of the invention relates to methods for using such tailJess nuclear hormone receptor polypeptides and polynucleotides. Such uses include the treatment of disorders of the central nervous system such as depression, anxiety, aggressive disorders, stroke, multiple sclerosis, Alzheimers, Parkinsons, neuropathic pain, CNS infl~n-m~tf ry disorders and other neurodegenreative diseases, eye defects and CN'i developmental problems among others. In still another aspect, the invention relates to methods to identify agonists and antagonists using the materials provided b~v the in~lention, and treating conditions associated with tailless nuclear horrnone receptor imbalance ~,vith the identified compounds. Yet another aspect of the invention relates to diagnostic assays for detectinE~ diseases associated with inappropriate tailless nuclear hormone receptor activity or levels.

BRIEF DESCRIPTION OF THE DR~WINGS
Figure I shows the nucleotide sequence SEQ ID NO: I and deduced amino acid sequence SEQ 1~ NO 2 of human tailless nuclear hormone receptor.

5 DESC~IPTION OF THE INVENI ION
Definitions The following definitions are provided to faci3itate underst~nding of certain terrns used frequently herein "tailless nuclear horrnone receptor" refers generally to a polypeptide having the 10 amino acid sequence set forth in SEQ ID NO:20r an allelic variant thereof.
"Receptor Activity' or "Biological Activity oi'the Receptor" refers to the metabolic or physiologic function of said tailless nuclear hormone receptor including similar activities or improved activities or these activities with decreased undesirable side-effects. Also included are antigenic and irnmunogenic activities of said tailless nuclear hormone receptor.
1~ "tailless nuclear horrnone receptor polypeptides" refers to polypeptides with amino acid sequences sufficiently similar to tailless nuclear hormone receptorsequences, preferably exhibiting at least one biological activity of the receptor.
"tailless nuclear honnone receptor gene" refers to a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: I or allelic variants thereof and/or their 20 complements.
"tailless nuclear hormone receptor polynucleotides" refers to polynucleotides containing a nucleotide sequence which encodes a tailless nuclear hormone receptor polypeptide or fragment thereof, or a nucleotide sequence which has at least 9~% identity to a nucleotide sequence encoding the polypeptide of SEQ ID NO:2 or the co..ea~,onding 25 fragment thereof, or a nucleotide sequence which has sufficient identity to a nucleotide sequence contained in SEQ lD NO: I to hybridize under conditions useable for amplification or for use as a probe or marker.
"Amtibodies'' as used herein includes polyclonal and monoclonal antibodies, chimeric, single chain, and humanized antibodies, as well as Fab fragments, including the 30 products of an Fab or other immunoglobulin e.~cpression library.
"Isolated" means al~ered "by the hand of man' from the natural state. If an ''Isolated'' composition or substance occurs in nature, i~ has been changed or removed from its original environment, or botll. For e:cample, a polynucleotide or a polypeptide naturally present in a living anirnal is not "isolated," but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is "isolated", as the term is employed herein.
"Polynucleotide" generally refers to any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. "Polynucleotides" in lude, without limitation single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-~t,~nde RNA, and RNA that is mixhlre of single- and double-stranded regions, hybrid molecules comprising DNA and RNA lhat may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. In addition, "polynucleotide" refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. The terrn polynucleotide also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbanes modified for stability or for other reasons. ~'Modified"
bases include, for example, tritylated bases and unusual bases such as inosine. A variety of 1~ modifications has been made to DNA and RNA; thus, "polynucleotide" embraceschemically, enzymatically Ol metabolically modified forms of polynucleotides as typically found in nature, as well as the chemical forms of DNA and RNA characteristic of viruses and cells. "Polynucleotide" also embraces relatively short polynucleotides, often referred to as oligonucleotides.
"Polypeptide'~ refers to any peptide or protein comprising two or more amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres.
"Polypeptide" refers to both short chains, commonly referred to as peptides, oligopeptides or oligomers, and to k)nger chains, generally referred to as proteins. Polypeptides may contain amino acids other than the 20 gene-encoded arnino acids. "Polypeptides" include amino acid sequences modified either by natural processes, such as posttranslational processing, or by chemical modification techniques which are well known in the art. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature. Modifications can occur anywhere in a polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given polypeptide. Also, a given polypeptide mav contain many types of modifications. Polypeptides may be branched as a result of ubiquitination, and they may be cyclic, with or without branching. Cyclic, branched and W 0 9~8418 PCT/GBg7~3S26 branched cyclic polypeptides may result from posttranslation natural processes or may be made by synthetic methods. Modifications include acetylation, acylation, ADP-ribosylation, ~mid~tion, covalent attachment of flavin, covalent attachment of a heme moiety~ covalent attachment of a nucleotide or nucleotide derivative, covalent attachment 5 of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond forrnation, demethylation, formation of covaient cross-links, forrnation of cystine, forrnation of pyrogl--t~mate~ fonnylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic procPcsing phosphorylation, prenylation, 10 racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination. See, for instance, PROTEINS -STRUCTURE AND MOLE('ULAR PROPERTIES, 2nd Ed., T. E. Creighton, W. H.
Freeman and Company, New York, 1993 and Wold, F., Posttranslational Protein Modifications: Perspectives and Prospects, pgs. 1-12 hl POSTTRANSLAT1ONAL
15 COVALENT MODIFI('ATION OF PROTE~NS, B. C. Johnson, Ed., Academic Press, New York, 1983; Seifter et ~1., "Analysis for protein modifications and nonprotein cofactors", Me~h Enzymol ( I ~gO) 182:626-646 and Rattan et al., "Protein Synthesis:
Posttranslational Modifications and Aging", Ann NYAcad Sci ( 1992) 663:48-62.
"Variant" as the term is used herein, is a polynucleotide or polypeptide that differs 20 from a reference polynucleotide or polypeptide respectively, but retains essential properties. A typical variant of a polynucleotide differs in nucleotide sequence from another, reference polynucleotide. Changes in the nucleotide sequence of the variant may or may not alter the amino acid sequence of a polypeptide encoded by the reference polynucleotide. Nucleotide changes may result in amino acid substitutions, additions, 25 deletions, fusions and truncations in the polypeptide encoded by the reference sequence, as di.~cuc.ced below. A typical variant of a polypeptide differs in amino acid sequence from another, reference polypeptide. Generally, differences are limited so that the sequences of the reference polypeptide and the variant are ciosely sim ilar overall and, in many regions, identical. A variant and reference polypeptide may differ in amino acid sequence by one or 30 more substitutions, additions, deletions in any combination. A substituted or inserted amino acid residue may or may not be one encoded by the genetic code. A variant of a polynucleotide or polypeptide may be a naturally occurring such as an allelic variant, or it may be a variant that is not known to occur naturally. Non-naturally occurring variants of WO 98/28418 PCT/GB97103~26 polynucleotides and polypeptides may be made by mutagenesis techniques or by direct synthesis.
"Identity" is a mea;ure of the identity of nucleotide sequences or amino acid sequences. In general, the sequences are aligned so that the highest order match is obtained. "Identity"perse has an art-recognized meaning and can be calculated using published techniques. See, e.g.: (COMPUTATIONAL MOLECULAR BIOLOGY, Lesk, A.M., ed., Oxford Umversil:y Press, New York, 1988, BIOCOMPUTING: INFORMATICS
AND GENOME PROJEC~S, Smith, D.W., ed., Academic Press, New York, 1993;
COMPUTER ANALYSIS VF SEQUENC~ DATA, PART 1, Griffin, A.M., and Griffin, H.G., eds., Humana ~Press, hiew Jersey, 1994; SEQUENCE ANALYSIS IN MOLECULAR
BlOLOGY, von Heinje, G., Academic Press, 1987; and SEQUENCE ANALYSIS
PRIMER, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 19gl).
While there exist a number Df methods to measure identity between two polynucleotide or polypeptide sequences, the lerm "identity" is well known to skilled artisans (Carillo, H., and Lipton, D., SL4M J~pplied Ma~h (1988) 48: 1073) Methods commonly employed todetermine identity or similarity between two sequences include, but are not limited to, those disclosed in Guide to Huge C'omputers, Martin J Bishop, ed., Academic Press, San Diego, 1994, and Carillo, H.~ and Lipton, D., SIAM~JApplied Math ( ] 988) 48: 1073. Methods to determine identity and similarity are codified in computer programs. Preferred computer program methods to detennine identity and similarity between two sequences include, but are not limited to, GCS program package (Devereux, J., e~ al., Nucleic Acids Researc~
( l 984) 12(1):387), BLASTP, BLASTN, FASTA ~Atschul, S .F. et al., ~ Molec Biol ( 1990) 215:403).

The invention relate; to polypeptides and polynucleotides of a novel tailless nuclear hormone receptor, which is related by amino acid sequence identit~ to mouse orphan nuclear receptor tailless. The invention relates especially to tailless nuclear hormone receptor materials having the nucleotide and amino acid sequences set out in Figure I (SEQ
ID NOS: I and 2) Polypeptides of the Invention The tailless nuclear hormone receptor polypeptides of the present invention include the polypeptide of SEQ ID NO:2 (in particular the mature polypeptide) as well as tailless W O 9~8418 PCT/GB97/03~26 nuclear hormone receptor polypeptides which have at least 99% identity to the polypeptide of SEQ ID NO:2 or the relevant portion thereof.
The tailless nuclear horrnone receptor polypeptides may be in the forrn of the "mature" protein or may be a part of a larger protein such as a fusion protein. It is often 5 advantageous to include additional amino acid sequence which contains secretory or leader sequences, pro-sequences, sequences which aid in purification such as multiple histidine residues, or additional sequence for stability during recombinant production.
Biologically active fiagrnents ofthe tailless nuclear hormone lece~lvl- polypeptides are also included in the invention. A fragment is a polypeptide having an amino acid 10 sequence that entirely is the same as part, but not all, of the amino acid sequence of the afc,.~;l.,e.llioned tailless nuclear hormone receptor polypeptides. As with tailless nuclear horrnone receptor polypeptides, fr~gmentc may be "free-et~nfling " or comprised within a larger polypeptide of which they form a part or region, most preferably as a single continuous region. Representative examples of polypeptide fragments of the invention, include, for example, fragments from about amino acid number 1-20, 21-40, 41-60, 61-80, 81-100, and 101 to the end of tailless nuclear horrnone receptor polypeptide. In this context "about"
includes the particularly recited ranges larger or smaller by several, 5, 4, 3, 2 or I amino acid at either extreme or at both e~cl~lcs.
Preferred fragments include, for example, truncation polypeptides having the amino 20 acid sequence of tailless nuclear hormone receptor polypeptides, except for deletion of a continuous series of residues that includes the amino terrninus, or a continuous series of residues that includes the carboxyl terminus or deletion of two continuous series of residues, one including the amino terminus and one including the carboxyl terrninus. Also plef~ll. d are fragments characterized b~ structural or functional attributes such as fragments that 25 comprise alpha-helix and alpha-helix forming regions, beta-sheet and beta-sheet-forrning regions, turn and turn-forming regions, coil and coil-forming regions~ hydrophilic regions, hydrophobic regions, alpha arnphipathic regions, beta amphipathic regions, flexible regions, surface-forming regions, substrate binding region, and high antigenic index regions.
Biologically active fragments are those that mediate receptor activity. including those with a 30 similar activity or an improved activity, or with a decreased undesirable activity. Also included are those that are antigenic or immunogenic in an animal. especially in a human.
Thus, the polypeptides of the invention include polypeptides having an amino acid sequence at least 99% identical to that of SEQ ID NO:' or fragments thereof with at least 99%

W O 9~8418 PCT/GBg7~3526 identity to the corresponding fragment of SEQ ID NO 2. Preferably, all of these polypeptides retain the biological activity of the receptor, includine antigenic activity. Included in this group are variants of the defined sequence and fragments. Preferred variants are those that vary from the ~ e.ll~ by conservative amino acid substitutions - i.e., those that substitute a S residue with another of like cha.~eh.i~lics. Typical such substitutions are among Ala, Val, Leu and Ile; among Ser and Thr; among the acidic residues Asp and Glu; among Asn and Gln;
and among the basic residues Lys and Arg; or aromatic residues Phe and Tyr. Particularly preferred are variants in which several, 5-10, 1-~, or 1-' amino acids are substituted, deleted, or added in any comblnation.
I 0 The tailless nuclear horrnone receptor polypeptides of the invention can be prepared in any suitable manner. Such polypeptides include isolated naturally occurring polypeptides, recombinantly produced polypeptides, synthetically produced polypeptides, or polypeptides produced by a combination Df these methods. Means for preparing such polypeptides are well understood in the art Polyn~ oti~s of the Invt ntion Another aspect of the invention relates to isolated polynucleotides which encode the tailless nuclear horrnone receptor po1ypeptides and polynucleotides closely related thereto.
Tailless nuclear horrnone receptor of the invention is structurally related to other 20 proteins of the nuclear hormone receptor, as shown by the results of sequencing the cDNA
encoding human tailless nuclear hormone reccptor. The cDNA sequence contains an open reading frame encoding a protein of 385 amino acids with a deduced molecular weight of 42.6 kDa. Tailless nuclear horrnone receptor of Figure I (SEQ ID NO:2) has about 98%
identity (using BLAST) identity in 385 amino acid residues with mouse tailless nuclear hormone receptor (Monaghan et al., Dcvelop.. ent, 121: B39-853, 199~). Tailless nuclear horrnone receptor gene of Figure I ~SEQ ID NO: I ) has about 91 % (B~AST) identity in 1158 nucleotide residues with mouse tailless nuclear hormone receptor (Monaghan et al., Development, 1'~1: 839-853, 1995).
Tailless nuclear hormone receptor of the invention differs in one position in the 30 coding sequence, at position 268 from the sequence of Jackson e~ al (GenBank accession no Y 13276), having a T rather than a C at this position. This translates into a tyrosine at 90, rather than histidine, in the amino acid sequence. This difference could be the result of a polymorphic variation or a error, for instance a PCR error, in cloning the gene, to obtain the W 0 9~28418 P ~/GB97/03S26 sequence. TLX from other species, such as frog, mouse, chicken, are found to have a C
residue in the same place as the Jackson sequence.
One polynucleotide of the present invention encoding tailless nuclear hormone receptor may be obtained using standard cloning and screening, from a cDNA library derived from mRNA in cells of human amygdala using the expressed sequence tag (EST) analysis (Adams, M.D., et al .Scien, e (1991) 252: 1651-1656; Adams, M.D. et al., Nature, (1992) 35i:632-634; Adams, M.D., et al., Nature (1995) 377 Supp:3- 174). Polynucleotides of the mvention can also be obtairled from natural sources such as genomic DNA libraries or can be synthesized using well k:nown and commercially available techniques.
Thus, the nucleotide sequence encoding tailless nuclear hormone receptor polypeptides may be identical over its entire length to the coding sequence in Figure I
(SEQ ID NO: I )? or may be a degenerate form of this nucleotide sequence encoding the polypeptide of SEQ [D NO:2, or may be highly identical to a nucleotide sequence that encodes the polypeptide of SEQ ID 1~10:2. Preferably. the polynucleotides of the invention contain a nucleotide sequence that is at least 92% identical, preferably at least 95%
identical, more preferably at least 97% identical, most preferably at least 99% identical with a nucleotide sequence encoding a tailless nuclear hormone receptor polypeptide, or at least 92% identical, preferably al least 95% identi~l more preferably at least 97% identi~
with the encoding nucleotide sequence set forth in Figure I (SEQ ID NO:I), or at least 92%
identica~, preferably at least 95% iden~ic ll more preferably at least 97% identical, to a nucleotide sequence encoding the polypeptide of SEQ ID NO:2.
When the polynucleotides of the invention are used for the recombinant production of tailless nuclear honnone receptor polypeptide, the polynucleotide may include the coding sequence for the mature polypeptide or a fragment thereof, by itself: the coding sequence for 2~ the mature polypeptide or fragment in reading frame with other coding sequences, such as those encoding a leader or secretory sequence, a pre-, or pro- or prepro- protein sequ~nl~ or other fusion peptide portions. For example, a marker sequence which facilitates purification of the fused polypeptide can be encoded. In certain preferred embodiments of this aspect of the invention, the marker sequence is a hexa-histidine peptide, as provided in the pQE vector (Qiagen,Inc.)anddescribedinGentzet al.,ProcNatl,4cadSciUSA(1989)86:821-824, orisan ~LA tag. The polynucleotide may also contain non-coding 5' and 3' sequences, such as transcribed, non-translated sequences, splicing and polyadenylation signals, ribosome binding sites and sequences that stabilize mRNA.

CA 02246787 l998-08-l8 W O 98~8418 r ~/GB97/03526 Among particularly preferred embodiments of the invention are polynucleotides encoding tailless nuclear hol~none receptor polypeptides having the amino acid sequence set out in Figure I (SEQ ID NO:2) and variants thereof.
Further preferred embodiments are polynucleotides encoding tailless nuclear hormone receptor variants that have the amino acid sequence of the tailless nuclear horrnone lece~tor of Figure I (SEQ II) NO:2) in which several, 5-10, 1-57 1-3, 1-2 or I amino acid residues are subsfi1l~t~ cl, deleted or added, in a~ny combination.
Further preferred embodiments of the invention are polynucleotides that are at least 92% identical over thelr entire length to a polynucleotide encoding the tailless nuclear 10 horrnone receptor polypeptide having the amino acid se4uence set out in Figure I (SEQ ID
NO:2), and polynucleotides which are complementary to such polynucleotides. Most highly preferred are polynucleotide~i that comprise a region that is at least 92% identical over their entire length to a polynucleo~ide encoding the tailless nuclear horrnone receptor polypeptide of the human cDNA of the depo~it~d clone and polynucleotides complementary thereto. In 15 this regard, polynucleotides with at least 97% are highly preferred and those with at least 98-99% are most highly preferred, with at least 99% being the most preferred.
The present invention fùrther relates to polynucleotides that hybridize to the herein above-described sequences. [n this regard, the present invention especially relates to polynucleotides which hybriclize under stringent conditions to the herein above-described 20 polynucleotides. As herein used, the term "stringent conditions" means hybridization will occur only if there is at least !~5% a~nd preferably at least 97% identity between the sequences.
Polynucleotides of the invention, which are sufficiently identical to a nucleotide sequence contained in SEQ ID NO: 1, may be used as hybridization probes for cDNA and genomic DNA, to isolate full- length cDNAs and genornic clones encoding tailless nuclear 25 horrnone receptor and to isol~te cDNA and genomic clones of other genes that have a high sequence similarity to the ta~illess nuclear horrnone receptor gene. Such hybridization t~rhniques are known to those of skill in the art. Typically these nucleotide sequences are 70% iderltic~l, preferably 80~/o idel-tic~l more prefèrably 90% identical to that of the referent.
The probes generally will comprise at least 15 nucleotides. Preferably, such probes will have 30 at least 30 nucleotides and may have at least 50 nucleotides. Particularly preferred probes will range between 30 and 50 nucleotides.

WO 9~X418 PCT/GE97/03~26 The polynucleotide:s and polypeptides of the present invention may be employed as research reagents and materials for discovery of treatments and ~ gno5tic5 to animal and human disease.

Vectors, Host Cells, E~ r The present invention also relates to vectors which comprise a polynucleotide orpolynucleotides ofthe present invention, and host cells which are genetically çr1~inePred with vectors of the invention and to the production of polypeptides of the invention by recombinant techniques. Cell-free translation systems can also be employed to produce such proteins usin~
RNAs derived from the DNA constructs of the present invention.
For recombinant pr~duction, host cells can be genetically engineered to incorporate expression systems or portions thereof for polynucleotides of the present invention.
Introduction of polynucleotides into host cells can be effected by methods described in many standard laboratory m~n~ ;, such as Davis et al., B~S C METHODS I~J ,~OI,ECULAR
BIOLOGY(1986) and Sambrook et al., MOLFCUI.AR ~'~ONING: A LABOR4TORY
.~4NUAJ, 2nd Ed., ('old Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989 such as calcium phosphate l,a.lDr~.;Lion, DEAE-dextran me~i~t~d transfection, transvection, microinjection, cationic lipid-mediated transfection, ele.;Ll~,?o~d~ion, transduction, scrape loading, ballistic introduction or infection.
Repl ese~ e examples of ap~ UlJl idte hosts include bacterial cells, such as streptococci, staphylococci, f~. coli, Strep~omyces and Bclcillus subtilis cells; fungal cells, such as yeast cells and Aspergillus cells; insect cells such as Drosophila S2 and Spodop~era S fg cells; animal cells such as CHO, COS, HeLa, C127, 3T~, BH~C, 293 and Bowes melanoma cells; and plant cells.
A great varietv of expression systems can be used. Such systems include, among others, chromosomal, episomal and virus-derived systerns, e.g., vectors derived from bacterial pl~smi-ls, from bacteriophage, from transposons, from yeast episomes, from insertion Cle~llC~ from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses 30 and retroviruses, and vectors derived from combinations thereof, such as those derived from plasmid and bacteriophage genetic elements, such as cosmids and phagemids. The e:cpression systems mav contain control regions that regulate as well as engender expression. Generally, any system or vector suitable to maintain, propagate or express polynucleotides to produce a WO 98/28418 PCTIGB97103~26 polypeptide in a host may be used. The appropriate nucleotide sequence may be inserted into an ~A~ ssion system by any of a variety of well-known and routine techniques, such as, for example, those set forth in ~,ambroolc et al., MOLECUJ,AR Cl ONING, ~4 I,A~ORATORY
~ANUAL (supra).
S For secretion of the translated protein into the lumen of the endoplasmic reticull-m into the periplasmic space or into the extracellular environment. ap~lu~ t~ secretion signals may be incorporated into the desired polypeptide. These signals may be endogenous to the polypeptide or they may be heterologous signals.
If the tailless nuclear hormone receptor polypeptide is to be expressed for use in screening assays, generally, it is preferred that the polypeptide be produced at the surface of the cell. In this event, the cells may be harvested prior to use in the screening assay. If tailless nuclear hormone receptor polypeptide is secreted into the medium, the medium can be recovered in order tO recover and purify the polypeptide; if produced intracellularly, the cells must first be Iysed befi~re the polypeptide is recovered.
Tailless nuclear horlnone receptor polypeptides can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography,hydroxylapatite chromatography and lectin chromatography. Most preferably, high performance liquid chromatography is employed for purification. Well known techniques for refolding proteins may be employed to ~ e active conformation when the polypeptide is denatured during isolation and or purification.

Diagnostic Assays l~his invention also relates to the use of tailless nuclear hormone receptor polynucleotides for use as diagnostic reagents. Detection of a mutated form of tailless nuclear hormone receptor gene associated with a dysfunction will provide a diagnostic tool that can add to or define a diagnosis of a disease or susceptibility to a disease which results from under-expression, over-expression or altered expression of tailless nuclear hormone receptor.
Individuals carrying mutations in the tailless nuclear horrnone receptor gene may be detected at the DNA level by a ~ariet~ of techniques.
Nucleic acids for diagnosis may be obtained from a subject's cells, such as fromblood, urine, saliva, tissue biopsy or autopsy material. The genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR or other amplification techniques prior to analysis. RNA or cDNA may also be used in similar fashion. Deletions and insertions can be detec~ed by a change in size of the amplified product in comparison to the normal genotype. Poin~ mutations can be identified by hybridizing amplified DNA to 5 labeled tailless nuclear honnone receptor nucleotide sequences. Perfectly matched sequences can be 11ictin~uiched *om rnicm~trhed duplexes by RNase digestion or by difT,.G.-ces in melting temperatures. DN~ sequence dil~,~,..ccs may also be detected by alterations in electrophoretic mobility of DNA fragments in gels, with or without denaturing agents, or by direct DNA sequencing. See, e.g., Myers e~al."~cience ~1985) ~30:124~. Sequence changes 10 at specific locations may also be revealed by nuclease protection assays, such as RNase and S I protection or the cl1emical cleavage method. See Cotton e~ ~l., Proc Natl Acad Sc~ USA
(1985) 85: 4397-4401 The diagnostic assays offer a process for diagnosing or detemmining a susceptibility to depression, anxiety~ aggressive disorders, stroke, multiple sclerosis, Alzheimers, 15 Parkinsons, neuropathic pain, CNS infl~mm~tory disorders and other neurodegenreative diseases, eye defects and CNS developmentaJ problems, through detection o~mutation in the tailless nuclear horrnone receptor gene by the methods described.
In addition, depression, anxiety, aggressive disorders, stroke, multiple sclerosis, Alzheimers, Parkinsons, neuropathic pain, CNS inflammatory disorders and other 20 neurodegenreative diseases, eye defects and CNS developmental problems, can be fii~no5ed by methods comprising deterrnining from a sample derived from a sub3ect an abnormally decreased or increased level of tailless nuclear hormone receptor polypeptide or tailless nuclear hormone receptor mRNA. Decreased or increased expression can be measured at the RI~A level using any of the methods well known in the art for the quantitation of 25 polynucleotides, such as, for example, PCR, RT-PCR, RNase protection, Northern blotting and other hybridization methods. Assay t~chniques that can be used to determine ievels of a protein, such as an tailless nuclear hommone receptor, in a sample derived from a host are well-known to those of skill in the a~t. Such assay methods include radioimmunoassays, competitive-binding assays, Westem Blot analysis and F~LISA assays.
Chromosome Assays The nucleotide sequences of the present invention are also valuable for chromosome identification. The sequence is specifically targeted to and can hybridize with a particular WO 98n8418 PCT/GB97/03526 iocation on an individual human chromosome. The mapping of relevant sequences tochromosomes according to the present invention is an important first step in correlating those sequences with gene associated disease. Once a sequence has been mapped to a precise chromosomal location. the physical position of the sequence on the chromosome can be 5 correlated with genetic map data. Such data are found, for e~cample? in V. McKusick, Mendelian Inheritance in M;~n (available on line through Johns Hopkins University Welch Medical Library). The relationship bet~ween genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes).
The differences in the cDNA or genomic sequence between affected and unaffected individuals can also he detelmined. If a mutation is o~served in some or all of the affected individuals but not in any norrnal individuals, then the mutation is likely to be the causative agent of the disease.
Chromosomal locali~ation has shown that the gene is localised to 6q21 and is in a region that maps to a translocation associated with a CNS disorder. This localisation has been corroborated by 3ackson et ah (vide infra).

Antibodies The polypeptîdes of l:he invention or their fragments or analogs thereof, or cells e~ ,ssi,-g them can also be used as imrmlnogen~ to produce antibodies immunospecific for the tailless nuclear horrnone receptor polypeptides. The terrn ' immunospecific" means that the antibodies have substantiall greater affinity for the polypeptides of the invention than their affinity for other related polypeptides in the prior art.
Antibodies generated against the tailless nuclear hormone receptor polypeptides can be obtained by administering the polypeptides or epitope-bearing fragments, analogs or cells to an animal, preferably a nonhuman, using routine protocols. For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. E~amples include the hybridoma technique (Kohler, G. and Milstein, C., ~a~ure ( 1975) 256:495-497)~ the trioma t.ochnique, the human B-cell hybridoma technique (Kozbor et al, Immunolo~ Toda}~ 1 1983 ) 4:72) and the EBV-hybridoma technique (Cole e~ al., MONOCLONAL ANTlBODlES AND CANCER THERAPY, pp 77-96, Alan R. Liss, Inc., 1985).

WO 98/28418 P~ 7/03526 Techniques tor the production of single chain antibodies (IJ.S. Patent No. 4,946,77~) can also be adapted to produce single chain antibodies to polypeptides of this invention. Also, transgenic mice, or other o~ isllls including other mammals, may be used to express humanized antibodies.
The above-described imtibodies may be employed to isolate or to identify clones ex~,ie~ ,g the polypeptide or to purify the polypeptides by affinity chromatography.
Antibodies against tailless nuclear hormone receptor polypeptides may also be employed to treat depression, anxiety, aggressive disorders, stroke, multiple sclerosis, Alzheimers, Parkinsons, neuropathic pain, CNS inflammatory disorders and other neurodegenreative diseases, eye defects and CNS developmental problems, among others.

Vaccines Another aspect of the invention relates to a method for inducing an immunological response in a mammal which comprises inocu~ n~ the m Imm:~l with tailless nuclear horrnone receptor polypeptide, or a fragment thereof, adequate to produce antibody and/or T
cell immune response to prc,tect said animal from depression, anxiety, aggressive disorders, stroke, multiple sclerosis, Alzheimers, Parkinsons, neuropathic pain, CNS infl~mmatory disorders and other neurode~ alive diseases, eye defects and CNS developmental problems, among others. Yet another aspect of the invention relates to a method of 20 inducing immunological response in a m~rnm~l which comprises, delivering tailless nuclear horrnone receptor gene via a vector directing expression of tailless nuclear horrnone receptor polypeptide in vivo in order to induce such an immunological response to produce antibody to protect said animal from diseases.
Further aspect of the invention relates to an immunological/vaccine formulation 25 (composition) which, when introduced into a mamm:llian host, induces an immunological response in that m~mm~l to a tailless nuclear horrnone receptor polypeptide wherein the composition comprises a tailless nuclear hormone receptor polypeptide or tailless nuclear hormone receptor gene The vaccine forrnulation mav further comprise a suitable carrier.
Since tailless nuclear hormol~e receptor polypeptide may be broken down in the stomach, it 30 is preferabl~ administered parenterally (including subcutaneous, intramuscular, intravenous, intradermal etc injection). Formulations suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-o~cidants, buffers, bacteriostats and solutes which render the forrnulation instonic with the W O 9&~8418 P ~/GB97/03526 blood of the recipiertt; and a4ueous and non-aqueous sterile suspensions ~vhich may include suspending agents or thickenin~; agents. The formulations may be presented in unit-dose or multi-dose containers, for example, sealed ampoules and vials and may be stored in a freeze-dried condition requiring only the addition of the sterile liquid carrier immediately prior to use. The vaccine i-'orrnulation may also include adjuvant systems for enhancing the immunogenicity of the formulation, such as oil-in water systems and other systems known in the art. The dosage will depend on the specific activity of the vaccine and can be readily determined by routine experimentation.

10 Screening Assays The tailless nuclear hormone receptor of the present invention may be employed in a screening process for compl)unds which bind the receptor and which activate (agonists) or inhibit activation of (~nt~goni~c) the receptor polypeptide of the present invention. Thus, polypeptides of the invention may also be used to assess the binding of small molecule 15 substrates and Jigands in, for exarnple, cells, cell-free p~epalalions, chemical libraries, and natural product mixtures. These substrates and ligands may be natural substrates and ligands or may be structural or func~ional mimetics. See Coligan et al., Current Protocols in ~mmunology 1(2):Chapter 5 (1991).
Tailless nuclear honnone receptor proteins are ubiquitous in the rn~mm~ n host and 20 are responsible for many biological functions, including many pathologies. Accordingly, it is desirous to find compounds and drugs which stimulate tailless nuclear hormone receptor on the one hand and which can inhibit the function of tailless nuclear hormone receptor on the other hand. In generaL agonists are employed for therapeutic and prophylactic purposes for such conditions as depression, anxiety, ag~,,c~sive disorders, stroke, multiple sclerosis, 2~ Alzheimers, Parkinsons, neuropathic pain, CNS infl~mmsltQry disorders and other neurodegenreative ~i~e~es, eye defects and CNS developmental problems. Antagonists may be employed for a variety of th~,.al)eulic and prophylactic purposes for such conditions as depression, an,Yiety, aggressive disorders, stroke, multiple sclerosis, Alzheimers, Parkinsons, neuropathic pain, CNS inflammatory disorders and other neurodegenreative 30 diseases, eye defects and CNS developmental problems, In general, such screening procedures involve producing a,oplopl iate cells which e:~press the receptor poiypeplide of the present invention on the surface thereof. Such cells include cells from mammals, yeast. Drosophila or ~. coli. Cells e.YpreSSing the tece~,lor (or cell membrane containing the explessed receptor) are then contacted with a test compound to observe binding, or stimulal ion or inhibition of a functional response.
An example of an assay may employ a chimeric receptor comprising the ligand binding domain of the tailless nuclear hormone receptor of the invention and the DNA
5 binding domain of another protein in a reporter gene assay This would take the form of a CIS-TRANS assay. An exarnple of such chi...e. ic receptor comprises a pofypeptide corrresponding to arnino acid residue 104 to 385 or 83 to 385 of SEQ ID NO: 2. An assay may also be configured by direct expression of the ligand binding domain as an E coli GST-fusion. This may be used as a ligand binding assay or as a fluorescence capture assay.
The assays may simply test binding of a candidate compound wherein adherence to the cells bearing the receptor is detected by means of i~ Iabel directly or indirectly associated with the c~ndi-l~fe compound or in an assay involving competition with a labeled competitor. Further, these assays may test whether the candidate compound results in a signal generated by activation of the receptor, using detection systems appropriate to 15 the ceils bearing the receptor at their surfaces. Inhibitors of activation are generally assayed in the presence of a known agonist and the effect on activation by the agonist by the presence of the candidale compound is observed. Standard methods for conducting such screening assays are well understood in the art.
Examples of potential tailless nuclear horrnone receptor antagonists include 20 antibodies or, in some ~ases, oligonucleotides or proteins which are closely related to the ligand of the tailless nuclear hormone receptor, e.g., a fragment of the ligand, or small molecules which bind to the receptor but do not elicit a response~ so that the activity of the receptor is prevented.

25 rr~ph~' ~ s and Therapeutic Methods This invention provides methods of treating an abnorrnal conditions related to both an e~cess of and insufficient amiounts of tailless nuclear hormone receptor activity.
I~the activity of tailless nuclear horrnone receptor is in e~cess, several approaches are available. One approach conlprises administering to a sllbject an inhibitor compound 30 (antagonist) as hereinabove clescribed along with a pharmaceutically acceptable carrier in an amount effective to inhibit activation by bloclcing binding of ligands to the tailless nuclear hormone receptor, or bY inhi~iting a second signal, and thereby alle~iating the abnorrnal condition.

WO 98n8418 PCT/GB97103~26 In another approach, soluble forms of tailless nuclear hormone receptor polypeptides still capable of binding the ligand in competition with endogenous tailless nuclear hormone receptor may be administered. Typical embodiments of such competitors comprise fragments of the tailless nuclear hormone receptor polypeptide.
In still another ap~.oach, expression of the gene encoding endogenous tailless nuclear hormone receptor can be inhibited using expression blocking techniques. Known such techniques involve the use of antisense sequences, either internally generated or separately ~lminictered. Sec, for example, O'Connor, JNeurocJ~em ( 1991 ) 56:560 in Oli~odeoxynucleotides AC~ Antisense lnhibitors of Gene F~ression, CRC Press, Boca Raton, FL (1988). Alternatively, oligonucleotides which forrn triple helices with the gene can be supplied. See, for example, Lee et al., Nucleic Acids Res ( 197g) 6:3073; Cooney et al.,Science(1988)241:456;Dervanetal., Science(19gl)251:1360. Theseoligomerscan be ~dminicteredper se or the relevant oligomers can be expressed in vivo.
For treating abnorrnal conditions related to an under-expression of tailless nuclear l 5 honnone receptor and its acti~dty, several approaches are also available. One approach comprises ~lministering to a subject a ther~reu~ic~lly effective amount of a compound which activates tailless nuclear honnone receptor, i.e., an agonist as described above, in combination with a pharrnaceutically acceptable carrier, to thereby alleviate the abnormal condition.
Alternatively, gene therapy may be employed to effect the endogenous production of tailless nuclear hormone receptor by the relevant cells in the subject. For example, a polynucleotide of the invention may be engineered for expression in a replication defective retroviral vector, as diccllcced above. The retro~iral expression construct may then be isolated and introduced into a par~ in~ cell transduced with a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention such that the packaging cell now produces infectious viral particles containin~ the gene of interest. These producer cells may be administered to a subject for engineering cells iK' vivo and expression of the polypeptide in vivo. For overview of gene therapy, see Chapter 2~, Gene ~herapy and other Molecl~ar Genetic-based Therapeutic Approaches (and references cited therein) in Human Molecular Genetics, T
Strachan and A P Read, BIOS Scientific Publishers Ltd ( 1996).
Form~ t~or and Admin;~tration Peptides, such as the soluble form of tailless nuclear hormone receptor polypeptides, and agonists and antagonist peptides or small molecules, may be formulated in combination IX

W O 9~28418 PCT/GB97tO3526 with a suitable pharmaceuti~al carrier. Such forrnulations comprise a therapeutically effective amount of the polypeptide or compound, and a pharm~eutic llly acceptable carrier or e~ccipient. Such carriers include but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. Formulation should suit the mode of5 adminictration, and is well within the skill ofthe art. The invention further relates to pharrn~ eutic~l packs and kits comprising one or more cont~in~rs filled with one or more of the ingredients of the aforementioned co...~osilions of the invention.
Polypeptides and other compounds of the present invention may be employed alone or in conjunction with other compounds, such as therapeutic compounds.
Preferred forms of systemic administration of the pharmaceutical compositions include injection, typically by intravenous injection. Other injection routes, such as sl-bcl-~ lneous, intramuscular, or inllape. i~oneal, can be used. Alternative means for systemic ~rlministration include translnucosal and transdermal administration usingpenetrants such as bile salts or fusidic acids om)ther d~:Lergt-.~. In addition, if proper]y formulated in enteric ~r encarsul~ted formulations, oral a~lminictration may also be possible. Administration ofthese compounds may also be topical and/or localized, in the form of salves, pastes, gels and the like.
The dosage range required depends on the choice of peptide, the route of ~rlmini~tratjon, the nature of the formulation, the nature of the subject's condition, and the judgment of the ~tten~ing practitioner. Suitable dosages, however, are in the range of 0.1-100 ~lglkg of subject. Wide variations in the needed dosage. however, are to be expected in view of the variety of compounds available and the differing efficiencies of various routes of ~lminic~ratjon. For example, oral administration would be expected to require higher dosages than administration by intravenous injection. Variations in these dosage levels can be adjusted using standard empirical routines for optimization, as is well understood in the art.
Polypeptides used in treatment can also be generated endogenously in the subject, in treatment modalities often referred to as "gene therapy" as described above. Thus, for example, cells from a subjecl may be engineered with a polynucleotide, such as a DNA or RNA, to encode a polypeptide ex YiVo, and for example, by the use of a retroviral plasmid vector. The cells are then introduced into the subject.
The example below is carried out using standard techniques. which are well knownand routine to those of skill hl the art, except where otherwise described in detail. The e:~ample illustrates, but does not limit the invention.

WO 98/28418 P ~/GB97~3526 Example 1 HGS clone 243890 in J~.coli host strain SOLR (Stratagene) was obtained from HGS
and amplified in 250ml Luria Broth. Phagemid DNA was purified by caesium chloride 5 centrifugation and sequenced on an ABI Prism .377 DNA sequencer using fluorescent dye-terminator cycle sequencin~. Nucleotide sequence was obtained from both strands, initially using primers complementa.ry to the T7 and T3 promoters in the pBluescript II SK +
phagemid vector (Stratagene) and later using internal primers complementary to the generated sequence.
The 5' end of the tailless nuclear hormone receptor gene missing from HGS clone 243890 was PCR amplified from a whole human brain Marathon-Read,vTM cDNA library(Clontech) using the following synthetic oligonucleotide primers:
5'GGCAGCTGATTCACACACCGACTCC3'; and S '&TGGCCACTTCA'rAG~GATAC~TTGGG3 ' 1~ according to m~nf3rturer's instructions and cloned into pCRScriptTM SK(+) (Stratagene).

F.Y~nrl~ 2 - tissue distribul~ion RT-PCR and the Taqman system (Perkin Elmer/Applied Biosystems) has been used to 20 determine the tissue localisation of human tailless nuclear horrnone receptor (TLX) in the CNS and peripheral tissues. R~A was obtained from eight different regions of the brain and fourteen peripheral tissues. Human TLX sequence specific primers were designed for RT-PCR and a second set of primers were designed for Taqman. RT-PCR showed that TLX was absent in the aorta. heart, pancreas, skeletal muscle, testes, prostate, lung, kidney, 25 bone marrow, liver and adpivse tissue whereas TLX was present in the amygdala, caudate, hippocampus, thalmus, subs1-~n~i~ nigra, cerebellum, hypothalamus, frontal cortex and spinal chord. Taqman data showed TLX was absent in the pancreas, lung, liver, spleen and bowel whereas TLX was present the amygdala, hippocampus, cerebellum, nucleus accumbens, striatum, putamen, para-hippocampal gyrus, medial frontal gyrus. TLX was 30 present in the stomach at levels approximately ~ orders of magnitude less than in the brain regions.

WO 9U28418 PCT/G~97~3S26 SEQUENC'E LI'STING

(1) GENE.~AL INFORMATION

(i) APPLICWT: S~ithKline Beecham pl~

(ii) TITLE OF THE INVENTION: Novel Conlpounds ~iii) NUMBER OF SEQUENCES: 2 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: SmithKline Beecha~
(B) STREET: 2 New Hori~ons Court, Great West P~oad (c) CITY Brentford (D) STATE:
(E) COUNT~Y: England (F) ZIP: TW~ 913P

( v ) COMPUTER REAI)ABLE FORM:
(A) MEDIUM TYPE: Diskette (B) COI.~U-~: IBM Co~patible (C) OPERATING ';YSTEM: DOS
~D) SOFTWARE: EastSEQ for Windows Version 2.0 (vi) CURRENT APPI-ICATION DATA:
(A) APPLIC~TION NUMBER:
(B) FILING DATE::
~C) CLASSIFICATIO~:
~vii) PRIOR APPLICATION DATA:
~A) APPLICATION NUMBER:
(B) FILING DATE:

(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Connell, Anthony C C
(B) REGISTRATION NUMBER:
(C) REFERENCE~DOCKET NUMBER: P3170G

(ix) TELECOMMUNICATION INFORMATION:

(A) TELE~HONE:
IB) TELEFAX:
(C) TELE.~:

(2~ INF~RMATION FOR SEQ ID NO:l:

[i) SEQUENCE CH M ACTERISTICS:
(A) LENGTH: 1158 base pairs (B) TYPE n~cleic acid ~C) STRANDEDNESS: single (D) TOP(')I.OGY: linear (ii) MOLEC~'LE T'YPE: cDNA

(xi) SEQUENCE D]35CRIPTION: SEQ ID NO:l:

ATGAGCAAGC CAGCC~C7GATC AACAAGCCGC ATTTT~GATA TCCCCTGCAA A~71~71~71GGC 60 GACCGCAGCT CGGGGAAGCA CTACGGGGTC TAC&CCTGCG ACGGCTGCTC AG~71L1L11C 120 CCGGTGGACA AGACGCACAG AAACCAGTGC AGGGCGTGTC GGCTGAAGAA ~1~7111~7GAA 240 GCCACGGAGT ~G~7~ 71GA ATCAGCTGCC AGA~11C1~1 TCATGAGCAT CAAGTGGGCT 600 GCTTGGAGAG AA~1G~11~T TCTAGGAATA GCACAATGGG CCATTCCGGT TGATGCTAAC 720 ATCATATCTG AAATACAGGC TTTACAAGAG ~71C7~71GGCTC GATTTAGACA ACTCCGGTTA 840 A~71G~711~1~7 AACTGAGAAG TTTCCGGAAT GCTGCCGCCA TTGCAGCCCT TCAAGATGAG 960 ~1~1 1 L 1 1 ~A AAAAAACCAT CGGCAATGTG CCAATTACAA GA~ 1 L lC AGATATGTAC ll40 AAATCCAGTG ATATCTAA ll58 (2) INFORMATION FOR SEQ ID NO:2:

(i~ SEQUENt'E' CHARACTERISTICS:
(A) LENGTH: 385 amino acids (B) TYPE ~min~ acid CA 02246787 l998-08-l8 WO 98n8418 PCT/GB97103526 (C) S T2PN~NF~ S: single (D) TOPCL~9GY: linear (xi ) SEQUENCE DESCRIPTION: SEQ Ir~ NO~

Met Ser Lys Pro ~.la Gly Ser Thr Ser Arg Ile Leu Asp Ile Pro Cys 1 ~ 10 15 Lys Val Cys Gly Asp Arg Ser Ser Gly Lys His Tyr Gly Val Tyr Ala 0 20 25 3~
Cys Asp Gly Cys iier Gly Phe Phe Lys Arg Ser Ile Arg A-g Asn Arg Thr Tyr Val Cys ~rs Ser Gly Asn Gln Gly Gly Cys P-o Va 1 Asp Lys 15 Thr ~is Arg Asn (ln Cys Arg Ala Cys Arg Leu Lys Lys Cys Leu Glu ~30 Val Asn Met Asn l.ys As? Ala Val Gln Tyr Glu Arg Gly Pro Arg Thr ~ 90 95 Ser Thr Ile Arg l~s Gln Val Ala Leu Tyr Phe ~rg 51y ~is Lys Glu loO 10S 110 lu Asn Gly Ala Ala Ala His Phe Pro Ser Ala ~la Leu Pro Ala Pro Ala Phe Phe Thr Ala Va:L Thr Gln Leu Glu Pro ;~is Gly Leu Glu L~u Ala Ala Val Ser Thr Thr Pro Glu Arg Gln Thr .~eu Val Ser Leu Ala 145 15(~ 155 160 Gln Pro Thr Pro Iys Tyr Prc His Glu Val Asn Gly Thr Pro Met Tyr ~65 17~ 175 Leu Tyr Glu Val Ala Thr Glu Ser Va Cys Glu .ier Ala Ald Arg Leu Leu Phe Met Ser lle Lys Trp Ala Lys Ser Val Pro A'a Phe Ser Thr ~eu Ser Leu Gln Asp Gln Leu Met Leu Leu Glu ~sp Ala Trp Arg Glu 210 215 -2~

3~ Leu Phe Val Leu Gly Ile Ala Gln Trp Ala Ile lro Val ASA;~ Ala Asn 225 23~l 235 240 Thr Leu Leu Ala Val Ser Gly Met Asn Gly Asp Asn Thr Asp Ser Gln 24~ 250 255 I.ys Leu Asn Lys Il~ Ile Ser Glu Ile Gln Ala Ieu Gln Jll.~ Val Val 260 265 27~) Ala Arg Phe Arg Gll Leu Arg Leu Asp Ala Thr ~lu Phe Al Cys Leu 275 280 2~5 Lys Cys Ile Val Tnr Phe Lys Ala Val Pro Thr }~is Ser Gl~ Ser Glu BCT/GB97/03St6 W O 9&~8418 Leu Arg Ser Phe Arg A.;n Ala Ala Aia Ile Ala Ala Leu Gln Asp Glu 305 3:L0 3L5 320 Ala Gln Leu Thr Leu Asn Ser Tyr Ile His Thr Arg Tyr Pro Thr Gln Pro Cys Arg Phe Gly LVS Leu Leu Leu Lel Leu Pro Ala Leu Arg Ser Ile Ser Pro Ser Thr I].e Glu Glu Val Phe Phe Lys Lys Thr Ile Gly Asn Val Pro Ile Thr Arg Leu Leu Ser Asp Met Tyr Lys Ser Ser Asp 370 375 3~0 Ile 3~5

Claims (18)

Claims

1. An isolated polynucleotide comprising a nucleotide sequence that is at least 92% identical to a nucleotide sequence encoding the polypetide of SEQ ID NO:2 or the corresponding fragment thereof; or a nucleotide sequence complementary to said nucleotide sequence.

2. The polynucleotide of claim 1 wherein said encoding nucleotide sequence encodes the polypeptide of SEQ ID NO:2 or a fragment thereof.

3. An isolated polynucleotide comprising a nucleotide sequence nucleotide which is at least 92% identical to that contained in SEQ ID NO:1.

4. The polynucleotide of claim 3 wherein said nucleotide sequence is contained in SEQ ID NO:1.

5. A polynucleotide probe or primer comprising at least 15 contiguous nucleotides of the polynucleotide of claim 3.

6. A DNA or RNA molecule comprising an expression system wherein said expression system is capable of producing a tailless nuclear hormone receptor or a fragment thereof having at least 92% identity with a nucleotide sequence encoding the polypeptide of SEQ ID NO:2 or said fragment when said expression system is present in a compatible host cell.

7. A process for producing a cell which produces a tailless nuclear hormone receptor polypeptide or a fragment thereof comprising transforming or transfecting a host cell with the expression system of claim 6 such that the host cell, under appropriate culture conditions, produces a tailless nuclear hormone receptor polypeptide or fragment.

8. A tailles, nuclear hormone receptor polypeptide or a fragment thereof comprising an amino acid sequence which is at least 99% identical to the amino acid sequence contained in SEQ ID NO:2.

9. The polypeptide of claim 8 which comprises the amino acid sequence of SEQ ID NO:2, or a fragment thereof.

10. An antibody immunospecific for the tailless nuclear hormone receptor polypeptide of claim 8.

11. A method for the treatment of a subject in need of enhanced tailless nuclearhormone receptor activity comprising:
(a) administering to the subject a therapeutically effective amount of an agonist to said receptor; and/or (b) providing to the subject tailless nuclear hormone receptor polynucleotide ina form so as to effect production of said receptor activity in vivo.

12. A method for the treatment of a subject having need to inhibit tailless nuclear hormone receptor activity comprising:
(a) administering to the subject a therapeutically effective amount of an antagonist to said receptor; and/or (b) administering to the subject a nucleic acid molecule that inhibits the expression of the nucleotide sequence encoding said receptor; and/or (c) administering to the subject a therapeutically effective amount of a polypeptide that competes with said receptor for its ligand.

13. A process for diagnosing a disease or a susceptibility to a disease in a subject related to expression or activity of tailless nuclear hormone receptor in a subject comprising:
(a) determining the presence or absence of a mutation in the nucleotide sequence encoding said tailless nuclear hormone receptor in the genome of said subject;
and/or (b) analyzing for the presence or amount of the tailless nuclear hormone receptor expression in a sample derived from said subject.

14. A method for identifying compounds which bind to tailless nuclear hormone receptor comprising:

(a) contacting cells of claim 11 with a candidate compound; and (b) assessing the ability of said candidate compound to bind to said cells.

15. The method of claim 14 which further includes determining whether the candidate compound effects a signal generated by activation of the tailless nuclear hormone receptor polypeptide at the surface of the cell, wherein a candidate compound which effects production of said signal is identified as an agonist.

16. An agonist identified by the method of claim 15.

17. The method of claim 14 which further includes contacting said cell with a known agonist for said tailless nuclear hormone receptor; and determining whether the signal generated by said agonist is diminished in the presence of said candidate compound, wherein a candidate compound which effects a diminution in said signal is identified as an antagonist for said tailless nuclear hormone receptor.

18. An antagonist identified by the method of claim 17