WO1997040072A2 - Proteines adam et leur utilisation - Google Patents

Proteines adam et leur utilisation Download PDF

Info

Publication number
WO1997040072A2
WO1997040072A2 PCT/GB1997/001067 GB9701067W WO9740072A2 WO 1997040072 A2 WO1997040072 A2 WO 1997040072A2 GB 9701067 W GB9701067 W GB 9701067W WO 9740072 A2 WO9740072 A2 WO 9740072A2
Authority
WO
WIPO (PCT)
Prior art keywords
adam
protein
met
dis
interdomainase
Prior art date
Application number
PCT/GB1997/001067
Other languages
English (en)
Other versions
WO1997040072A3 (fr
Inventor
Peter Ian Croucher
Norman Mckie
Robert Graham Goodwin Russell
Original Assignee
The University Of Sheffield
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The University Of Sheffield filed Critical The University Of Sheffield
Priority to AU25727/97A priority Critical patent/AU2572797A/en
Priority to EP97917346A priority patent/EP0894132A2/fr
Publication of WO1997040072A2 publication Critical patent/WO1997040072A2/fr
Publication of WO1997040072A3 publication Critical patent/WO1997040072A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6489—Metalloendopeptidases (3.4.24)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Definitions

  • the present invention relates to ADAM 12 proteins, to species variants, homologues , allelic forms, mutant forms, derivatives, muteins and equivalents thereof, to various individual domains of ADAM 12 proteins and various domain combinations, to inhibitors thereof and to various forms of therapy, diagnosis and prophylaxis based thereon.
  • the invention also relates to various therapeutic, diagnostic and prophylactic applications of proteins of the ADAM (reprolysin) family in general, as well as their individual domains, domain combinations, inhibitors and other materials based thereon.
  • ADAM family is a term of art defining a recently recognized and widely distributed family of membrane proteins which contain both a metalloprotease domain and a disintegrin domain (see e.g. Wolfsberg et al. (1995) , J.
  • the ADAM family is also recognized as a grouping in an independent classification scheme representing a family which at least partially overlaps with the reprolysin family.
  • the reprolysin family of metalloproteinases are a well characterised group of enzymes present in snake venom. The family has been divided into four classes based upon the characteristic domains present (Bjarnason and Fox (1994), Pharmac. Ther. Vol.
  • class I contains a proteinase domain only, those of class II a proteinase and disintegrin-like domain, whereas those of class III contain proteinase, disintegrin-like and cysteine rich domains.
  • the class IV reprolysins are similar to the class III molecules with the addition of a lectin-like domain at the C terminus (Bjarnason and Fox, Snake venom metalloendopeptidases: Reprolysins. In: A.J.Barrett (ed.), Proteolytic enzymes: Aspartic and metallopeptidases, pp. 345-368, London: Academic Press Inc.).
  • ADAM proteins exhibit structural affinities with inter alia the class III and class IV reprolysins.
  • ADAM, ADAM protein(s) and ADAM family are used in a broad sense to correspond to the reprolysins as defined by Bjarnason and Fox (1994), Pharmac. Ther. Vol. 62, pages 325-372 and Bjarnason and Fox, Snake venom metalloendopeptidases : Reprolysins. In: A.J.Barrett (ed.), Proteolytic enzymes: Aspartic and metallopeptidases, pp. 345-368, London: Academic Press Inc.). These terms therefore encompass related metalloproteinases of snake origin.
  • ADAM ADAM protein and ADAM family refer to the ADAM family as defined by Wolfsberg et al. (1995), J. Cell Biol., Vol. 131(2), pages 275-278 and Wolfsberg et al. (1995), Developmental Biology, Vol. 169, pages 378-383 together with classes P-III and P- IV of the venom proteinases.
  • ADAM ADAM protein(s) and ADAM family are also intended to be interpreted herein in a narrower sense to correspond to the family defined by Wolfsberg et al. (1995), J. Cell Biol., Vol. 131(2), pages 275-278 and Wolfsberg et al. (1995), Developmental Biology, Vol. 169, pages 378-383.
  • ADAM reprolysin family is mosaicism: multiple structural domains are present at both the DNA and protein level. These may include a metalloprotease-like domain, which may or may not be proteolytically active.
  • Proteolytically active ADAM ⁇ met ⁇ domains may be characterized by the presence of a HEXXH motif (characteristic of zinc-dependent metallo- endopeptidases) .
  • ADAM ⁇ met ⁇ domains which lack this motif may have a different activity (such as a different proteolytic activity/substrate specificity) , may act as an effector sink (and so act as a regulatory element), or fulfil a structural role in the context of a multidomain ADAM protein (perhaps to effect signalling across a membrane) .
  • Different splicing pathways may also generate ADAMs having different ADAM ⁇ met ⁇ domains, and so the presence of an active ADAM ⁇ met ⁇ may dependent on a particular tissue-specific splicing pathway.
  • the ADAM proteins may also include a disintegrin-like domain (which may or may not be a ligand for integrins or other receptors), a potential fusogenic motif or domain (which may or may not be fusogenic, and which may form part of a high-cysteine region which may be associated with the function of the disintegrin-like domain) , an EGF-like repeat-containing domain (which also forms part of the cysteine rich region) and a cytoplasmic tail domain containing a transmembrane subdomain. Not all ADAMs have a potential fusogenic motif/domain.
  • ADAM ⁇ met> the metalloprotease-like domain
  • HEXGHNLGXXHD the consensus sequence
  • the disintegrin-like domain (hereinafter abbreviated ADAM ⁇ dis ⁇ ) may be a ligand for integrins or other receptors. Different ADAMs may interact with different integrins and/or other receptors. Only a subset of ADAMs may be functional adhesion molecules.
  • the disintegrin loops of all ADAMs and P-III SVMPs contain an extra cysteine as compared to those of P-II SVMPs.
  • This cysteine which provides the disintegrin-like domain with an odd number of cysteines, may be free, or it may form a disulfide bond with a cysteine in the cysteine-rich domain, which also contain an odd number of cysteines.
  • the unpaired cysteine could be available for dimer (homo- or heterodimer) formation. Recent evidence suggests that disintegrin-like domains which contain this extra cysteine are functional adhesion molecules.
  • the cytoplasmic tails are unusually rich in proline, serine, glutamic acid, and/or lysine. None of the tails show obvious sequence similarity to other proteins. Given the roles of the cytoplasmic domains of other plasma membrane proteins, the tails of the ADAMs may be involved in oligomerization or signalling.
  • ADAM activities are complex. Transcription of ADAM mRNA is modulated both positionally and temporally. For example, although some ADAM mRNA are testis-specific, others are found in a variety of tissues. In addition, transcription of ADAMs 1-6 in the testis is developmentally regulated. Splicing of ADAM transcripts is also regulated. Many ADAMs are composed of multiple small exons and alternatively spliced forms of ADAM II have been proposed. The two isoforms of monkey ADAM 1 could be due either to alternative splicing or to multiple genes. ADAMs may also be regulated at the protein level. ADAMs may form combinations of dimers or oligomers.
  • ADAMs 1 and 4 show identical patterns of tissue distribution, there may be ADAM 1/4 complexes in some cell types.
  • Proteolytic cleavage between domains may regulate certain functions, as many SVMPs, and possibly guinea pig fertilin ⁇ , are proteolyzed at interdomain boundaries.
  • Many ADAMs and SVMPs contain di- or tetrabasic residues between domains which could be recognized by interdomainases (for example, subtilisin-like proteases).
  • interdomainases for example, subtilisin-like proteases
  • ADAM metalloprotease activity may also occur by a cysteine-switch mechanism, in which a prodomain cysteine ligands the active site zinc and maintains it in an inactive state.
  • ADAMs which encode the metalloprotease active site residues contain a cysteine in their prodomain which is not present in ADAMs which lack the zinc-liganding histidines.
  • ADAM 12 protein an isolated ADAM 12 protein.
  • ADAM 12 protein is used herein to refer to the human ADAM 12 protein (hereinafter hADAM 12), as represented by the amino acid sequence shown in Figure 2, together with species variants, allelic and mutant forms thereof.
  • ADAM 12 is also used herein to refer to a particular set of members of the ADAM family having amino acid sequences exhibiting high degrees of similarity with that of Figure 2, including allelic and mutant forms thereof.
  • ADAM 12 protein encompasses hADAM 12 and all homologues or species variants thereof (for example, species variants occurring in other organisms, particularly in other mammals).
  • ADAM 12 as used herein embraces the bovine homologue or species variant (hereinafter bADAM 12) .
  • hADAM 12 protein and its allelic and/or mutant forms and derivatives.
  • ADAM 12 may also encompass variant protein forms generated by alternative splicing pathways ("splicing variants") which arise during expression of the corresponding structural gene(s).
  • splicing variants variant protein forms generated by alternative splicing pathways
  • ADAM 12 defines an ADAM 12 protein complex, this complex being that constellation of proteins derived by expression of ADAM 12 structural gene(s) via each of the various different splicing pathways in each of the various different organisms in which it occurs, including allelic and mutant forms thereof.
  • isolated is used herein to indicate that the isolated protein or substance exists in a physical milieu distinct from that in which it occurs in nature.
  • the isolated protein or substance may be substantially isolated (for example purified) with respect to the complex cellular milieu in which it naturally occurs.
  • purified material of the invention is specified herein the absolute level of purity is not critical and those skilled in the art can readily determine appropriate levels of purity according to the use to which the material (e.g. ADAM protein) is to be put.
  • the isolated material e.g. protein
  • a composition for example a more or less crude extract containing many other proteins and substances
  • buffer system or pharmaceutical excipient which may for example contain other components (including other proteins, such as albumin) .
  • the isolated protein may be purified to essential homogeneity, for example as determined by PAGE or column chromotography (for example HPLC) .
  • the isolated ADAM protein species of the invention is essentially the sole ADAM protein in a given composition.
  • Particularly preferred are compositions in which the ADAM 12 protein (or homologues, muteins, derivatives or equivalents thereof) is the sole representative of the ADAM family (for example, the sole active ingredient in a pharmaceutical composition) .
  • ADAM 12 ⁇ pro> The designations ADAM 12 ⁇ met ⁇ , ADAM 12 ⁇ dis ⁇ , ADAM 12 ⁇ fus ⁇ , ADAM 12 ⁇ egf ⁇ and ADAM 12 ⁇ tmt ⁇ are abbreviations for the pro-domain, metalloprotease-like domain, disintegrin-like domain, fusogenic-like motif or domain, EGF-like domain and transmembrane-cytoplasmic tail domains of the ADAM 12 protein, respectively.
  • the protein of the invention preferably comprises or consists essentially of: (a) ADAM 12 ⁇ pro ⁇ ; and/or (b) ADAM 12 ⁇ met ⁇ ? and/or (c) ADAM 12 ⁇ dis ⁇ ; and/or (d) ADAM 12 ⁇ fus ⁇ ; and/or (e) ADAM 12 ⁇ egf ⁇ ; and/or (f) ADAM 12 ⁇ tmt ⁇ .
  • the invention specifically contemplates all individual domains of the ADAM 12 protein as separate and independent entities, as well as all combinations thereof and all combinations of subsets thereof.
  • a subset is a group of some (but not all) ADAM domains as hereinbefore described.
  • the ADAM 12 ⁇ met ⁇ domain may not be an active protease, and the ADAM 12 ⁇ dis ⁇ domain may not act as a functional disintegrin (e.g. may not interact with integrins or other receptors) .
  • the ADAM 12 ⁇ fus ⁇ domain is not necessarily fusogenic.
  • the isolated protein comprises or consists essentially of: (a) ADAM 12 ⁇ pro ⁇ ; or (b) ADAM 12 ⁇ met ⁇ ; or (c) ADAM 12 ⁇ pro ⁇ and ADAM 12 ⁇ met ⁇ ; or (d) ADAM 12 ⁇ ro ⁇ , ADAM 12 ⁇ met ⁇ and ADAM 12 ⁇ dis ⁇ ; or (e) ADAM 12 ⁇ met ⁇ and ADAM 12 ⁇ dis ⁇ ?
  • ADAM 12 ⁇ dis ⁇ or (f) ADAM 12 ⁇ dis ⁇ ; or (g) ADAM 12 ⁇ egf ⁇ ; or (h) ADAM 12 ⁇ met ⁇ and ADAM 12 ⁇ egf ⁇ ; or (i) ADAM 12 ⁇ met ⁇ , ADAM 12 ⁇ dis ⁇ and ADAM 12 ⁇ egf ⁇ ; or (j) ADAM 12 ⁇ pro ⁇ , ADAM 12 ⁇ met ⁇ , ADAM 12 ⁇ dis ⁇ and ADAM 12 ⁇ egf ⁇ ; or (k) ADAM 12 ⁇ dis ⁇ and ADAM 12 ⁇ fus ⁇ ; or (1) ADAM 12 ⁇ met ⁇ , ADAM 12 ⁇ dis ⁇ and ADAM 12 ⁇ fus ⁇ .
  • Such domain sequences may or may not occur in nature.
  • Some or all of these particular combinations may be functionally complementary in that the conjunction of the selected domains promotes or enables (either directly or indirectly via one or more mediators) a functional interaction therebetween.
  • the ADAM ⁇ pro ⁇ and ADAM ⁇ met ⁇ domains together comprise a zymogen activated by proteolysis at the interdomain boundary.
  • the ADAM ⁇ pro ⁇ domain may thus act as a cysteine switch, co-ordinating the active site zinc atom via a cysteine residue thus interfering with binding of a water molecule and rendering the ADAM ⁇ met ⁇ domain inactive.
  • the ADAM ⁇ met ⁇ domain may be involved in autoactivation by a proteolytic event, and a high-cysteine sequence context in which the ADAM ⁇ fus ⁇ may be located and/or the ADAM ⁇ egf ⁇ domain may function as inhibitors of ADAM ⁇ met ⁇ .
  • the cysteine switch may also be activated by cleavage at the ADAM ⁇ pro ⁇ -ADAM ⁇ met ⁇ interdomain boundary by a matrix metalloprotease (MMP) , for example a membrane-bound MMP or gelatinase A.
  • MMP matrix metalloprotease
  • one class of ADAM ⁇ met ⁇ inhibitors would be inhibitors of the activating MMPs.
  • the isolated protein of the invention comprises two or more particular domains
  • these domains can be present as the products of cotranslation from a corresponding DNA (e.g. a cDNA) in which the corresponding structural genes are arranged in tandem, or can be the products of fusion, crosslinking (e.g, chemical or immunological cross linking), binding or other associative processes conducted on mixtures of individual domains (which may have been independently purified or co-purified) .
  • multidomain proteins according to the invention are the products of the expression of recombinant DNA molecules in which the structural genes for individual ADAM domains have been operably linked in various preselected patterns.
  • "operably linked” means that the structural genes for each domain can give rise to a messenger RNA which can be translated to yield the fused ADAM protein domains. This is conveniently achieved by preparing a collection of DNA cassettes consisting essentially of the coding sequences for each domain, which cassettes are bounded by one or more restriction endonuclease sites (or cloning sites) to facilitate their manipulation in vitro using standard cloning techniques.
  • Multidomain ADAM proteins of the invention may comprise one or more heterogenous domains.
  • a heterogenous domain is one which is derived from (or corresponds to) a different ADAM to the other domain(s) with which it is associated.
  • the invention covers ADAM proteins in which some or all of the constituent domains are derived from different organisms (e.g. different species).
  • the invention also contemplates a DNA fragment or cassette consisting essentially of DNA encoding the ADAM ⁇ pro ⁇ , ADAM ⁇ met ⁇ , ADAM ⁇ dis ⁇ , ADAM ⁇ fus ⁇ , ADAM ⁇ egf ⁇ or ADAM ⁇ tmt ⁇ domain, the fragment or cassette optionally being bounded by one or more restriction endonuclease cleavage sites or cloning sites.
  • ADAM DNA cassettes are ADAM 12 DNA cassettes (for example hADAM 12 or bADAM 12 cassettes) .
  • the invention also contemplates concatenated domain cassettes, as well as mutant ADAM structural genes which have cloning sites (e.g. one or more restriction endonuclease cleavage sites) located in one or more interdomain boundary regions.
  • cloning sites e.g. one or more restriction endonuclease cleavage sites
  • the invention also embraces homologues, derivatives, muteins or equivalents of the protein (particularly the ADAM 12 protein) of the invention.
  • An example of an equivalent of the ADAM 12 protein are proteins identified by probing with hADAM 12 or jbADAM 12 nucleic acid (e.g. having a sequence corresponding to all or a portion of that shown in Fig. 2) according to techniques known to those skilled in the art.
  • hADAM 12 or bADAM 12 nucleic acid is that which corresponds to any hADAM 12 or bADAM 12 structural gene (including for example alleles or mutant forms of hADAM 12 or bADAM 12, for example nucleic acids in which nucleotide residues have been altered in the light of the codon usage in the organism being probed) .
  • homologue is used herein in two distinct senses. It is used sensu stricto to define the corresponding protein from a different organism (i.e. a species variant ) , in which case there is a direct evolutionary relationship between the protein and its homologue. This is reflected in a structural and functional equivalence, the protein and its homologue performing the same role in each organism.
  • homologue is also used herein sensu lato to define a protein which is structurally similar (i.e. not necessarily related and/or structurally and functionally equivalent) to a given (reference) protein. In this sense, homology is recognized on the basis of purely structural criteria by the presence of amino acid sequence identities and/or conservative amino acid changes (as set out by Dayoff et al. , Atlas of protein structure vol. 5, National BioMed Res Fd'n, Washington D.C, 1979).
  • homologues may be recognized as those proteins the corresponding DNAs of which are capable of specifically or selectively cross- hybridizing, or which can cross-hybridize under stringent hybridization conditions.
  • the term selectively or specifically (cross)hybridizable in this context indicates that the sequences of the corresponding ssDNAs are such that binding to a unique (or small class) of homologous sequences can be obtained under more or less stringent hybridization conditions.
  • This method of the invention is not dependent on any particular hybridization conditions, which can readily be determined by the skilled worker (e.g. by routine trial and error or on the basis of thermodynamic considerations) .
  • the homologues, derivatives, muteins or equivalents of the ADAM 12 protein of the invention have at least 20% identity with the hADAM 12 (Fig. 2) or bADAM 12 amino acid sequence.
  • the homologues, derivatives, muteins or equivalents of the individual ADAM 12 domains (or domain combinations) of the invention have at least 20% identity with the amino acid sequences of the respective hADAM 12 (Fig. 2) or bADAM 12 domains.
  • homologues, derivatives, muteins or equivalents having at least 30% identity, for example at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 98% identity with these ADAM 12 amino acid sequences .
  • homologues, derivatives, muteins or equivalents of isolated ADAM domains or domain combinations having at least 30% identity, for example at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 98% identity with the corresponding ADAM 12 domain amino acid sequences.
  • ADAM 12 protein (or individual domain) s) thereof) of the invention may have at least 25% homology with the hADAM 12
  • bADAM 12 amino acid sequence (or with the amino acid sequences or the corresponding domains) .
  • homologues, derivatives, muteins or equivalents having at least 30% homology, for example at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 98% homology with these ADAM 12 (or ADAM 12 domain) amino acid sequences.
  • Preferred homologues of the ADAM 12 protein are the bADAM 12 and hADAM 12 proteins, together with their allelic and mutant forms as well as the alternative splice pathway- derived variants.
  • the homologues, derivatives, muteins or equivalents of the invention are to be understood as applying to the entire mosaic ADAM protein as well as to its individual domains/domain subset combinations.
  • derivatives as applied herein to the proteins of the invention is used to define proteins which are modified versions of the proteins of the invention.
  • Such derivatives may include fusion proteins , in which the proteins of the invention have been fused to one or more different proteins or peptides (for example an antibody or a protein domain conferring a biochemical activity, such as enzymic or conjugative activity, to act as a label, or to facilitate purification) .
  • the derivatives may also be products of synthetic processes which use a protein of the invention (for example, an ADAM 12 protein, e.g. hADAM 12 or JbADAM 12) as a starting material or reactant.
  • a protein of the invention for example, an ADAM 12 protein, e.g. hADAM 12 or JbADAM 12
  • mutein is used herein to define proteins that are mutant forms of the proteins of the invention, i.e. proteins in which one or more amino acids have been added, deleted or substituted.
  • the muteins of the invention therefore include truncates (e.g. ADAM 12 truncates), fusion proteins (for example, fusions of the ADAM 12 protein or one or more domains thereof with another protein, such as an immunoglobulin, a peptide toxin, a receptor or enzyme) and a variety of different combinations of ADAM domains.
  • Particularly preferred truncates are those which lack the ADAM ⁇ tmt ⁇ domain.
  • proteins which comprise "shuffled” ADAM (e.g. ADAM 12) domains.
  • Such proteins are hereinafter referred to as shuffled ADAM proteins.
  • Shuffled ADAM proteins comprise or consist essentially of arrays of two or more ADAM domains (e.g. two or more cotranslated ADAM domains) in a sequence other than that found in the canonical ADAM ⁇ pro ⁇ -ADAM ⁇ met ⁇ - ADAM ⁇ dis ⁇ -ADAM ⁇ fus ⁇ -ADAM ⁇ egf ⁇ -ADAM ⁇ tmt ⁇ sequence.
  • Shuffled ADAM proteins are conveniently produced by processes involving the use of the DNA fragments or cassettes consisting essentially of DNA encoding the ADAM ⁇ pro ⁇ , ADAM ⁇ met ⁇ , ADAM ⁇ dis ⁇ , ADAM ⁇ fus ⁇ , ADAM ⁇ egf ⁇ or ADAM ⁇ tmt ⁇ domain of the invention, which may optionally be bounded by one or more restriction endonuclease cleavage sites or cloning sites.
  • the shuffled ADAM proteins may also be produced by processes involving the concatenated domain cassettes of the invention, or mutant ADAM structural genes which have cloning sites (e.g. one or more restriction endonuclease cleavage sites) located in one or more interdomain boundary regions.
  • the muteins may also include proteins in which mutations have been introduced which effectively promote or impair one or more activities of the protein, for example mutations which promote or impair the function of a catalytic site or an effector binding site.
  • the muteins of the invention may also comprise ADAM proteins in which one or more i ⁇ terdomain boundaries have been replaced with other sequences, for example with sequences encoding proteolytic cleavage sites.
  • mutant forms are truncates consisting essentially of the catalytic, binding, effector or receptor domains of the various ADAM domains. Such domains may be identified and isolated by performing mutagenesis followed by functional assay and/or by the identification of canonical or conserved sequence motifs.
  • equivalent as used herein and applied to the proteins of the invention defines proteins which exhibit substantially the same functions as those of the proteins of the invention while differing in structure (i.e. amino- acid sequence) .
  • Such equivalents may be generated for example by identifying sequences of functional importance (e.g. by identifying conserved or canonical sequences or by mutagenesis followed by functional assay) , selecting an amino acid sequence on that basis and then synthesising a peptide based on the selected amino acid sequence.
  • Such synthesis can be achieved by any of many different methods known in the art, including solid phase peptide synthesis (to generate synthetic peptides) and the assembly (and subsequent cloning) of oligonucleotides.
  • homologues, fragments, muteins, equivalents or derivatives of the proteins of the invention may also be defined as those proteins which cross-react with antibodies to the proteins of the invention, and in particular which cross-react with antibodies directed against hADAM 12 or bADAM 12 (or any particular domain thereof).
  • the ADAM proteins of the invention may be provided in the form of oligomers, tetramers, trimers, dimers or monomers.
  • the ADAM proteins of the invention are provided in the form of homotetramers, homotrimers or homodimers.
  • the ADAM proteins may also be provided in the form of heterotetramers, heterotrimers or heterodimers.
  • at least one member of the heteromeric forms is an ADAM 12 monomer (for example, in association with ADAM 11 and/or ADAM 10).
  • the invention also contemplates pharmaceutical compositions comprising any of the proteins of the invention or homologues , derivatives , muteins or equivalents thereof .
  • a pharmaceutical composition is a solid , liquid or gaseous composition in a form, concentration and level of purity suitable f or administration to an individual upon which administration it can elicit physiological changes in a patient ( e . g . to a human or animal patient ) .
  • the invention in another aspect relates to a pharmaceutical composition
  • a pharmaceutical composition comprising an ADAM protein or an isolated ADAM protein which is: (a) for use in therapy, diagnosis or prophylaxis? or (b) in a pharmaceutical excipient, a unit dosage form or in a form suitable for local or systemic administration.
  • ADAM and ADAM protein are also terms of art, and are used herein in several senses as described above. The terms therefore define inter alia a family of proteins sharing sequence similarity or homology, and include the proteins described in e.g. Wolfsberg et al. , 1995, J. Cell Biol., Vol. 131(2), pages 275-278.
  • ADAM, ADAM protein and ADAM family are used in an extended sense to correspond to the reprolysins as defined by Bjarnason and Fox (1994), Pharmac. Ther. Vol. 62, pages 325-372 and Bjarnason and Fox, Snake venom metalloendopeptidases: Reprolysins.
  • ADAM Alzheimer's alogenous metalloproteinases
  • ADAM protein and ADAM family refer to the ADAM family as defined by Wolfsberg et al. (1995), J. Cell Biol., Vol. 131(2), pages 275-278 and Wolfsberg et al. (1995), Developmental Biology, Vol. 169, pages 378-383 together with classes P-III and P-IV of the venom proteinases.
  • ADAM ADAM protein
  • ADAM family are also used herein in a narrower sense to correspond to the family defined by Wolfsberg et al. (1995), J. Cell Biol., Vol.
  • family is used herein to indicate a group of proteins which share substantial sequence similarities, either at the level of the primary sequence of the proteins themselves, or at the level of the DNA encoding them.
  • sequence similarities may extend over the entire protein/gene, or may be limited to particular regions or domains. Similarities may be based on nucleotide/amino acid sequence identity as well as similarity (for example, those skilled in the art recognize certain amino acids as similar, and identify differences based on switches of similar amino acids as conservative changes) .
  • Some members of a protein family may be related in the sense that they share a common evolutionary ancestry, and such related proteins may herein be referred to as homologues.
  • the members of a protein family do not necessarily share the same biochemical properties or biological functions, though their similarities are usually reflected in common functional features (such as effector binding sites and substrates) .
  • the criteria by which protein families are recognized are well-known in the art, and include computer analysis of large collections of sequences at the level of DNA and protein as well as biochemical techniques such as hybridization analysis and enzymatic assays (see for example Lipman and Pearson, Science, Vol. 227, pages 1435-1441).
  • isolated protein consisting essentially of: (a) ADAM ⁇ pro ⁇ ; and/or (b) ADAM ⁇ met ⁇ ; and/or (c) ADAM ⁇ dis ⁇ ? and/or (d) ADAM ⁇ fus ⁇ ; and/or (e) ADAM ⁇ egf ⁇ ; and/or (f) ADAM ⁇ tmt ⁇ , the isolated protein for example forming part of a pharmaceutical composition or for use in therapy, diagnosis or prophylaxis.
  • Preferred ADAM ⁇ dis ⁇ proteins may be identified on the basis of their ability to mediate interactions between myeloma cells, stromal cells and endothelial cells using known technology (see e.g. Myles et al (1994) PNAS USA Vol.
  • Therapeutically active ADAM ⁇ dis ⁇ domains may also be identified by testing for the ability to inhibit myeloma cell/ECM substrate adhesion using quantitative adhesion assays.
  • Myeloma cells adhere to a number of substrates including type I and IV collagen, and fibronectin when coated on 96 well plates. Adhesion of myeloma cells to these substrates can be quantitated by staining cells with propidium iodide and measuring nuclear fluorescence using a fluorescence plate reader. Synthetic peptides corresponding to the ADAM ⁇ dis ⁇ can be used in these assays to test for activity in the disruption of myeloma cell/ECM adhesion.
  • Myeloma cells are known to adhere to a number of cells including stromal cells, bone cells and possibly endothelial cells. These activities have now been discovered to be mediated by the ADAM proteins of the invention. Peptides or other compounds which inhibit adhesion can be identified by adding them to co-cultures of stromal and myeloma cells and assessing their ability to inhibit adhesion by staining with FITC labelled anti- immunoglobulin light chain antibodies and quantitated by both fluorescence microscopy and fluorescence plate reader.
  • the present invention also relates to a method of diagnosis comprising the step of detecting the expression of an ADAM gene in a selected class of cells.
  • the diagnostic method of the invention is a method of diagnosing multiple myeloma comprising the step of detecting the expression of ADAM 12 in myeloma cells.
  • ADAM genes in such diagnostic methods is preferably detected and/or measured by dual fluorescence in situ hybridization (FISH) , according to the method described in Sati et al. (1996) (the content of which is included herein by reference).
  • FISH fluorescence in situ hybridization
  • This technique comprises the steps of preparing cyto-spins of bone marrow and peripheral blood from the patient, followed by fixation, FISH processing and hybridization.
  • the hybridization may be carried out with two probes.
  • One probe is a cocktail of directly fluorescent oligonucleotides specific for the immunoglobulin light chain (enabling the detection of malignant plasma cells in a mixed cell population)
  • the other probe is specific for the ADAM gene labelled with digoxygenin and detected with anti-DIG antibody conjugated with rhodamine.
  • the isolated protein consists essentially of: (a) ADAM ⁇ pro ⁇ ; or (b) ADAM ⁇ met ⁇ ; or (c) ADAM ⁇ pro ⁇ and ADAM ⁇ met ⁇ ; or (d) ADAM ⁇ pro ⁇ , ADAM ⁇ met ⁇ and ADAM ⁇ dis ⁇ ; or (e) ADAM ⁇ met ⁇ and ADAM ⁇ dis ⁇ ; or (f) ADAM ⁇ dis ⁇ ; or (g) ADAM ⁇ egf ⁇ ; or (h) ADAM ⁇ met ⁇ and ADAM ⁇ egf ⁇ ; or (i) ADAM ⁇ met ⁇ , ADAM ⁇ dis ⁇ and ADAM ⁇ egf ⁇ ; or (j) ADAM ⁇ pro ⁇ , ADAM ⁇ met ⁇ , ADAM ⁇ dis ⁇ and ADAM ⁇ egf ⁇ , (k) ADAM ⁇ dis ⁇ and ADAM ⁇ fus ⁇ , (1) ADAM ⁇ met ⁇ , ADAM ⁇ dis ⁇ and ADAM ⁇ fus ⁇ , and may form part of a pharmaceutical composition or for use in therapy, diagnosis or prophylaxis.
  • ADAM domain combinations are functionally complementary in that the conjunction of the selected domains promotes or enables a functional interaction therebetween, as explained above in the case of the ADAM 12 domain combinations.
  • the ADAM ⁇ fus ⁇ domain preferably further comprises (e.g. occurs in the amino acid sequence context of) the cysteine repeat pattern Cys-5/6X-Cys-4X-Cys-14X- Cys-12/13X-Cys-9/10/llX-Cys-6X-Cys-4X-Cys, or a functionally equivalent repeat pattern.
  • composition comprising or consisting essentially of an inhibitor of an ADAM ⁇ met ⁇ .
  • This composition may: (a) comprise or consist essentially of an ADAM ⁇ pro ⁇ (for example the ADAM ⁇ pro ⁇ cysteine switch); or (b) comprise or consist essentially of an ADAM ⁇ egf ⁇ ; or (c) be an antibody to an ADAM ⁇ met ⁇ ?
  • alpha 2 macroglobulin or a homologue, derivative, mutein or equivalent thereof; or (n) ligand the active site Zn ion of the ADAM ⁇ met ⁇ ; or (o) be a high-cysteine subdomain of an cysteine rich region.
  • the inhibitor of the ADAM ⁇ met ⁇ domain is preferably an inhibitor of the ADAM 12 ⁇ met ⁇ domain. Particularly preferred are inhibitors of the protease activity of the ADAM ⁇ met ⁇ domain. However, the inhibitor can also be an inhibitor of other activities of the ADAM ⁇ met ⁇ , for example its effector binding activity.
  • the inhibitor may block the ability of the ADAM ⁇ met ⁇ domain to act as a sink for various molecules, for example effector molecules or substrates (for example effector molecules and/or substrates for other enzymes) .
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising or consisting essentially of an inhibitor (for example an agonist or antagonist) of an ADAM ⁇ dis ⁇ .
  • Such a composition is preferably one which: (a) is an ADAM ⁇ dis ⁇ receptor mimetic (e.g. an integrin mimetic); (b) is an ADAM ⁇ dis ⁇ receptor binding sequence mimetic (e.g. a peptide (e.g. a trimer, tetramer or pentamer) comprising or consisting essentially of the amino acid sequence ECD and/or TDE); or (c) is an antibody to an ADAM ⁇ dis ⁇ .
  • Other ADAM ⁇ dis ⁇ receptor binding sequence mimetics include peptides comprising or consisting essentially of the amino acid sequences TSE and/or ESE and/or VGP and/or EDE and/or VNE and/or KDK.
  • compositions which comprise or consist essentially of an ADAM ⁇ dis ⁇ receptor binding sequence mimetic wherein the ECD and/or TDE sequence is within a rigid disulfide loop, a cyclic peptide or associated with an ADAM ⁇ fus ⁇ , for example an ADAM ⁇ fus ⁇ which further comprises the cysteine repeat pattern Cys- 5/6X-Cys-4X-Cys-14X-Cys-12/13X-Cy ⁇ -9/10/llX-Cys-6X-Cys-4X- Cys, or a functionally equivalent repeat pattern.
  • the ADAM is preferably ADAM 12, as hereinbefore defined. Particularly preferred in this respect are the hADAM 12 and bADAM 12 proteins.
  • the domain preferably further comprises the cysteine repeat pattern Cys-5/6X-Cys-4X-Cys-14X-Cys-12/13X-Cys-9/10/llX-Cys-6X-Cys- 4X-Cys, or a functionally equivalent repeat pattern.
  • the invention also relates to an isolated ADAM interdomainase.
  • interdomainase is used herein to define a protease which cleaves (preferably specifically) an ADAM protein within a junction region between two domains thereof.
  • the junction region may define an interdomainase-specific target site.
  • interdomainases can be identified and purified for example using techniques known to those skilled in the art on the basis of their interactions with the ADAM proteins of the invention. For example, they can be identified and/or isolated by affinity chromatography and/or chemical crosslinking.
  • the interdomainase of the invention preferably cleaves at any or all of the: (a) ADAM ⁇ pro ⁇ -ADAM ⁇ met ⁇ interdomain boundary; or (b) ADAM ⁇ met ⁇ -ADAM ⁇ dis ⁇ interdomain boundary; or (c) ADAM ⁇ dis ⁇ -ADAM ⁇ fus ⁇ interdomain boundary; or (d) ADAM ⁇ fus ⁇ -ADAM ⁇ egf ⁇ interdomain boundary; or (e) ADAM ⁇ egf ⁇ - ADAM ⁇ tmt ⁇ interdomain boundary.
  • the invention also contemplates inhibitors of the interdomainase of the invention.
  • Such inhibitors are preferably peptides (e.g. peptides comprising a tetra and/or dibasic residue) consisting essentially of an interdomain amino acid sequence selected from: (a) an ADAM ⁇ pro ⁇ -ADAM ⁇ met ⁇ interdomain amino acid sequence; or (b) an ADAM ⁇ met ⁇ -ADAM ⁇ dis ⁇ interdomain amino acid sequence; or (c) an ADAM ⁇ dis ⁇ -ADAM ⁇ fus ⁇ interdomain amino acid sequence; or (d) an ADAM ⁇ fus ⁇ -ADAM ⁇ egf ⁇ interdomain amino acid sequence; or (e) an ADAM ⁇ egf ⁇ -ADAM ⁇ tmt ⁇ interdomain amino acid sequence, or functionally equivalent amino acid sequences derived therefrom or modelled thereon.
  • Such sequences act as interdomain boundary sequence mimetics, and act as interdomainase decoys in vivo.
  • the interdomainase or inhibitor of the invention is preferably for use in therapy, diagnosis or prophylaxis or provided in the form of a pharmaceutical excipient, a unit dosage form or in a form suitable for local or systemic administration.
  • the interdomainase or inhibitor of the invention is provided as a pharmaceutical composition.
  • the invention also contemplates isolated nucleic acid (for example RNA (e.g. mRNA) or DNA (e.g. cDNA) encoding the ADAM protein or interdomainase of the invention, as well as nucleic acid probes (e.g. labelled nucleic acid probes) which are selectively hybridizable therewith.
  • nucleic acid probes e.g. labelled nucleic acid probes
  • Such probes are preferably single stranded DNA or RNA probes.
  • nucleic acid As used herein and applied to nucleic acid (for example,
  • the term isolated indicates that the nucleic acid exists in a physical milieu distinct from that in which it occurs in nature.
  • the nucleic acid may be substantially isolated with respect to the complex cellular milieu in which it naturally occurs, or simply present in a different nucleic acid sequence context from that in which it occurs in nature (for example, when cloned in a vector, in the form of a restriction fragment or present in a heterologous host cell).
  • the nucleic acid (e.g. DNA) of the invention may be isolated in the sense used herein, yet present in any of a wide variety of vectors and in any of a wide variety of host cells (or other milieu, such as buffers, viruses or cellular extracts) .
  • the DNA of the present invention embraces DNA having any sequence so long as it encodes the proteins of the invention.
  • any particular amino acid sequence of the invention may be encoded by many different DNA sequences.
  • the invention also contemplates vectors (e.g. recombinant vectors) comprising the nucleic acid of the invention.
  • vectors e.g. recombinant vectors
  • the nature of the vector is not critical to the invention. Any suitable vector may be used, including plasmid, virus, bacteriophage, transposon, minichromosome, liposome or mechanical carrier.
  • the invention also embraces recombinant expression vectors, which vectors are defined herein as DNA construct used to express DNA which encodes a desired protein and which includes a transcriptional subunit comprising an assembly of: 1) genetic elements having a regulatory role in gene expression, for example, promoters and/or enhancers; 2) a structural or coding sequence which is transcribed into MRNA and translated into protein, and 3) appropriate transcription and translation, initiation and termination sequences.
  • recombinant expression vectors of the present invention can be constructed.
  • Possible vectors for use in the present invention include, but are not limited to: for mammalian cells, pJT4 (discussed further below), pcDNA-1 (Invitrogen, San Diego, CA) and pSV-SPORT 1 (Gibco-BRL, Gaithersburg, MDO; for insect cells, pBlueBac III or pBlueBacHis baculovirus vectors (Invitrogen, San Diego, CA) ; and for bacterial cells, PET-3 (Novagen, Madison, WI).
  • the DNA sequence coding for the protein of the invention e.g. an ADAM protein or an interdomainase
  • Particularly preferred for bacterial expression systems are the polymerase T7 based vectors in suitable E. coli hosts.
  • eukaryotic gene expression is the vector pcDNA3 (Invitrogen) in which transcription is under the control of the human cytomegalovirus promoter) .
  • This vector can be transformed into NSO mouse myeloma cells (with e.g. vectors having strong eukaryotic primers such as pcdna3 (Invitrogen)) according to the protocols described in e.g. Murphy and Willenbrock (1995) Methods in Enzymology Vol. 248, pages 496-510, the content of which is incorporated herein by reference.
  • the ADAM ⁇ tmt ⁇ domain is preferably removed, e.g. by site-directed mutagenesis.
  • the vector may preferably comprise an expression element or elements operably linked to the DNA of the invention to provide for expression thereof at suitable levels.
  • an expression element or elements may for example be selected from promoters, enhancers, ribosome binding sites, operators and activating sequences.
  • Such expression elements may be regulatable, for example inducible (via the addition of an inducer) .
  • operably linked refers to a condition in which portions of a linear DNA sequence are capable of influencing the activity of other portions of the same linear DNA sequence.
  • DNA for a signal peptide secretory leader
  • a promoter is operably linked to a coding sequence if it controls the transcription of the sequence
  • a ribosome binding site is operably linked to a coding sequence if it is positioned so as to permit translation.
  • operably linked means contiguous and, in the case of secretory leaders, contiguous in reading frame.
  • the vector of the invention is a viral vector, being for example based on simian virus 40, adenoviruses (e.g. human adenoviruses), retroviruses, and papillomavirus.
  • adenoviruses e.g. human adenoviruses
  • retroviruses e.g. human adenoviruses
  • papillomavirus e.g. human adenoviruses
  • the vector may further comprise a positive selectable marker and/or a negative selectable marker.
  • a positive selectable marker facilitates the selection and/or identification of cells containing the vector.
  • a host cell comprising one or more vectors of the invention.
  • Any suitable host cell may be used, including prokaryotic host cells (such as Escherichia coli and Bacillus subtilis) and eukaryotic host cells (such as mammalian cells and yeast cells).
  • Host cells may be stably transfected or transiently transfected within a recombinant expression plasmid or infected by a recombinant virus vector.
  • Other host cells include permanent cell lines derived from insects such as Sf-9 and Sf-21, and permanent mammalian cell lines such as Chines hamster ovary (CHO) and SV40- transformed African green monkey kidney cells (COS). COS cells are particularly preferred for transient expression.
  • the invention also contemplates a process for producing the protein or interdomainase of the invention comprising the steps of: (a) culturing the host cell of the invention, and (b) purifying the protein or interdomainase from the cultured host cells (e.g. from a culture supernatant or cell fraction) .
  • the invention in another aspect, relates to a process for producing the protein or interdomainase of the invention comprising the steps of: (a) probing a gene library with a nucleic acid probe which is selectively hybridizable with nucleic acid encoding the protein or interdomainase (for example having a sequence which is comprised in a gene corresponding to the sequence shown in Fig. 1), to produce a signal which identifies a gene that selectively hybridizes to the probe; and (b) expressing the gene identified in step (a) (for example by cloning into a host cell) to produce the protein.
  • Refolding, dimerization, trimerization, tetramerization and/or oxidation (e.g. in vitro or in vivo) to establish inter- and/or i ⁇ tra-molecular disulphide bonds may be necessary to obtain fully active ADAM protein (or active domains thereof). This can be achieved using standard techniques known to those skilled in the art.
  • Such recombinantly-produced ADAM protein (recombinant ADAM protein) can be produced relatively inexpensively in large quantities, and can be relatively easily purified.
  • the term selectively or specifically hybridizable indicates that the sequence of the probe is such that binding to a unique (or small class) of target sequences can be obtained under more or less stringent hybridization conditions.
  • This method of the invention is not dependent on any particular hybridization conditions, which can readily be determined by the skilled worker (e.g. by routine trial and error or on the basis of thermodynamic considerations).
  • the invention also embraces proteins obtainable by the above-described methods, as well as proteins obtained by the above-described methods.
  • vectors for altering the expression of an ADAM (e.g. ADAM 12) in vivo comprising the DNAs of the invention and/or upstream or downstream DNA.
  • ADAM e.g. ADAM 12
  • vectors are preferably formulated as pharmaceutical compositions.
  • the invention in another aspect, relates to a method for screening for therapeutically active drugs comprising the steps of: (a) contacting a candidate drug with the ADAM protein or interdomainase of the invention, and (b) determining whether binding between the candidate drug and protein/interdomainase occurs, wherein binding is indicative of a therapeutically active drug.
  • the method described above is useful for screening large numbers of drug candidates for therapeutic activity.
  • the method is employed in high throughput screening of drug candidates.
  • Drug candidates identified by the method of the invention can be further modified or used directly as therapeutic drug candidates to activate or inhibit the natural functions of the protein in vivo.
  • the invention relates to a method for evaluating the therapeutic activity of a drug comprising the steps of: (a) contacting a candidate drug with the ADAM protein or the interdomainase of the invention, and (b) measuring the binding affinity of the candidate drug for the protein or interdomainase.
  • the protein used in the screening and evaluation methods of the invention comprises an ADAM ⁇ met ⁇ (e.g. ADAM 12 ⁇ met ⁇ ) and the drug evaluated is preferably an inhibitor of an ADAM ⁇ met ⁇ domain.
  • ADAM ⁇ met ⁇ e.g. ADAM 12 ⁇ met ⁇
  • the drug evaluated is preferably an inhibitor of an ADAM ⁇ met ⁇ domain.
  • the invention also relates to a method for synthesizing a therapeutically active drug comprising the steps of: (a) generating a three-dimensional model of the active site (e.g. the catalytic or ligand binding site) of the ADAM protein or interdomainase of the invention (e.g. by computer analysis of its amino-acid sequence and/or by X ray crystallography of the protein/interdomainase or fragment thereof), and (b) modelling the drug with reference to the three-dimensional model generated in step (a), the drug for example being an inhibitor of an ADAM ⁇ met ⁇ and the protein comprising an ADAM ⁇ met ⁇ (e.g. ADAM 12 ⁇ met ⁇ ) .
  • a three-dimensional model of the active site e.g. the catalytic or ligand binding site
  • the ADAM protein or interdomainase of the invention e.g. by computer analysis of its amino-acid sequence and/or by X ray crystallography of the protein/interdomainase or fragment thereof
  • the three-dimensional model is generated by computer analysis of the amino-acid sequence of all or a portion of the proteins (or individual domains) of the invention (for example the ADAM ⁇ met ⁇ domain).
  • the three-dimensional model could be generated by X ray crystallography of the protein (or domains, fragments or derivatives thereof), or by NMR techniques. These techniques could also be applied to the protein-substrate/effector complex, the results of which could also be used as the basis for the rational design of therapeutic agents.
  • a three-dimensional model can be generated on the basis of comparisons with the related or similar reprolysin crystal structures which are known in the art.
  • the invention also embraces therapeutically active drugs which have been screened, evaluated or synthesised by the methods of the invention.
  • the invention relates to an antibody (e.g. a monoclonal antibody) which binds (preferably specifically) to the ADAM protein or interdomainase of the invention.
  • the invention relates to a test kit comprising the protein or interdomainase of the invention, for example for use in the methods of the invention.
  • the protein is bound to a solid support and/or
  • the kit further comprises a labelled (e.g. radiolabelled or fluorescently labelled) protein substrate, receptor or ligand and/or (iii) the kit further comprises the antibody of the invention.
  • the invention also relates to a nucleic acid probe which is selectively hybridizable with the DNA of the invention.
  • selectively hybridizable indicates that the sequence of the probe is such that binding to a unique (or small class) of target sequences can be obtained under more or less stringent hybridization conditions.
  • the nucleic acid probe is selectively hybridizable with (for example having a sequence which is comprised in) a gene corresponding to that shown in Fig. 2.
  • the protein of the invention may be labelled, for example with a flourescent label, a radioisotope or an enzyme. Such labelled proteins may be particularly suitable for use in the test kits of the invention.
  • test kits comprising the protein of the invention.
  • Such kits are useful, for example, in the screening and evaluating methods of the invention.
  • the protein comprised in the kits of the invention are preferably bound to a solid support and may conveniently include a labelled (e.g. radioactively-labelled) substrate (for example for use in competitive binding assays or in displacement assays) .
  • antibodies which bind to the protein of the invention are also contemplated by the invention.
  • Such antibodies can be prepared by employing standard techniques well known to those skilled in the art, using any of the proteins of the invention or individual domains/fragments thereof as antigens for antibody production. These antibodies can be employed for diagnostic applications, therapeutic applications, and the like. Preferably for therapeutic applications, the antibodies are monoclonal antibodies.
  • the antibodies of the invention may advantageously bind specifically to the proteins of the invention.
  • Antibodies specific for the catalytic or effector sites of the various domains of the proteins of the invention may act as substrate/effector mimetics. Specific binding may be exploited in imaging techniques, for example to assess the extent to which the ADAM proteins are active or their distribution in vivo. They may also be used to identify and isolate further embodiments of the proteins of the invention.
  • the invention also contemplates antibody derivatives, including antibody fragments (e.g. Fab fragments), chimaeric antibodies (including humanized antibodies) and antibody derivatives (such as fusion derivatives comprising an antibody-derived variable region and a non- immunoglobulin peptide having for example enzyme or conjugative activity) .
  • antibody fragments e.g. Fab fragments
  • chimaeric antibodies including humanized antibodies
  • antibody derivatives such as fusion derivatives comprising an antibody-derived variable region and a non- immunoglobulin peptide having for example enzyme or conjugative activity
  • the invention also contemplated mimetics (for example, the antibodies of the invention described above) , agonists and antagonists of the proteins of the invention.
  • the medicaments, pharmaceutical compositions and drugs of the invention finds application in various forms of therapy, prophylaxis and diagnosis.
  • These medicaments, pharmaceutical compositions and drugs can be administered in a clinical setting by intraperitoneal, intramuscular, intravenous, or subcutaneous injection, implant or transdermal modes of administration, and the like.
  • the invention finds application in the therapy, prophylaxis and/or diagnosis of disorders or diseases of connective tissue, disorders or diseases of the skeletal system (e.g. bone), inflammatory diseases or disorders (for example asthma), cancer (e.g. multiple myeloma), coagulopathies (e.g. thrombo-embolic disorders), haemorrhagic disorders or diseases and amyloidosis (e.g. Alzheimer's disease) .
  • skeletal system e.g. bone
  • inflammatory diseases or disorders for example asthma
  • cancer e.g. multiple myeloma
  • coagulopathies e.g. thrombo-embolic disorders
  • haemorrhagic disorders or diseases and amyloidosis e.g. Alzheimer's disease
  • connective tissue is used herein in a broad sense to embrace coUagenous (including cartilaginous) tissues.
  • Cartilage consists of chondrocytes surrounded by an extracellular matrix.
  • the matrix is a mesh of type II collagen fibrils in which proteoglycan aggregates (aggrecan) are trapped. Damage to one or both of these molecules results in major changes in cartilage function.
  • aggrecan proteoglycan aggregates
  • a major feature of the pathology is the loss of joint function due to erosion of articular cartilage.
  • Destruction of collagen and aggrecan is mediated by proteolytic enzymes produced by either the chondrocytes themselves (in osteoarthritis) or by cells which have infiltrated the joint during the disease process (rheumatoid arthritis).
  • Aggrecan degradation is mediated by an aggrecanase, which produces a characteristic cleavage between E 373 and A 374 of the aggrecan molecule.
  • the cleavage sites are shown below:
  • hADAM 12 and MLQE.AVRQ bADAM 12 cleavage site. Releases ADAM ⁇ met ⁇ and ADAM ⁇ dis ⁇ .
  • ADAMs 10, 11 and 12 exhibit aggrecanase activity, are expressed in chondrocytes and are responsible for destruction of aggrecan in e.g. arthritides and emphysema (especially atrophic emphysema and inherited emphysema) .
  • the disorder or disease treated, diagnosed or prevented is: (a) that requiring regulation of aggrecan degradation (e.g. the regulation of aggrecanase activity) ; or (b) that requiring the regulation of cartilage breakdown; or (c) that requiring the prevention or reduction of cartilage breakdown; or (d) arthritides, for example osteoarthritis or rheumatoid arthritis.
  • aggrecan degradation e.g. the regulation of aggrecanase activity
  • cartilage breakdown e.g. the regulation of cartilage breakdown
  • arthritides for example osteoarthritis or rheumatoid arthritis.
  • connective tissue disorders which may be treated or prevented by the drugs of the invention include giant-cell arteritis, polyarteritis nodosa, polymyalgia rheumatica, polymyositis and systemic lupus erythematosus .
  • Drugs e.g. inhibitors and interdomainases/interdomainase inhibitors as hereinbefore described
  • ADAM 10 ADAM 11
  • ADAM12 are particularly preferred in the treatment or prophylaxis of disorders or diseases of connective tissue.
  • osteoporosis f or example postmenopausal osteoporosis
  • Paget ' s disease metastatic bone disease or myeloma associated bone disease
  • the ADAM ⁇ met ⁇ domain is involved in the degradation of the bone matrix , particularly of the unmineralized matrix that protects bone f rom uncontrolled resorption .
  • inhibitors of the ADAM ⁇ met ⁇ domain may be used to prevent degradation of the bone matrix and/or the unmineralized matrix and so reduce bone resorption .
  • ADAM ⁇ met ⁇ inhibitors or those of the cognate interdomainase ( s ) responsible for activating ADAM ⁇ met ⁇ ) form the basis of a new class of anti-resorptive drugs .
  • ADAM ⁇ dis ⁇ domain mediates adhesion of osteoclasts and osteoblasts to bone and to the ECM.
  • inhibitors of the ADAM ⁇ dis ⁇ domain may be used to prevent adhesion of osteoclasts and osteoblasts to bone and to the ECM.
  • ADAM ⁇ dis ⁇ inhibitors or those of the cognate interdomainase(s) responsible for activating ADAM ⁇ dis ⁇ form the basis of a new class of anti-resorptive drugs.
  • the ADAM ⁇ dis ⁇ domain is involved in the prevention of adhesion of osteoclasts and osteoblasts to bone and the
  • ADAM ⁇ dis ⁇ or ADAM ⁇ dis ⁇ activators form the basis of a new class of anti-resorptive drugs.
  • the ADAM ⁇ fus ⁇ domain is involved in the fusion of osteoclast precursors to form multinucleated osteoclasts.
  • inhibitors of the ADAM ⁇ fus ⁇ domain may be used to prevent osteoclast fusion and so reduce osteoclast-mediated bone resorption.
  • ADAM ⁇ fus ⁇ inhibitors, inhibitors or activators of the interdomainase(s) responsible for activating (e.g. releasing from a membrane) ADAM ⁇ fus ⁇ or the interdomainases per se form the basis of a new class of anti-resorptive drugs.
  • ADAM ⁇ fus ⁇ domain is also involved in myoblast fusion to form the muscular syncytium.
  • ADAM ⁇ fus ⁇ inhibitors, inhibitors or activators of the interdomainase( s ) responsible for activating (e.g. releasing from a membrane) ADAM ⁇ fus ⁇ or the interdomainases per se may be used to regulate muscle development, e.g. in the treatment or prophylaxis of various myasthenias (including inflammatory muscle disorders such as myopathies and vascular muscle disorders such as polymyositis) .
  • ADAM ⁇ fus ⁇ domain is also involved in the fusion of giant cells.
  • ADAM ⁇ fus ⁇ inhibitors, inhibitors or activators of the interdomainase(s) responsible for activating (e.g. releasing from a membrane) ADAM ⁇ fus ⁇ or the interdomainases per se may be used to regulate giant cell development e.g. in the treatment or prophylaxis of giant-cell arteritis.
  • ADAM ⁇ fus ⁇ domain is also involved in neuronal development.
  • ADAM ⁇ fus ⁇ inhibitors, inhibitors or activators of the interdomainase(s) responsible for activating (e.g. releasing from a membrane) ADAM ⁇ fus ⁇ or the interdomainases per se may be used to regulate neuronal development.
  • ADAM ⁇ fus ⁇ domain is also involved in fertility, including implantation in utero.
  • ADAM ⁇ fus ⁇ inhibitors, inhibitors or activators of the interdomainase(s) responsible for activating (e.g. releasing from a membrane) ADAM ⁇ fus ⁇ or the interdomainases per se also find application in fertility treatment, contraception and abortion.
  • the inflammatory diseases with which the present invention is concerned may be characterized by cell infiltration and the secretion of proinflammatory cytokines (for example, rheumatoid arthritis is characterized by the entry of macrophages into the joint space) .
  • proinflammatory cytokines for example, rheumatoid arthritis is characterized by the entry of macrophages into the joint space
  • Proinflammatory cytokines include interleukin l ⁇ (IL-l ⁇ ) and tumour necrosis factor ⁇ (TNF ⁇ ) . Both of these cytokines are synthesised as precursors and are processed by proteinases to give mature soluble form by proteolytic shedding mechanisms (explained in more detail below). For example, IL-l ⁇ is processed by a cysteine proteinase known as ICE (IL-l ⁇ converting enzyme). Soluble forms of the TNF ⁇ receptor are also processed by proteinases.
  • ICE IL-l ⁇ converting enzyme
  • the invention finds particular application in relation to inflammatory and/or allergic disorders or diseases, for example those mediated by proinflammatory cytokines and/or by cell (e.g. macrophage) infiltration.
  • the invention finds application in the treatment or prophylaxis of inflammation attendant on infection, trauma, graft rejection, autoimmune disorders, psoriasis and diseases of the peripheral and central nervous sytem.
  • the invention may also be used in the treatment or prophylaxis of scleroderma (preferably together with adjunctive therapy) and other skin diseases.
  • Drugs e . g . those defined in the claims including inter alia inhibitors and interdomainases /interdomainase inhibitors as hereinbefore described
  • ADAM 8 interdomainase inhibitors
  • the drugs of the invention are used in the treatment or prophylaxis of allergic disorders , inflammatory diseases , systemic tissue damage and/or apoptosis by administration in an amount sufficient to regulate , promote or reduce membrane protein shedding (which process is described in more detail below) .
  • the drugs of the present invention may be used in the treatment or prophylaxis of cancer.
  • Preferred modes of cancer therapy, prophylaxis or diagnosis according to the invention include the detection or prevention of tumour progression or the detection or prevention of tumour metastasis.
  • tumour cells undergo uncontrolled proliferation which may be stimulated by local growth factors and cytokines.
  • myeloma cells grow in response to interleukin-6 (IL-6), which binds the IL-6 receptor to produce a signal which is transduced through gpl30.
  • IL-6 interleukin-6
  • the soluble form of IL-6 receptor appears unique in that it binds IL-6 but still retains the capacity to stimulate signal transduction thereby acting as an agonist (rather that an antagonist, as is the case with other soluble receptors) of its cognate cytokine.
  • the soluble IL- 6R is shed from cell membranes by proteolytic cleavage from the cell surface, and the ADAM proteins of the invention are involved in this (and other) shedding processes.
  • the drugs of the invention may be used to inhibit or prevent tumour progression by inhibiting cytokine-mediated tumour stimulation at the level of proteolytic shedding of membrane bound cytokines or receptors (e.g. membrane-bound IL-6 receptor) .
  • cytokine-mediated tumour stimulation at the level of proteolytic shedding of membrane bound cytokines or receptors (e.g. membrane-bound IL-6 receptor) .
  • the invention also finds application in the treatment or prophylaxis of metastatic disease which characterizes the terminal stages of most malignancies.
  • Tumour metastasis involves loss of adhesion with and shedding from the primary tumour, degradation of the basement membrane components and migration into the blood supply.
  • ADAM ⁇ met ⁇ domain promotes metastasis by assisting basement membrane cleavage and so promoting tumour cell extravasation.
  • inhibitors of ADAM ⁇ met ⁇ (or inhibitors of the ADAM ⁇ met ⁇ -releasing interdomainase(s) ) may be used to prevent or reduce basement membrane cleavage and so reduce or eliminate metastasis.
  • ADAM ⁇ met ⁇ inhibitors (or those of the cognate interdomainase(s) responsible for activating ADAM ⁇ met ⁇ ) may form the basis of a new class of anticancer drugs.
  • Particularly preferred is the treatment or prophylaxis of ovarian metastasis, choriocarcinoma and trophoblast tumours .
  • ADAM ⁇ dis ⁇ domain is involved in the loss of cell-cell and cell-matrix adhesion necessary for the metastasis of solid tumours.
  • inhibitors of ADAM ⁇ dis ⁇ may be used to promote or maintain cell-cell and/or cell-matrix adhesion and so reduce or eliminate metastasis.
  • ADAM ⁇ dis ⁇ inhibitors (or those of the cognate interdomainase(s) responsible for activating ADAM ⁇ dis ⁇ ) may form the basis of a new class of anticancer drugs.
  • ADAM ⁇ dis ⁇ domain is involved in cell-cell and cell- matrix adhesion necessary to prevent metastasis of solid tumours.
  • ADAM ⁇ dis ⁇ or ADAM ⁇ dis ⁇ activators such as the cognate interdomainase(s) responsible for activating ADAM ⁇ dis ⁇
  • ADAM ⁇ dis ⁇ activators may be used to maintain cell-cell and/or cell- matrix adhesion and so reduce or eliminate metastasis.
  • myeloma This is a B cell neoplasm resulting in clonal expansion of the plasma cell compartment.
  • Myeloma cells are found in the bone marrow where they may represent as many as 90% of the mononuclear cells. They interact with cells of the bone marrow microenvironment, disrupting normal haemopoesis and causing neutropenia, anaemia, bone destruction and hypercalcemia.
  • malignant plasma cells exit the bone marrow and are found in the peripheral blood in a disease known as plasma cell leukaemia.
  • ADAM family including ADAM 12
  • ADAM ⁇ met ⁇ proteins are involved in the degradation of the extracellular matrix observed in multiple myeloma.
  • ADAM ⁇ dis ⁇ domain is involved in the loss of cell-cell and cell-matrix adhesion necessary for the progression to plasma-cell leukaemia.
  • inhibitors of ADAM ⁇ dis ⁇ may be used to promote or maintain cell-cell and/or cell-matrix adhesion and so reduce or eliminate progression to plasma- cell leukaemia.
  • ADAM ⁇ dis ⁇ inhibitors (or those of the cognate interdomainase( s) responsible for activating ADAM ⁇ dis ⁇ ) may form the basis of a new class of drugs for the treatment or prophylaxis of multiple myeloma.
  • ADAM ⁇ dis ⁇ domain is involved in cell-cell and cell- matrix adhesion necessary to prevent progression to plasma- cell leukaemia.
  • ADAM ⁇ dis ⁇ or ADAM ⁇ dis ⁇ activators such as the cognate interdomainase(s) responsible for activating ADAM ⁇ dis ⁇
  • ADAM ⁇ dis ⁇ activators may be used to maintain cell-cell and/or cell-matrix adhesion and so reduce or eliminate progression to plasma-cell leukaemia.
  • ADAM ⁇ met ⁇ domain promotes degradation of the extracellular matrix in multiple myeloma.
  • inhibitors of ADAM ⁇ met ⁇ may be used to prevent or reduce degradation of the matrix.
  • ADAM ⁇ met ⁇ inhibitors or those of the cognate interdomainase(s) responsible for activating ADAM ⁇ met ⁇ may form the basis of a new class of drugs for the treatment or prophylaxis of multiple myeloma.
  • Drugs e.g. inhibitors and interdomainases/interdomainase inhibitors as hereinbefore described
  • ADAM 11 MDC
  • ADAM12 ADAM 11
  • the drugs of the present invention may be used in the treatment or prophylaxis of various coagulopathies.
  • the ADAM ⁇ met ⁇ or the appropriate ADAM ⁇ met ⁇ - releasing interdomainases may be used to interfere with coagulation. This may be applied in the treatment or prophylaxis of disseminated intravascular coagulation (DIC) or in other diseases associated with intravascular coagulation, such as meningococcal meningitis.
  • DIC disseminated intravascular coagulation
  • meningococcal meningitis other diseases associated with intravascular coagulation
  • the ADAM ⁇ met ⁇ or the appropriate ADAM ⁇ met ⁇ -releasing interdomainases may also be used as fibrinolytic agents, for example to disperse blood clots (e.g. in the treatment or prophylaxis of thrombosis) .
  • ADAM ⁇ dis ⁇ or the appropriate ADAM ⁇ dis ⁇ -releasing interdomainases may also be used to promote clotting, e.g. in the treatment or prophylaxis of haemophilia or thrombocytopenia.
  • the ADAM ⁇ dis ⁇ or the appropriate ADAM ⁇ dis ⁇ -releasing interdomainases may also be used to prevent platelet aggregation, which can lead to occlusive platelet plugs. This finds particular application in the manufacture of vascular grafts, the luminal surface of which can be coated with the ADAM ⁇ dis ⁇ of the invention to prevent platelet aggregation thereon.
  • amyloidosis relates to a collection of etiologically unrelated diseases characterized by protein deposition in tissues arising as the end result of aberrant protein processing.
  • Alzheimer's disease is one important example of such a disease.
  • An aberrant proteolytic cleavage event is thought to be associated with amyloidosis in Alzheimer's, and the ADAM ⁇ met ⁇ inhibitors of the present invention may be used to reduce or prevent this aberrant processing.
  • the invention in another aspect, relates to methods of regulating, promoting or reducing a variety of biochemical processes. Such methods may be used to control or treat a number of different diseases or disorders.
  • the invention relates to methods of regulating, promoting or reducing: (a) membrane protein shedding or processing; (b) ADAM processing; (c) cell-cell adhesion, contact or communication (e.g. juxtacrine stimulation, as described by Massague (1990) J. Biol. Chem. Vol. 265, pages 21393-21396); (d) aggrecan degradation, e.g. via the regulation, promotion or reduction of aggrecanase activity; (e) the degradation of basement membrane components (e.g. type IV collagen and/or fibronectin) ; (f) osteoclast precursor fusion, and (g) collagen type II degradation and/or removal.
  • a) membrane protein shedding or processing e.g. juxtacrine stimulation, as described by Massague (1990) J. Biol. Chem. Vol. 265, pages 21393-21396
  • aggrecan degradation e.g. via the regulation, promotion or reduction of aggrecanase activity
  • the degradation of basement membrane components
  • soluble isoforms Many proteins exist as membrane-bound and soluble isoforms and the function of the protein may differ dramatically according to its state.
  • One important mechanism for the generation of a soluble isoform from a membrane-bound precursor is proteolytic cleavage, which results in "shedding" of the soluble isoform from the membrane. This mechanism can be used to rapidly change the phenotype of a cell, to simultaneously remove a surface protein while creating a soluble isoform (there being a functional synergy between these two events) and to meet a need for a rapid switch from a local to a systemic distribution of a given protein (such as a cytokine).
  • ADAM proteins of the invention are involved in the proteolytic shedding of membrane proteins. This discovery can be exploited in the design of drugs which regulate, promote or reduce proteolytic shedding in the treatment, diagnosis and prophylaxis of a wide range of different diseases and disorders which arise from dysfunctions in membrane protein shedding dynamics.
  • the membrane protein may be a receptor, a receptor ligand, a cell adhesion molecule, a leukocyte antigen or an ectoenzyme.
  • Particularly preferred receptors are cytokine receptors, for example a receptor for any one of TNF, IL-6, CSF-1, NGF, EGF and GH.
  • Other preferred receptors include those for transferrin, poly-Ig and folate.
  • Particularly preferred receptor ligands are cytokines (e.g. lymphokines or monokines) or growth factors, for example any one of Steel factor, TNF (e.g. TNF ⁇ ), TGF- ⁇ , CSF-1 Fas ligand (FasL) , or c-kit ligand.
  • cytokines e.g. lymphokines or monokines
  • growth factors for example any one of Steel factor, TNF (e.g. TNF ⁇ ), TGF- ⁇ , CSF-1 Fas ligand (FasL) , or c-kit ligand.
  • the invention finds application in the treatment or prophylaxis of fever, shock (e.g. septic and endotoxic shock), cachexia and cerebral malaria.
  • shock e.g. septic and endotoxic shock
  • cachexia e.g. cachexia and cerebral malaria.
  • the Fas ligand is a member of the tumour necrosis family. It induces apoptosis in Fas-bearing cells.
  • the membrane- bound FasL is converted into the soluble form (sFasL) by ADAM ⁇ met ⁇ .
  • sFasL soluble form
  • ADAM ⁇ met ⁇ inhibitors or the appropriate ADAM ⁇ met ⁇ -releasing interdomainase inhibitors may be used to regulate (e.g.
  • ADAM ⁇ met ⁇ inhibitors or the appropriate ADAM ⁇ met ⁇ -releasing interdomainase inhibitors of the invention may also be used in the treatment or prophylaxis of patients having high levels of sFasL in their serum (e.g. neutropenic or hepatocompromized individuals) .
  • the ADAM ⁇ met ⁇ inhibitors or the appropriate ADAM ⁇ met ⁇ -releasing interdomainase inhibitors of the invention find application in the treatment or prophylaxis of various diseases that are accompanied with systemic tissue destruction or apoptosis.
  • ADAM ⁇ met ⁇ inhibitors or the appropriate ADAM ⁇ met ⁇ -releasing interdomainase inhibitors of the invention may also find application in the treatment or prophylaxis of AIDS.
  • Particularly preferred cell adhesion molecules include gp 100, Leu 8, ELAM-1, GMP-140, glycoprotein lb and neural cell adhesion molecule (NCAM) .
  • leukocyte antigens include immunoglobulin, CD8 , class I MHC, IL 2 receptor, IL 4 receptor, CD16, CD23 and CD14.
  • Particularly preferred ectoenzymes include angiotensin- converting enzyme (ACE) , NEP 24.11, DPIV, sialyltransferase, D ⁇ M, carboxypeptidase H and cholinesterase.
  • ACE angiotensin- converting enzyme
  • NEP 24.11 NEP 24.11
  • DPIV sialyltransferase
  • D ⁇ M carboxypeptidase H
  • cholinesterase particularly preferred ectoenzymes
  • membrane proteins include gp55 or VSV glycoprotein, amyloid precursor protein (APP), ⁇ -glycan, syndecan, DAF, VSG, CEA, prion protein, the Mcl-14 neutrophil adhesion protein or GP-2.
  • the drugs of the present invention e.g. inhibitors of ADAM ⁇ met ⁇ and of the ADAM ⁇ met ⁇ -releasing interdomainase(s)
  • ACE angiotensin-converting enzyme
  • the invention also contemplates an in vitro method of diagnosis (e.g. of multiple myeloma) comprising the step of detecting the expression of an ADAM gene (e.g. ADAM 12) in a selected class of cells (e.g. in myeloma cells).
  • an ADAM gene e.g. ADAM 12
  • a selected class of cells e.g. in myeloma cells.
  • the ADAM ⁇ met ⁇ of the invention may also be used in wound debridement (e.g. following burn injury) .
  • the invention may also be used to regulate angiogenesis, neovascularization (e.g. of tumours), vascular proliferation in the eye and diabetes angiopathy.
  • ADAM ⁇ met ⁇ on various cell surface receptors may be exploited in the treatment or prophylaxis of various parasitic diseases which involve the interaction of parasite and receptor (e.g. malaria and diseases caused by trypanosomes, leishmania or amoebae) .
  • the drug of the invention is used to prevent the interaction of the parasite with its cognate cellular receptor.
  • Figure 1 shows the sequence of the full length cDNA for hADAM 12.
  • Figure 2 shows the predicted hADAM 12 protein sequence for the full length hADAM 12 cDNA. Highlighted areas identify the hADAM 12 ⁇ pro ⁇ domain (1) , cysteine switch (2), the hADAM 12 ⁇ met ⁇ domain (3), the hADAM 12 ⁇ egf ⁇ domain (4) and hADAM 12 ⁇ tmt ⁇ domain (5). The hADAM 12 ⁇ dis ⁇ domain is underlined.
  • Figure 3 shows in schematic form the domain structure of hADAM 12, including the metalloproteinase domain (hADAM 12 ⁇ met ⁇ ), the disintegrin-like domain (hADAM 12 ⁇ dis ⁇ ), a cysteine-rich region, an epidermal growth factor-like domain (hADAM 12 ⁇ egf ⁇ , stippled) and a putative transmembrane sequence (hADAM 12 ⁇ tmt ⁇ , TMT) , with a transmembrane subdomain shown as a solid bar.
  • hADAM 12 ⁇ met ⁇ the metalloproteinase domain
  • hADAM 12 ⁇ dis ⁇ disintegrin-like domain
  • cysteine-rich region a cysteine-rich region
  • hADAM 12 ⁇ egf ⁇ , stippled an epidermal growth factor-like domain
  • hADAM 12 ⁇ tmt ⁇ , TMT putative transmembrane sequence
  • Figure 4 shows an alignment of protein sequences from hADAM 12, atrolysin-E (ATR-E, reprolysin), HRIB (reprolysin), PH- 30 ⁇ , PH-30 ⁇ , EAP1, MDC and MS2.
  • FIG 5 shows an alignment of the disintegrin-like region. conserveed cysteine residues and ECD motif are highlighted. Bitistatin (Bit) is included in this line up to identify the disintegrin domain. The position of the RGD sequence in bitistatin is underlined.
  • the human myeloma cell lines, U266-B1, HS-Sultan, ARH-77 and RPMI-8226 were obtained from the European Collection of Animal Cell Cultures (Porton Down, UK) . All cell lines were maintained in RPMI 1640 (Life technologies) supplemented with 10% foetal calf serum (Life technologies) .
  • RNA was reversed transcribed to cDNA using MMLV reverse transcriptase primed with random hexamers (Pharmacia).
  • the PCR Primers used to amplify TIMP-3 were 5' ATCACCTGGGTCATATGTGCAAGATCAAG 3' and 5 ' GATTCTCAGGGGTCTGTGGCATTGATG 3 ' .
  • Products of the PCR reaction were electrophoresed on a 1.5% agarose gell in Tris-Borate-EDTA (TBE) . Amplified products were excised and extracted from the gel using the Wizard DNA purification system (Promega) . Purified DNA was cloned into a pCRTMII vector (Invitrogen) following the manufacturers protocol.
  • DNA sequencing was performed using a Sequenase Kit (USB Biochemicals) using synthetic oligonucleotide primers. Sequenced products were electrophoresed on an 8% denaturing acrylamide gel.
  • RNA 15 ⁇ m was electrophoresed on a 1% agarose- formaldehyde gel, transferred to a positively charged nylon membrane (Boehringer Mannheim) by capillary blotting and fixed by UV crosslinking (Stratalinker, Stratagene).
  • a human placental cDNA library (Stratagene) was plated according to manufacturers instructions and screened with cDNAs identified from the EST database. IO 7 individual clones were screened by filter hybridisation on Hybond N (Amersham) . Overlapping positive clones were isolated, amplified and used as templates for DNA sequencing analysis.
  • Overlapping cDNAs were isolated from a human placental library by screening with HII999 and the DNA sequenced. A total of 3.5kbp of cDNA was isolated by this method. The predicted protein sequence for the full length cDNA is shown in Figure 2. The sequence encompasses an open reading frame of 2.2kbp with an inferred 3' untranslated region (UTR) of approximately 1.6kbp. This agrees with the Northern analysis indicating that the full length cDNA for this protein is likely to have been cloned. Thus, a novel human mRNA was identified whose potential translation products contain a number of characteristics in common with the class III reprolysins.
  • hADAM 12 has significant amino acid similarity to a number of mammalian proteins with a variety of functions. These include ADAM 8 (MS2), a cell surface antigen of approximately 89kD, expressed in the murine macrophage lineage. This shows significant identity with hADAM 12; however, the authors omitted to identify the characteristic zinc binding motif characteristic of the metalloproteinases. hADAM 12 also has significant identity with both subunits of ADAM 2 (PH-30), which is an heterodimeric protein implicated in sperm-egg fusion. The ⁇ subunit contains the consensus zinc-binding motif which aligns with hADAM 12, whereas, the ⁇ subunit, although not containing this region, contains a disintegrin-like sequence which also shares considerable identity with hADAM 12.
  • ADAM 8 MS2
  • PH-30 is an heterodimeric protein implicated in sperm-egg fusion.
  • the ⁇ subunit contains the consensus zinc-binding motif which aligns with hADAM 12, whereas,
  • ADAM 7 epididymis of a number of mammalian species.
  • This protein has also been proposed to contain a metalloproteinase domain; however, on the basis of the presented sequence it is unlikely to be catalytically active since it lacks the glutamic acid residue within the zinc-binding motif.
  • ADAM 7 also contains a disintegrin-like domain with similarity to hADAM 12.
  • ADAM 11 (or MDC), a recently described tumour suppressor gene, shown to be somatically rearranged in primary breast cancer, also shows significant similarities to hADAM 12.
  • This protein was also suggested to contain a metalloproteinase domain; however, the presented sequence does not appear to contain a characteristic zinc-binding motif, although it does contain a putative cysteine switch and may represent a member of a novel class of zinc-binding metalloproteinases.
  • Example 2 Cloning of bADAM 12
  • Chondrocytes were isolated following collagenase digestion of cartilage explants cut from fresh tissue. Culture conditions were as published in Buttle et al. (1993) Arthritis Rheum 36, pages 1709-1717.
  • RNA was reversed transcribed to cDNA using MMLV reverse transcriptase primed with random hexamers (Pharmacia) .
  • the PCR Primers used were based upon the human ADAM sequence.
  • DNA sequencing was performed using a Sequenase Kit (USB Biochemicals) using synthetic oligonucleotide primers. Sequenced products were electrophoresed on an 8% denaturing acrylamide gel.
  • the partial sequence was determined to comprise the nucleotide sequence:

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Cell Biology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne des protéines ADAM 12, des variantes de l'espèce, des homologues, des formes allèles, des formes mutantes, des dérivés, des mutéines et certains de leurs équivalents. L'invention concerne également différents domaines spécifiques des protéines ADAM 12, différentes combinaisons de domaines, certains de leurs inhibiteurs et différentes formes de thérapies, de diagnostics et de prophylaxies ayant recours à ces domaines. L'invention concerne en outre différentes applications thérapeutiques, diagnostiques et prophylactiques des protéines de la famille ADAM (reprolysine) en général, ainsi que leurs différents domaines, combinaisons de domaines, inhibiteurs et autres matériels les faisant intervenir.
PCT/GB1997/001067 1996-04-19 1997-04-16 Proteines adam et leur utilisation WO1997040072A2 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
AU25727/97A AU2572797A (en) 1996-04-19 1997-04-16 Adam proteins and uses thereof
EP97917346A EP0894132A2 (fr) 1996-04-19 1997-04-16 Proteines adam et leur utilisation

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB9608130.2A GB9608130D0 (en) 1996-04-19 1996-04-19 Adam proteins and uses thereof
GB9608130.2 1996-04-19

Publications (2)

Publication Number Publication Date
WO1997040072A2 true WO1997040072A2 (fr) 1997-10-30
WO1997040072A3 WO1997040072A3 (fr) 1998-03-26

Family

ID=10792345

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB1997/001067 WO1997040072A2 (fr) 1996-04-19 1997-04-16 Proteines adam et leur utilisation

Country Status (4)

Country Link
EP (1) EP0894132A2 (fr)
AU (1) AU2572797A (fr)
GB (1) GB9608130D0 (fr)
WO (1) WO1997040072A2 (fr)

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0933423A1 (fr) * 1996-02-23 1999-08-04 Mochida Pharmaceutical Co., Ltd. Meltrines
WO2000002912A2 (fr) * 1998-07-10 2000-01-20 Zymogenetics, Inc. Homologues de disintegrine
WO2001009293A2 (fr) * 1999-08-03 2001-02-08 Zymogenetics, Inc. Peptides proteases a adhesion mammalienne (mapp)
US6265199B1 (en) 1998-07-10 2001-07-24 Zymogenetics, Inc. Disintegrin homologs
DE10337368A1 (de) * 2003-08-08 2005-03-03 Technische Universität Dresden Verfahren und Mittel zur Diagnose und Behandlung von Pankreastumoren
WO2005071387A1 (fr) 2004-01-09 2005-08-04 Children's Medical Center Coporation Methodes de diagnostic et de pronostic de cancers d'origine epitheliale
WO2005100596A1 (fr) * 2004-04-19 2005-10-27 Guy's & St Thomas' Nhs Foundation Trust Marqueurs de diagnostic pour l'arthrose
WO2006014903A2 (fr) * 2004-07-27 2006-02-09 Five Prime Therapeutics, Inc. Compositions et techniques d'utilisation d'antagonistes adam12 dans le traitement de maladie
WO2006017386A2 (fr) * 2004-08-02 2006-02-16 Elan Pharmaceuticals, Inc. Intermédiaires de signalisation dans un modèle in vitro de la maladie d'alzheimer
US7226596B2 (en) 1999-07-28 2007-06-05 Genentech, Inc. Compositions and methods for the treatment of tumors
GB2453589A (en) * 2007-10-12 2009-04-15 King S College London Protease inhibition
WO2010078411A1 (fr) 2008-12-30 2010-07-08 Children's Medical Center Corporation Procédé de prédiction d'une appendicite aiguë
WO2011024146A2 (fr) * 2009-08-28 2011-03-03 Institut Pasteur Inhibiteurs d'adam12 et leur utilisation contre une fibrose induite par inflammation
WO2011069093A1 (fr) 2009-12-04 2011-06-09 Boston Biomedical Research Institute, Inc. Détection et dénombrement de cellules souches spécifiques d'un tissu et utilisations associées
US8012947B2 (en) 2007-03-15 2011-09-06 Hospital For Special Surgery Methods and compositions for promoting wound healing
WO2014078713A1 (fr) * 2012-11-15 2014-05-22 Feldman Brian Jay Modulation de la distribution de muscle et d'adipocytes et de leur devenir
EP3366695A1 (fr) 2009-12-17 2018-08-29 Children's Medical Center, Corp. Peptides dérivés de la saposine-a et leurs utilisations
EP3560509A1 (fr) 2011-12-22 2019-10-30 Children's Medical Center Corporation Peptides dérivés de la saposine-a et leurs utilisations
WO2020006273A1 (fr) * 2018-06-27 2020-01-02 Juvena Therapeutics, Inc. Polypeptides associés à l'héparine et leurs utilisations
EP3666284A1 (fr) 2007-06-22 2020-06-17 Children's Medical Center, Corp. Procédés et utilisations d'un fragment de saposine a

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114569709B (zh) * 2022-05-05 2022-07-12 苏州慧疗生物医药科技有限公司 高表达adam-28的黑色素瘤自体肿瘤疫苗的制备方法及其应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995035118A1 (fr) * 1994-06-20 1995-12-28 Merck & Co., Inc. Vaccin contraceptif

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995035118A1 (fr) * 1994-06-20 1995-12-28 Merck & Co., Inc. Vaccin contraceptif

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
ARI-PEKKA J. HUOVILA ET AL: "ADAMs and cell fusion" CURRENT OPINION IN CELL BIOLOGY, vol. 8, no. 5, October 1996, pages 692-699, XP002044203 *
E. WU ET AL: "expression of members of the novel membrane linked Metalloproteinase family ADAM in cells derived from a range of haematological malignancies" BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS., vol. 235, no. 2, 18 June 1997, ORLANDO, FL US, pages 437-442, XP002044205 *
N. MCKIE ET AL: "Cloning of a novel membrane-linked metalloproteinase from human myeloma cells" BIOCHEMICAL JOURNAL, vol. 318, no. 2, 1 September 1996, pages 459-462, XP002044202 *
N. MCKIE ET AL: "Expression of Members of a novel Membrane linked Metalloproteinase family (ADAM) in human articular chondrocytes" BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS., vol. 230, no. 2, 13 January 1997, ORLANDO, FL US, pages 335-339, XP002044204 *
S. YOSHIDA ET AL: "Molecular cloning of cDNA encoding MS2 antigen, a novel surface antigen strongly expressed in murine monocytic lineage" INTERNATIONAL IMMUNOLOGY, vol. 2, no. 6, June 1990, pages 585-591, XP002044200 *
T.G. WOLSBERG ET AL: "ADAM, a novel family of membrane proteins containing A Disintegrin And Metalloprotease domain : Multipotential functions in cell-cell and matrix interactions" JOURNAL OF CELL BIOLOGY, vol. 131, no. 2, October 1995, THE ROCKEFELLER UNIVERSITY PRESS, pages 275-278, XP002044201 cited in the application *
WESKAMP G ET AL: "MDC9, A WIDELY EXPRESSED CELLULAR DISINTEGRIN CONTAINING CYTOPLASMIC SH3 LIGAND DOMAINS" THE JOURNAL OF CELL BIOLOGY, vol. 132, no. 4, February 1996, pages 717-726, XP000644308 *

Cited By (45)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7060791B2 (en) 1996-02-23 2006-06-13 Mochida Pharmaceutical Co., Ltd. Meltrins
EP0933423A4 (fr) * 1996-02-23 2000-12-20 Mochida Pharm Co Ltd Meltrines
EP0933423A1 (fr) * 1996-02-23 1999-08-04 Mochida Pharmaceutical Co., Ltd. Meltrines
US7605226B2 (en) 1996-02-23 2009-10-20 Mochida Pharmaceutical Co., Ltd. Meltrins
WO2000002912A2 (fr) * 1998-07-10 2000-01-20 Zymogenetics, Inc. Homologues de disintegrine
US6265199B1 (en) 1998-07-10 2001-07-24 Zymogenetics, Inc. Disintegrin homologs
WO2000002912A3 (fr) * 1998-07-10 2001-09-07 Zymogenetics Inc Homologues de disintegrine
US7135317B2 (en) 1998-07-10 2006-11-14 Zymogenetics, Inc. Polynucleotides encoding disintegrin homologs, and related products
US7226596B2 (en) 1999-07-28 2007-06-05 Genentech, Inc. Compositions and methods for the treatment of tumors
WO2001009293A2 (fr) * 1999-08-03 2001-02-08 Zymogenetics, Inc. Peptides proteases a adhesion mammalienne (mapp)
WO2001009293A3 (fr) * 1999-08-03 2001-08-16 Zymogenetics Inc Peptides proteases a adhesion mammalienne (mapp)
DE10337368A1 (de) * 2003-08-08 2005-03-03 Technische Universität Dresden Verfahren und Mittel zur Diagnose und Behandlung von Pankreastumoren
EP1709421A1 (fr) * 2004-01-09 2006-10-11 Children's Medical Center Corporation Methodes de diagnostic et de pronostic de cancers d'origine epitheliale
JP4847873B2 (ja) * 2004-01-09 2011-12-28 チルドレンズ メディカル センター コーポレーション 上皮起源の癌を診断および予後診断するための方法
AU2005207318B2 (en) * 2004-01-09 2012-02-02 Children's Medical Center Corporation Methods for diagnosis and prognosis of cancers of epithelial origin
JP2007519903A (ja) * 2004-01-09 2007-07-19 チルドレンズ メディカル センター コーポレーション 上皮起源の癌を診断および予後診断するための方法
EP1709421A4 (fr) * 2004-01-09 2008-08-13 Childrens Medical Center Methodes de diagnostic et de pronostic de cancers d'origine epitheliale
WO2005071387A1 (fr) 2004-01-09 2005-08-04 Children's Medical Center Coporation Methodes de diagnostic et de pronostic de cancers d'origine epitheliale
WO2005100596A1 (fr) * 2004-04-19 2005-10-27 Guy's & St Thomas' Nhs Foundation Trust Marqueurs de diagnostic pour l'arthrose
WO2006014903A3 (fr) * 2004-07-27 2006-04-20 Five Prime Therapeutics Inc Compositions et techniques d'utilisation d'antagonistes adam12 dans le traitement de maladie
WO2006014903A2 (fr) * 2004-07-27 2006-02-09 Five Prime Therapeutics, Inc. Compositions et techniques d'utilisation d'antagonistes adam12 dans le traitement de maladie
US7674597B2 (en) 2004-08-02 2010-03-09 Elan Pharmaceuticals, Inc. Signaling intermediates in an in vitro model of Alzheimer's disease
WO2006017386A2 (fr) * 2004-08-02 2006-02-16 Elan Pharmaceuticals, Inc. Intermédiaires de signalisation dans un modèle in vitro de la maladie d'alzheimer
WO2006017386A3 (fr) * 2004-08-02 2006-08-10 Elan Pharm Inc Intermédiaires de signalisation dans un modèle in vitro de la maladie d'alzheimer
US8012947B2 (en) 2007-03-15 2011-09-06 Hospital For Special Surgery Methods and compositions for promoting wound healing
EP3666284A1 (fr) 2007-06-22 2020-06-17 Children's Medical Center, Corp. Procédés et utilisations d'un fragment de saposine a
US9546198B2 (en) 2007-10-12 2017-01-17 Cancer Research Technology Limited Cyclic peptides as ADAM protease inhibitors
GB2453589A (en) * 2007-10-12 2009-04-15 King S College London Protease inhibition
US10472393B2 (en) 2007-10-12 2019-11-12 Cancer Research Technology Limited Method for inhibiting ADAM proteases with cyclic peptides
EP3913367A1 (fr) 2008-12-30 2021-11-24 Children's Medical Center Corporation Procédé de prédiction d'une appendicite aiguë
WO2010078411A1 (fr) 2008-12-30 2010-07-08 Children's Medical Center Corporation Procédé de prédiction d'une appendicite aiguë
EP3032258A1 (fr) 2008-12-30 2016-06-15 Children's Medical Center Corporation Procédé de prédiction d'une appendicite aiguë
EP3358351A1 (fr) * 2009-08-28 2018-08-08 Institut Pasteur Inhibiteurs d'adam12 et leur utilisation contre la fibrose induite par inflammation
US9777276B2 (en) 2009-08-28 2017-10-03 Institut Pasteur ADAM12 inhibitors and their use against inflammation-induced fibrosis
WO2011024146A3 (fr) * 2009-08-28 2011-06-16 Institut Pasteur Inhibiteurs d'adam12 et leur utilisation contre une fibrose induite par inflammation
WO2011024146A2 (fr) * 2009-08-28 2011-03-03 Institut Pasteur Inhibiteurs d'adam12 et leur utilisation contre une fibrose induite par inflammation
US10961536B2 (en) 2009-08-28 2021-03-30 Institut Pasteur ADAM12 inhibitors and their use against inflammation-induced fibrosis
WO2011069093A1 (fr) 2009-12-04 2011-06-09 Boston Biomedical Research Institute, Inc. Détection et dénombrement de cellules souches spécifiques d'un tissu et utilisations associées
EP3366695A1 (fr) 2009-12-17 2018-08-29 Children's Medical Center, Corp. Peptides dérivés de la saposine-a et leurs utilisations
EP3925670A1 (fr) 2009-12-17 2021-12-22 Children's Medical Center, Corp. Peptides dérivés de la saposine-a et leurs utilisations
EP3560509A1 (fr) 2011-12-22 2019-10-30 Children's Medical Center Corporation Peptides dérivés de la saposine-a et leurs utilisations
EP4306123A2 (fr) 2011-12-22 2024-01-17 Children's Medical Center Corporation Peptides dérivés de la saposine-a et leurs utilisations
US9950043B2 (en) 2012-11-15 2018-04-24 The Board Of Trustees Of The Leland Stanford Junior University Modulation of muscle and adipocyte distribution and fate
WO2014078713A1 (fr) * 2012-11-15 2014-05-22 Feldman Brian Jay Modulation de la distribution de muscle et d'adipocytes et de leur devenir
WO2020006273A1 (fr) * 2018-06-27 2020-01-02 Juvena Therapeutics, Inc. Polypeptides associés à l'héparine et leurs utilisations

Also Published As

Publication number Publication date
AU2572797A (en) 1997-11-12
GB9608130D0 (en) 1996-06-26
WO1997040072A3 (fr) 1998-03-26
EP0894132A2 (fr) 1999-02-03

Similar Documents

Publication Publication Date Title
WO1997040072A2 (fr) Proteines adam et leur utilisation
Spriggs et al. Recombinant human CD40 ligand stimulates B cell proliferation and immunoglobulin E secretion.
Black et al. Substrate specificity and inducibility of TACE (tumour necrosis factor α-converting enzyme) revisited: the Ala-Val preference, and induced intrinsic activity
JP4102441B2 (ja) 単離された線維芽細胞活性化タンパク質アルファ二量体、およびその使用
US5656728A (en) Human ostoclast-specific and -related genes
Wei et al. Expression and enzymatic activity of human disintegrin and metalloproteinase ADAM19/meltrin beta
EP0830130B9 (fr) Enzyme de conversion du facteur de necrose tumorale alpha
JP4854174B2 (ja) ＮＦ−κＢの受容体活性化剤のアゴニストまたはアンタゴニストのスクリーニングアッセイ法
US6403304B1 (en) Human osteoclast-specific and -related DNA sequences
WO1998003651A9 (fr) Sequences d'adn specifique des osteoclastes ou associe a ceux-ci, d'origine humaine
EP1234025B1 (fr) Enzymes humaines de la famille des metalloproteases
EP1476545A2 (fr) Molecules d'aggrecanase
AU2003207795A1 (en) Aggrecanase molecules
US20090247605A1 (en) Treating diseases mediated by metalloprotease-shed proteins
WO2004009797A2 (fr) Molecules de modification et d'entretien de proteines
KR100496001B1 (ko) 폴리펩티드의제조방법
Willmroth et al. A matrix metalloproteinase gene expressed in human T lymphocytes is identical with collagenase 3 from breast carcinomas
US6664383B1 (en) Polypeptides, cDNA encoding the same and utilization thereof
AU750038B2 (en) Testis-specific human SVPH1-8 proteinase
WO2003100016A2 (fr) Molecules de modification et de maintenance de proteines
EP1105485B1 (fr) Adn humain il-1 epsilon et polypeptides
CA2428319C (fr) Compositions et methodes de diagnostic ou de traitement du psoriasis
AU2003215070A1 (en) Truncated aggrecanase molecules
WO2003083084A2 (fr) Molecules de modification et d'entretien de proteines
US7074616B1 (en) Mouse CXC chemokine receptor

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH HU IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TR TT UA UG US UZ VN YU AM AZ BY KG KZ MD RU TJ TM

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH KE LS MW SD SZ UG AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 1997917346

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1997917346

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

NENP Non-entry into the national phase in:

Ref country code: JP

Ref document number: 97537821

Format of ref document f/p: F

NENP Non-entry into the national phase in:

Ref country code: CA

WWW Wipo information: withdrawn in national office

Ref document number: 1997917346

Country of ref document: EP