WO1998010779A1 - Method for treating parasitic diseases with proteasome inhibitors - Google Patents

Abstract

Disclosed herein are methods of treating parasitic infections in mammals by administering effective amounts of an agent selected from the group consisting of proteasome inhibitors, ubiquitin pathway inhibitors and mixtures thereof.

Description

METHOD FOR TREATING PARASITIC DISEASES

WITH PROTEASOME INHIBITORS

This application claims priority under 35 U.S.C. § 119 from Provisional U.S. patent application No. 60/025,894 filed September 13, 1996, the entire disclosure of which is hereby incorporated by reference . FIELD OF THE INVENTION

This invention is directed to the treatment of parasitic diseases by administering proteasome and/or ubiquitin pathway inhibitors.

BACKGROUND OF THE INVENTION

Protozoan parasites are responsible for a wide range of diseases affecting millions of individuals worldwide. For example, parasitic diseases such as malaria, trypanosomiasis, leishmaniasis and schistosomiasis remain among the major causes of human sickness and death in the world today. A number of technical, social, economic and political phenomena have combined to produce a dramatic increase in the prevalence of some of these illnesses. Growing resistance of the malaria mosquito vector to insecticides and the development of drug- resistant strains of Plasmodium has led to millions of deaths annually to the disease. Tiγpanosoma cruzi , the causative agent of Chagas' disease, infects several million people in the world, leaving many with severe heart and gastrointestinal lesions. Leishmaniasis is found in parts of Europe, Asia, Africa and South and Central America where it affects millions. About 10% of the world's population is infected with Entamoeba hystoli tica . A oebiasis is the third cause of death from parasitic disease after schistosomiasis and malaria. Giardia lamblia colonizes the small intestine and causes diarrhea and malabsorption in millions of people around the world. Infection by T. cruzi is initiated by metacyclic trypomastigotes present in the faeces of triatomine bugs. The trypomastigotes invade host cells and enter the cytoplasm where they transform into amastigotes. The amastigotes replicate and, a few days later, transform back into trypomastigotes, rupture the host cells and invade the bloodstream (1) . Thus, on two occasions during its intracellular stage, T. cruzi undergoes shape and volume changes, restructures its flagellum and kinetoplast, and synthesizes new sets of surface molecules. These striking modifications are precisely timed, take place in an orderly fashion, and must involve selective degradation of cytoplasmic proteins.

In eukaryotic cells most proteins in the cytoplasm and nucleus are degraded not in lysosomes, but within proteasomes, after they are marked for destruction by covalent attachment of ubiquitin (Ub) molecules (2-5) . In addition to their role in non-lysosomal protein turnover, proteasomes are involved in specific cellular functions, including: the programmed inactivation of mitotic cyclins, transcription factors, and transcriptional regulators; the elimination of mutated or damaged proteins; and antigen presentation. The function of the proteasomes is also tightly regulated, and their structure may vary to match function (6-7) .

Malaria is transmitted by Anopheles mosquitoes. The infection is initiated by the introduction in the host's circulation of sporozoites found in the salivary gland of the mosquitoes. The sporozoites rapidly find their way into hepatocytes, where they develop within a few days into exoerytrocytic forms (EEF) . The early EEF are morphologically quite different from sporozoites. Late EEF contain thousands of merozoites that are released from the hepatocyte, and enter erythrocytes, starting the clinical stage of the disease.

What is needed in the art are new methods for treating protozoan parasitic infections such as those caused by Plasmodium, Trypanosoma and Leishmania . Plasmodium parasites are rapidly developing resistance to the available chemotherapic agents, and the drugs of choice used to treat African and American Trypanosomiasis as well as Leishmaniasis are very toxic.

SUMMARY OF THE INVENTION It has now been unexpectedly discovered that proteasomes play a key role in the transformation of protozoan parasite forms. Thus, proteasomes and the ubiquitin pathway (which "marks" proteins to target to proteasomes) provide novel targets for anti-parasitic drugs. Before the present invention, the key role of proteasomes and the ubiquitin pathway in the life cycle of protozoan parasites was unrecognized.

Described herein are data showing the participation of proteasomes in the developmental pathways of protozoan parasites. T. cruzi has an advantage as an experimental model because its trypomastigote form can be induced to change rapidly into amastigotes in axenic medium, i.e. in the absence of cells. The resulting amastigote-like parasites cannot be distinguished from intracellular amastigotes by light or electron microscopy, or by stage-specific surface markers. Thus, using this model, the effects of proteasome inhibitors on transformation were studied independently from their effect on the host's cells. Described herein are data showing that proteasome inhibitors prevent the transformation of Trypanosoma trypomastigotes into amastigotes. In addition, these drugs inhibit the development of Plasmodium sporozoites into EEF, and trophozoites into schizontes. Also, cyst formation in JSntamoeJba parasites was inhibited.

BRIEF DESCRIPTION OF THE FIGURES

Figures 1A and IB show the effect of protease inhibitors on the transformation of T. cruzi trypomastigotes into amastigotes. Parasites were incubated for 4 h at 37°C in transformation medium with the protease inhibitors, and then reincubated overnight in DMEM 10% FCS. Transformation was scored in a double-blind fashion by light microscopy, and results expressed as means ± S .D. Figure 2A - 2D show the effect of Lactacystin and Clasto-lactacystin on T. cruzi . (2A) shows the structure of Lactacystin. (2B) shows the structure of Clasto-lactacystin di-hydroxy acid, an inactive metabolite of lactacystin. (2C) and (2D) show the morphology of T. cruzi trypomastigotes that were incubated in DMEM pH 5.0 in the presence of lactacystin or clasto-lactacystin respectively.

Figure 3 shows the effect of proteasome inhibitors on the expression of stage-specific epitopes of T. cruzi . Parasites undergoing transformation in the presence or absence of the proteasome inhibitors lactacystin (A,B,C,D), and MG-132

(E,F,G,H), were analyzed by FACS. Trypomastigotes were incubated for 4h in the transformation medium alone or containing inhibitor, and then reincubated in DMEM 10% FCS in the presence (B,D,F,H) or absence (A,C,E,G) of inhibitors. At the end of the incubation, the parasites were washed and stained by immunofluorescence with mAb 2C2 (A,B,E,F) or 3C9

(C,D,G,H), and analyzed by FACS. The mAb 2C2 detects Ssp-4, an amastigote-specific epitope, and mAb 3C9 detects Ssp-3, a trypomastigote-specific epitope.

Figure 4 shows the effect of lactacystin on cell invasion and growth of T. cruzi . L6E9 irradiated myoblasts were infected with trypomastigotes that had been pre-incubated for l h at 37°C with 10 μM lactacystin or clasto-lactacystin. After 2 h incubation at 37°C, the trypomastigotes were removed, and the L6E9 cell were washed with DMEM. One set of cells was fixed with 4% paraformaldehyde in PBS for 30 min. The extracellular trypomastigotes were detected by immunofluorescence with a polyclonal antibody to T. cruzi , and the total number of parasites was determined by staining with Hoechst dye after permeabilization of the L6E9 cells with cold methanol for 10 min. The number of intracellular parasites was calculated by subtracting the extracellular from total number of parasites. The remaining infected cell cultures were reincubated at 37°C. At 24, 48 and 72 h triplicate wells were washed and stained with May Grunwald-Giemsa. The slides were examined under light microscopy and the number of intracellular amastigotes in 100 cells was counted. Results are expressed as means ± S.D.

Figures 5A and 5B show the effect of lactacystin on amastigote/trypomastigote intracellular transformation. L6E9 irradiated myoblasts were infected with r. cruzi trypomastigotes. At 48 h post infection lactacystin or clasto-lactacystin was added. After 2 h of incubation at 37°C, the cultures were washed and reincubated at 37°C for various periods of time. The effect of the drugs on parasite development was evaluated: (5A) by counting in a Neubauer chamber the number of trypomastigotes in the culture supernatants . This was measured 48 h after removal of the drugs. Values are expressed in parasites/ml. (5B) By measuring transialidase activity in extracts of infected cells 72, 80, 88 and 96 h post- infection, i.e., 24, 32, 40 and 48 h after removal of the drugs . All experiments were performed in triplicate and values expressed as means ± S.D.

Figure 6 shows the morphology of T. cruzi infected cultures treated with lactacystin. L6E9 irradiated myoblasts were infected with T. cruzi trypomastigotes. At 48 h post infection lactacystin or clasto-lactacystin was added. After 2 h of incubation at 37°C, the cultures were washed and reincubated at 37°C for another 48 h. The infected cultures were fixed and stained with May Grunwald-Giemsa and examined by light microscopy. (6A) Myoblasts treated with lactacystin showing typical amastigotes. (6B) Myoblasts treated with clasto-lactacystin showing trypomastigotes and intermediate forms.

Figure 7 shows the purification and characterization of T. cruzi proteasomes. (7A) Gel filtration on Superose 6. The chymotrypsin-like (Ch-L) activity in fractions 17-24 was totally inhibited by lactacystin but unaffected by E-64. (7B) Anion-exchange chromatography of pooled fractions 17-24 on a Mono Q column. Bound proteins were eluted using a 0-lmM KC1 linear gradient. Fractions that displayed Ch-L activity that was inhibitable by lactacystin, but not by E-64, were eluted at approximately 400-500 mM KC1. (C) Gel Filtration on Superose 6. Fractions eluted from the Mono Q at 400-500 mM KC1 were loaded onto Superose 6 16/30. Proteolytic activities under the major protein peak were measured with the following fluorogenic peptides: Suc-Leu-Leu- Val-Tyr-MCA ( Ch-L), Boc-Leu-Arg-Arg-MCA trypsane (T-L) and Z-Leu-Leu-Glu- (NA peptidylglutamyl peptide hydrolyzing-like activity. All activities were strongly inhibited by lactacystin but not by E-64.

Figure 8A is a composite of SDS-PAGE (first track on the left) and 2D-gel analysis of T. cruzi proteasomes. The arrow points to an added control protein (pi 5.2) . On the left are the MW markers. 8B shows electronmicroscopy of T. cruzi proteasomes. Bar=100nm.

Figure 9 shows the inhibition of T. cruzi proteasomes by lactacystin. (9A) . Trypomastigotes were incubated for 3h in transformation medium containing 10 μM lactacystin (solid bars) , or clasto-lactacystin (striped bars) or with medium alone (empty bars) . Samples of parasites (3xl0⁷) were washed with PBS, resuspended in 200 μM of 20 mM Tris, sonicated, and centrifuged. Supernatants were immunoprecipitated with polyclonal antibodies raised against T. cruzi proteasomes. Immunocomplexes were collected using Protein-A Sepharose, and the Ch-L activity associated with the beads was measured. When parasites were treated with medium and immunoprecipitated with pre-immune serum no Ch-L activity was detected. (9B) As additional controls for the specificity of the immunoprecipitation reaction, untreated parasites were sonicated, treated with lactacysin (solid bars) , or clasto-lactacystin (stripped bars) or medium (empty bars) and immunoprecipitated as above. The Ch-L activity of the immunoprecipitates was then measured. All experiments were performed in triplicate, and results expressed as means ± S.D. Figure 10 is a graph showing the effect of lactacystin on encystation of Entamoeba invadens parasite at 24 hours after transfer to encystation media.

Figure 11 is a graph showing the effect of lactacystin on encystation of Entamoeba invadens parasite at 48 hours after transfer to encystation media.

Figure 12 is a graph showing the effect of lactacystin on encystation of Entamoeba invadens parasite at 60 hours after transfer to encystation media.

Figure 13 is a graph showing the effects of lactacystin, Z-Leu, Z-Ile, MG-132 and E-64 on encystation of Entamoejba invadens parasites at 60 hrs after transfer to encystation media.

Figure 14. Lactacystin does not affect malaria sporozoite invasion of HepG2 cells. 50,000 Plasmodium berghei sporozoites were incubated with the indicated concentrations of lactacystin or clasto-lactacystin dihydroxy acid at room temperature for l h. The parasites were then washed, plated on HepG2 cells grown in 96 well plates, and allowed to invade for l h. For each point, one set of triplicate wells was fixed with paraformaldehyde and the other was fixed with paraformaldehyde followed by methanol . Cells were blocked with 1% BSA in PBS, incubated with radiolabelled mAb 3D11, washed and counted in a gamma counter. Percent invasion is calculated by from the ratio of cpm bound to permeabilized versus nonpermeabilized cells.

Figure 15. Lactacystin alters the normal development of sporozoites into EEF in vitro. Plasmodium berghei sporozoites were incubated in 3 μM lactacystin or medium alone for 15 minutes at room temperature and then added to HepG2 cells in the presence or absence of lactacystin. They were allowed to invade and begin their development into EEF. Four and fifteen hours later the cells were fixed and stained with mAb 3D11 using the double staining assay which allows distinction of intracellular and extracellular sporozoites. The morphology of the intracellular lactacystin treated and untreated sporozoites at both time points was noted and photographed under 100X using a Zeiss photomicroscope III.

Figure 16. Lactacystin inhibits the switch to A-type rRNA of P. berghei in vitro. Sporozoites were incubated with or without 3 μM lactacystin for 15 minutes, and then plated on HepG2 cells. After 3 hours, the medium was removed and fresh medium without inhibitor was added. At 5 and 21 hours (panels a. and b. respectively) , total RNA was extracted and RT reactions were performed using 0.1 μg of RNA. PCR of this cDNA was performed using primers specific for A-type rRNA and serial dilutions of cDNA. The first lanes in each panel show the result of a PCR reaction performed with 2 μl of cDNA, the second lanes of each panel show the result of a PCR reaction performed with 0.4 μl of cDNA, and the third lanes of panel b show the result of a PCR reaction performed with 0.2 μl of CDNA.

Figure 17. Lactacystin inhibits the development of P. falciparum erythrocytic stages in vitro. Synchronized trophozoites at 18 hours in the cycle were plated in 96-well microtiter plates with [³H] hypoxanthine and the concentrations of lactacystin indicated. After 24 hours, plates were harvested and incorporation of the label was measured by liquid scintillation counting. Shown are the means of triplicate wells with standard deviations.

Figure 18A - 18D are photomicrographs of synchronized trophozoites at 18 hours (18A) , after which they were incubated for another 24 hours in either medium alone (18B) , or 1.25 μM (18C) or 10 μM lactacystin (18D) .

Figure 19. Inhibition of the erythrocyte proteasome does not affect the growth of P. falciparum in vitro. Panel a: erythrocytes were pre- incubated with 10 μM lactacystin, or medium alone, for l hour and washed extensively. Untreated parasites were then added to lactacystin pretreated and control erythrocytes . Giemsa stained blood smears were made from the cultures each day, and parasitemias were measured by blindly counting number of infected cells per 2000 cells. Shown are the means of parasitemias from triplicate treatments with standard deviations. Panel b: proteasome isolation from erythrocytes which were treated and washed as above was performed. Erythrocyte lysates were centrifuged at 10,000 x g for 30 minutes, and the supernatants were passed over a HiTrap Q anion exchange column. Samples were eluted using a gradient from 200 mM to 1 M NaCl, and 1.2 ml fractions were assayed for chymotrypsin-like activity by incubation with the fluorogenic substrate, Suc-LLVY-AMC. Fractions from the two treatments showed equal absorbances at OD 280 nm (data not shown) . Shown are the means of fluorescences from duplicate reactions with standard deviations.

Figure 20. Lactacystin analogs have varying activities on the development of P. falciparum erythrocytic stages in vitro. Synchronized trophozoites at 18 hours in the cycle were plated in 96-well microtiter plates with [³H] hypoxanthine and the concentrations of lactacystin or lactacystin analogs indicated. After 24 hours, plates were harvested and incorporation of the label was measured by liquid scintillation counting. Shown are the means of triplicate wells with standard deviations.

Figure 21. Lactacystin inhibits DNA synthesis in a stage specific manner. Synchronized trophozoites were plated in 96 well microtiter plates at 18 hours of the cycle. [³H] hypoxanthine, with or without 0.6 μM lactacystin, was added to wells at the times of the cycle indicated. For each time point, each treatment was performed using triplicate wells. In addition, 3 wells containing uninfected erythrocytes and label, another 3 wells containing only label were plated at the 18 hour point. All wells were harvested 30 hours after plating (which is equivalent to 48 hours in the cycle) , and incorporation of the label was measured by liquid scintillation counting. Shown are the means of triplicate wells with standard deviations .

Figure 22. Lactacystin decreases sporozoite infectivity in vivo. Plasmodium yoelii sporozoites are incubated in 5 μM Lactacystin or medium alone for l hour at room temperature. 2000 sporozoites are then injected i.v. into each mouse and 40 hours later the mice were sacrificed and their livers harvested for isolation of RNA. Sporozoite infectivity is quantified by measuring the amount of parasite rRNA using a quantitative RT- PCR assay. The top two panels show PCRs performed with P. yoelii rRNA primers and 1 and 0.1 pg of a P. yoelii rRNA competitor. The parasite target band is 393 bp and the competitor is 459 bp. The bottom panel shows control PCRs performed with the same RT reactions using hypoxanthine ribosyltransferase (HPRT) primers and 0.04 pg of an HPRT competitor, where the HPRT target band is 352 bp and the competitor is 450 bp. M = markers; 1000,750,500,300,150 bp

Figure 23. Lactacystin significantly reduces parasitemia in vivo. Six P. berghei infected rats were paired into 2 groups of 3 rats, each with comparable parasitemias. Each rat in the experimental group received 1.6 mg of lactacystin in 1 ml of PBS, given as one injection i.p. of 0.5 ml, and one injection i.v. of 0.5 ml at the same time. Each rat in the control group received identical injections of PBS alone. Giemsa stained blood smears, taken at the time points indicated, were blindly counted to measure parasitemias. Each point represents the mean of parasitemias from 3 rats with standard deviations.

Figure 24 is a graph showing the inhibition of P. falciparum by proteasome inhibitors MG 306, MG 309, MG 385 and MG 369.

DETAILED DESCRIPTION OF THE INVENTION All patent applications, patents and literature references cited herein are hereby incorporated by reference in their entirety. In the case of inconsistencies the present disclosure will prevail. It has now been unexpectedly discovered that the proteasome/ubiquitin pathway is a target for therapeutic/drug intervention against protozoan parasitic diseases, and that proteasome inhibitors, exemplified by lactacystin and MG-132, can provide effective therapy for the treatment of protozoan parasitic diseases. This is a most unexpected finding in that no such activity had previously been ascribed to these proteasome inhibitors.

In the present description, the following definitions will be used.

"Treatment" shall mean not only palliative measures used for ongoing infections but prevention of initiation of disease.

"Parasitic infections" are those caused by protozoan members of the genera Plasmodium, Tirypanosoma, Entamoeba, Giardia and Leishmania . Pneumocystis carinii , now considered a fungus shares many features of protozoa and is included here. All of these parasites have a lactacystin- inhibitable proteasome. "Ubiquitin pathway inhibitor" shall mean any substance which directly or indirectly inhibits ubiquitination or the transfer of ubiquitin to proteins.

"Proteasome inhibitor" shall mean any substance which directly or indirectly inhibits the proteasome or the activity thereof.

In accordance with the present invention, protozoan parasitic infections are treated by administering to a mammal in need of such treatment an anti-parasitic infection effective amount of an agent selected from the group consisting of proteasome inhibitors, ubiquitin pathway inhibitors and mixtures thereof .

Without wishing to be bound by theory, it is believed that the proteasome-inhibitors disclosed herein will have broad range anti-parasitic activity against protozoan parasites. Proteasomes isolated from diverse organisms have similar structural features and architecture.

Peptidyl aldehyde proteasome inhibitors have been described (Orlowski et al. U.S. Patent 5,580,854; Iqbal et al. U.S. Patent 5,550,262; Stein et al . WO 95/24914) . Adams et al . described peptidyl boronic acids with improved proteasome selectivity (Adams et al . WO 96/13266). Other peptidyl derivatives with proteasome inhibitory activity have also been described (Iqbal et al . U.S. Patent 5,614,649; Spaltenstein et al. Tetrahedron Letters 1996, 37,1343). Fenteany et al. described proteasome inhibitors related to lactacystin (Fenteany et al . WO 96/32105).

All of the above-described proteasome inhibitors are suitable for use in the present invention. Non- limiting examples of useful inhibitors include lactacystin, the peptide aldehyde MG-132 (available from Proscript, Cambridge, MA.), compounds produced by modification of the tetra-peptide aldehyde N-meth-oxysuccinyl-Glu-Val-Lys-Phe-H (as described in Igbal, M. , et al., Potent Inhibi tors of Proteasome, J. Med. Chem.1995:38: 2276-2277) , ethyl lactacystin (obtained from E.J. Corey, Harvard University) , desmethyl lactacystin, and clasto- lactacystin dihydroxy acid 0-lactone (both as described in Fenteany et al. WO 96/32105) , decarboxylactacystin (as described in Journal of Antibiotics, 18:747-8 (1995)) and peptidyl boronic acids MG 360, MG 309, MG 369 and MG 385 (as described in Adams et al . WO 96/13266). Lactacystin can be synthesized as described in Corey et al . , J. Am. Chem. Soc. 114:10677-10678. The proteasome inhibitors may be administered by any route, including intradermally, intramuscularly, subcutaneously, orally or intravenously.

The proteasome inhibitors of the prophylactally present invention may be administered to a mammal before (preventively) or after infection by a protozoan parasite. Indeed, as shown below, incubation of parasites with lactacystin inhibited their infectivity. This would curtail further rounds of infection within the infected mammal and the spreading of disease to other individuals. The present inventors have discovered that blocking proteasome function inhibits the development of protozoan parasites. This can be done by direct proteasome inhibition

(shown with lactacystin) or by blocking ubiquitination of proteasome-targeted parasite proteins. The parasitic proteasome is the target of lactacystin-mediated inhibition of protozoan parasites. Therefore, any inhibitors which affect the ubiquitin/proteasome pathway in eukaryotic cells are expected to be inhibitory to these parasites and are thus in the scope of the present invention. Non- limiting examples of ubiquitin pathway inhibitors include those disclosed in Berleth et al., Bioche . 35JJL : 1664-1671, 1996.

Non- limiting examples of diseases caused by the protozoan parasites, and suitable for treatment pursuant to the present invention include malaria (caused by Plasmodia) , Chagas' disease (caused by Trypanasoma cruzi ) , various forms of leish aniasis (caused by Leishmania) , Giardiasis (caused by Giardia lamblia) , amebiasis (caused by Entamoeba hystolitica) and pneumocystis pneumonia (caused by Pneumocystis carinii ) .

Effective amounts of the proteasome inhibitors for treating parasitic infections would broadly range between about

10 μg and about 1,000 μg per Kg body weight of a recipient mammal . The treatments may be administered daily or more frequently depending upon the stage and severity of the disease. Any amelioration of any symptom of the parasitic disease pursuant to treatment using any proteasome or ubiquitination inhibitor is within the scope of the invention. Animal models for all of the above mentioned diseases are available, and the effective dosages can be readily established.

The present invention also provides pharmaceutical formulations and dosage forms comprising the proteasome and/or ubiquitin pathway inhibitors of the present invention. The pharmaceutical formulation of the present invention may also include, as optional ingredients, pharmaceutically acceptable vehicles, carriers, diluents, solubilizing or emulsifying agents, and salts of the type well known to those of ordinary skill in the art. The proteasome and/or ubiquitin pathway inhibitors of the present invention can be incorporated into pharmaceutical formulations to be used to treat mammals suffering from protozoan parasite infections. Pharmaceutical formulations comprising the inhibitors of the present invention as at least one of the active ingredients, would in addition optionally comprise pharmaceutically-acceptable carriers, diluents, fillers, salts and other materials well-known in the art depending on the dosage form utilized. For example, preferred parenteral dosage form may comprise a sterile isotonic saline solution, 0.5 N sodium chloride, 5% dextrose and the like. Methyl cellulose or carboxymethyl cellulose may be employed in oral dosage forms as suspending agents in buffered saline or in cyclodextran solutions for enhanced solubility.

Data presented herein demonstrates for the first time that proteasome activity is essential for T. cruzi remodeling. Very similar results were also obtained with other protozoan parasites. In a rodent malaria model, lactacystin did not prevent the penetration of the Plasmodium berghei crescent-shaped sporozoites into hepatocytes, but strongly inhibited their transformation into the round hepatocyte stages

(EEF) and subsequent development in the erythrocyte stages. As shown in Example 2 below, lactacystin also prevented the encystation of Entamoeba invadens . Trypanosoma , Entamoeba and Plasmodium belong to phyla widely separated in evolution. It is envisioned that the mechanisms governing stage-specific morphological changes in protozoa are conserved, and proteasome-dependent, and that proteasome inhibitors will have a broad range of targets. Attractive features for use of this class of chemotheraputic agents are that some parasites, such as Plasmodium etc., as described herein, undergo constant and rapid remodeling in the mammalian host. Thus, effective drugs need not be administered for prolonged periods of time to arrest parasite development. Furthermore, the accurate discrimination between the "old" and "new" proteins which coexist within the same cell during remodeling of protozoa may require specialized features of the proteasome/ubiquitin system.

In the experiments described in Example 3 below, lactacystin inhibited P. berghei exoerythrocy ic forms (EEF) when added before, during or after infection. In addition, lactacystin- treated parasites were less infectious to mice. Lactacystin also inhibits the development of Plasmodium erythrocytic stages, in vitro and in vivo. The drug is apparently acting in a relatively specific manner on parasite metabolism in low doses. Sporozoites treated with lactacystin are able to invade hepatocytes, and while they do not develop into EEF, they maintain normal sporozoite morphology. Similarly, although schizogony of erythrocytic stages is inhibited by lactacystin, the treated trophozoites maintain normal morphology for extended periods. Inhibition of schizogony is stage specific, as lactacystin treatment before the onset of schizogony inhibits [³H] hypoxanthine incorporation but DNA synthesis occurs at normal levels when treatment occurs after schizogony has begun. These findings introduce the usefulness of proteasome inhibitors not only as therapeutic agents but also as tools for studying the ubiquitin-proteasome pathway of the parasite, potentially furthering our understanding of other aspects of parasite biology that are mediated by proteasome activity. One example of such a related function is the control of the cell cycle in Plasmodium, a fundamental problem about which there is currently little known.

Encapsulation of Entamoeba parasites was also inhibited by lactacystin. Thus, the replication of three distinct phyla of protozoan parasites required proteasome function and were inhibited by the proteasome inhibitor lactacystin.

As shown in Example 4 below, peptidyl boronic acid proteasome inhibitors MG 306, MG 309, MG 369 and MG 385 inhibited the growth of Plasjnodiiun falciparum cultured in human red blood cells in a dose-dependent fashion.

The present invention is described further below in specific examples which are intended to further describe the invention without limiting its scope.

EXAMPLE 1

In the example presented below, the following Materials and Methods were used: Cell Lines . LLC-MK2 cells were obtained from American Type Culture Collection, Rockville, MD (ATCC CCL-7) . L6E9 myoblasts cells were a gift of Dr. Roberto Docampo (University of Illinois, Urbana-Champaign, ILL.). Cells were grown in RPMI 1640 medium supplemented with 10% FCS, 100 μg/ml penicillin and streptomycin.

Reagents . Protease inhibitors E 64, E 64d, Cbz-Phe-Ala-FMK, Cbz- (S-BZ) -Cys-Phe-CHN2 and fluorogenic substrates were purchased from Sigma (St. Louis, MO). Lactacystin and clasto-lactacystin were synthesized as previously described

(8,9). MG-132 was from Proscript Inc., (Cambridge, MA ).

Chroma ography columns and resins were from Pharmacia Biotech

AB (Uppsala, Sweden) .

Inhibi tion of Trypomastigote Transformation into Amastigotes .

LLC-MK₂ cells were infected with T. cruzi trypomastigotes, Y strain (10) . Four days later the supernatants contained more than 95% trypomastigotes and small number of amastigotes or intermediate forms. Parasite transformation into amastigotes was induced by lowering the pH of the incubation medium (11, 12) . To assay for the effect of inhibitors in the transformation, two- fold dilutions of each inhibitor were distributed in 96 microwell plates using as diluent DMEM buffered with 20 mM MES (pH 5.0) containing 0.4% BSA. Lactacystin or clasto-lactacystin, MG-132, E-64, Cbz- (S-BZ) -Cys-Phe-CHN2 and Cbz-Phe-Ala-FMK were prepared at 200 μM, and 50 μl were added to wells to final dilutions of 100 to 0.78 μM. Depending on the inhibitors used, DMSO dilutions or medium were used as controls. Trypomastigotes were centrifuged (3,000 g x 15 min) and resuspended at 2xl0⁷/ml in DMEM pH 5.0. Fifty μl of this suspension was added to each well, mixed and incubated for 4 h at 37°C in a 5% C0₂ atmosphere. The plate was centrifuged and the supernatants were removed and replaced by DMEM pH 7 containing 10% FCS. The plates were re-incubated overnight at 37°C in a C0₂ incubator. The percentage of transformed parasites was determined by microscopically scoring 200 cells in each well in a blinded fashion. All experiments were carried out in duplicate.

FACS Analysis . Parasites (2.5 xlO⁷) were transformed in the presence or absence of proteinase inhibitors as described. At the end of the incubation, parasites were resuspended in 250 (1 of DMEM at 4°C, and an equal volume of monoclonal antibodies 2C2 anti Ssp-4 or 3C9 anti-Ssp-3 (13) was added. The incubation proceeded for 30 min on ice. The suspension was then centrifuged for 7 min at 3,500 rpm in a refrigerated centrifuge (Sorvall RT6000B) , using a horizontal rotor. The supernatant was removed, and the parasites were fixed with 4% paraformaldehyde in PBS. After 30 min at 4°C, the fixative was removed and the parasites were washed with 1 ml of cold 0.4% BSA-DMEM. The parasites were then incubated for 30 min with anti-mouse IgG conjugated with FITC. The suspensions were centrifuged, washed with 0.4% BSA-DMEM, resuspended in 50 μl of PBS and post- fixed with 4% paraformaldehyde. The cell suspensions were analyzed in a Becton Dickinson FACScan.

Inhibi tion of Development of Intracellular Parasi tes. L6E9 myoblast cells were irradiated with 2,000 rad (14) and plated in 4-well Lab-Tek microchamber slides (NUNC, Naperville, ILL) . Trypomastigotes were pretreated for 1 h with 10 μM lactacystin or clasto-lactacystin at 37°C. Parasites were washed twice, resuspended in DMEM and used to infect myoblasts at a parasite to L6E9 cells ratio of 5:1. After 2 h incubation at 37°C, trypomastigotes were removed, and the L6E9 cells were washed with DMEM. To study the effect of inhibitors on invasion, one set of cells was fixed with 4% paraformaldehyde in PBS for 30 min. The extracellular trypomastigotes were detected by immunofluorescence with a polyclonal antibody to T. cruzi , and the total number of parasites was determined by staining with Hoechst dye (Sigma Chemical Company, St. Louis, MO) after permeabilization of the L6E9 cells with cold methanol for 10 min. The number of intracellular parasites was calculated by subtracting the extracellular from the total parasites (15) . To determine the fate of lactacystin-treated parasites, the remaining infected cell cultures were reincubated at 37°C. At 24, 48 and 72 h triplicate wells were washed and stained with May Grunwald-Giemsa. The slides were examined under light microscopy and the number of intracellular amastigotes in 100 cells was counted. Results are expressed as means ± S.D.

In another set of experiments, we studied the effect of inhibitors on the transformation of intracellular amastigotes into trypomastigotes. Cell cultures were infected with T. cruzi trypomastigotes. Forty-eight hours post-infection, the cultures were treated for 2 h with 0.75, 1.5 and 3 μM of lactacystin or clasto-lactacystin. The cultures were washed and reincubated at 37 (C for an additional 2 days, when the first parasite burst occurs. The culture supernatants were collected and the numbers of exiting trypomastigotes were determined in a Neubauer chamber. In order to further document the inhibitory effect of lactacystin in the amastigote/trypomastigote transformation, infected cultures were lysed 72, 80, 88 and 96h post- infection with a buffer containing 3% n-octylglucopiranoside, 50 mM Tris-HCl pH 7.4, 0.1 mM EDTA, 20 μM E-64 and 5 μg/ml leupeptin, antipain and pepstatin. The extracts were analyzed for levels of transialidase an enzyme expressed in trypomastigotes, but not in amastigotes (16) . Measurements were made in triplicate samples, and transialidase activity was expressed as cpm ± S.D.

Enzymatic Assays. Proteolytic activity was assayed using as substrate 100 μM fluorogenic peptides diluted in 50 M Tris-HCl pH 7.8. Ten μl of chromatographic fractions were added to 90 μl of the fluorogenic peptide, and the mixtures incubated at 37°C for 30 min prior to quenching with 200 μl of cold ethanol . Fluorescence was measured on a Fluoroskan II (Labsystems, Helsinki, Finland) using an excitation wavelength of 380 nm and an emission wavelength of 440 nm. Fluorescence values were compared with a standard curve prepared with 7-amino-4-methylcoumarin or 2 naphthylamide, as described by Rivett et al. (17). The following fluorogenic peptides were used: Suc-Leu-Leu-Val-Tyr-MCA and Suc-Ala-Ala-Phe-MCA to measure chymo ryps in - 1 ike (Ch-L) activity, Cbz-Leu-Leu-Glu-2 -naphthylamide to measure peptidylglutamyl peptide hydrolysing activity (PGPH) and Boc-Leu-Arg-Arg-MCA to measure trypsin-like activity (T-L) . Cruzipain activity was measured using Cbz-Phe-Arg-AMC as a substrate.

Purifi cation of T. cruzi Proteasomes . For purification of proteasomes, T. cruzi epimastigotes (Y strain) were used. Parasites were harvested from three litres of 6-day cultures by centrifugation at 2,000 g for 20 min and washed three times with PBS. Parasites were suspended in 5 vol of 20 mM Tris/HCl, 1 mM EDTA, sonicated and the homogenate clarified by centrifugation. The pellet was discarded and the supernatant was centrifuged at 100,000 g for 1 h. The 100,000 g supernatant was concentrated by filtration in a Centricon 10 unit (A icon, Beverly, MA) , and fractionated by fast performance liquid chromatography (FPLC) using a Superose 6 HR 16/50 column equilibrated with 25 mM Tris-HCl, lmM EDTA, pH 7.5. Fractions of 1.2 ml were collected and assayed for Ch-L activity. The active fractions were again assayed in the presence of 50 μM of either lactacystin or E-64. Those that were inhibited by lactacystin but not by E-64 were pooled and loaded onto a Mono-Q 5/5 column equilibrated with 20 mM Tris, pH 8.0. Bound proteins were eluted using a 0 - 1M KC1 linear gradient in 20 mM Tris, pH 8.0. Fractions of 0.5 ml were collected and assayed for proteolytic activity as above. The active fractions eluted at approximately 400-500 mM KC1. They were pooled and concentrated in a Centricon-10 unit. The concentrated sample was loaded onto a Superose 6 HR 16/30 equilibrated with 25 mM Tris-HCl, 1 mM EDTA, pH 7.5. Fractions of 0.6 ml were collected and assayed for Ch-L, T-L and PGPH activities.

Protein Determination . Protein concentration was determined by the Bradford method (18) , using bovine serum albumin as a standard.

Electrophoretic Techniques. Samples were analyzed by SDS-PAGE electrophoresis according to (19) in a 12% separating gel and 3% stacking gel. 2D-gel SDS-PAGE electrophoresis was performed as in (20) .

Antibodies and Immunoprecipi tation Studies . Anti-T. cruzi proteasome antibodies were obtained by injecting rabbits with 3 doses of 50 μg of purified proteasomes using Titer Max (CytRx Corp, Norcross, GA) as adjuvant. The antiserum strongly reacted with the 25-35 kDa proteasome subunits by Western blotting. Two weaker, unidentified bands of about 70 kDa were also seen on the blots (not shown) . For immunoprecipitation studies, aliquots of 3xl0⁷ trypomastigotes were incubated for 3h in transformation medium alone, or in the presence of lactacystin or clasto-lactacystin. The parasites were washed, resuspended in 20 mM Tris-HCl pH 7.5, 1 mM EDTA and sonicated. Sonicates were centrifuged for 5 min at 10,000 g. The supernatants were pre-treated with preimmune rabbit serum and Protein A-Sepharose (Pharmacia Biotech, Uppsala, Sweeden) and then incubated overnight with anti T. cruzi proteasome antisera diluted 1:250. The immunocomplexes were collected by incubation with 100 μl of a 50% suspension of protein A-Sepharose. The immunoprecipitates were washed and Ch-L activity measured in the presence or absence of protease inhibitors, as explained in the text and figure legends. Experiments were performed in triplicate and expressed as fluorescence units ± S.D.

Electron Microscopy. Purified proteasomes (50 μg/ml) were attached to carbon-coated and glow-discharged formvar film for 1 min, and subjected to negative staining with 1% uranyl acetate as described (21) . Electron micrographs were recorded with magnification of 80,000x in a Zeiss EM 910 electron microscope.

N- terminal Sequences . Samples were separated on SDS-PAGE, transferred to polyvinylidene difluoride membranes (Immobilon P, Millipore; Milford, MA) using CAPS (Sigma, Chemical Company, St. Louis, MO) pH 11, containing 10% (v/v) methanol, stained with Coomassie blue, and the protein bands were excised and sequenced. Automatic Edman degradation analysis was carried out on a 477A protein sequencer, and the resulting phenylthiohydantoin-derivatives identified using an on-line 120A phenylthioidantoin analyser (Applied Biosystems, Foster City, CA) .

RESULTS

Effect of Protease Inhibi tors on the Transformation of T. cruzi in Axeπic Medium. Fig. 1A and IB show that proteasome inhibitors prevented the transformation of T. cruzi trypomastigotes into amastigote-like parasites. Fifty percent inhibition of transformation was achieved at 1-2 μM concentrations of lactacystin and MG132, a peptide aldehyde (22) (Fig. 1A) . Clasto-lactacystin dihydroxy acid, an inactive analog of lactacystin (Figs. 2A and 2B) (23) , did not prevent transformation. Lactacystin has no effect on cysteine proteinases (24) , including cruzain (or cruzipain) , the major lysosomal cathepsin L-like enzyme of T. cruzi (25-27) that has been implicated in the growth and differentiation of the parasite (28-30) . The hydrolysis of Cbz-Phe-Arg-AMC by recombinant cruzain (a gift from Dr. J. McKerrow, University of California, San Francisco, CA) , or by cruzain purified from parasite extracts, was not affected by high concentrations (100 μM) of lactacystin (not shown) . Conversely, parasite remodeling was not affected by Cbz-Phe-Ala-FMK or Cbz- (S-Bz) Cys - he-CHN2 , cell-permeant inhibitors of cysteine proteases, or by E-64 at concentrations as high as 50 μM (Fig. 1A, IB) . The trypomastigotes treated with 10 μM lactacystin for I8h appeared normal on the basis of motility and morphology, when examined by light microscopy (Fig. 2C) and electron microscopy (not shown) . Nevertheless, higher concentrations of lactacystin were toxic for the parasite, similar to what has been described for other eukaryotic cells. Fig.2D shows the amastigote-like morphology of the parasites that had treated with clasto-lactacystin. The proteasome inhibitors also delayed the expression of stage-specific antigens, as shown by FACS analysis of parasite samples taken at the end of the transformation process. In control samples, a large proportion of the amastigote- like organisms acquired the amastigote-specific Ssp-4 epitope, and lost the trypomastigote-specific Ssp-3 epitope (13) , while most parasites incubated with lactacystin or MG-132 retained the Ssp-3 epitope, and were Ssp-4 negative (Fig. 3) .

Effect of Protease Inhibi tors on the Intracellular Transformation of T. cruzi . In one series of experiments, trypomastigotes were preincubated with 10 μM lactacystin or clasto-lactacystin for lh at 37°C, washed by centrifugation and added to cultured myoblasts. The mean number of intracellular parasites 2 h post-infection was not significantly different for trypomastigotes treated with lactacystin (4l.7±5.4) or with clasto-lactacystin (41.1±1.2), indicating that proteasome activity was not required for cell invasion. Nevertheless, at 24, 48 and 72 h post- infection the number of intracellular amastigotes was much lower in cells infected with lactacystin-treated trypomastigotes (Fig. 4) .

Next, we studied the effect of lactacystin on the intracellular transformation of the dividing amastigotes into trypomastigotes, an event that occurs between 40 and 48 h post-infection. In the following set of experiments, the myoblasts were treated 48 h post-infection with lactacystin or clasto-lactacystin. After 2h incubation, the drugs were removed, the cells were thoroughly washed and reincubated at 37°C. At various times thereafter, trypomastigotes were collected in the culture supernatants and counted. In the cultures treated with lactacystin at concentrations of 3 and 1.5 μM, significantly fewer trypomastigotes were released from the cells as compared to controls treated with clasto-lactacystin or medium alone (Fig. 5A) . We also assayed extracts of infected cells for the presence of transialidase, an enzyme expressed only in trypomastigotes. In cultures treated with clasto-lactacystin or medium alone, the expression of transialidase starts 80 h post- infection, and increases until the end of intracellular parasite differentiation. In lactacystin-treated cultures, the expression of transialidase was inhibited (Fig. 5B) . Finally, one set of infected cells was stained 90 h pos -infection and examined by light microscopy. While 90% percent of cells treated with lactacystin contained typical amastigotes, about 80% of myoblasts treated with clasto-lactacystin contained trypomastigote-like or intermediate flagellate forms (Fig. 6) . Analogous experiments were performed with the cell-permeant cysteine proteinase inhibitors E-64d (31) , and Cbz-Phe-Ala-FMK at concentrations of 10 μM. They had no effect on the transformation of intracellular amastigotes into trypomastigotes, or on the expression of transialidase (not shown) .

Identification of the lactacystin target in T. cruzi . We used two approaches to identify the target of lactacystin in T. cruzi . First, we isolated the lactacystin- inhibitable chymotrypsin activity from crude extracts of parasite. As shown in Fig. 7A, a broad peak of chymotrypsin activity was detected following filtration of the extracts in a Superose 6 column. However, only the activity in fractions 17 to 24, containing proteins of higher molecular weight, was inhibitable by lactacystin, but not by E-64. In later fractions the chymotryptic activity was inhibited by E-64 but not by lactacystin. The lactacystin- inhibitable fractions were then subjected to anion-exchange chromatography in a Mono Q column. A peak of chymotrypsin activity that was inhibited by lactacystin eluted at 400-450 mM of KCl (Fig. 7B) . Pooled fractions from this peak were then filtered through another Superose 6 column. A major symmetrical O.D. peak of 670 kDa was eluted from the column. It contained the three characteristic peptidase activities of eukaryotic proteasomes, T-L, Ch-L and PGPH (Fig. 7C) . All activities were inhibitable by lactacystin. Using Suc-Leu-Leu-Val-Tyr-AMC as a substrate, the specific activity of the Ch-L activity was 1.5 μM/mg/hr. At concentrations up to 50 μM, the cruzain inhibitors Cbz-Phe-Ala-FMK and Cbz- (S-Bz) Cys-Phe- -CHN₂did not affect the Ch-L activity of the purified proteasomes.

By SDS-PAGE under denaturing conditions the 670 kDa molecules are resolved into subunits with molecular weights between 25-35 kDa. By isoelectrofocusing, their pis varied between 4.5 and 8.5 (Fig. 8A) . The N-terminal protein sequence of the protein from one band (TSIMAVTFKD) is identical to that of the 0-subunit PRE3, which has PGPH activity from yeast proteasomes (32) . Electron-microscopy of negatively stained preparations revealed characteristic images of proteasomes, i.e. , hollow cylinders 18 nm in length and 12-15 nm in diameter (Fig. 8B) .

To identify the target of lactacystin in vivo, we incubated samples of trypomastigotes for 2 h in transformation medium in the presence of lactacystin, clasto-lactacystin or medium alone. The parasites were washed, and sonicated extracts were immunoprecipitated with a rabbit antiserum to purified T. cruzi proteasomes, or with normal rabbit serum. Immunoprecipitates were then assayed for chymotrypsin activity. As shown in Fig. 9A, the immunoprecipitated proteasomes from parasites that had been incubated with lactacystin were inactive. The control immunoprecipitates from parasites treated with medium alone or clasto-lactacystin had Ch-L activity that was inhibited by lactacystin, but not by E-64. No enzymatic activity was detected in samples immunoprecipitated with normal rabbit serum. As additional controls of the specificity of the immunoprecipitation, trypomastigote extracts were treated with lactacystin or clasto-lactacystin and then immunoprecipitated as described above. The immunoprecipitates originating from extracts treated with lactacystin were inactive (Fig.9B)

DISCUSSION

We show here that the proteasome inhibitors MG132 and lactacystin prevented the transformation of trypomastigotes into amastigotes in axenic medium. MG132, a peptide aldehyde, also potently inhibits cysteine proteases, but lactacystin selectively inhibits the peptidase activity of proteasomes. The transient intermediate of lactacystin, clasto-lactacystin lactone, binds tightly to threonines in the active site of the subunits of proteasomes (24, 33) . Clasto-lactacystin dihydroxy acid (Fig. 2B) , the product of hydrolysis of the active lactone had no activity on parasite transformation. Lactacystin does not inhibit serine or cysteine proteases of mammalian cells (24) , and did not affect the activity of cruzain, the major T. cruzi lysosomal enzyme. We further ascertained that proteasomes are the targets of lactacystin in trypomastigotes by two independent criteria. First, proteasomes were isolated to apparent homogeneity from crude extracts of parasites using a lactacystin-based assay to follow purification. Second, while immunoprecipitates of proteasomes present in extracts of clasto-lactacystin treated parasites had Ch-L activity, the immunoprecipitates from lactacystin- treated parasites were inactive.

We also studied the effect of lactacystin on the infectivity of T. cruzi trypomastigotes to myoblasts. In these experiments, we tried to minimize or exclude possible effects of the drug on the target cells. For example, when studying the attachment and penetration phases of infection, drug-treated parasites were washed prior to incubation with the myoblasts. We found that lactacystin had no effect on invasion, an active process that requires parasite energy (34) , and is associated with calcium fluxes in the parasite (35) . However, the intracellular development of the lactacystin-treated parasites was arrested. It cannot be deduced from these results whether lactacystin inhibited only the trypomastigote/amastigote transformation. There is a distinct possibility that lactacystin inhibited amastigote proliferation as well, since the eukaryotic cell cycle is regulated by proteasomes. In any case, these experiments also show that the effects of lactacystin persisted during the intracellular development of the parasite. Lactacystin is an irreversible inhibitor of proteasomes, and the half-life of proteasomes is long. Alternatively, drug treatment may have irreversibly affected a proteasome-dependent and essential parasite function. Lactacystin also prevented the transformation of amastigotes into trypomastigotes that occurs at the end of the intracellular phase. In these experiments, myoblasts infected 48 h previously with trypomastigotes were exposed for 2 h to 1-3 μM of lactacystin. The effect was striking: as compared to clasto-lactacystin treated cells, the lactacystin- reated cells released fewer trypomastigotes into the culture medium, contained more amastigotes in their cytoplasm, and displayed much less transialidase activity. In contrast, higher concentrations of cell-permeant inhibitors of cruzipain had no effect on the amastigote/trypomastigote transformation. The small concentrations of lactacystin used, the short duration of drug treatment, the specificity of the observed effects, and the lack of effect of cysteine protease inhibitors argue strongly that the prime targets of lactacystin are the transforming parasites rather than the myoblasts.

These results show that proteasome activity is necessary for remodeling, but the substrates that are degraded have not been identified. They probably include proteins that maintain the "old" shape, most likely cytoskeletal elements, a set of proteins and enzymes involved in the "old" metabolic pathways, and stage-specific surface proteins. In addition to these house-keeping functions, the cleavage of key regulatory proteins by proteasomes may provide the central switching mechanism that initiates the stage-specific changes (36) .

In eukaryotic cells the substrates destined for degradation are recognized by specific E2-E3 Ubiquitin-protein ligases (37) . Very little, however, is known about the Ub-proteasome system in protozoan parasites. Southern and Northern blots of DNA and RNA from various strains of T. cruzi revealed large variations in the number of Ub genes (38) . Its genome may contain more than 100 Ub coding sequences, a number much larger than in other organisms. These are encoded in five polyUb genes and five Ub- fusion genes, whose transcription is altered under stress conditions. There is a significant increase in steady-state levels of Ub mRNA between the midlog phase cultures of non-infective epimaεtigotes of T. cruzi , and the stationary phase cultures that contain the morphologically distinct, infective metacyclics (39) . It is noteworthy that heat shock elements are present in the intergenic regions preceding the polyUb genes. Perhaps the expression of the Ub genes in T. cruzi is regulated by the shifts in environmental pH and temperature, and by other stress conditions that lead to stage-specific remodeling. In yeasts that bear mutations in proteasomes, sensitivity to stress is increased, and under stress conditions the mutants accumulate ubiquitinated proteins . Other proteases have been identified in T. cruzi

(40-42) . One of them, cruzain, a lysosomal cathepsin L-like cysteine protease, also plays a role in growth and differentiation of the parasite (28-30) . Studies in different laboratories have shown that synthetic inhibitors of cruzain, including Cbz-Phe-Ala-FMK and Cbz- (S-Bz) Cys- Phe-CHN2 , inhibit T. cruzi infectivity. However, different from lactacystin, the cysteine protease inhibitors prevent parasite penetration into the heart muscle cells (28) . As shown here, relatively high concentrations of Cbz-Phe-Ala-FMK and Cbz- (S-Bz) Cys-Phe-CHN2 did not affect the remodeling of T. cruzi in axenic medium or inside cells. Although our findings do not exclude a role for cruzain and other lysososmal enzymes in the extensive proteolysis that must accompany remodeling, they argue that cruzain 's role is not pivotal during these phases of parasite development.

Some publications report the presence of proteasomes in Trypanosoma (43,44) and Entamoeba (45), but their function has not been studied. We found that the structural features and architecture of the T. cruzi proteasomes were similar to those of other species. By SDS-PAGE the cylindrical 20S structure was resolved into the typical 6-8 bands of 25-35 kDa. However, more than 20 proteins, with widely diverse pi's, were seen in T. cruzi proteasomes analyzed by two-dimensional PAGE. It is generally accepted that the 20S proteasome is a dimer of 14 subunits arranged α₇ β₇ α₇ β_η . In the yeast Saccharomyces cerevisiae there are fourteen genes encoding lot and 7/3 subunits, and the dendrogram representing the alignments of all eukaryotic proteasome sequences yields only 14 subgroups containing a single yeast member. The explanation for the large number of T. cruzi proteasome-associated proteins may be trivial: some extra spots could represent post- translational modifications of a polypeptide, or simply contaminants. Alternatively, an unusual feature of T. cruzi is that its proteins are frequently encoded by several tandemly arranged genes that are polycistronically transcribed from a single promoter and are concurrently expressed. Sequence variation of genes found in one such transcription unit could result in subunit heterogeneity. Further studies are necessary to clarify this issue.

REFERENCES

1. Brener, Z. 1973. Biology of Trypanosoma cruzi . Ann . Rev. Microbiol . 27:347-362.

2. Orlowski, M. 1990. The multicatalytic proteinase complex, a major extralysosomal proteolytic system. Biochemistry 29:10289-10297.

3. Coux, O., Tanaka, K. and Goldberg, A.L. 1996. Structural functions of the 20S and 26S proteasomes. Annu. Rev. Biochem.

65: 801-847.

4. Rechsteiner, M. , L. Hoffman, and W. Dubiel . 1993. The multicatalytic and 26S proteases. J. Biol . Chem. 268:6065-6068. 5. Hilt, W. , and D.H. Wolf. 1996. Proteasomes: destruction as a program. Trends. Biochem. Sci . 21:96-102.

6. Cardozo, C, A.M. Eleuteri, and M. Orlowski, M. 1995. Differences in catalytic activities and subunit pattern of multicatalytic proteinases (proteasomes) isolated from bovine pituitary, lung and liver. J. Biol . Chem. 270:22645-22651.

7. Nandi, D. , H. Jiang, and J.J. Monaco. 1996. Identification of MECL-1 (LMP-10) as the third IFN-(- inducible proteasome subunit. J. Immunol . 156:2361-2364.

8. Corey, E. J. and G. A. Reichard. 1992. Total synthesis of lactacystin. J. Am. Chen. Soc. 114:10677-10678.

9. Corey, E. J. and S. Choi. 1993. An enantioselective synthesis of (6R) -lactacystin. Tetrahedrom Letters. 34:6969-6972. 10. Silva, L.H.P. and V. Nussenzweig. 1953. Sobre u a cepa de Trypanosoma cruzi altamente virulenta para o camundongo branco. Fol . Clin . Biol . 20: 191-207.

11. Kanbara, H., H. Uemura, S. Nakazawa and T. Fukama. 1990. Effect of low pH on transformation of Trypanosoma cruzi trypomastigote. Jap. J. Parasitol . 39:226-228.

12. Tomlinson, S., F. Vandekerckhove, U. Frevert and V. Nussenzweig. 1995. The induction of Trypanosoma cruzi trypomastigote to amastigote transformation by low pH. Parasi tolOgx y 110:547-554.

13. Andrews, N.W., K.S. Hong, E.S. Robbins, and V. Nussenzweig. 1987. Stage-specific surface antigens expressed during the morphogenesis of vertebrate forms of Trypanosoma cruzi . Exp. Parasi tol . 64:474-484. 14. Schmatz, D.M. and P.K. Murray.1982. Cultivation of Trypanosoma cruzi in irradiated muscle cells: improved synchronization and enhanced trypomastigote production. Parasi tology 85:115-125.

15. Schenkman, S., Diaz, C. and Nussenzweig, V. 1991. Attachment of Trypanosoma cruzi trypomastigotes to receptors at restricted cell surface domains. Exp. Parasi tol . 72: 76-86.

16. Schenkman, S., J. Man-Shiow, G.W. Hart and V. Nussenzweig. 1991. A novel cell surface transialidase of Trypanosoma cruzi generates a stage-specific epitope required for invasion of mammalian cells. Cell 65:1117-1125.

17. Rivett, A.J., P.J. Savory and H. Djaballah. 1994. Multicatalytic endopeptidase complex: Proteasome . Meth. Enzymol . 244: 330-350.

18. Bradford, M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254.

19. Laemmli, U.K. 1970. Cleavage of structural protein during the assembly of the head of bacteriophage T4. Nature (London) 227:680-685. 20. 0' Farrell, P. H. 1975. High resolution two-dimensional electrophoresis . J. Biol . Chem. 250:4007-4021. 21. Baumeister, W. , B. Dahlmann, R. Hegerl , F. Koop, L. Kuehn, and G. Pfeifer. 1988. Electron microscopy and image analysis of the multicatalytic proteinase. FEBS Lett. 241:239-245.

22. Rock, K. L. , C Gramm , L. Rothstein, K. Clark, R. Stewin, L. Dick, D. Hwang and A.L. Goldberg. 1994. Inhibitors of the proteasome block the degradation of most cell proteins and the generation of peptides presented on MHC class I molecules. Cell 78: 761-771.

23. Fenteany, G., R.F. Standaert, G.A. Reichard, E.J. Corey and S.L. Schreiber. 1994. A β - lactone related to lactacystin induces neurite outgrowth in a neuroblastoma cell line and inhibits cell cycle progression in an osteosarcoma cell line. Proc . Natl . Acad. Sci . USA . 91:3358-3362.

24. Fenteany, G., R.F. Standaert, W.S. Lane, S. Choi, E.J. Corey, and S.L. Schreiber. 1995. Inhibition of proteasome activities and subunit-specific amino-terminal threonine modification by lactacystin. Science 268 : 726 -731.

25. Cazzulo, J.J. , R. Couso, A. Raimondi , C. Wernstedt and U. Hellman. 1989. Further characterization and partial amino acid sequence of a cysteine proteinase from Trypanosoma cruzi . Mol . Biochem. Parasi tol . 33:33-42.

26. Murta, A. CM., P.M. Persechini, T. Souto-Padrόn, W. De Souza, J.A. Guimaraes and J. Scharfstein. 1990. Structural and functional identification of GP 57/51 antigen of Trypanosoma cruzi as a cysteino proteinase. Mol . Biochem. Parasitol . 43:27-38.

27. Eakin, A.E., J. Bouvier, J.A. Sakanari, C.S. Craik and J.H. McKerrow. 1990. Amplification and sequencing of genomic DNA fragment encoding cysteine proteinase from protozoan parasites. Mol . Biochem. Parasitol . 39:1-8.

28. Meirelles, M.N.L., L. Juliano, E. Carmona, S.G. Silva, E.M. Costa, A. CM. and J. Scharfstein. 1992. Inhibitors of the major cysteinyl proteinase (GP57/51) impair host cell invasion and arrest the intracellular development of Trypanosoma cruzi in vitro. Mol . Biochem. Parasitol . 52:175-184.

29. Harth, G. , N. Andrews, A.A. Mills, J.C Engel, R. Smith and J.H. McKerrow. 1993. Peptide-fluoromethyl ketones arrest intracellular replication and intercellular transmission of Trypanosoma cruzi . Mol . Biochem. Parasi tol . 58:17-24.

30. Franke de Cazzulo, B.M., J. Martinez, M.J. North, G.H. Coombs, G.H. and J.J. Cazzulo. 1992. Effects of proteinase inhibitors on the growth and differentiation of Trypanosoma cruzi . FEMS Microbiol . Letters . 124:81-86.

31. Wang, K.K.W. and P.W. Yuen. 1994. Calpain inhibition: an overview of its therapeutic potential. Trends . Biochem. Sci . 15:412-419. 32. Hilt, W. and D.H. Wolf. 1995. Proteasomes of the yeast S. cerevisiae : genes, structure and functions. Mol . Biol . Rep. 21:3-10.

33. Dick, R.L., L.G. Cruikshank, F.D. Melandri, S.L. Nunes, and R. Stein. 1996. Mechanistic studies on the inactivation of the proteasome by lactacystin. J. Biol . Chem. 271:7273-7276.

34. Schenkman, S., E.S. Robbins and V. Nussenzweig. 1991. Attachment of Trypanosoma cruzi to mammalian cells requires parasite energy, and invasion can be independent of the target cell cytoskeleton. Infect . I mun. 59:645-654. 35. Moreno, S.N.J., J. Silva, A.E. Vercesi and R. Docampo. 1994. Cytosolic-free calcium elevation in Trypanosoma cruzi is required for cell invasion. J. Exp . Med. 180: 1535-1540.

36. Palombella, V. J. , O.J. Rando, A.L. Goldberg and T. Maniatis. 1994. The ubiquitin-proteasoma pathway is required for processing the NF-kBl precursor protein and the activation of NF-kB. Cell 78:773-785.

37. Ciechanover, A. 1994. The Ub-proteasome proteolytic pathway. Cell 79:13-21.

38. Kirchhoff, L. V., K.S. Kim, D.M. Engman and J.E. Donelson. 1988. Ubiquitin genes in Trypanosomatidae. J. Biol . Chem.

263:12698-12704.

39. Swindle, J. , J. Ajioka, H. Eisen, B. Sanwal, C Jacquemot, Z. Browder and G. Buck. 1988. The genomic organization and the transcription of the ubiquitin genes of Trypanosoma cruzi . EMBO. J . (Europ. Mol . Biol. Org.) . 7:1121-1127.

40. Ashall, F. 1990. Characterization of an alkaline peptidase of Trypanosoma cruzi and other trypanosomatids. Mol . Biochem. Parasi tol . 38:77-88. 41. Santana, J.M., P. Grellier, M.-H. Rodier, J. Schrevel and A. Teixeira. 1992. Purification and characterization of a new 120 kDa alkaline proteinase of Trypanosoma cruzi . Biochem. Biophys . Res . Comm. 187:1466-1473. 42. Burleigh, B.A. and N.W. Andrews. 1995. A 120-kDa alkaline peptidase from Trypanosoma cruzi is involved in the generation of a novel Ca2+-signaling factor for mammalian cells. J. Biol . Chem. 270:1-9.

43. Hua, S., W, To., T.T. Nguyen., M.L. Wong and C.C Wang, C.C 1996. purification and characterization of proteasomes from Trypanosoma brucei . Mol . Biochem. Parasitol .78:33-46.

44. Lima, B.D., M.H.G. Vainstein and C Martins de Sa. 1993. Multicatalytic proteinase complex purified from different stains of Trypanosoma cruzi - A comparative study. Mem . Inst . Oswaldo Cruz . (Rio de Janeiro) . 88: BQ29, 143.

45. Scholze, H. , S. Frey, Z. Cejka and T. Bakker-Grunwald. 1996. Evidence for the existence of both proteasomes and a novel high molecular weight peptidase in Entamoeba histolytica . J. Biol . Chem. 271:6212-6216

EXAMPLE 2

Effect of lactacystin on differentiation (cyst formation) of

Entamoeba parasites.

EnϋamoeJba parasites undergo two differentiation events during their life cycle. The first event is the conversion of the trophozoite form into the cyst form, which is the infectious stage of the parasite. This form, if ingested, undergoes the second event, excystation, or conversion back to the ameboid trophozoite form, which is the stage that causes intestinal disease. E. invadens, a parasite of reptiles that is used as a model for the human parasite E. histolytica, will undergo the first event, encystation, in vitro in response to glucose deprivation and/or osmotic stress (1) .

Ent.amoeba invadens trophozoites were grown in TYI-S- 33 medium to early log phase. Cells were harvested and resuspended at a concentration of 2xlO^s/ml in 47%LG (1) containing various concentrations of protease/proteasome inhibitors, as indicated in the accompanying figures. Cultures were examined at various time points afterward for the formation of cysts. Cysts were quantitated by chilling the encystation cultures, pelleting the cells, counting total cells per volume, and adding sarkosyl to 0.1% to lyse trophozoites. The remaining detergent-resistant cysts were then counted. This set of experiments, then, tested for the ability of protease/proteasome inhibitors to alter the formation of the detergent-resistant form of the cyst.

Figures 10-12 show the levels of cyst formation at 24, 48, and 60 hours after transfer to encystation medium, in the presence of increasing concentrations of lactacystin and E64. Where E64 at the higher concentrations delayed the formation of cysts, lactacystin prevented 90% cyst formation at a concentration of lOuM. Figure 13 shows the results of using other protease inhibitors at increasing concentrations to inhibit encystation. At 60 hours of encystation, lactacystin is the only inhibitor that prevented cyst formation.

1. Sanchez, L. , Enea, V., and Eichinger, D. 1994. Identification of a developmentally regulated transcript expressed during encystation of Entamoeba invadens . Mol. Biochem. Parasitol. 67:125-135.

EXAMPLE 3

In the present Example, the following Materials and Method were used.

Drugs. Lactacystin and lactacystin analogs were synthesized as previously described [14-16] , except ethyl lactactacystin and desmethyl lactacystin [17] . All drugs, except clasto-lactacystin dihydroxy acid /3-lactone, were dissolved in HjO to 1 mM and stored at 4°C until use. Clasto- lactacystin dihydroxy acid β-lactone was solubilized in DMSO to 10 mM and stored at -20° C until use. Lactacystin for injection into rats was dissolved in PBS, pH 7.4 immediately before use. Assay for sporozoite infectivity in vitro. This was performed as described [18] with a few modifications. Briefly, HepG2 cells (ATCC HB8065; American Type Culture Collection, Rockville, MD) were plated in chamber slides (model 4808, Lab-tek, Naperville, IL) 48 hours before each experiment . P. berghei sporozoites were dissected from mosquito salivary glands and resuspended in DMEM (Gibco BRL, Gaithersburg, MD) supplemented with 10% fetal calf serum (FCS; Hyclone Laboratories, Logan, UT) and 20 mM Hepes (Sigma) . Approximately 50,000 sporozoites were added per well, and the parasites were allowed to adhere and invade the HepG2 cell for 3 hours. The wells were washed and cells grown for an additional 2 days after which they were fixed with methanol and the EEF revealed by concentration with mAb 2E6, [19] , followed by goat anti-mouse immunoglobulin (Ig) conjugated to horseradish peroxidase (Accurate Chemical Corp., Westbury, NY) and 3, 3 ' -diaminobenzidine (Sigma). The number of EEF in each well were counted microscopically using a 20X light microscope objective. Microscopic assay for quantification of sporozoite invasion and assessment of sporozoite development. This assay was conducted according to the method described by Renia et al. [20] with a few modifications. HepG2 cells were plated in chamber slides as above. P. berghei sporozoites were pretreated with 3 μM lactacystin in DMEM/FCS for 1 hour at room temperature, washed and then added to the cells. Controls were pretreated with medium alone. The parasites were incubated with the cells for 1 hour at 37°C in 5% C0₂. The unattached sporozoites and medium were then removed, the cells were fixed with 4% paraformaldehyde and the extracellular parasites revealed by incubation with mAb 3D11 followed by anti-mouse Ig conjugated to rhodamine (Boehringer Mannheim, Indianapolis, IN) . The cells were then permabilized with methanol and all parasites (iurra and extracellular) revealed with mAb 3D11 followed by anti-mouse Ig conjugated to fluorescein isothiocyanate (Boehringer Mannheim) . 3D11 binds to the repeats of the P. berghei circu sporosoite protein, found both on sporozoites and EE. The slides were mounted and each field was counted using 2 different UV filters so that both FITC-labeled and rhodamine-labeled sporozoites could be counted. Between 40 and 50 fields were counted per well and three wells were plated per point. The percent invasion for each well was calculated using the following equation:

total parasites - extracellular parasites x 100 = %invasion total parasites

where total parasites is the number of FITC-labeled sporozoites and extracellular parasites is the number of rhodamine- labeled sporozoites. In other experiments the sporozoites were incubated with 3 μM lactacystin in DMEM/FCS for 15 minutes at room temperature and then added to the cells in the presence of the inhibitor. The cells were processed as outlined above at 4 and 15 hours after the addition of sporozoites. Photographs were taken of intracellular sporozoites with a 100X objective using a Zeiss photomicroseope. Radioimmunometric assay for quantification of sporozoite invasion. This assay was developed based on the microscopic assay described above. HepG2 cells (4xl0⁴ cells/well) were plated in 96 -well plates (Removawell tissue culture plates; Dynatech Laboratories, Inc., Chantilly, VA) and allowed to grow for 36 to 48 hours. P. berghei sporozoites were resuspended in DMEM/FCS with the indicated concentration of lactacystin or clasto-lactacystin dihydroxy acid and incubated at room temperature for 1 hour. The parasites were then washed and resuspended in DMEM/FCS and 40,000 sporozoites were added to each well of HepG2 cells for l hour at 37°C The unattached sporozoites and medium were removed and 100 μl of 4% paraformaldehyde (Eastman Kodak Co. , Rochester, NY) were added to each well for 10 minutes at room temperature. The cells were washed 3x with Tris-buffered saline (TBS; 130 mM NaCl, 50 mM Tris, pH 7.4) and 100 μl of cold methanol were added to three of the six wells plated for each point. After 10 minutes, the methanol was removed and the wells were washed with TBS two more times. The wells were then blocked for 1 hour at 37°C with 1% BSA (Sigma, St. Louis, MO) in TBS. The blocking buffer was removed and ¹²⁵I-mAb 3D11 (2xl0⁵ cpm/well) in TBS/BSA was added to each well for 45 minutes at 37°. The wells were washed 4x with TBS and then counted in an LKB γ- counter (model 1260; Pharmacia, Uppsala, Sweden) . Percent invasion was calculated using the following equation:

1 - cpm bound after paraformaldehyde fixation x 1.56 x

100 cpm bound after paraformaldehyde/methanol fixation

Assessment of C-type rRNA switching to A-type rRNA. HepG2 cells (2.5 x 10⁵ cells/well) were plated in 24 well plates (Falcon, Becton Dickson, Franklin Lakes, NJ) and allowed to grow for 2 days. P. berghei sporozoites were incubated with or without 3 μM lactacystin for 15 minutes at room temperature and then 20,000 sporozoites were added to each well in the presence or absence of lactacystin. After 3 hours the medium was removed and fresh medium without inhibitor was added. At 5 and 21 hours after infection, the cells from each well were trypsinized, spun at 300xg and resuspended in 1 ml of Tri- Reagent (Sigma) and total cellular RNA was extracted according to manufacturer ' s instructions . Reverse- transcriptase (RT) and PCR reactions were performed using an RT-PCR kit (Perkin Elmer, Branchburg, NJ) . Total RNA was quantified by absorbance at 260 nm and RT reactions were performed with 0.1 μg of RNA and random hexamers supplied by the manufacturer. PCR of this cDNA was performed using primers specific for either C- or A-type rRNA. These primers were designed based on published sequences [22], and included a 5' primer common to both types of rRNA

(5 ' -GCCTGAGAAATAGCTACCACATC-3 ' ) or G-type rRNA (5 '

GGATAAAAGCAGTGACAGAAGTC 3') and a 3' primer specific for A-type rRNA (5'- CATGAAGATATCGAGGC GGAG-3') . Amplification products were analyzed as stated below and the relative amounts of A- type and rRNA in each starting sample was estimated by performing a series of PCR reactions for each sample using serial dilutions of the cDNA. Culture of Erythrocytic Stages. P. falciparum strain 3D7 erythrocytic stages were cultured as described [23] with a few modifications. Briefly, parasites were cultured in fresh, washed human erythrocytes and RPMI 1640 (Gibco) containing 0.5% Albumax I (Gibco) , 50 μg/ml gentamicin (Gibco) and 100 μM_hypoxanthine (Sigma) . The parasites were grown in 25 cm² flasks (Falcon) containing 5 ml total volume at 5% hematocrit. Culture medium was changed daily and flasks were gassed with 5% 0₂, 5% C0₂, 90% N₂ before being sealed and maintained at 37° C Parasitemia was measured by counting the number of infected red cells on Giemsa stained blood smears.

['H] hypoxanthine uptake assay. Parasites were synchronized with 5% sorbitol (Sigma) [24] , using 2 treatments, 30 hours apart, resulting in approximately 90% synchrony. Eighteen hours after the second sorbitol treatment, parasites were resuspended in medium without hypoxanthine at a parasitemia of 0.5% and plated in 96-well microtiter plates

(Falcon) at a final volume of 250 μl/well and a hematocrit of

1.5% [25]. In the standard assays, [³H] hypoxanthine (Amersham, Arlington Heights, IL) , 0.5 μCi/well, and drugs at the indicated concentrations were added at the time of plating. For the time course assay, the [³H] hypoxanthine, with or without 0.6 μM lactacystin, was added at the time points indicated. As negative controls, one treatment contained uninfected erythrocytes and label, and one contained label and medium alone. Plates were gassed and sealed in airtight boxes and incubated at 37°C for 24 hours. The plates were harvested using a 1295-001 Cell Harvester (Wallac Oy, Turku, Finland) onto glass fiber filters (Wallac) that were then dried and counted in a 1205 Betaplate (Wallac) liquid scintillation counter. All treatments were performed in triplicate wells.

Parasite growth in lactacytin-treated erythrocytes Three ml of packed, washed human erythrocytes were resuspended at a 50% hematocrit in RPMI 1640 and incubated with or without lOμM lactacystin in 50 ml conical tubes for 1 hour at 37°C with agitation. Cells were washed 3 times in 10 volumes of RPMI 1640 at 37°C, for 2 hours per wash. Untreated schizonts were concentrated to a parasitemia of approximately 80% by floatation on 65% percoll (Pharmacia) [26] . These were then added to control and lactacystin pretreated target cells so that the starting parasitemia was approximately 0.1%. Each point was performed in triplicate. Parasitemias were measured daily by blinded counting of the number infected RBCs per 2000 cells on Giemsa stained blood smears from each flask.

Erythrocyte proteasome isolation. Lactacystin- treated and control erythrocytes were treated and washed as for the growth assay above and then washed once in 10 volumes of ice-cold 10 mM Tris, 150 mM NaCl, pH 7.5. The cells were then resuspended in 6 ml of ice-cold 10 mM Tris, pH 7.5 (lysis buffer) and incubated on ice for 5 minutes. 3 ml of 10 mM Tris, 800 mM NaCl, pH 7.5 (4X salt) were added to each tube before ultracentrifugation at 10,000 X g for 30 minutes at 4°C using a Beckman SW-41 rotor and L8-80 ultracentrifuge. The supernatants (approximately 9ml each) were loaded onto a 1ml HiTrap Q (Pharmacia) column for anion-exchange FPLC. Samples were eluted with an NaCl gradient from 200 mM to 1M, in 10 mM Tris pH 7.5 and 1.2 ml fractions were collected on ice.

Enzymatic assay for proteasome activity. Chymotrypsin- like activity of relevant HiTrap Q fractions was measured using the fluorescent substrate Suc-Leu-Leu-Val-Tyr-AMC, as described in [12] . 10 μl of each fraction was added to 90 μl of substrate diluted to 100 μM in 50 mM Tris-HCl, pH 7.8, in Microfluor plates (Dynatech) and the reactions were incubated at 37° C for 30 minutes in the dark. Duplicate wells were performed for each treatment. Reactions were quenched with 200 μl/well of ice-cold ethanol, after which fluorescence was measured in a Fluoroskan II (Labsystems, Helsinki, Finland) using an excitation wavelength of 380 nm and an emission wavelength of 440 nm.

Quantitative PCR assay for sporozoite infectivity. P. yoelii sporozoites were incubated with or without 5 μM lactacystin for 1 hour at room temperature and then injected i.v. into Swiss Webster mice. Two Thousand sporozoites were injected into each mouse and 40 hours later the mice were sacrificed and their livers removed for total RNA extraction [27] . RT and PCR reactions were performed with 1 μg of RNA. PCR of this cDNA was performed using parasite rRNA primers that recognize P. yoelii specific sequences within the 18S rRNA. These reactions were performed in the presence of a competitor template, constructed by insertion of a 66 bp lambda DNA fragment into the cloned 393 bp rRNA parasite amplification product. Mouse hypoxanthine phosphorybosyl transferase (HPRT) primers and competitor were used as positive controls to assess the efficiency of RT reactions as described [28] . Amplification products were analyzed by electrophorectic separation on 2% agarose in 0.04 M Tris-acetate, 0.001 M EDTA, stained with 0.5 μg/ml ethidium bromide and photographed under long wavelength UV light. Assessment of malaria infection in vivo. Six Sprague-Dawley rats (Taconic, Germantown, NY) , each 21 days old and weighing approximately 60 g, were infected with P. berghei blood stages, and then monitored by blood smear. 2 days later, when the average parasitemia was approximately 1%, the rats were paired into 2 groups of 3 rats each, such that the parasitemias of the groups were comparable. One group received 1.6 mg of lactacystin per rat in 1 ml of PBS, given as 2 injections at the same time: 0.5 ml i.v. and 0.5 ml i.p. In the control group the rats were injected with buffer alone. Blood smears were counted blindly at the indicated times after treatment. Data were analyzed using a 1-tailed repeated measures analysis of variance (general linear models procedure, the SAS system) . In experiments where the effect of lactacystin treatment of sporozoites on the development of bloodstream forms was assessed, P. yoelii sporozoites were incubated with or without 3 μM lactacystin for 1 hour at room temperature and then injected into mice i.v. at the doses indicated. Blood smears were taken from the mice starting at day 3 and assessed for the presence of parasites as described above. Results and Discussion Lactacystin inhibits the exoerythrocytic development of P. berghei in vitro. TABLE 1

Expt Inhibitor Concentration Number of Percent μM EEF* Inhibition

₁** none 448±25 lactacystin 1 109±10 75

3 5±2 99

9 0 100

2*** none 291±5 lactacystin 1 156±6 46

3 34±5 88

9 0 100 clasto- 9 280±32 6 lactacystin dihydroxy acid

₃**** none 816±9 lactacystin 1 574±13 29

3 458±17 43

9 408±3 50

Number of exoerythrocytic forms per 100 high powered fields

Inhibitor present for the first 3 h of experiment

*** Parasites preincubated with inhibitor for 1 h, washed and then plated on cells **** Inhibitor added 24 h after parasites plated on cells, the EEF in the lactacystin treated wells were smaller than those in the control wells.

Initial experiments (Table 1; Expt. 1) demonstrated that lactacystin inhibited the development of P. Jergriiei sporozoites into EEFs in a dose-dependent manner. In this initial experiment, however, the sporozoites were preincubated with the drug for 15 minutes and then plated on HepG2 cells in the continued presence of lactacystin. Although the drug was removed 3 hours later, the effect on development could be attributed to an e fect on host cell proteasomes and not on the parasite. Therefore, we performed other experiments (Table 1; Expt. 2) in which the sporozoites were preincubated with lactacystin, washed and then plated on the cells. This treatment also inhibited EEF development, suggesting that parasite proteasomes are required for sporozoite development in hepatocytes. As predicted, preincubation with clasto- lactacystin dihydroxy acid, the inactive product of lactacystin hydrolysis [29] , does not inhibit EEF development in this assay. In order to test whether the inhibitory activity of lactacystin was dependent upon the timing of its addition to the parasites, we performed an experiment in which the drug was added 24 hours after the parasites were added to the cells (Table l; Expt. 3) . As shown, there was still a significant inhibition of EEF development and those EEFs that did develop were smaller than those seen in control wells.

We then went on to see if lactacystin affects sporozoite invasion of target cells. In order to test this we preincubated sporozoites with lactacystin for 1 hour and then added them to HepG2 cells and measured the invasion rate. As shown in Figure 14, there is no inhibition of invasion by lactacystin, even in concentrations as high as 9 μM. This suggests that proteasome activity in sporozoites is not required for invasion. Additionally, since invasion of host cells by apicomplexan parasites is an active process [30-32] , this result indicates that the inhibition of exoerythrocytic development by lactacystin is not due to a lethal effect on sporozoites. Within 4 hours after invasion, the morphology of normal sporozoites begins to change; the middle portion of the parasite begins to expand into a characteristic bulb-like structure (Figure 15a) . This region continues to expand as the parasite grows so that after 15 hours the parasite is in a rounded form (Figure 15c) . If the sporozoites are treated with lactacystin, none of the parasites have this pronounced bulblike structure at 4 hours after invasion (Figure 15b) . This is in contrast to the control sporozoites where almost all of the intracellular parasites have begun this developmental change. At 15 hours, however, there is a greater variety in the forms of the lactacystin-treated parasites. Approximately half of the parasites have not changed form at all and remain as slender sporozoites in the cell (Figure 15d) . The other half are divided between rounded parasites which appear normal and rounded parasites in which the CS stains more densely, giving it a pyknotic appearance (Figure 15e) . These observations suggest that lactacystin affects the morphological changes that accompany the development of EEFs from sporozoites. In order to further investigate the effect of lactacystin on EEF development, we assayed for the effect of lactacystin on the switch from C-to A-type rRNA. Plasmodium spp. are unique in that they posess different rRNAs in different stages of their life cycle (reviewed in reference [33] ) . Although small amounts of all rRNA types can always be found in each stage, the vast majority of rRNA in sporozoites is C-type rRNA. After the parasites invade hepatocytes, they begin to synthesize A-type rRNA, and by 20 hours after invasion this is the predominant rRNA associated with the parasites. Although the reasons for rRNA switching are not known, it serves as a useful marker for parasite development. We therefore assayed for the effect of lactacystin on the switch from C- to A- type rRNA. Lactacystin-treated and untreated sporozoites were added to HepG2 cells, and 5 and 21 hours later the cells were harvested for quantitative RT-PCR using A and C specific rRNA primers. At 5 hours, there is little A-type rRNA in either the lactacystin- treated or control sporozoites (Figure 16a) . However, at 21 hours only untreated sporozoites showed an increase in the amount of A-type rRNA, (Figure 16b) . There was no apparent changes in the amounts of C-type rRNA remained constant in both the lactacystin-treated and control sporozoites (data not shown) .

Lactacystin inhibits growth of P. falciparum erythrocytic stages in vi tro . Normal trophozoites go through several rounds of DNA replication and nuclear division within the erythrocyte as they develop into the merozoite-containing schizonts. To assess the effects of lactacystin on the development of the erythrocytic stages, incorporation of [³H] hypoxanthine was used as a measure of DNA synthesis. Figure 17 shows that lactacystin inhibits the development of P. falciparum trophozoites into schizonts. Significant inhibition occurs at nanomolar concentrations of lactacystin, with approximately 50% inhibition seen at 300 nM. This inhibition of schizogony can be viewed microscopically. Normal trophozoites have a single nucleus

(Figure 18a) that divides a variable number of times to produce the 10 - 20 nuclei that are contained in the mature schizont (Figure 18b) . At concentrations which maximally inhibit parasite development, i.e. 1.25 μM, approximately 90% of the parasites appear developmentally arrested (Figure 18c) , and persist for at least 24 hours with morphology that is indistinguishable by light microscopy from normal trophozoites before treatment. At higher concentrations, i.e. 10 μM, however, many of the parasites show degenerative changes (Figure 18d) .

Human erythrocytes are an abundant source of proteasomes, and even mature erythrocytes appear to have appreciable levels of functional proteasomes [34, 35] . To exclude the possibility that any of the effects of latacystin on erythrocytic stage development are due to inhibition of the erythrocyte proteasome, uninfected erythrocytes were treated with 10 μM lactacystin and washed before the addition of untreated schizonts. Figure 19b shows that the chymotrypsin-like activity of proteasomes isolated from these erythrocytes is totally inhibited. The lactacystin treated erythrocytes supported parasite growth equally well as control erythrocytes (Figure 19a) . We conclude that the effects of lactacystin on parasite development are not due to inhibition of the erythrocyte proteasome, but rather are due to effects of the drug on the parasite itself.

Next we examined the effects of several lactacystin analogs against P. falciparum in the [³H] hypoxanthine incorporation assay. Figure 20a shows that lactacystin analogs have differential activities in the inhibition of the development of P. falciparum erythrocytic stages in vitro. Clasto-lactacystin dihydroxy acid β-lactone is the sole intermediate and active form of the drug [29] , which acylates the catalytic β-subunit of the proteasome. In this assay, clasto-lactacystin dihydroxy acid β-lactone displays activity identical to lactacystin on a molar basis (Figure 20a) . Again in this assay, casto-lactacystin dihydroxy acid shows no activity (Figure 20b) .

Increased activity compared to lactacystin is seen with ethyl-lactacystin (Figure 20b) . While the ethyl-lactacystin analog has one more carbon on the γ-lactam ring than lactacystin, the desmethyl lactacystin (Figure 20b) which has one less carbon, shows greatly decreased activity. The side chains of the inhibitor make numerous stereochemical interactions with the 05/PRE2 subunit of the yeast proteasome [38] . These findings suggest that at least a methyl group at C7 of lactacystin is necessary for acylation of the parasite proteasome, and an ethyl group at this position facilitates this reaction.

The decarboxylactacystin also shows increased activity compared to lactacystin (Figure 20a) . This compound, however, is modified only on the N-acetylcysteine moiety that is lost during lactonization into the active β-lactone. Thus, the β- lactone produced by the lactonization of decarboxylactacystin is the same as that of lactacystin, making this increase in activity surprising. It is thought that cells are impermeable to lactacystin, and that it is the β-lactone which enters cells [39] . The increase in hydrophobicity, which results from the removal of the carboxyl group of lactacystin to form decarboxylactacystin, might allow the analog to enter cells, providing a possible explanation for its greater activity.

We then tested the effect of lactacystin on the parasite at different stages of the erythrocytic cycle. Figure 21 shows when lactacystin treatment occurs before approximately 30 hours, [³H] hypoxanthine incorporation is inhibited. However, inhibition of [³H] hypoxanthine incorporation no longer occurs when parasites are treated later, after the onset of schizogony when DNA replication occurs. One possible explanation for this loss of inhibition is that these late stage parasites are impermeable to the drug. However, parasites appear to remain permeable to the drug during schizogony, as schizonts treated with lactacystin do not rupture, resulting in a lack of concomitant reinvasion (data not shown) . It is likely, therefore, that lactacystin inhibits some process that is necessary for the commencement of DNA replication in the parasite, and not DNA synthesis per se.

Effects of lactacystin on P. yoelii EEF development in vivo . The length of the prepatent period in malaria infection correlates roughly with the number of infectious sporozoites. Using a rodent model of malaria, P. yoelii sporozoites were preincubated in medium with or without 3μM lactacystin and then injected into mice. The results are set forth in Table 2 below.

TABLE 2

Number of Inhibitor** Day 3*** Day 4*** Day 5***

Sporozoites

Injected

100,000 none 1/1 lactacystin 2/2

10,000 none 2/2 lactacystin 0/3 3/3

1000 none 3/3 lactacystin 0/3 3/3

100 none 0/3 3/3 2/3* lactacystin 0/3 0/3

* The mouse that was negative on day 5 remained negative for the next 7 days ** Sporozoites were preincubated in medium ± 3μM lactacystin for 1 hour and then injected into mice intravenously. *** On days 3-5 post injection bloodsmears were taken from mice and analyzed for the presence of parasites.

The mice injected with lactacystin-treated sporozoites showed an increase in the prepatent period versus controls (Table 2). As shown, injection of 10,000 or 1,000 lactacystin treated sporozoites results in the same prepatent period as 100 untreated sporozoites, suggesting a 90-99% inhibition of EEF development under these conditions.

A more direct quantification of sporozoite infectivity was performed using a competitive RT-PCR assay (Figure 22) . When the amounts of rRNA in the livers of mice injected with untreated and lactacystin-treated sporozoites were compared, we found a 10- fold decrease in the parasite rRNA in mice injected with treated sporozoites.

Effects of lactacystin on P. berghei erythrocytic stages in vivo . Figure 23 shows that treatment with lactacystin as one dose of 1.6 mg per rat infected with P. berghei erythrocytic stages results in a significant (p = .05), albeit modest, reduction of parasitemia versus controls. Treatment with a total of 4 mg of lactacystin per rat, given as 3 i.v. injections of 1.3 mg each, 8 hours apart, results in the complete clearance of infection (data not shown) . However, none of the 5 rats treated survived this regimen.

References cited in Example 3

1. Butler, D., J. maurice, and C. O'Brien, Time to put malaria control on the global agenda . Nature, 1997.

386(6625) : p. 535-540. 2. Coux, 0., K. Tanaka, and A.L. Goldberg, Structure and functions of the 20S and 26S proteasomes . Annu. Rev.

Biochem., 1996. 65: p. 801-847. 3. Hilt, W. and D.H. Wolf, Proteasomes : destruction as a program. Trends Biochem. Sci., 1996. 21: p. 96-102. 4. Orlowski, M. , The multicatalytic proteinase complex, a major extralysosomal proteolytic system. Biochemistry,

1990. 29(45): p. 10289-10297. 5. Rivett, A.J., Proteasomes : mul ticatalytic proteinase complexes . Biochem. J., 1993. 291: p. 1-10. 6. Ciechanover, A., The ubiqui tin -proteasome proteolytic pathway. Cell, 1994. 79: p. 13-21.

7. Rock, K.L., et al . , Inhibi tors of the proteasome block the degradation of most cell proteins and the generation of peptides presented on MHC class I molecules. Cell, 1994. 78: p. 761-771.

8. Deshaies, R.J., V. Chau, and M. Kirschner, Ubiqui tination of the Gl cyclin Cln2p by a Cdc34p- dependent pathway. EMBO J., 1995. 14(2): p. 303-312.

9. Glotzer, M. , A.W. Murray, and M.W. Kirschner, Cyclin is degraded by the ubiquitin pathway. Nature, 1991. 349: p.

132-138.

10. Pahl, H.L. and P.A. Baeuerle, Control of gene expression by proteolysis . Current Opinion in Cell Biology, 1996. 8: p. 340-347. 11. Fenteany, G., et al., Inhibition of proteasome activities and subuni t -specific amino - terminal threonine modification by lactacystin . Science, 1995. 268: p. 726- 731.

12. Gonzalez, J. , et al., Proteasome activi ty is re-quired for the stage -specific transformation of a protozoan parasi te . J. Exp. Med. , 1996. 184: p. 1909-1918.

13. Eichinger, D. , V. Nussenzweig, and J. Gonzalez, manuscript in preparation. .

14. Corey, E.J. and G.A. Reichard, Total synthesis of lactacystin . J. Am. Chem. Soc, 1992. 114: p. 10677-

10678.

15. Fenteany, G., et al., A b-lactone related to lactacystin induces neuri te outgrowth in a neuroblastoma cell line .and inhibi ts cell cycle progression in -an osteosarcoma cell line . Proc. Natl. Acad. Sci. USA, 1994. 91: p. 3358- 3362.

16. Nagamitsu, T. , et al., Structure-activi y relationships of lactacystin, the first non-protein neurotrophic factor. The Journal of Antibiotics, 1995. 48(7): p. 747- 748. 17. Corey, E.J., unpublished.

18. Hollingdale, M.R., M. McCullough, and R.L. Beaudoin, In vi tro cul tivation of the exoerythrocytic stage of Plasmodium berghei from sporozoi tes . Science, 1981. 213: p. 1021-1022.

19. Tsuji, M. , et al., Demonstration of heat -shock protein 70 in the sporozoi te stage of malaria parasi tes . Parasitology Research, 1994. 80: p. 16-21.

20. Renia, L. , et al . , Malaria sporozoi te penetration . Journal of Immunological Methods, 1988. 112: p. 201-205.

21. Yoshida, N., et al . , Hybrido a produces protective antibodies directed against the sporozoi te stage of malaria parasi te . Science, 1980. 207: p. 71-73.

22. Gunderson, J.H., et al . , Structurally distinct, stage- specific ribosomes occur in Plasmodium. Science, 1987.

238: p. 933-937.

23. Read, M. and J.E. Hyde, Simple in vitro cul tivation of the malaria parasite Plasmodium falciparum (erythrocytic stages) sui table for large-scale preparations. Protocols in Molecular Parasitology, ed. J.E. Hyde. 1993, Totowa, NJ: Humana Press Inc.

24. Lambros, C and J.P. Vanderberg, Synchronization of Plasmodium Falciparum erythrocytic stages in cul ture . J. Parasitol., 1979. 65(3): p. 418-420. 25. Desjardins, R.E. , et al . , Quanti tative assessment of antimalarial activity in vi tro by a semiautomated microdilution technique. Antimicrobial Agents and Chemotherapy, 1979. 16(6): p. 710-718.

26. Dluzewski, A.R. , et al . , A simple method for isolating viable mature parasites of Plasmodium falciparum from cul tures . Trans. R. Soc. Trop. Med. Hyg., 1984. 78: p. 622-624.

27. Briones, M.R.S., M. Tsuji, and V. Nussenzweig, The large differences in infectivi ty for mice of Plasmodium berghei and Plasmodium yoelii sporozoites cannot be correlated wi th their abili ty to enter hepatocytes . Molecular and Biochemical Parasitology, 1996. 77: p. 7-17.

28. Reiner, S.L., et al., Constructing polycompeti tor cDNAs for quantitative PCR. Journal of Immunological Methods, 1993. 165: p. 37-46.

29. Dick, L.R., et al . , Mechanistic studies on the inactivation of the proteasome by lactacystin . The Journal of Biological Chemistry, 1996. 271(13): p. 7273- 7276. 30. Dobrowolski, J.M. and L.D. Sibley, Toxoplasma invasion of mammalian cells is powered by the actin cytoskeleton of the parasite. Cell, 1996. 84: p. 933-939.

31. Vanderberg, J.P., S. Chew, and M.J. Stewart, Plasmodiumsporozoite interactions with acrophages in vitro; a videomicroscopic analysis . Journal of Protozoology, 1990. 37(6): p. 528-536.

32. Vanderberg, J.P., Studies on the motili ty of Plasmodium sporozoi tes . Journal of Protozoology, 1974. 21(4): p. 527-537. 33. Waters, A. P., The ribosomal genes of Plasmodium. Advances in Parasitology, 1994. 34: p. 33-79. 34. McGuire, M.J. and G.N. DeMartino, Purification and characterization of a high molecular weight proteinase (macropain) from human erythrocytes . Biochimica et Biophysica Acta, 1986. 873: p. 279-289. 35. Speiser, S. and J.D. Etlinger, Loss of ATP - dependent proteolysis wi th maturation of reticulocytes and erythrocytes . Journal of Biological Chemistry, 1982. 257(23): p. 14122-14127.

36. Pouvelle, B., et al . , Direct access to serum macromolecules by intraerythrocytic malaria parasi tes .

Nature, 1991. 353: p. 73-75.

37. Lauer, S.A., et al . , A membrane network for nutrient import in red cells infected wi th the malaria parasi te. Science, In Press. 38. Groll, M. , et al., Structure of the 20S proteasome from yeast at 20 A resolution . Nature, 1997. 386: p. 463-471. 39. Dick, L.R., et al . , Mechanistic studies on the inactivation of the proteasome by lactacystin in cul tured cells . Journal of Biological Chemistry, 1997. 272(1): p. 182-188.

EXAMPLE 4

As shown below, the peptidyl boronic acid proteasome inhibitors MG-306, MG-309, MG-369 and MG-385 (described in WO 96/13266) inhibit growth of Plasmodium falciparum cultured in human red cells. In this experiment, parasites prepared from synchronized cultures, with 7% parasitemia, were plated in 96 well microtiter plates with serial dilutions of inhibitors.

[³H] hypoxanthine was added immediately after the compounds and uptake was used as a measure of growth of parasite.

All compounds showed steep dose responses with 90% killing at:

Ki ,human (nM)

MG-306 30 nM 0.2

MG-309 30 nM 0.8

MG-385 300 nM 18

MG-369 3,000 nM 30

The results are shown graphically in Figure 24. In cytotoxicity assays done previously (data not shown) these doses, for MG-306 and MG-309, give 10-50% cell death depending on cell type.

Claims

WHAT IS CLAIMED IS:

1. A method for treating a mammal suffering from an infection caused by a protozoan parasite comprising administering to said mammal an anti-parasitic infection effective amount of an agent selected from the group consisting of proteasome inhibitors, ubiquitination pathway inhibitors, and mixtures thereof .

2. The method of claim 1 wherein said proteasome inhibitor is selected from the group consisting of lactacystin, MG-132, N-meth-oxysuccinyl-glu-val-lys-phe-modified compounds, desmethyl lactacystin, clasto-lactacystin dihydroxy acid β - lactone, decarboxylactacystin, MG 306, MG 309, MG369, MG 385 and mixtures thereof .

3. The method of claim 1 wherein said disease is selected from the group consisting of malaria, Chagas ' disease, leishmaniasis, Giardiasis, amebiasis and Pneumocystis pneumonia.

4. A method for inhibiting the infectivity of a protozoan parasite comprising contacting said parasite with an infectivity- inhibiting effective amount of an agent selected from the group consisting of proteasome inhibitors, ubiquitination pathway inhibitors and mixtures thereof.

5. The method of claim 4 wherein said proteasome inhibitor is selected from the group consisting of lactacystin, MG-132, N-meth-oxysuccinyl-glu-val-lys-phe-modified compounds, desmethyl lactacystin, clasto-lactacystin dihydroxy acid β - lactone, decarboxylactacystin, MG 306, MG 309, MG369, MG 385 and mixtures thereof.

6. The method of claim 4 wherein said disease is selected from the group consisting of malaria, Chagas' disease, leishmaniasis, Giardiasis, amebiasis and Pneumocystis pneumonia.

7. A method for inhibiting the replication of a protozoan parasite comprising contacting said parasite with a replication inhibitory-effective amount of an agent selected from the group consisting of proteasome inhibitors, ubiquitination pathway inhibitors and mixtures thereof.

8. The method of claim 7 wherein said proteasome inhibitor is selected from the group consisting of lactacystin, MG-132, N-meth-oxysuccinyl-glu-val-lys-phe-modified compounds, desmethyl lactacystin, clasto-lactacystin dihydroxy acid β - lactone, decarboxylactacystin, MG 306, MG 309, MG369, MG 385 and mixtures thereof.

9. The method of claim 7 wherein said disease is selected from the group consisting of malaria, Chagas' disease, leishmaniasis, Giardiasis, amebiasis and Pneumocystis pneumonia .

10. A pharmaceutical formulation for treating a mammal suffering from a disease caused by a protozoan parasite comprising an effective amount to treat said disease of an agent selected from the group consisting of proteosome inhibitors, ubiquination pathway inhibitors and mixtures thereof.

11. The pharmaceutical formulation of claim 10 wherein said proteasome inhibitor is selected from the group consisting of lactacystin, MG-132, N-meth-oxysuccinyl-glu-val- lys-phe-modified compounds, desmethyl lactacystin, clasto- lactacystin dihydroxy acid β- lactone, decarboxylactacystin, MG 306, MG 309, MG369, MG 385 and mixtures thereof.

12. The pharmaceutical formulation of claim 10 wherein said disease is selected from the group consisting of malaria, Chagas' disease, leishmaniasis, Giardiasis, amebiasis and Pneumocystis pneumonia.