WO1998018958A1 - Procede de mise en evidence de contaminants microbiologiques vivants dans un echantillon de produit a usage alimentaire - Google Patents
Procede de mise en evidence de contaminants microbiologiques vivants dans un echantillon de produit a usage alimentaireInfo
- Publication number
- WO1998018958A1 WO1998018958A1 PCT/FR1997/001918 FR9701918W WO9818958A1 WO 1998018958 A1 WO1998018958 A1 WO 1998018958A1 FR 9701918 W FR9701918 W FR 9701918W WO 9818958 A1 WO9818958 A1 WO 9818958A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- pcr
- mrna
- sample
- detection
- synthesis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Definitions
- the present invention relates to a method for detecting living microbiological contaminants in a sample of products for food use.
- European patent publication EP-A-0 133671 describes a method for determining the presence of bacteria in samples, in particular in suitable diagnostic media, such as body fluids, which implements the techniques of nucleic acid hybridization.
- the sample to be tested is first of all subjected to denaturing conditions so as to make the nucleic acids of the bacteria present in the sample single stranded.
- the single-stranded nucleic acids thus obtained are brought into contact with a polynucleotide probe having a homologous sequence with at least one sequence common to all the species of bacteria present in the sample.
- the probe and the denatured nucleic acids are brought into contact so as to carry out a hybridization between the probe and the respective sequences of the bacteria.
- the probe used comprises at least a portion of one of the strands of a gene coding for the synthesis of a nucleic acid or of a protein which is involved in the mechanism of protein synthesis.
- genes coding for transfer RNAs, ribosomal RNAs, initiation, elongation or termination factors for translation are examples of genes coding for transfer RNAs, ribosomal RNAs, initiation, elongation or termination factors for translation.
- One of the characteristics of this method is that it is based not on expression, but rather on the presence of hybridizable nucleic acids, for example RNA or genomic DNA or the extra chromosomal nucleic acids of the bacteria present.
- the samples do not have to be treated so as to guarantee the viability of the bacteria present.
- mRNA messenger RNA
- prokaryotes in particular bacteria, unicellular eukaryotes, in particular yeasts, pluricellular eukaryotes, in particular mushrooms.
- prokaryotes in particular bacteria
- unicellular eukaryotes in particular yeasts
- pluricellular eukaryotes in particular mushrooms.
- different species can be identified. thus, for example, Escherichia, Salmonella, Mycobacterium for bacteria; Saccharomyces, Candida for yeasts; Mucor, Neurospora, Trichoderma for mushrooms.
- Protein synthesis by microorganisms includes transcription and translation steps.
- nucleic acids and proteins involved in each of the three basic stages of protein synthesis, initiation, elongation and termination. Mention may thus be made, as element intervening in this phase of translation, of the transfer RNAs, of the ribosomal RNAs, of the ribosomal proteins, of initiation, elongation and termination factors.
- proteins or nucleic acids whose primary structure is at least partially conserved between different species of microorganisms belonging to the same family and this property is advantageously exploited according to the invention to highlight living microbiological contaminants belonging to different species.
- the invention relates to a process for the non-specific detection of living contaminants belonging to different species of a family of microorganisms, according to which the detected mRNA is an mRNA which codes for the synthesis of a protein whose primary structure is at least partially conserved between different species.
- elongation factors there may be mentioned the factors EF-1, EF-2, EF-G, EF-TU for bacteria (2), or even the factor EF-1 ⁇ (3) for yeasts and fungi.
- EF-1, EF-2, EF-G, EF-TU for bacteria (2) or even the factor EF-1 ⁇ (3) for yeasts and fungi.
- this gene represents a very appropriate marker for cell viability since the inactivation of this gene is a lethal event, in both prokaryotes and eukaryotes (5, 6).
- the gene coding for an elongation factor codes for a protein which is among the proteins most widely expressed in prokaryotes and eukaryotes (7, 8) which makes it possible to considerably decrease the level of detection of cells. .
- insofar as this function is preserved in prokaryotes and in eukaryotes and where the primary structure of this type of gene is very similar (9), it is possible to modulate the specificity of detection .
- the mRNA coding for elongation factors has a very short half-life (10, 11). Its presence therefore makes it possible to reveal the presence of cells which were still alive approximately ten minutes before the detection of the mRNA.
- an mRNA which codes for an elongation factor is therefore detected.
- a living microorganism cell within the meaning of the invention is a cell capable of producing the mRNA corresponding to an elongation factor.
- a method of choice for detecting the presence of messenger RNA according to the invention is RT-PCR (polymerization by chain reaction combined with reverse transcription).
- This technique consists in carrying out a PCR using an RNA previously transcribed into complementary DNA, in the presence of a reverse transcriptase and a primer.
- the PCR phase proper is carried out under conventional conditions in the presence of the DNA to be amplified, of the two oligonucleotide primers framing the region to be amplified and of the four deoxynucleotide triphosphates (DATP, DCTP, DGTP, DTTP) in large molar excess and of the Taq polymerase enzyme.
- DATP deoxynucleotide triphosphates
- oligonucleotide primers are prepared in such a way that they are specific for the coding region of a gene coding for an elongation factor.
- the EF-TU factor is preferably chosen for bacteria and the EF-1 ⁇ factor for yeasts and fungi.
- the primers B1 / B2 (5 'CGCTGGAAGGCGACGMRRAG 3' / 5 'CGGAAGTAGAACTGCGGACGGTAG 3') were prepared, which are specific for a fragment of the elongation factor EF-TU of the bacteria which is found in particular in Salmonella typhimurium, Mycobacterium tuberculosis, Mycobacterium leprae, Escherichia coli, Brevibacterium linens, Streptomyces ramocissimus.
- primers L1 / L2 (5 'TCCATGGTACAAGGGTTGGGAA 3' / 5 'GCGAATCTACCTAATGGTGGGT 3') were prepared which are specific for a fragment of the elongation factor EF-l ⁇ of yeasts, which is found at both in Saccharomyces cerevisiae and Candida albicans.
- nucleotide primer usable for the detection of messenger RNA specific for fungi is represented by the pair M1 / M2 (5 'GCTGGTATCTCCAAGGATGG 3' / 5'- CGACGGACTTGACTTCRGTGG 3 '). These primers are more particularly specific to a fragment of the elongation factor EF-l ⁇ of the fungi which is found in Mucor racemosus, Neurospora crassa, Trichoderma reesei, Absidia glauca, Aureobasidium pullulans, Histoplasma capsulatum, Puccinia graminis.
- the primers which can be used according to the invention were prepared after comparison of the coding region of the elongation factor of different species of microorganisms (software Lasergene, Dnastar, Medison, Wisconsin USA).
- the method according to the invention can be characterized by all of the following steps: a) a sample of food product to be tested is taken; b) the cells are lysed; c) reverse transcription is carried out; d) amplification cycles are carried out using oligonucleotide primers specific for the coding region of a gene coding for an elongation factor; e) the amplification products are separated; f) the amplification products are displayed. g) the products as seen in step f) are compared with the amplification products obtained from pure mRNA.
- the invention essentially aims at detecting living microbiological contaminants, it is particularly advantageous to eliminate as much as possible, any additional contamination of the medium by the DNA present in the sample.
- an additional step (b ′) is added after step b) intended to eliminate the DNA present in the sample.
- DNAase I which does not contain RNase. If one wishes to verify the absence of false positives which would be linked to the presence of DNA, one possibility consists in carrying out a PCR reaction from the same samples as those used for RT-PCR.
- FIG. 1 represents an electrophoresis gel of the RT-PCR products of the EF-Tu gene from E. coli (tuf b gene) (A) or from the EF-1 gene from S. cerevisiae (B) or from M. racemosus (C) suspended in milk in concentrations ranging from 105 cells / ml (lane 1) to 1 cell / ml (lane 6) decreasing each time by 10 times the concentration.
- Lane 7 represents a cellless negative control
- lane 8 represents a positive control with pure mRNA
- lane 9 represents a PCR carried out on a lysate digested with DNAase I
- the bands M represent a lkb scale (Gibco BRLTM).
- FIG. 2 represents an electrophoresis gel for RT-PCR products of the E. coli EF-Tu gene (tuf b gene) (A) or of the EF-alpha gene of S. cerevisiae (B) or of M. racemosus ( C) suspended in milk at a cell concentration of 104-105 cells / ml.
- Band 1 corresponds to 100% dead cells; lane 2, 25% living cells and 75% dead cells; lane 3, 50% dead cells and 50% living cells; band-4, 75% living cells and 25% dead cells; lane 5, 100% living cells; lane 6, to a negative control without cell; lane 7, to a positive control with pure mRNA; lane 8, to a PCR carried out on a lysate digested with DNAase I; the M bands, at a scale of 1 kb (Gibco BRLTM).
- FIG. 3 represents an electrophoresis gel of the RT-PCR products of the E. coli EF-Tu gene (tuf b gene) and of the EF-1 ⁇ gene of S. cerevisiae and M. racemosus.
- the cells were suspended in milk at a concentration of 10 cells / ml.
- Lane 1 bacteria primers; lane 2, yeast primers; lane 3, mushroom primers; lane 4, bacteria and yeast primers; lane 5, yeast and mushroom primers; lane 6, bacteria and fungus primers; lane 7, primers of bacteria, yeasts and fungi; band 8, negative control without cell ; lane 9, positive control with pure mRNA; lane 10, PCR carried out on a lysate digested with DNAase I; M bands, lkb scale (Gibco BRLTM).
- strain ATCC 19110 Examples have been made with the following strains: - Escherichia coli (strain ATCC 19110);
- the sample on which the process was carried out is milk, but of course, the invention is applicable to any other product for food use, preferably liquid.
- EXAMPLE 1 Determination of the Presence of Living E. coli Cells in Milk (Detection of mRNA Coding for the Elongation Factor EF-Tu)
- a) Preparation of the Strain An E. coli strain is cultivated at 37 ° C. in a Luria broth, then a solid medium is prepared by adding 2% agar (Difco Laboratories). Part of the cells are removed during the exponential growth phase. The cells are distributed in 2 ml samples and then are subjected to lethal conditions by incubation at 65 ° C for 15 min. Serial dilutions of the samples are placed on plates on Agar medium in order to verify the cell viability and to count them. The samples are then used to inoculate samples of commercially available ultra high temperature pasteurized cow's milk. b) contamination of milk
- Concentration series ranging from 105 to one cell per ml of milk are carried out.
- the possible interference of milk with the PCR reaction is eliminated by carrying out 4 washing cycles with PBS medium, as indicated in the document Cooray et al. (12), the content of which is incorporated herein by reference.
- the final milk pellet is resuspended after washing with PBS until it returns to the original volume of milk and then filtered through a 25mm polycarbonate membrane of diameter moistened with PBS medium (pore size, 0.8 ⁇ m Millipore).
- the filter is transferred to a 15 ml FalconTM tube (Becton Dickinson). 1 ml of PBS is added and mixed vigorously for 30 seconds and the supernatant is recovered. An additional 0.5 ml of PBS is then added to the filter and the resulting suspensions are combined and then centrifuged at 5000 g for 5 min.
- RNA To prevent degradation of the RNA, 40 units of RNase inhibitor (Boehringer) are added and water adjusted with 0.05% diethylpyrocarbonate is added to inactivate the nucleases to a final volume of 50 ⁇ l according to the process described in Roszak et al. (13) the content of which is incorporated herein by reference.
- RNase inhibitor Boehringer
- the cells are then lysed by adding 50 mg of glass microbeads (0.5 mm, Biospec Products, Bartlesville, Oklahoma). The tubes are shaken twice for 20 seconds at 5000 revolutions per minute, 10 seconds apart and left on ice between two mixtures. After decantation, 10 ⁇ l of the lysate are transferred to a new tube. c) elimination of genomic DNA
- EZ buffer (Perkin Elmer kit) is added as reaction buffer for the once concentrated rTth enzyme, 2.5 mM Mn (OAc) 2 and, in order to prevent further amplification of contaminating genomic sequences (14 ), 10 units of DNase I containing no RNase (Boehringer) until reaching a final volume of 20 ⁇ l. After incubation for 10 min at 37 ° C, the DNase is inactivated by bringing the temperature to 95 ° C for 5 min. d) RT-PCR The two stages of RT and PCR are carried out successively in the same tube.
- RNA separation of the amplification products 10 ⁇ l of the amplification products are separated by electrophoresis on a horizontal gel (1 to 2% agarose in EDTA Tris-acetate) and are visualized by staining with ethidium bromide and UV illumination.
- Total RNA is also analyzed as a positive RT-PCR control (it is extracted using the RNAgentTM kit (Promega)) and the amplification products obtained are compared to those obtained from total RNA.
- An optional step can be added to confirm the identity of the amplified products.
- the expected size bands ("Gel Extract Kit” (Gel Extract Kit), Qiagen) are purified on gel (fragment of 462 bp), then 1 ⁇ l of the DNA solution is used as a template for a second PCR using internal primers.
- the elongation factor could be detected from 10 cells / ml, which corresponds to 5-10 cells per reaction tube according to the procedure used (Fig. 1A, lane 5). No transcript is detected below this level as well as in uncontaminated milk (Fig. 1A, bands 6 and 7 respectively).
- DNase I Fig. 1A, lane 9
- none detectable PCR product did not appear from the cell lysate. It therefore seems that the addition of a treatment step to DNase I does indeed prevent amplification of the contaminating genomic sequences.
- EXAMPLE 2 Implementation of RT-PCR on a sample of milk contaminated with both live and dead E. coli cells
- EXAMPLE 3 Determination of the presence of living cells of S. cerevisiae in milk (detection of mRNA coding for the elongation factor EF-1 ⁇ ).
- a strain S. cerevisiae S 288C is cultivated at 30 ° C in a YPD medium ("Yeast Peptone Dextrose") containing 2% of bactopeptone, 1% of yeast extract (Laboratoires Difco) and 2% of glucose. Then a solid medium is prepared by adding 2% agar (Difco Laboratories). Part of the cells are removed during the exponential growth phase. The cells are distributed in 2 ml samples and are then exposed to lethal conditions by incubation at 65 ° C for 15 min.
- YPD medium Yeast Peptone Dextrose
- a solid medium is prepared by adding 2% agar (Difco Laboratories).
- the oligonucleotide primers used which are specific for the elongation factor EF-1 ⁇ are the following: Ll: 5 'TCCATGGTACAAGGGTTGGGAA 3'
- Example 1 The same type of results is obtained as in Example 1 (FIG. 1B, detection of a fragment of 657 bp).
- EXAMPLE 4 Implementation of RT-PCR on a sample of milk contaminated with S. cerevisiae cells, both living and dead.
- EXAMPLE 5 Determination of the presence of living M. racemosus cells in milk (detection of mRNA coding for the elongation factor EF-1 ⁇ ).
- Example 1 The procedure of Example 1 is repeated except that in step a) the M. racemosus strain is cultured at 30 ° C. in a YPD medium containing 2% of bacterepeptone, 1% of yeast extract (Difco Laboratories ) and 2% glucose. Then a solid medium is prepared by adding 2% agar (Difco Laboratories). Part of the cells are removed during the exponential growth phase. The cells are distributed in 2 ml samples and are then exposed to lethal conditions by incubation at 120 ° C for 30 min.
- Serial dilutions of the samples are placed on plates on OGY Agar medium (MERCK) in order to verify the cell viability and to count them.
- MERCK OGY Agar medium
- nucleotide primers used which are specific for the elongation factor EF-l ⁇ are the following:
- Ml 5 'GCTGGTATCTCCAAGGATGG 3'
- M2 5'-CGACGGACTTGACTTCRGTGG 3 '
- Example 6 The same type of results is obtained as in Example 1 (FIG. 1C, determination of a fragment of 498 bp).
- EXAMPLE 6 Implementation of RT-PCR on a sample of milk contaminated with both live and dead M. racemosus cells.
- EXAMPLE 7 Determination of the simultaneous presence of living cells of E. coli, S. cerevisiae and M. racemosus.
- the EF-Tu genes of E.coli and EF-1 ⁇ of S. cerevisiae and M. racemosus were detected simultaneously in a single reaction.
- Amplification products of expected size were detected simultaneously by RT-PCR (fragments of 462 bp (E. coli) 657 bp (S. cerevisiae) and 498-bp (M. racemosus), respectively), using contaminated milk both by E. coli, S. cerevisiae and M. racemosus.
- two (Fig. 3 lanes 4, 5 and 6) or three (Fig. 3 lane 7) pairs of primers were placed in the same reaction mixture without modifying the conditions of RT-PCR.
- RT-PCR is a particularly powerful method for the detection of viable contaminants because of its strong ability to increase the detection sensitivities and its speed of implementation.
- a detection level of 10 cells / ml of milk could be reached and the whole RT-PCR process, including washing and filtration of the milk sample, could be carried out in 4 hours without requiring any step enrichment preliminary.
- the choice of target gene is important.
- the selection of primers specific for the coding region of the elongation factor gene has thus been found to be particularly advantageous.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Sampling And Sample Adjustment (AREA)
- Other Investigation Or Analysis Of Materials By Electrical Means (AREA)
Abstract
Description
Claims
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| IL12946697A IL129466A (en) | 1996-10-28 | 1997-10-27 | Method for detecting live microbiological contaminants in a food product sample |
| DK97912259T DK0943010T3 (da) | 1996-10-28 | 1997-10-27 | Fremgangsmåde til påvisning af levende mikrobiologiske kontaminanter i en prøve af et levnedsmiddelprodukt |
| EP97912259A EP0943010B1 (fr) | 1996-10-28 | 1997-10-27 | Procede de mise en evidence de contaminants microbiologiques vivants dans un echantillon de produit a usage alimentaire |
| DE69711073T DE69711073T2 (de) | 1996-10-28 | 1997-10-27 | Verfahren zur erkennung von lebenden mikrobiologischen verunreinigungen in einer lebensmittelprobe |
| AU49517/97A AU728893B2 (en) | 1996-10-28 | 1997-10-27 | Process for detecting live microbiological contaminants in food product sample |
| AT97912259T ATE214430T1 (de) | 1996-10-28 | 1997-10-27 | Verfahren zur erkennung von lebenden mikrobiologischen verunreinigungen in einer lebensmittelprobe |
| CA002269863A CA2269863C (fr) | 1996-10-28 | 1997-10-27 | Procede de mise en evidence de contaminants microbiologiques vivants dans un echantillon de produit a usage alimentaire |
| BRPI9712585-7A BR9712585B1 (pt) | 1996-10-28 | 1997-10-27 | processo para diferenciar contaminantes microbiológicos vivos de contaminantes microbiológicos mortos, e para detectar contaminantes microbiológicos vivos, em uma amostra de produto alimentìcio. |
| US09/297,136 US6472149B1 (en) | 1996-10-28 | 1997-10-27 | Method for detecting live microbiological contaminants in a food product sample |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| FR96/13125 | 1996-10-28 | ||
| FR9613125A FR2755145B1 (fr) | 1996-10-28 | 1996-10-28 | Procede de mise en evidence de contaminants microbiologiques vivants dans un echantillon de produit a usage alimentaire |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO1998018958A1 true WO1998018958A1 (fr) | 1998-05-07 |
Family
ID=9497096
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/FR1997/001918 Ceased WO1998018958A1 (fr) | 1996-10-28 | 1997-10-27 | Procede de mise en evidence de contaminants microbiologiques vivants dans un echantillon de produit a usage alimentaire |
Country Status (13)
| Country | Link |
|---|---|
| US (1) | US6472149B1 (fr) |
| EP (1) | EP0943010B1 (fr) |
| AT (1) | ATE214430T1 (fr) |
| AU (1) | AU728893B2 (fr) |
| BR (1) | BR9712585B1 (fr) |
| CA (1) | CA2269863C (fr) |
| DE (1) | DE69711073T2 (fr) |
| DK (1) | DK0943010T3 (fr) |
| ES (1) | ES2171913T3 (fr) |
| FR (1) | FR2755145B1 (fr) |
| IL (1) | IL129466A (fr) |
| PT (1) | PT943010E (fr) |
| WO (1) | WO1998018958A1 (fr) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999037804A3 (fr) * | 1998-01-23 | 1999-11-11 | Akzo Nobel Nv | ARNm de EF-Tu, EN TANT QUE MARQUEUR DE VIABILITE DE BACTERIES |
| WO2004015141A3 (fr) * | 2002-08-08 | 2004-05-21 | Univ Lausanne | Nouveaux outils moleculaires destines a l'evaluation rapide de la presence et de la viabilite de micro-organismes et procedes d'utilisation de ces outils |
| WO2013049437A2 (fr) | 2011-09-28 | 2013-04-04 | Lonza Walkersville Inc. | Cibles moléculaires et procédés pour le criblage de formulation et un test d'efficacité de conservateur |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1246935B1 (fr) * | 1999-09-28 | 2013-08-14 | Geneohm Sciences Canada Inc. | Genes a fort pouvoir de conservation et leur utilisation pour produire des sondes d'acide nucleique specifiques a l'espece, specifiques au gene, specifiques a la famille, specifiques au groupe et universelles et des sondes d'amplification, en vue de detecter et d'identifier rapidement des micro-orga |
| US7294490B2 (en) | 2000-07-21 | 2007-11-13 | Compagnie Gervais Danone | Method for detecting microorganisms |
| AU2003288018A1 (en) * | 2002-11-20 | 2004-06-15 | Pharmacia Italia S.P.A. | Method for the detection of microorganisms in pharmaceutical products |
| DE102005058431A1 (de) * | 2005-12-07 | 2007-06-14 | Biotecon Diagnostics Gmbh | Verfahren und Nukleinsäuremoleküle zum Nachweis von Hefen und filamentösen Pilzen |
| AU2010205133B2 (en) | 2009-01-15 | 2015-01-22 | Hokkaido Mitsui Chemicals Inc. | Enzyme preparation containing thermostable dna polymerase, method for producing same, and method for detecting subject organism to be detected |
| EP3708646A4 (fr) * | 2017-11-10 | 2021-07-21 | Yokogawa Electric Corporation | Dispositif, système, procédé et programme de sélection de contre-mesure en cas de contamination microbienne |
| CN113195742A (zh) * | 2018-10-02 | 2021-07-30 | 拜奥法尔诊断有限责任公司 | 细菌应答 |
| US11098377B1 (en) * | 2020-09-15 | 2021-08-24 | Nubiyota Llc | Systems and methods for characterizing compositions comprising bacterial populations |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0133671A2 (fr) * | 1983-08-05 | 1985-03-06 | Miles Inc. | Détection des bactéries au moyen d'hybridation d'acide nucléique, sondes marquées et trousse d'essai à cet effet |
| WO1990011370A1 (fr) * | 1989-03-17 | 1990-10-04 | Holland Biotechnology Bv | Sonde de polynucleotide, procede et kit d'identification et de detection de bacteries gram-negatives |
| WO1992003455A1 (fr) * | 1990-08-16 | 1992-03-05 | Isis Pharmaceutics, Inc. | INHIBITION DE $i(CANDIDA) |
| JPH09248186A (ja) * | 1996-03-15 | 1997-09-22 | Oozeki Kk | ラクトバチルス属微生物のポリペプチド鎖延長因子遺伝子Tuおよびその利用 |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4965188A (en) * | 1986-08-22 | 1990-10-23 | Cetus Corporation | Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme |
| US5004682A (en) * | 1987-11-02 | 1991-04-02 | Olin Corporation | Method and kit for detecting live microorganisms in chlorine- or bromine-treated water |
-
1996
- 1996-10-28 FR FR9613125A patent/FR2755145B1/fr not_active Expired - Fee Related
-
1997
- 1997-10-27 EP EP97912259A patent/EP0943010B1/fr not_active Expired - Lifetime
- 1997-10-27 CA CA002269863A patent/CA2269863C/fr not_active Expired - Fee Related
- 1997-10-27 US US09/297,136 patent/US6472149B1/en not_active Expired - Lifetime
- 1997-10-27 WO PCT/FR1997/001918 patent/WO1998018958A1/fr not_active Ceased
- 1997-10-27 PT PT97912259T patent/PT943010E/pt unknown
- 1997-10-27 AU AU49517/97A patent/AU728893B2/en not_active Ceased
- 1997-10-27 ES ES97912259T patent/ES2171913T3/es not_active Expired - Lifetime
- 1997-10-27 DK DK97912259T patent/DK0943010T3/da active
- 1997-10-27 DE DE69711073T patent/DE69711073T2/de not_active Expired - Lifetime
- 1997-10-27 IL IL12946697A patent/IL129466A/xx not_active IP Right Cessation
- 1997-10-27 BR BRPI9712585-7A patent/BR9712585B1/pt not_active IP Right Cessation
- 1997-10-27 AT AT97912259T patent/ATE214430T1/de active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0133671A2 (fr) * | 1983-08-05 | 1985-03-06 | Miles Inc. | Détection des bactéries au moyen d'hybridation d'acide nucléique, sondes marquées et trousse d'essai à cet effet |
| WO1990011370A1 (fr) * | 1989-03-17 | 1990-10-04 | Holland Biotechnology Bv | Sonde de polynucleotide, procede et kit d'identification et de detection de bacteries gram-negatives |
| WO1992003455A1 (fr) * | 1990-08-16 | 1992-03-05 | Isis Pharmaceutics, Inc. | INHIBITION DE $i(CANDIDA) |
| JPH09248186A (ja) * | 1996-03-15 | 1997-09-22 | Oozeki Kk | ラクトバチルス属微生物のポリペプチド鎖延長因子遺伝子Tuおよびその利用 |
Non-Patent Citations (3)
| Title |
|---|
| BERG S. ET AL.,: "Development of an amplification and hybridization assay for the specific and snsitive detection of Mycoplasma fermentas DNA", MOL. CELL. PROBES, vol. 10, - February 1996 (1996-02-01), pages 7 - 14, XP002034547 * |
| DATABASE WPI Section Ch Week 9748, Derwent World Patents Index; Class B04, AN 97-520740, XP002054735 * |
| MULLIS K.B. ET AL.,: "PCR; The polymerase chain reaction", 1994, BIRKHAUSER, BOSTON, USA, XP002034388 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999037804A3 (fr) * | 1998-01-23 | 1999-11-11 | Akzo Nobel Nv | ARNm de EF-Tu, EN TANT QUE MARQUEUR DE VIABILITE DE BACTERIES |
| JP2002500893A (ja) * | 1998-01-23 | 2002-01-15 | アクゾ・ノベル・エヌ・ベー | バクテリアの生存率に関するマーカーとしてのEF−TumRNA |
| US6489110B1 (en) | 1998-01-23 | 2002-12-03 | bioMérieux, B.V. | EF-Tu mRNA as a marker for viability of bacteria |
| WO2004015141A3 (fr) * | 2002-08-08 | 2004-05-21 | Univ Lausanne | Nouveaux outils moleculaires destines a l'evaluation rapide de la presence et de la viabilite de micro-organismes et procedes d'utilisation de ces outils |
| WO2013049437A2 (fr) | 2011-09-28 | 2013-04-04 | Lonza Walkersville Inc. | Cibles moléculaires et procédés pour le criblage de formulation et un test d'efficacité de conservateur |
Also Published As
| Publication number | Publication date |
|---|---|
| DE69711073D1 (de) | 2002-04-18 |
| DK0943010T3 (da) | 2002-06-10 |
| EP0943010B1 (fr) | 2002-03-13 |
| ES2171913T3 (es) | 2002-09-16 |
| CA2269863A1 (fr) | 1998-05-07 |
| EP0943010A1 (fr) | 1999-09-22 |
| ATE214430T1 (de) | 2002-03-15 |
| DE69711073T2 (de) | 2002-11-07 |
| FR2755145A1 (fr) | 1998-04-30 |
| IL129466A0 (en) | 2000-02-29 |
| PT943010E (pt) | 2002-08-30 |
| FR2755145B1 (fr) | 1999-01-15 |
| AU4951797A (en) | 1998-05-22 |
| BR9712585A (pt) | 1999-10-26 |
| BR9712585B1 (pt) | 2009-08-11 |
| AU728893B2 (en) | 2001-01-18 |
| CA2269863C (fr) | 2005-04-05 |
| IL129466A (en) | 2001-08-26 |
| US6472149B1 (en) | 2002-10-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Rivera et al. | Method of DNA extraction and application of multiplex polymerase chain reaction to detect toxigenic Vibrio cholerae O1 and O139 from aquatic ecosystems | |
| FR2811321A1 (fr) | Amplificateur d'une region ribonucleique cible d'un arn ribosomal 16s ou adn pour un tel arn d'une espece eubacterienne et detection de telles especes | |
| EP0647279A1 (fr) | Procede de destabilisation d'une structure secondaire intracatenaire d'un polynucleotide simple brin, et de capture dudit nucleotide | |
| Tolker-Nielsen et al. | Visualization of specific gene expression in individual Salmonella typhimurium cells by in situ PCR | |
| EP0943010B1 (fr) | Procede de mise en evidence de contaminants microbiologiques vivants dans un echantillon de produit a usage alimentaire | |
| CA2087006C (fr) | Sequences nucleiques issues du genome de salmonella typhi, et leurs utilisations notamment pour le diagnostic in vitro de la presence de bacteries du genre salmonella dans les produits alimentaires | |
| EP0662131A1 (fr) | Fragment nucleotidique de l'arn ribosomique 23s de mycobacteries, sondes et amorces derivees, reactif et procede de detection | |
| EP0461045A1 (fr) | Détection spécifique du mycobacterium tuberculosis | |
| FR2769323A1 (fr) | Moyens pour l'analyse qualitative et quantitative des populations microbiennes eventuellement presentes dans un echantillon | |
| FR2636075A1 (fr) | Procede de detection des bacteries, levures, parasites et autres eucaryotes, notamment dans les produits alimentaires | |
| Yadava et al. | Detection and confirmation of toxigenic Vibrio cholerae O1 in environmental and clinical samples by a direct cell multiplex PCR | |
| TW201202431A (en) | Compositions and methods for the rapid detection of Legionella pneumophila | |
| US20090136930A1 (en) | Method for the identification of microorganisms by means of in situ hybridization and flow cytometry | |
| JP2001128679A (ja) | Dnaジャイレース遺伝子中に存在する特徴的な塩基配列を用いた遅発育性マイコバクテリアの同定法及び特異的検出法 | |
| WO1993009251A1 (fr) | Sequences nucleotidiques hybridant specifiquement avec les souches bacteriennes du complexe mycobacterium avium-intracellulare | |
| FR2844522A1 (fr) | Procede et sequences nucleotidiques pour la detection et l'identification de microorganismes dans un melange complexe | |
| FR2941240A1 (fr) | Procede pour determiner la sensibilite d'un patient a contracter une infection nosocomiale. | |
| WO2021152096A1 (fr) | Procede de pcr multiplexe pour la detection de microorganismes et son utilisation | |
| FR2844523A1 (fr) | Procede et sequences nucleotidiques pour la detection et l'identification de microorganismes dans un melange complexe ou dans de l'eau | |
| EP1104489B1 (fr) | Procede de separation et de caracterisation des fonctions potentiellement presentes dans un echantillon biologique contenant des acides nucleiques | |
| EP2392669B1 (fr) | Méthode de détection des leptospires pathogènes basée sur le gène rpoB | |
| EP1257666A1 (fr) | Methode de detection d'une inteine specifique de mycobacterium tuberculosis et son utilisation pour le diagnostic de la tuberculose | |
| Virolainen | DETECTION OF 16S RIBOSOMAL RNA IN CLINICAL SAMPLES | |
| MXPA99003912A (en) | Method for detecting live microbiological contaminants in a food product sample | |
| CN119842946A (zh) | 一种基于CRISPR/Cas12b的淋病奈瑟菌检测方法 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW AM AZ BY KG KZ MD RU TJ TM |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH KE LS MW SD SZ UG ZW AT BE CH DE DK ES FI FR GB GR IE IT LU MC |
|
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| ENP | Entry into the national phase |
Ref document number: 2269863 Country of ref document: CA Kind code of ref document: A Ref document number: 2269863 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1997912259 Country of ref document: EP Ref document number: 09297136 Country of ref document: US |
|
| WWE | Wipo information: entry into national phase |
Ref document number: PA/a/1999/003912 Country of ref document: MX |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
| WWP | Wipo information: published in national office |
Ref document number: 1997912259 Country of ref document: EP |
|
| WWG | Wipo information: grant in national office |
Ref document number: 1997912259 Country of ref document: EP |