WO1998013505A1 - Produits de synthese d'adn et procedes pour produire des proteines a l'aide de ces produits de synthese d'adn - Google Patents

Produits de synthese d'adn et procedes pour produire des proteines a l'aide de ces produits de synthese d'adn Download PDF

Info

Publication number
WO1998013505A1
WO1998013505A1 PCT/EP1997/005217 EP9705217W WO9813505A1 WO 1998013505 A1 WO1998013505 A1 WO 1998013505A1 EP 9705217 W EP9705217 W EP 9705217W WO 9813505 A1 WO9813505 A1 WO 9813505A1
Authority
WO
WIPO (PCT)
Prior art keywords
dna
plant
ribosomal
region
construct
Prior art date
Application number
PCT/EP1997/005217
Other languages
English (en)
Inventor
Andreas Bachmair
Dieter Schweizer
Original Assignee
Plant Genetic Systems N.V.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Plant Genetic Systems N.V. filed Critical Plant Genetic Systems N.V.
Priority to JP10515258A priority Critical patent/JP2001501089A/ja
Priority to AU49421/97A priority patent/AU725390B2/en
Priority to EP97912083A priority patent/EP0932691A1/fr
Priority to CA002265519A priority patent/CA2265519A1/fr
Publication of WO1998013505A1 publication Critical patent/WO1998013505A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells

Definitions

  • the present invention provides DNA-constructs comprising DNA fragments of the intergenic spacer between ribosomal rRNA gene repeats, as well as methods to produce proteins and methods for enhancing copy number or expression using these DNA- constructs, in eu aryotic cells, particularly in plant cells.
  • RNA- polymerase I is specifically responsible for the transcription of ribosomal RNA (rRNA)- genes. Due to their high copy number, the ribosomal RNA-genes were the first genes to be ⁇ analysed molecularly. The repetitive nature of these genes has hampered considerably their further analysis.
  • the control elements for transcription are located in the intergenic region (IGR), also called intergenic spacer (IGS).
  • IGR is the DNA region located between the 25S RNA encoding region of the preceding rRNA gene unit and the 18S RNA encoding region of the following rRNA gene unit. It consists in general of a 3 ' external transcribed spacer extending from the end of the region encoding the mature 25S RNA up to the transcription termination site of the preceding rRNA gene unit, .and a 5' external transcribed spacer extending from the transcription initiation site up to the beginning of the region encoding the mature 18S RNA of the next rRNA gene unit, with in between these two regions a non-transcribed spacer.
  • the IGR contains repetitive sequence motifs in the majority of the cases.
  • the exact base sequence of these motifs is probably under low selective pressure, since there is mostly little or no sequence similarity between related species. This is in contrast with the good conservation of another part of the IGR, namely the region surrounding the transcription start.
  • DNA constructs comprising the following operably linked DNA fragments: a DNA fragment comprising a ribosomal DNA sequence preferably derived from a plant, preferably derived from the intergenic region of the ribosomal DNA of a plant; particularly comprising the upstream Sail repeats from the intergenic region from the ribosomal DNA of Arabidopsis thaliana or a similar region from another plant; a fragment comprising an expressible promoter region, especially a plant-expressible promoter region, preferably a promoter recognized by RNA polymerase II; a heterologous coding region; and optionally a transcription termination and polyadenylation region, preferably a region which is active in plant cells.
  • Particularly preferred ribosomal DNA sequences comprise a DNA sequence selected from the DNA sequence of SEQ ID N° 1 from nucleotide position 486 to 5212, the DNA sequence of SEQ ID N° 1 from nucleotide position 1263 to nucleotide position 3003, the DNA sequence of SEQ ID N° 1 from nucleotide position 569 to nucleotide position 2862, the DNA sequence of SEQ ID N° 1 from nucleotide position 1263 to nucleotide position 2862, the DNA sequence of SEQ ID N° 1 from nucleotide position 486 to 5212, the DNA sequence of SEQ ID N° 1 from nucleotide position or 596 to 5373.
  • Also provided are a method to produce proteins comprising the following steps: introducing a DNA-construct according to the invention in a suitable host organism; cultivating the host-organism under conditions which allow expression of the protein encoded by the structural gene; and harvesting the expressed protein.
  • a method for enhancing the stability, the copy number or the expression of a transgene in a plant comprising the following steps: introducing a DNA construct according to the invention in a plant cell; and regenerating a plant from the transformed plant cell.
  • host-organisms particularly plants and plant cells comprising the DNA-constructs according to the invention, integrated in their nuclei genome, are provided.
  • Fig 1 the restriction map of the ribosomal DNA from Arabidopsis thaliana
  • Fig 2 (A) the sequence of the VI region of A. thaliana 25S rRNA before (left) and after (right) introduction of the insertion sequence
  • Fig 4 Primer extension analysis to detect the transgenic rRNA
  • Fig 5 determination of the 5 'end of A. thaliana 25S rRNA
  • Fig 6 serial silver-stained sections through cells with trangene R4
  • Fig 7 analysis of transcription of the ectopic ribosomal gene
  • Fig 8(a)-(e) binary vectors R4 to R8.
  • Fig 9-A/B schematic representation of the binary vectors comprising respectively lacking the upstream Sail repeats in front of a chimeric CaMV35S-gus gene
  • a DNA-construct which allows improved expression of foreign proteins in eukaryotic cells, particularly in plant cells.
  • a DNA-construct according to the invention comprises in reading direction, the following operably linked DNA fragments: a DNA fragment comprising a ribosomal DNA sequence, preferably derived from a plant a fragment comprising an expressible promoter region, especially a plant-expressible promoter region, a heterologous coding region; and optionally a transcription termination and polyadenylation region, preferably a region which is active in plant cells.
  • RNA-poly tnerase I the ribosomal DNA
  • the promoter region in the recombinant DNA according to the invention is preferably a promoter recognized by RNA polymerase II
  • the promoter may also be comprised within the ribosomal DNA, which could make the construction of the recombinant DNA according to the invention easier.
  • plant- expressible promoter region means a promoter which is capable of driving transcription in a plant cell.
  • the ribosomal DNA should be derived from a plant, it is meant that the sequence of that ribosomal DNA fragment should be identical or similar to the sequence as it is found in a plant.
  • the DNA fragment can have been cloned in an intermediate organism, such as E. coli or be completely or partially synthetic.
  • Ribosomal DNA fragments suitable for the invention are capable to direct the chromatin structure in such a way that the DNA constructs according to the invention, integrated in the nuclear genome are located in the neighbourhood of the nucleolus or that the genomic region wherein the transgene is integrated, adopts a similar chromatin structure as found in the nucleolus.
  • Methods to determine the spatial location of a DNA fragment in a cell are known to the person skilled in the art, and one such method is set forth in detail in the Examples. Mehods to determine the structural characteristics of chromatin, particularly the degree of accessibility of the DNA for interacting molecules, are also know in the art (e.g.
  • the ribosomal DNA is specifically adapted to the host- organism wherein the recombinant DNA according to the invention will be introduced; eg. a ribosomal DNA derived from that host organism or from a closely related species.
  • the ribosomal DNA is preferentially derived from the intergenic region of the ribosomal DNA.
  • the intergenic region from variety ColO has the DNA sequence of SEQ ID N° 1 from nucleotide position 486 to 5212
  • especially preferred .are DNA fragments comprising the "upstream Sail repeats" from the intergenic region of Arabidopsis thaliana ribosomal DNA.
  • upstream Sail repeats are organized in three blocks [the so-called Sail box 1 (SEQ ID N° 1 from nucleotide position 1263 to 1557) Sail box 2 (SEQ ID N° 1 from nucleotide position 1883 to 2177) and Sail box 3 (SEQ ID N° 1 from nucleotide position 2503 to 3003)] and it is thought that inclusion of a DNA fragment comprising these Sail repeats (such as a fragment having the DNA sequence of SEQ ID N° 1 from nucleotide position 1263 to nucleotide position 3003) is sufficient to obtain the effects according to the invention.
  • Sail box 1 SEQ ID N° 1 from nucleotide position 1263 to 1557
  • Sail box 2 SEQ ID N° 1 from nucleotide position 1883 to 2177
  • Sail box 3 SEQ ID N° 1 from nucleotide position 2503 to 3003
  • the ribosomal DNA comprises a fragment having the DNA sequence of SEQ ID N° 1 from nucleotide position 1263 to nucleotide position 2862.
  • fragments comprising the upstream Sail repeats can be used, such as a fragment comprising the complete intergenic region (having the DNA sequence of SEQ ID N° 1 from nucleotide position 486 to 5212) or even a fragment comprising parts of the regions coding for the rRNA transcripts, particularly the 18S transcript (such as a fragment having the DNA sequence of SEQ ID N° 1 from nucleotide position 596 to 5373).
  • DNA fragments comprise those domains of the ribosomal DNA which correspond to these domains in Arabidopsis, particularly those which are derived therefrom.
  • DNA fragments comprising the intergenic spacers, located between the DNA regions coding for the 25S and 18S regions, panicularly DNA fragments comprising the non-transcribed intergenic spacers located between the transcription termination site of the previous rRNA gene unit and the transcription initiation site of the following rRNA gene unit.
  • Other rRNA intergenic spacers are .known in the art at least for corn [McMullen et al., Nucl. Acids Res. 14: 4953-4968 (1986)Toloczyki and Feix, Nucl.
  • intergenic spacers from a plant can be straightforwardly amplified in a PCR reaction using oligonucleotides corresponding to the 3' end of the conserved 25S mature rRNA encoding region and the 5' end of the conserved 18S mature rRNA encoding region.
  • modified ribosomal DNA which is derived from the original ribosomal DNA by mutation, insertion or deletion, as long as the essential functional, particularly related (e.g. with DNA-binding proteins such as polymerases) or at least the essential topological characteristics from the ribosomal DNA are not lost by the modification.
  • coding region or "coding sequence” refers to a DNA region which when provided with appropriate regulatory regions, particularly a promoter region, is transcribed into an RNA which is biologically active i.e. , which is either capable of interaction with another nucleic acid such as e.g. an antisense RNA or a ribozyme or which is capable of being translated into a biologically active polypeptide or protein.
  • heterologous with regard to a coding region refers to any coding region which is different from the rRNA coding region naturally associated with ribosomal DNA fragment used in the chimeric DNA according to the invention.
  • coding region all known natural or modified coding regions can be used, which are compatible with the host-organism, in other words that the expressed product is expressed in such a way that the product is not too toxic for the host, particularly that it leads to a significant expression, before the product is collected, if collected at all.
  • the coding region might encode a vaccine, an antibody, a therapeutical protein, an insecticidal protein such as a Bt toxin or the minimal toxic fragment thereof, a protein used in food technology, an antisense-RNA or a ribozyme.
  • the DNA-construct can be made in such a way that it is adapted to a particular host or transformation system.
  • the DNA construct according to the invention is in the form of a vector.
  • the DNA construct is a T-DNA vector.
  • the ribosomal DNA fragment preferably precedes the promoter region and the heterologous coding region in the DNA-constructs according to the invention, it is expected that similar effects will be achieved when the ribosomal DNA fragment is placed downstream of the operably linked promoter region and coding region.
  • the present invention also provides a process for the production of proteins comprising the following steps: introducing a DNA-construct according to the invention in a suitable host organism, cultivating the host-organism under conditions which allow expression of the protein encoded by the structural gene optionally, harvesting the expressed protein.
  • the present invention provides a process for enhancing the stability, the copy number and/or the expression of a transgene, especially in a plant, comprising the following steps: introducing a DNA construct according to the invention in a cell, preferably in a plant cell regenerating an organism, preferably a plant, from the transformed cell
  • the method of the invention is particularly suited to enhance the stability and expression of recombinant genes which have at least partially homology to a sequence present in the host cell, particularly the plant cell, such as transgenes in multiple copies or different transgenes comprising similar sequences such as e.g. the same promoter. It is known that such transgenes are frequently prone to homologous recombination, as well as to reduction in expression by e.g. methylation, or co- suppression events.
  • the localization of the transgenes resulting from the transformation of the DNA constructs according to the invention, in or in the neighbourhood of the nucleolus or the enforcement of a nucleolus-like chromatin structure on the chromosomal region wherein the transgene is integrated reduces the recombination between homologous sequences (thus increasing stability), the methylation and any other events resulting in a reduction in expression of such transgenes.
  • Introduction of the DNA can be done using any method or manner and different techniques - dependent upon the host-orgasm used - are available to the skilled artisan. Particularly preferred ways of introduction of DNA are T-DNA transformation, electroporation or particle -bombardment as well as plasmid- or virus-transformation.
  • the optimal cultivation conditions depend on the used host-organism and on the nature of the expressed protein. These conditions are again known to the person skilled in the art (for well-known host-organism) and/or can be easily determined or optimised using known biotechnological protocols.
  • the harvest of the proteins is also preferably performed according to standard methods for the concerned host-organism and depends also on the way the protein is expressed (e.g. whether it is secreted or excreted in the culture medium, or accumulates inside the host-organism, or is included in specific compartments, ).
  • the person skilled in the art can without undue experimentation deteimine ⁇ and or optimize the harvesting conditions for a particular host/ structural protein system.
  • Preferred host-organisms particularly plants are well-known and well defined systems, such as Arabidopsis thaliana, or economically important crops such as tobacco, corn, wheat, potato, rice, soy beans, barley, rye, a brassica vegetable, a Beta species or manioc.
  • a host-organism comprising the DNA-construct of the invention.
  • this host-organism is a eukaryotic cell, particularly a plant cell, as well as an organism comprising these cells or generated from these cells.
  • the invention provides reproduction material, particularly plant reproduction material, comprising cells which comprise the DNA-construct according to the invention.
  • SEQ ID No.1 DNA sequence of the intergenic region of rRNA gene repeats of
  • A. thaliana SEQ ID No .2 oligonucleotide
  • SEQ ID No.6 DNA sequence of the A. thaliana region between the 3' end of
  • a Sail fragment from lambda-phage ATR3 (Grundler, P., Unfried, I., Pointner, R. and Schweizer, D. (1989) "Nucleotide sequence of the 25S-18S ribosomal gene spacer from Arabidopsis thaliana", Nucleic Acids Res., 17, 6395-6396; Unfried, I., Stocker, U. and Grundler, P. (1989) "Nucleotide sequence of the 18S rRNA gene from Arabidopsis thaliana Col-0", Nucleic Acids Res., 17, 7513; Unfried, I. and Grundler, P.
  • the resulting vector, R2 is cleaved with Asp718, treated with Klenow-enzyme and cleaved partially with Sfil.
  • a fragment from the Sail-restriction site in position 305 from sequence X 16077 to the Pstl restriction site in position 1425 from X52320, comprising the largest part of the 18S rDNA-sequence and the 5 '-end of the 25S rDNA sequence was first cloned in pSK+ (plasmid pBlu/SP). After cleaving with Xbal and Srfl , filling in of the sticky ends with Klenow-enzyme and ligation, the ligation product is treated with Xhol and EcoNI, treated with Klenow enzyme and religated. The resulting vector now has a single Aatll restriction site.
  • CCAAGGTAACCTTCGACGT SEQ ID N° 2
  • CGAAGGTTACCTTGGACGT SEQ ID N° 3
  • Plant transformation was performed as described by Valvekens, D., van Montagu, M. and van Lijsebettens, M. (1988) "Agrobacterium tumefaciens-mediated transformation of Arabidopsis thaliana root explants by using kanamycin selection", (Proc. Natl. Acad. Sci. USA, 85, 5536-5540), except that hygromycin selection was used.
  • the selectable marker in the plasmids used in the examples 1 and 2 was indeed hygromycin phosphotransferase.
  • DNA-isolation was performed as described (Dellaporta, S.L. , Wood, J. and Hicks, J.B. (1983) "A plant DNA minipreparation version II", Plant Mol. Biol. Rep., 1, 19-21), with the following modifications: After phenol extraction, 1/10 of the volume ethidiumbromide (lOg/1) is added to the DNA solution as well as CsCl (0.9 g/ml). The solution is kept on ice for 30 min. After centrifugation (5 min 5000 RPM) the clear solution is adjusted with CsCl to a density of 1.6 g/ml and centrifuged for 3 hours at 80000 rpm in a Beckman NVT90 rotor.
  • DNA is harvested using standard methods from the gradient (Ausubel, F.M., Brent, R., Scientific, R.F., Moore, D.O., Seidman, J.G., Smith, J.A. and Struhl, K. (Eds.) (1987) Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York). 4. DNA-analysis through gel-blot
  • Purified DNA from callus material was digested with restriction enzymes such as BstEII and used for gel-blot-analysis (Ausubel et al., 1987).
  • RNA was prepared as described in Logemann, J., Schell, J and Willmitzer, L. ((1987) "Improved method for the isolation of RNA from plant tissues" Anal. Biochem., 163, 16- 20) with the following modifications: callus material was ground in liquid nitrogen and mixed with 2 ml extraction buffer (8M guanidium chloride, 20 mM MES, 20 mM EDTA, 50 mM 2-mercaptoethanol, 0.5 % Sarcosyl pH about 3) per gram callus material. After thawing the suspension was transferred to a centrifuge tube, and extracted widi one volume phenol/chloroform/iso ⁇ tmyl alcohol (50:49:1).
  • the mixture After heavy vortexing, the mixture is kept on ice for about 15 minutes and centrifuged at lOOOOg for about 10 min.
  • the aqueous phase is transferred to a new tube, and 1/10 volume sodium acetate (1M) and 1 volume of ethanol is added, to precipitate the nucleic acids.
  • the pellet was washed with 3M sodium acetate and 70 % ethanol. After evaporation of the residual alcohol, the pellet is dissolved in water through incubation at 60 to 65 °C for about 3 hrs.
  • oligonucleotide E GAAACGTCGAAGGTTACCTTGG (SEQ ID N° 4); an oligonucleotide which exclusively binds to the rRNA with the 19 nucleotide insertion) or Q (CCCGGTTCGCTCGCCGTTACTAAG (SEQ ID N° 5) ; nucleotide 950 to 927 of the non-coding strand of sequence X52320, which can bind to all 25S RNA-molecules of A.
  • thaliana were phosphorylated with 10 ⁇ Ci 32 P-gamma-ATP in a volume of 10 ⁇ l for 90 minutes, extracted with phenol/chloroform after addition of 1 mg of tRNA and precipitated with sodium-acetate and ethanol.
  • the oligonucleotide was incubated with 2.5 ⁇ g of total RNA from A. thaliana in 11 ⁇ l water to allow hybridization, and cooled from 90°C to 63 °C and then to 52 °C in a time span of about one and a half hour.
  • Callus material was fixed with 2.5 % paraformaldehyde and 0.5 % glutaraldehyde in 0.1 M phosphate buffer and embedded in LR White Harz.
  • Serially following sections with a thickness of 800 nm ( resulting in about 5 to 6 sections per nucleus) were produced using a Reichert Ultracut E Microtome.
  • the sections were stained with Richardson's Dye and analysed using a Leitz Dialux Microscope.
  • variable region has a hairpin structure which may be either longer, shorter or even completely absent.
  • VI One such variable region in the large rRNA, named VI, was used, to insert a specific nucleic acid sequence. This region is also close enough to the beginning of the mature 25S rRNA so that extension experiments can be performed.
  • a DNA fragment of the rDNA which comprises somewhat more than one repeat unit (transcription unit) was inserted into the binary vector pBIB Hyg (Becker, D., 1990).
  • the construct contains the presumed signals for transcription termination on both ends of the repeat unit.
  • the structure of this construct (named R4) and the restriction map of the ribosomal repeat unit of A. thaliana are represented in Fig. 1 and Fig. 8(a).
  • the open boxes indicated 18S, 5.8S and 25S represent the regions coding for the three ribosomal RNAs.
  • "Upstream Sal repeats" indicates three blocks of repetitive DNA in the intergenic region, which comprise a lot of Sail restriction sites. Bold lines at both ends of the scheme indicate the vector DNA.
  • the BstEII restriction site, introduced by the nucleotide-insertion is indicated with “B”.
  • Vector R5 is different from vector R4 in the absence of "the upstre.am Sail repeats", as well as in the presence of the Kpnl restriction site at the border of the ribosomal unit (K).
  • B BstEII
  • E EcoRI
  • F Fspl
  • H Hindlll
  • K KpnI
  • P Pstl
  • Pc Pad
  • S Sail
  • Sc Seal
  • Sf Sfil
  • Sr Srfl
  • X Xbal
  • Xh Xhol.
  • the nucleic acid sequence of the region is available in the EMBL-database under accession number X16077, X52320 and X15550. Variants of a part of the ribosomal DNA are available in the EMBL-database under accession number X52631, X52637 and X52636 (Grundler et al. , 1989; Unfried et al., 1989; Unfried et al. , 1990; Grundler, P., Unfrie, I., Pascher, K. and Schweizer, D. (1991) rDNA intergenic region from Arabidopsis thaliana: structural analysis, interspecific variation and functional implications. J. Mol. Biol., 221 , 1209-1222).
  • a ribosomal gene-unit (Fig. 1) was marked with a small nucleotide insertion in the large (25S) ribosomal RNA to be able to recognize it specifically and discriminate it from other ribosomal gene-units present in the genome.
  • Fig. 2 shows the nucleotide insertion as well as an oligonucleotide which allows detection of transcription of this (marked) ribosomal gene-unit.
  • the insertion sequence has a BstEII restriction site, which can be used for the specific recognition of the gene-unit (a), sequence of the region VI of A. thaliana 25S rRNA before (left) and after (right) insertion of the oligonucleotide sequence.
  • the secondary structure of the insertion is hypothetical and is only for the purpose of comparison with the structure without insertion.
  • the insertion has a BstEII-restriction site in the DNA.
  • (b) Sequence of the oligonucleotide allowing detection and quantification of 25S ribosomal RNA through reverse transcription.
  • R5 differs from R4 in that the "upstream Sail repeats" have been removed.
  • R4.and R5 were introduced in root explants of A. thaliana plants using Agrobacterium tumefaciens. Adjacent to the ribosomal unit a gene is located which is transcribed by RNA-polymerase II and confers resistance to hygromycin B (hygromycin- phosphotranferase-gene; Becker, D., 1990). Transformed cells/calli are selected by their resistance to hygromycin. DNA from these calli is used for DNA-blot-experiments.
  • Fig 3 shows that the ribosomal transgene-copies and the adjacent marker gene can integrate in different places in the genome.
  • the enzyme BstEII was used which does not cleave in the ribosomal genes of the A. thaliana ecotype Col-0. Therefore, the ribosomal DNA is visible as a high-molecular weight band or is even partially retained in the gel-slot.
  • ribosomal transgenes which have not integrated between natural ribosomal DNA repeats can give rise to smaller bands, since in the genomic region near the integration place, BstEII restriction sites should be present in a statistically random way. Exactly the latter result can be seen in the analysed calli.
  • DNA-hybridization experiments shown in Fig. 3 demonstrate that integration of the transgene at least in the majority of cases does not occur in the regions of the ribosomal DNA.
  • DNA from callus material was restricted with BstEII and transferred to a nylon-membrane after size fractionation on an agarose gel.
  • Lanes 1 and 2 contain DNA from non-transformed callus material, and from callus material transformed by DNA construct R4 respectively.
  • DNA from the hygromycin phosphotransferase gene was used as probe.
  • the detected fragments have one side the BstEII restriction site located in the 25S rRNA transgene and on the other hand a BstEII restriction site in the DNA of the integration place.
  • Lanes 3 and 4 show the same digested DNA as in lanes 1 and 2, but here ribosomal DNA was used as probe.
  • the DNA from the calli remains either in the gel-slot, or moves as high-molecular DNA at the limits of the separating power of the gel.
  • Lanes 5- 8 contain DNA from three further independently transformed calli, whereby lane 8 has been hybridized with a ribosomal probe.
  • RNA was prepared and used for the primer extension analysis. Therefore, an oligonucleotide was designed, which binds to the insertion in the variable region VI , but not to RNA which does not contain such an insertion.
  • the synthetic DNA- fragment indicated as oligonucleotide E in Fig 2 was particularly suited.
  • a reverse transcript using this oligonucleotide as primer, was obtained in transformed calli, but not in non-transformed calli.
  • the activity of the ribosomal transgene can be detected in the majority of cases (Fig. 4):
  • RNA (a) Lane 1 : callus material not transformed with ribosomal transgene DNA; lane 2: callus material transformed by the ribosomal transgene R4; (b) gel slot (indicated by arrow) and size marker ; precursors with higher molecular weight (2 or 3 asterisks) can be seen in a lot of experiments; lane 1: size marker; lane 2, as lane 1 in (a); lane 3: as lane 2 in (a)).
  • the adjacent hygromycin resistance gene is active in all cases.
  • ribosomal transgenes are comparable to the natural ribosomal gene, in that the same 5' end of the 25S rRNA could be determined (Fig 5): the 5 'end of the normal genomic 25S rRNA was determined using oligonucleotide Q, die 5 'end of the transgene marked wid the inserted sequence was determined using oligonucleotide E.
  • Fig 5 the 5 'end of the normal genomic 25S rRNA was determined using oligonucleotide Q, die 5 'end of the transgene marked wid the inserted sequence was determined using oligonucleotide E.
  • Fig 5 (a) shows the primer extension analysis with oligonucleotide Q, which can bind all 25S rRNA transcripts.
  • Fig 5(b) shows the reverse transcription with oligonucleotide E, which is specific for die transgenic ribosomal copy.
  • a sequencing ladder obtained using the same oligonucleotide as primer is represented.
  • the asterisk marks the final base of the reverse transcripts.
  • Transgenic and endogenous ribosomal 25S rRNA have an identical 5 '-end Fig 5(c) is analogous to lane 3 in Fig 4 ), but with sequencing ladder.
  • Fig 5(d) shows die sequence of the ribosomal DNA with indication of die 5 'ends of die 25S rRNA, as well from a precursor (one asterisk and two asterisks respectively). The dot represents die previously presumed 5'end.
  • Bold font indicates the part present in 25S, respectively 5.8S RNA.
  • transgenic and natural ribosomal RNA indicates mat die components necessary for such a processing (which normally occur in the nucleolus) have access to the ectopically integrated transgene. It was further analysed, whedier the latter one could be located in a nucleolus or in the neighbourhood of a nucleolus. A positive result would correspond to die situation found in Drosophila (Karpen, G.H. , Schaefer, J.E. and Laird, C. D. (1988) "A Drosophila rRNA gene located in euchromatin is active in transcription and nucleolus formation", Genes Dev. 2, 1745-1763), a negative result would be similar to the situation found in baker's yeast. Transgenic Arabidopsis nuclei were stained widi silver and serial diin sections were made. Fig 6 and Table 1 show mat Arabidopsis cells widi the mentioned transgene have on average one additional nucleolus.
  • Table 1 Average number of nucleoli in callus cells transformed with R4, and in non- transformed control. cells (in each case, 25 cells were analysed by serial sectioning as in Fig 6)
  • Control cells 2.0 ⁇ 0.3
  • Additional nucleoli ((a) drrough (j)- Sections through A. thaliana callus- cells without ectopic ribosomal DNA; (k) through (t), as (a) through (j), but with callus material comprising ectopic rDNA (remarkable cells are indicated by asterisks); in (k) through (t) additional nucleoli can be seen.
  • the selected callus-nuclei have on average three nucleoli, while this number in non- transformed callus material is around two; The size of the three nucleoli cannot be distinguished in such a way as to state that one of them contains only the ectopic copies. It can equally be assumed mat the available active ribosomal genes are divided between all drree copies. Further experiments indicated mat the gene coding for hygromycin resistance is located in a position at least in me neighbourhood of die nucleoli.
  • a reverse transcription and analysis was performed on plant material which was either transformed only with vector sequences (lanes 1 in bodi panels of Fig 7), with ribosomal copies lacking die upstream Sail repeats (lanes 2 in both panels) or with the complete ribosomal copies (Lanes 3 in both panels).
  • Fig 7 (a) the oligonucleotide E (specific for die transgenic copy) was used; in Fig 7(b) oligonucleotide Q binding to all 25S rRNA molecules was used (as a control for similar amounts of RNA).
  • Fig. 7 shows diat no difference could be demonstrated. To exclude positional effects on some of the integrated transgenes, a mixture of several independently transformed calli were used as starting material. Also the processing of die rRNA does not seem to suffer from me loss of the upstre ⁇ un Sail repeats. Therefore, it seems that sequences from die so-called "upstream Sal repeats" (see Fig 1) have no significant influence on the expression level of die ribosomal gene unit in freshly transformed callus material. Fig 7 shows a quantitative evaluation of the gene expression of ribosomal gene-units.
  • Fig. 8(a)-(e) shows constructs which were compared widi each omer
  • R4-R8 are E. coli-Agrobacterium shuttle vectors widi RK2 origin of replication, whereby "Br” and "Bl” indicate die right, respectively left T-DNA border
  • binary vector R4 comprises the complete ribosomal unit from A. thaliana next to a hygromycin resistance gene (HPT)
  • binary vector R5 is similar to R4, without the "upstream Sal repeats” (lacks me DNA sequence of SEQ ID
  • binary vector R6 comprises only die intergenic region (IGR) of the ribosomal DNA next to the hygromycin resistance gene (was constructed by insertion of me DNA fragment having the sequence of SEQ ID N° 1 from
  • binary vector R7 is similar to R6 but lacks the
  • upstream Sal repeats (deletion of die DNA sequence of SEQ ID N° 1 from nucleotide position 1269 to 3002); (e) binary vector R8: comprises only the RNA encoding part of the ribosomal DNA adjacent to a resistance gene (similar to Rl but without die sequence of
  • All constructs according to die invention cause a stabilization of the transgene, which can be observed as die presence of a higher copy number and/or higher transformation efficiency, particularly as a more stable expression of the structural gene, particularly a marker gene such as me hygromycin phosphotransferase genes).
  • upstre.am Sal repeats USR
  • Wrout upstream Sal repeats
  • DNA was prepared from transformed callus material and digested widi me restriction enzymes BamHI and Hindlll. Bom enzymes cut widiin die transferred DNA, tiius all copies integrated in d e genome will run as a single band upon size separation by gel electrophoresis.
  • Soudiern blotting using the hygromycin resistance gene as probe die relative number of me transgene copies was determined in different calli by comparison of the intensity of me hybridizing bands with the help of a Phospho imager.
  • die DNA blot was hybridized using as probe, a DNA known to be present in two copies in the genome (chlorata 42). The relative intensity of die bands determined as described above, was used to estimate the amount of DNA in the different lanes. From me comparison of the intensity of die bands of both probes, it was determined diat me analysed transgenes were present in die following copy number:
  • Construct widiout USR copy number per haploid genome in 5 cases 2; 1; 2; 1.5; 1.5 leading to an average of 1.6 ⁇ 0.5 copies.
  • the vector represented in Fig. 9B was constructed by introduction of a DNA fragment comprising e chimeric CaMV35S-gus gene from pRTgus (Topfer et al. (1993) "Expression vectors for high-level gene expression in dicotyledonous and monocotyledonous plants” Medi.Enzymol. 217, 66-78") in die polynucleotidelinker between die nos terminator and die hyg gene of pBIB Hyg (Becker et al. 1990).
  • Th ⁇ vector represented in Fig. 9A was constructed by introduction of an EcoRI-Sall DNA fragment having die DNA sequence of SEQ ID N° 1 from nucleotide position 596 to 2862, in the vector of Fig. 9B in such a way mat die end of d e ribosomal DNA fragment located originally adjacent to die Poll promoter is now located adjacent to me CaMV35S promoter.
  • the activity of die enzyme encoded by me transgene was estimated for transgenic callus material (2 to 25 mg) homogenized in 200 ⁇ l extraction buffer (50 mM sodium phosphate pH 7, 10 mM 2-merca ⁇ to-eti ⁇ anol, 10 mM EDTA, 0.1 % SDS, 0.1 % Triton X-100). After centrifugation (10 min, 4°C, 18000 rpm) me activity was measured. Therefore, para-nitrophenyl-beta-glucuronide (pNPG; 2mM) was added and incubated from 10 to 30 min at 37°C. The reaction was stopped by addition of 0.2 M sodium-carbonate (modified after Gallagher, ed. , GUS protocols, Academic Press, 1992).
  • Example 3 Analysis of corn plants transformed widi DNA constructs according to die invention.
  • the rRNA intergenic region of corn is amplified by PCR using oligonucleotides corresponding to die 3' end of die conserved 25S mature rRNA encoding region and the 5 ' end of die conserved 18S rRNA mature rRNA encoding region (using die sequence available from EMBL database under die accession number EMBL X03990).
  • the oligonucleotides are designed to include suitable restriction sites at die extremities of me amplified fragment.
  • the fragment is cloned upstream of a CaMV35S promoter region operably linked to a region encoding phospinotricinacetyl transferase (PAT encoded by bar) as described in WO 92/09696 in such orientation diat die intergenic region sequence proximal to the mature 18S rRNA coding region is now proximal to d e chimeric bar gene.
  • the DNA construct comprising me intergenic rDNA and die chimeric bar gene are inserted between die borders of die T-DNA vector pGSV5 (described in W097/ 13865).
  • the DNA-construct is tiien integrated into die nuclear genome of corn according to die methods described in WO92/09696 or EP 0469273.
  • Transgenic corn lines are analysed for expression level (fay determination of d e level of PAT activity) and d e copy number of transgenes (by Soudiern hybridizations). Bodi the average copy number and average expression level of die chimeric bar gene are higher in the lines transformed by the DNA constructs comprising me intergenic repeat, man in control lines transformed by DNA constructs wittiout intergenic repeat.
  • Example 4 Analysis of oilseed rape plants transformed widi DNA constructs according to me invention.
  • the rRNA intergenic region of oilseed rape is amplified by PCR using oligonucleotides corresponding to die 3' end of die conserved 25S mature rRNA encoding region and die 5' end of die conserved 18S rRNA mature rRNA encoding region (using die sequence; of a related species such as die one available from EMBL database under die accession number X60324).
  • the oligonucleotides are designed to include suitable restriction sites at die extremities of d e amplified fragment.
  • the fragment is cloned upstream of a CaMV35S promoter region operably linked to a region encoding phospinotricinacetyl transferase (PAT encoded by bar) as described in WO 92/09696 in such orientation that the intergenic region sequence proximal to the mature 18S rRNA coding region is now proximal to the chimeric bar gene.
  • the DNA construct comprising the intergenic rDNA and die chimeric bar gene are inserted between die borders of the T-DNA vector pGSV5 (described in W097/ 13865).
  • the DNA-construct is men integrated into die nuclear genome of oilseed rape according to die methods described in WO97/ 13865.
  • Transgenic oilseed rape lines are analysed for expression level (by determination of die level of PAT activity) and d e copy number of transgenes (by Soudiern hybridizations). Both die average copy number and average expression level of die chimeric bar gene are higher in die lines transformed by die DNA constructs comprising me intergenic repeat, than in control lines transformed by DNA constructs widiout intergenic repeat.
  • MOLECULE TYPE DNA (genomic)
  • ORGANISM Arabidopsis thaliana
  • CAGGGGTTGA AATAGTCGAC CAGGTCCGAG ACTTCATCGA CCGGGTCCGA GGAATCGTCG 2040

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un produit de synthèse d'ADN comprenant les fragments suivants: ADN ribosomique, zone de promoteur et zone de codage hétérologue. L'invention a aussi pour objet un procédé pour la production de protéines et pour assurer une amplification de gènes ou d'expression à l'aide de ces produits de synthèse d'ADN, ainsi que des organismes hôtes, en particulier des plantes, comprenant des produits de synthèse.
PCT/EP1997/005217 1996-09-24 1997-09-23 Produits de synthese d'adn et procedes pour produire des proteines a l'aide de ces produits de synthese d'adn WO1998013505A1 (fr)

Priority Applications (4)

Application Number Priority Date Filing Date Title
JP10515258A JP2001501089A (ja) 1996-09-24 1997-09-23 Ｄｎａ構築物及びこれらのｄｎａ構築物を用いてタンパク質を生産するための方法
AU49421/97A AU725390B2 (en) 1996-09-24 1997-09-23 DNA-constructs comprising intergenic ribosomal DNA and methods to produce proteins using these DNA-constructs
EP97912083A EP0932691A1 (fr) 1996-09-24 1997-09-23 Produits de synthese d'adn et procedes pour produire des proteines a l'aide de ces produits de synthese d'adn
CA002265519A CA2265519A1 (fr) 1996-09-24 1997-09-23 Produits de synthese d'adn et procedes pour produire des proteines a l'aide de ces produits de synthese d'adn

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
ATA1695/96 1996-09-24
AT169596 1996-09-24

Publications (1)

Publication Number Publication Date
WO1998013505A1 true WO1998013505A1 (fr) 1998-04-02

Family

ID=3519000

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP1997/005217 WO1998013505A1 (fr) 1996-09-24 1997-09-23 Produits de synthese d'adn et procedes pour produire des proteines a l'aide de ces produits de synthese d'adn

Country Status (6)

Country Link
EP (1) EP0932691A1 (fr)
JP (1) JP2001501089A (fr)
CN (1) CN1231698A (fr)
AU (1) AU725390B2 (fr)
CA (1) CA2265519A1 (fr)
WO (1) WO1998013505A1 (fr)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999066058A2 (fr) * 1998-06-15 1999-12-23 Rutgers, The State University Of New Jersey Materiels et methodes d'amplification et de transcription ameliorees de polynucleotides dans des plantes ou des parties de celles-ci
EP1375670A1 (fr) 2002-06-20 2004-01-02 Institut Pasteur Virus de la rougeole recombinants exprimant des epitopes d' antigenes de virus à ARN et utilisation des virus recombinants pour la preparation de vaccins
FR2926560A1 (fr) * 2008-01-21 2009-07-24 Millipore Corp Procede d'extraction et de purification d'acides nucleiques sur membrane
EP2085479A1 (fr) 2008-01-31 2009-08-05 Institut Pasteur Génétique inversée de virus à ARN négatifs dans la levure
WO2010037209A1 (fr) * 2008-10-03 2010-04-08 Agrisoma Biosciences Inc. Production d'acides gras modifiés dans des plantes
DE102009035671A1 (de) * 2009-07-30 2011-02-03 Dechema Gesellschaft Für Chemische Technik Und Biotechnologie E.V. Verfahren zur Expression von homologen Proteinen und/oder Peptiden in Pilzen der Klasse Dothideomycetes
EP2390256A1 (fr) 2001-05-30 2011-11-30 Agrisoma, Inc. Chromosomes artificiels de plantes, leurs utilisations et leurs procédés de préparation

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1986000089A1 (fr) * 1984-06-14 1986-01-03 Ciba-Geigy Ag Vecteurs hybrides eucaryotes et preparation de polypeptides
WO1991000920A2 (fr) * 1989-07-07 1991-01-24 Unilever N.V. Procede de preparation d'une proteine a partir d'un champignon transforme par integration multicopie d'un vecteur d'expression

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1986000089A1 (fr) * 1984-06-14 1986-01-03 Ciba-Geigy Ag Vecteurs hybrides eucaryotes et preparation de polypeptides
WO1991000920A2 (fr) * 1989-07-07 1991-01-24 Unilever N.V. Procede de preparation d'une proteine a partir d'un champignon transforme par integration multicopie d'un vecteur d'expression

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DOELLING J. AND PIKAARD C.: "The minimal ribosomal RNA gene promoter of Arabidopsis thaliana includes a critical element at the transcription initiation site", THE PLANT JOURNAL, vol. 8, no. 5, November 1995 (1995-11-01), pages 683 - 692, XP002055922 *
DOELLING J. ET AL.: "Functional analysis of Arabidopsis thaliana rRNA gene and spacer promoters in vivo and by transient expression", PNAS,U.S.A., vol. 90, no. 16, 15 August 1993 (1993-08-15), pages 7528 - 7532, XP002055921 *
WANZENBÖCK E. ET AL.: "Ribosomal transcription units integrated via T-DNA transformation associate with the nucleolus and do not require upstream repeat sequences for activity in Arabidopsis thaliana", THE PLANT JOURNAL, vol. 11, no. 5, May 1997 (1997-05-01), pages 1007 - 1016, XP002055923 *

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999066058A3 (fr) * 1998-06-15 2000-06-29 Univ Rutgers Materiels et methodes d'amplification et de transcription ameliorees de polynucleotides dans des plantes ou des parties de celles-ci
US6100092A (en) * 1998-06-15 2000-08-08 Board Of Trustees, Rutgers The State University Of New Jersey Materials and methods for amplifying polynucleotides in plants
US6355860B1 (en) 1998-06-15 2002-03-12 Rutgers, The State University Of New Jersey Materials and methods for amplifying and enhanced transcribing of polynucleotides in plants and portions thereof
WO1999066058A2 (fr) * 1998-06-15 1999-12-23 Rutgers, The State University Of New Jersey Materiels et methodes d'amplification et de transcription ameliorees de polynucleotides dans des plantes ou des parties de celles-ci
EP2390256A1 (fr) 2001-05-30 2011-11-30 Agrisoma, Inc. Chromosomes artificiels de plantes, leurs utilisations et leurs procédés de préparation
EP2290091A2 (fr) 2002-06-20 2011-03-02 Institut Pasteur Virus de la rougeole recombinants exprimant des épitopes d'antigènes de virus à ARN et utilisation des virus recombinants pour la préparation de vaccins
EP1375670A1 (fr) 2002-06-20 2004-01-02 Institut Pasteur Virus de la rougeole recombinants exprimant des epitopes d' antigenes de virus à ARN et utilisation des virus recombinants pour la preparation de vaccins
WO2009093142A1 (fr) * 2008-01-21 2009-07-30 Millipore Corporation Procédé pour l'extraction et la purification d'acides nucléiques sur une membrane
FR2926560A1 (fr) * 2008-01-21 2009-07-24 Millipore Corp Procede d'extraction et de purification d'acides nucleiques sur membrane
EP2085479A1 (fr) 2008-01-31 2009-08-05 Institut Pasteur Génétique inversée de virus à ARN négatifs dans la levure
WO2010037209A1 (fr) * 2008-10-03 2010-04-08 Agrisoma Biosciences Inc. Production d'acides gras modifiés dans des plantes
US8546645B2 (en) 2008-10-03 2013-10-01 Agrisoma Biosciences Inc. Production of modified fatty acids in plants through rDNA targeted integration of heterologous genes
AU2009299075B2 (en) * 2008-10-03 2017-01-19 Agrisoma Bioscience Inc. Production of modified fatty acids in plants
US10081815B2 (en) 2008-10-03 2018-09-25 Agrisoma Biosciences Inc. Production of modified fatty acids in plants through rDNA targeted integration of heterologous genes
DE102009035671A1 (de) * 2009-07-30 2011-02-03 Dechema Gesellschaft Für Chemische Technik Und Biotechnologie E.V. Verfahren zur Expression von homologen Proteinen und/oder Peptiden in Pilzen der Klasse Dothideomycetes

Also Published As

Publication number Publication date
EP0932691A1 (fr) 1999-08-04
AU4942197A (en) 1998-04-17
JP2001501089A (ja) 2001-01-30
AU725390B2 (en) 2000-10-12
CA2265519A1 (fr) 1998-04-02
CN1231698A (zh) 1999-10-13

Similar Documents

Publication Publication Date Title
AU747872B2 (en) Gene silencing
AU732026B2 (en) Leafy cotyledon1 genes and their uses
EP0959133A1 (fr) Procédé pour l'inhibtion de l' expression de gènes
WO1998037184A9 (fr) Genes de type 'cotyledon1 feuillu' et leurs utilisations
US7211712B2 (en) Seed-preferred regulatory elements
US6066781A (en) Production of mature proteins in plants
AU725390B2 (en) DNA-constructs comprising intergenic ribosomal DNA and methods to produce proteins using these DNA-constructs
EP2118291B1 (fr) Séquence d'ADN artificielle ayant une fonction leader optimisée en 5' (5'-UTR) pour l'expression améliorée de protéines hétérologues dans les plantes
AU2005222518A1 (en) Constitutive expression cassettes for regulation of plant expression
CA2404471C (fr) Construction capable de liberation en forme circulaire fermee a partir d'une sequence nucleotidique plus grande permettant l'expression specifique du milieu et/ou l'expression a regulation de developpement de sequences genetiques selectionnees
CN113980919B (zh) 调控玉米穗腐病抗性的dna序列及其突变体、分子标记和应用
US7005559B1 (en) Expression silencing system and different uses thereof
AU2005229721A1 (en) Expression cassettes for seed-preferential expression in plants
AU754135B2 (en) Gene promoter sequences and uses thereof
EP3057980A1 (fr) Promoteur végétal spécifique des tissus et ses utilisations
AU2015202438B2 (en) Cambium/xylem-preferred promoters and uses thereof
US6930182B1 (en) Composition and methods of using the Mirabilis mosaic caulimovirus sub-genomic transcript (Sgt) promoter for plant genetic engineering
CN102676457A (zh) 一个花特异表达启动子kt631p的功能和应用
MXPA04008897A (es) Elementos de regulacion de inflorescencia temprana preferida y sus usos.
CN104975021B (zh) 植物花药特异表达启动子的鉴定和应用
CA2808845A1 (fr) Promoteurs et procedes de transformation de tubercules et tubercules transformes
AU6552599A (en) Tissue-specific and developmentally regulated transcriptional sequences and uses thereof
JP2003116553A (ja) 外来遺伝子の発現方法及びそのためのベクター
WO2011154385A1 (fr) Promoteurs de plantes et leurs utilisations
AU2001243939A1 (en) A construct capable of release in closed circular form from a larger nucleotide sequence permitting site specific expression and/or developmentally regulated expression of selected genetic sequences

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 97198212.0

Country of ref document: CN

AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW AM AZ BY KG KZ MD RU TJ TM

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH KE LS MW SD SZ UG ZW AT BE CH DE DK ES FI FR GB GR IE IT LU MC

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
ENP Entry into the national phase

Ref document number: 2265519

Country of ref document: CA

Ref document number: 2265519

Country of ref document: CA

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 1997912083

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 1998 515258

Country of ref document: JP

Kind code of ref document: A

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 1997912083

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 09274803

Country of ref document: US

WWW Wipo information: withdrawn in national office

Ref document number: 1997912083

Country of ref document: EP