WO1997039132A1 - Preparations stabilisees de troponines humaines et modifications de ces troponines, procedes diagnostiques de dosage et trousses de dosage - Google Patents

Preparations stabilisees de troponines humaines et modifications de ces troponines, procedes diagnostiques de dosage et trousses de dosage Download PDF

Info

Publication number
WO1997039132A1
WO1997039132A1 PCT/US1997/006147 US9706147W WO9739132A1 WO 1997039132 A1 WO1997039132 A1 WO 1997039132A1 US 9706147 W US9706147 W US 9706147W WO 9739132 A1 WO9739132 A1 WO 9739132A1
Authority
WO
WIPO (PCT)
Prior art keywords
troponin
protein
glu
lys
ala
Prior art date
Application number
PCT/US1997/006147
Other languages
English (en)
Other versions
WO1997039132A9 (fr
Inventor
James D. Potter
Original Assignee
University Of Miami
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University Of Miami filed Critical University Of Miami
Priority to AU26671/97A priority Critical patent/AU2667197A/en
Publication of WO1997039132A1 publication Critical patent/WO1997039132A1/fr
Publication of WO1997039132A9 publication Critical patent/WO1997039132A9/fr

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6887—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids from muscle, cartilage or connective tissue
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4716—Muscle proteins, e.g. myosin, actin
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • the invention relates generally to human and mammalian troponin proteins and assay methods and components employing them. More specifically, the invention provides stable aqueous and lyophilized preparations of troponin proteins characterized by low pH, as well as modified troponin proteins, fusion proteins and complexes, which are suitable for use as a calibrator/control standards in diagnostic assays for the detection of disorders or diseases characterized by damage to heart or skeletal muscle and for other research uses.
  • Troponins are proteins located on the actin thin filament of vertebrate skeletal and cardiac muscles.
  • Troponin is a complex of three subunits: troponin-C (TnC) is the calcium binding component; troponin-I (Tnl) is the inhibitory subunit; and troponin-T is the protein which locates the complex on the tropomyosin complex.
  • Cardiac and skeletal isoforms of Tnl are similar in their sequences. The cardiac isoform differs substantially from its skeletal counterpart in possessing a 30-33 amino acid, species dependent N terminal extension. Previously these proteins were purified from heart or skeletal muscle. However, recently, genes for cardiac isoforms of Tnl, TnC and TnT have been cloned and sequenced [Armour, K.L.
  • Troponin proteins have previously been cloned, expressed and purified from an E. coli expression •vectors [see, e.g., Al-Hillawi, E. et al , 1994, Eur. J. Biochem., 225:1195-1201] .
  • the troponin proteins have been proposed as biochemical markers for diseases and disorders of the heart and skeletal muscles, because these proteins alone or in complex are released into the plasma when the cardiac or skeletal muscles are damaged, such as in acute myocardial infarction, among other diseases.
  • such proteins have been proposed to replace the present serum biochemical marker of choice for the diagnosis of AMI, the MB isoform of creatine Kinase [See, e.g., Adams, J.E. et al , 1993, Circul., £8 ⁇ :750-763; Mangano, D. T.,
  • Buffered aqueous solutions of cTnl are stable for months at -80°C; however, this temperature requirement is not feasible for routine clinical laboratory use.
  • fusion proteins containing HcTnl as part of the molecule have been designed.
  • Armour et al fused HcTnl to ⁇ -galactosidase in an effort to increase expression of the troponin in a bacterial system.
  • Hayden et ai cited above, evaluated the solubility properties of an HcTnl-CKS fusion protein, but found no increase in the solubility of the fusion protein, but rather aggregates of the fusion protein in the initial crude extracts from bacterial culture.
  • compositions including stable and soluble troponin preparations for use as calibrators and controls in clinical assays for troponin levels in patients.
  • Desirably such compositions would be stable over conventional conditions of storage and transport.
  • the invention provides an assay for measuring the level of a mammalian, preferably human, troponin protein in a patient sample.
  • the assay includes the step of comparing the level in the sample with a novel troponin protein standard.
  • the novel standard is a stable aqueous, acid- dialyzed solution of a troponin protein, the solution having a pH between about 2 and about 5.
  • the standard is a stable dry composition of a lyophilized acid-dialyzed solution of a troponin protein, the solution having a pH between about 2 and about 5.
  • the standard is reconstitutable to a stable liquid form by the addition of water, without the addition of any salt.
  • the invention provides an assay kit for measuring the level of a mammalian, preferably human, troponin protein in a patient sample.
  • this kit contains as its human troponin protein standard or calibrator a novel composition.
  • the novel composition is a stable aqueous, acid-dialyzed solution of a troponin protein, the solution having a pH between about 2 and about 5.
  • the novel calibrator is a stable dry composition comprising the lyophilized acid- dialyzed solution of a troponin protein, the solution having a pH between about 2 and about 5, the standard reconstitutable to a stable liquid form by the addition of water.
  • the invention provides a stable aqueous, acid-dialyzed solution of a mammalian troponin protein having a pH between about 2 and about 5.
  • the troponin protein may be a mammalian troponin isoform, or a functional fragment thereof, a modified troponin protein or functional fragment thereof containing, e.g., an amino or carboxy terminal modification; a troponin protein or functional fragment thereof fused at its amino or carboxy terminus to a selected peptide or protein; a heterodimeric troponin complex or a heterotrimeric troponin complex.
  • the invention provides a stable liquid composition suitable for assay calibrations comprising the solutions described above and a protein- based matrix comprising plasma components and stabilizers.
  • the invention provides a lyophilized dry composition formed from the acid-dialyzed solutions described above, including that containing a matrix, the composition reconstitutable to a stable liquid form by the addition of water and in the absence of salt.
  • modified troponin protein which is a full-length or functional fragment of the troponin comprising at its amino or carboxy terminus a selected peptide, the modified protein having a pi lower than of an unmodified troponin protein.
  • the modified troponins of this invention may be dialyzed or lyophilized as described above.
  • the invention provides a troponin fusion protein comprising a full-length or functional fragment of a troponin protein fused at its amino or carboxy terminus to a selected protein partner, the fusion protein having a pi lower than that of an unfused troponin protein.
  • fusion proteins may be dialyzed or lyophilized as described above.
  • the invention provides a hetero-multimeric troponin protein complex.
  • This complex may be dialyzed or lyophilized as described above.
  • the complex may contain individual mammalian troponin proteins or functional fragments which are recombinant or native troponins, cardiac or skeletal troponins, and the members of the complex may originate from different mammalian species or different tissues from the same or different mammalian species. Similarly, each member of the complex may be a different isoform of the same troponin, or modified troponins or fusion proteins.
  • the complex may be a heterodimer or a heterotrimer.
  • the complex may be dialyzed or lyophilized as described above.
  • the invention provides a process for producing a stable aqueous solution of a human troponin protein.
  • the process includes first dialyzing the protein against a suitable acid in a concentration sufficient to provide an acid/protein solution with a pH between about 2 and about 5.
  • the troponin protein may be a mammalian troponin, a functional fragment of a mammalian troponin, a modified troponin protein or functional fragment thereof as described above, a troponin fusion protein as described above or a hetero-multimeric troponin complex as described above.
  • the invention provides a process for producing a water-reconstitutable, lyophilized composition comprising a mammalian troponin protein.
  • This process includes the dialyzing step of the preceding process and a lyophilizing step, which results in a lyophilized composition which is reconstitutable in water in the absence of salt.
  • Fig. 1 is a photograph of a sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) demonstrating the banding patterns of human cardiac troponin I, Lane 1; human cardiac troponin I containing a carboxy terminal 5 histidine-6 lysine-1 aspartate modified tail, (HcTnI-K 6 -H 5 -D) Lane 2; human cardiac troponin I- parvalbumin fusion protein (HcTnl-Pv) Lane 3; and human cardiac troponin I-human cardiac troponin C fusion protein (HcTnl-HcTnC) Lane 4.
  • SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis
  • Fig. 2 is a photograph of an SDS-PAGE gel illustrating the banding patterns of bacterial lysates of cultures co-expressing HcTnC and HcTnl. Lanes 1 and 2 are lysates of bacteria expressing troponin I and C together from the same plasmid.
  • Lane 3 is a lysate of the BL-21 (DE3)pLysS host bacteria that do not contain a plasmid as a comparison to the expressing host lysates in lanes 1 and 2.
  • the bands representing troponin I and troponin C are indicated in the figure as Tnl and TnC respectively.
  • Fig. 3 is a photograph of an SDS-PAGE gel demonstrating the co-elution of HcTnl and HcTnC from DEAE Sephacel. The co-elution demonstrates the formation of a complex of the two troponin subunits, as HcTnl will not bind to the anion exchanger DEAE as an isolated subunit but will only do so when complexed with TnC.
  • Lane 1 is the sample before loading on the column.
  • Lane 2 FT is the flow-through.
  • Lane 3, W is the column wash.
  • Lane 4, STD is the HcTnl, HcTnC standard.
  • Lane 5 is fraction 20 from the column. Subsequent lanes are labeled with the appropriate fraction number.
  • Lanes labeled F25 and F30 show the correct stoichiometry for the two subunits when complexed as visualized on Coomassie blue stained SDS gels. The next lane marked F35 shows the elution of some complex along with excess free HcTnC (uncomplexed) .
  • Fig. 4 is a photograph of a Western blot confirming the presence of HcTnl in fractions 25-45. Lanes correspond to the lanes in the SDS-PAGE gel of Fig. 3: lane 1 is flow through, lane 2 is wash, lane 3 is Tnl standard, lanes 4-10 are fractions 18, 24, 30, 35, 40, 45 and 50, respectively.
  • Primary antibody was a monoclonal antibody (mAb) raised against recombinant HcTnl designated 2A7-1E7, subclass IgG 2a . See Example 13.
  • Fig. 5 is a photograph of an SDS-PAGE gel demonstrating the integrity of isoform 3 of HcTnT (HcTnT 3 ) at three temperatures and as liquid or lyophilized samples. All samples were dialyzed, according to the invention, before storage. Lane 1 is a sample of a previous lot of recombinant HcTnT stored at -20°C shown as a comparison for the lot used for the stability study.
  • Lane 2 is HcTnT stored as a liquid at ambient temperature; Lane 3 is HcTNT stored as a lyophilized powder at ambient temperature and reconsti ⁇ tuted in the same volume of distilled water just prior to running the gel. Lane 4 is HcTnT stored as a liquid at 4°C; Lane 5 is HcTnT stored as a lyophilized powder at 4°C and reconstituted as above. Lane 6 is HcTnT stored as a liquid at 20°C. Lane 7 is HcTnT stored as a lyophilized powder at -20°C and reconstituted as above. Lane 8 is an untreated aliquot of HcTnT.
  • Lane 9 illustrates molecular weight markers of 107,000, 76,000, 52,000, 36,800, 27,200 and 19,000 daltons. See Example 11.
  • Fig. 6 is a Western blot demonstrating the presence of HcTnC, HcTnl and HcTnT expressed from the same plasmid.
  • a commercially available antibody against TnC, 1A7 (Biodesign International, ME), the mAb 2A7-1E7, and a goat polyclonal antibody raised against bovine cardiac TnT were used simultaneously as primary antibody.
  • Lane 1 large culture of troponin complex (Tn) expressed in BL-21 (DE3)pLysS host; Lane 2: large culture of Tn expression in BL-21 (DE3) ; Lane 3: small culture of Tn expressed in BL- 21 (DE3); Lane 4: HcTnT standard; Lane 5: prestained molecular weight standards.
  • Tn troponin complex
  • Fig. 7 is a photograph of an SDS-PAGE gel showing the presence of all troponin subunits after dialysis against either lmM HCl according to this invention or against 5 mM ammonium bicarbonate.
  • Lane 1 HcTnl/HcTnC complex dialyzed against ammonium bicarbonate
  • Lane 2 HcTnT/HcTnl/HcTnC complex dialyzed against ammonium bicarbonate
  • Lane 3 Tnl/TnC complex dialyzed against HCl
  • Lane 4 TnT/Tnl/TnC complex dialyzed against HCl
  • Lane 5 spill over, no sample
  • Lane 6 TnT/Tnl/TnC standard
  • Lane 7 TnC standard
  • Lane 8 Tnl standard
  • Lanes 9 and 10 TnT standards.
  • Fig. 8 is a photograph of an SDS-PAGE gel showing the stability of the troponin complexes after storage.
  • Lanes 1-4 represent samples stored as lyophilized complexes.
  • Lane 1 HcTnl/HcTnC complex dialyzed against ammonium bicarbonate and lyophilized for storage.
  • Lane 2 Tnl/TnC complex dialyzed against HCl according to the invention and lyophilized for storage.
  • Lane 3 HcTnT/HcTnl/HcTnC complex dialyzed against ammonium bicarbonate and lyophilized for storage.
  • Lane 4 TnT/Tnl/TnC complex dialyzed against HCl according to this invention and lyophilized.
  • Lane 5 TnT/Tnl/TnC standard.
  • Lane 6 TnT standard
  • Lane 7 Tnl/TnC complex dialyzed against ammonium bicarbonate and kept as liquid for storage
  • Lane 8 Tnl/TnC complex dialyzed against HCl according to this invention and kept as liquid for storage
  • Lane 9 TnT/Tnl/TnC complex dialyzed against ammonium bicarbonate and kept as liquid for storage
  • Lane 10 TnT/Tnl/TnC complex dialyzed against HCl according to this invention and kept as liquid for storage.
  • the present invention meets the needs in the art for soluble compositions of mammalian, preferably human, troponin molecules which are stable under a variety of conditions on storage.
  • Stable liquid solutions of substantially pure, mammalian troponins are provided by this invention, as well as stable lyophilized compositions of troponin which may be readily reconstituted in aqueous medium in the absence of urea or salt.
  • the invention also provides methods of employing these stable solutions and preparations of troponins in assays formats, preferably immunoassays for the diagnosis and detection of damage to heart and skeletal muscle.
  • stable means that the solution or composition retains substantially all of its activity or immunogenicity over a wide range of temperature conditions and for up to about 60 days.
  • the invention provides a stable aqueous, acid-dialyzed solution of a mammalian troponin protein having a pH between about 2 and about 5.
  • troponin solutions are unexpectedly soluble in the absence of the urea or high salt concentrations considered necessary by the prior art to solubilize troponin protein solutions.
  • the aqueous acid-protein solutions of the invention contain no substantial amounts of urea or salt, because these compounds are removed during dialysis.
  • the solutions of this invention are stable under conventional reagent storage temperatures of between about 25 °C to about -80°C. The solutions are stable under such temperatures for periods of up to 60 days.
  • the stable, low ionic solutions of troponin proteins according to this invention are desirably prepared by dialyzing a selected troponin protein against a suitable acid in a concentration sufficient to provide the resulting aqueous acid/protein solution with a pH between about 2 and about 5.
  • the pH of the resulting aqueous acid-protein is between about 2 and about 4; and most desirably, a pH of about 3 or 4.
  • the conditions of dialysis can be variable depending upon the number and frequency of changes in dialysis solutions. As disclosed in detail below, in one example the solution was dialyzed four times against four liters of ImM HCl at 4°C over two days with a change in solution every six hours. However, such conditions which are sufficient to acheive exchange of the contaminants and salts in solutions for the acid may be readily selected by those of skill in the art, and do not limit the practice of this invention.
  • a troponin solution of this invention is prepared by dialyzing the selected troponin protein with hydrochloric acid in a concentration of 1 mM, resulting in a pH of 3. Human cardiac troponin I is particularly useful in such a stable, soluble low ionic solution.
  • the solutions may be mixed into another stable liquid composition suitable for immunoassay calibrations or preferably for use as controls in certain assays, by mixing the solutions described above with protein-based matrices comprising known and commercially available plasma components and stabilizers.
  • the troponin proteins which may be contained in the stable solutions described above include naturally- occurring or recombinant troponin proteins alone, as well as naturally occurring or recombinant troponin proteins in modified form, or in complexes with other troponin proteins.
  • solutions according to this aspect of the invention include dialyzed solutions of mammalian, preferably human, troponin proteins which are naturally occurring and are isolated from a selected tissue, such as cardiac tissue or skeletal tissue.
  • recombinant troponin proteins or functional fragments of such proteins may be stabilized into solutions according to this invention.
  • functional fragment as used herein means a portion of the complete protein sequence of the troponin molecule which portion retains the immunogenicity and immunoreactivity of the complete native protein.
  • Solutions of this invention include, e.g., cardiac or skeletal troponin I, troponin C or troponin T, various isoforms of such proteins, or functional fragments thereof.
  • modified troponins are modified troponin proteins having a pi lower than that of said unmodified troponin protein.
  • Modified troponins may contain a carboxy terminal modification, including troponin proteins or functional fragments thereof which are fused at the carboxy terminus to a selected peptide or protein. Alternatively, similar modifications may be made to the
  • modified troponin molecules are described in detail below.
  • These low ionic strength, stable and soluble solutions of the invention may also contain a heterodimeric troponin complex or a heterotrimeric troponin complex formed by, e.g., the association of troponins T, I and C, or a complex in which each troponin protein or functional fragment in said multimer differs from the other members of the multimer by tissue source, species origin, or isoform.
  • tissue source e.g., species origin, or isoform.
  • illustrative dialyzed troponin solutions of this invention are soluble, stable on storage, retain the immunoreactivity of the native troponin molecule (e.g., HcTnl) by reactivity with antibodies raised to native HcTnl.
  • Example 6 below specifically demonstrates that troponin protein solutions dialyzed against ImM HCl from high salt and urea solutions according to this invention unexpectedly show no loss of solubility as demonstrated by a lack of precipitate present in the dialysate.
  • Example 6 also compares total protein before and after dialysis according to this invention by densitometry on SDS-PAGE gels to demonstrate the stability of the solutions of this invention.
  • the dialyzed troponin protein solutions described above may also be provided in a dry composition.
  • the dialyzed solutions of the invention may be lyophilized, or freeze-dried, by conventional methods.
  • the selected troponin compound is dialyzed against an acidic solution to produce a low ionic strength solution consisting essentially of the protein without any substantial amounts of either urea or salt.
  • the dialysis step removes salts and other materials (i.e. urea) that can crystallize or otherwise interfere with lyophilization of the protein.
  • the lyophilized compositions are stable on storage in the lyophilized form.
  • the dry troponin composition may be reconstituted in an aqueous medium, preferably distilled water, also without the addition of urea or high salt, previously believed essential to maintaining the solubility of a troponin protein.
  • the reconstituted troponin protein compositions are stable on storage and, when reconstituted in water, demonstrate substantially no loss of function in an immunoassay.
  • the dialyzed troponin protein solutions of the invention may be lyophilized and stored under various conditions.
  • dialyzed, lyophilized troponin compositions of the invention proteins are stored at 25° to -80°C, or at room temperature, and completely reconstituted in distilled water to a low ionic strength solution.
  • the lyophilized compositions have been shown to be stable over time under the described conditions.
  • the examples further demonstrate that no loss of protein occurs during reconstitution, demonstrating complete solubility under the described conditions.
  • all of the troponin proteins were able to be lyophilized and reconstituted with minimal loss of protein concentration as judged on SDS-PAGE gels either visually or by densitometry.
  • the lyophilized and reconstituted troponin molecules have not lost the immunogenicity of the native molecule.
  • immunoreactivities of lyophilized troponin preparations are compared with that of native human cardiac troponin I using a specific monoclonal antibody and a conventional ELISA in Example 6 and the immunoreactivities of the compositions of this invention are found to be identical with that of the native protein.
  • a modified troponin protein is a full-length or functional fragment of a troponin having an increased polarity compared to that of the unmodified troponin.
  • modified troponin bears on its carboxy terminus a peptide, which is a sequence of amino acid residues having a higher polarity that than of unmodified troponin.
  • Another such modified troponin has a similar modification on its amino terminus.
  • amino acids have high polarities, e.g., including inter alia, histidine, asparatic acid.
  • amino acids have high polarities, e.g., including inter alia, histidine, asparatic acid.
  • amino acids with high polarities e.g., including inter alia, histidine, asparatic acid.
  • amino acids with high polarities e.g., including inter alia, histidine, asparatic acid.
  • amino acids with high polarities e.g., including inter alia, histidine, asparatic acid.
  • amino acids with high polarities e.g., including inter alia, histidine, asparatic acid.
  • amino acids with high polarities e.g.
  • Another modified troponin which is stable under a variety of storage conditions, even when the modified troponin is not in a stable dialyzed solution or lyophilized composition described above is a troponin modified by adding to the carboxy terminus of the protein a sequence of 6 lysines, 5 histidines and 1 aspartic acid. See, particularly, Example 2, which teaches HcTnI-K 6 -H s -D. Still another particular example of a stable carboxy terminal modification of a troponin molecule is prepared by adding to the carboxy terminus of the protein a sequence comprised of three alternating histidines and three alternating leucines. See, Example 3, which teaches HcTnl- (HL) 3 .
  • Any number of similar peptides may be used to modify a troponin (naturally occurring, isolated from tissue or recombinant) to have an increased polarity or to modify the troponin at the carboxy or amino terminus.
  • Such peptides may be designed by one of skill in the art from among known amino acids with high polarities and introduced onto the amino or carboxy terminus of mammalian, preferably human, troponins e.g., Tnl, TnC or TnT, by recombinant techniques or by chemical cross- linking methods known to those of skill in the art.
  • the troponins so modified may be derived from a variety of mammalian tissues, or prepared recombinantly. Similarly, such modified troponins may also be dialyzed into stable solutions as described above, and/or lyophilized as described above.
  • a second type of modified troponin useful according to the present invention is a troponin fusion protein which is made up of a full-length or functional fragment of a selected troponin protein fused at its carboxy or amino terminus to a selected protein partner, the resulting fusion protein having a pi lower than that of the unfused troponin protein.
  • Unfused or unmodifed troponin has a pi of about 7-8.
  • one such fusion protein desirably has the selected troponin, i.e., Tnl, TnC or TnT, as the N terminal protein, fused to a second protein having a net negative charge sufficient when fused to the troponin protein to achieve the desired pi.
  • the selection of the carboxy terminal fusion protein or amino terminal fusion protein having a suitable net negative charge or low ionic strength is well within the skill of the art.
  • the identity of that fusion partner protein is not a limitation upon this modification.
  • the fusion partner may be fused in frame directly to the N terminal troponin molecule, or it may be fused to the N terminal protein by means of an optional and conventional linker or spacer sequence.
  • the protein is parvalbumin.
  • Other non-interacting proteins having low pis may also be employed as fusion partners.
  • a fusion protein made of HcTnl fused to carp parvalbumin is constructed by resort to conventional genetic engineering techniques.
  • the attachment of the fusion partner may be by conventional chemical cross-linking methods.
  • the resulting HcTnl-Pv fusion protein has an additional quality of being less susceptible to the formation of interchain disulfide bonds due to oxidation than the other Tnl ' s as seen on SDS-PAGE run under non- reducing conditions therefore increasing the stability of this modified protein (see Fig. 1) .
  • the carboxy or amino protein partner may be another troponin protein or fragment thereof.
  • a troponin fusion partner may be derived from a different species of mammal than the first troponin protein. It may be a different isoform of the same troponin protein. It may be derived from a different tissue source than the first protein.
  • the N terminal protein is HcTnl
  • the carboxy terminal fusion partner is HcTnC or a functional fragment thereof. See, for example, the fusion protein of Example 4.
  • fusion proteins may be designed by one of skill in the art by selecting as the fusion partner protein, a protein from among known proteins with low ionic strengths, and introducing it onto the amino or carboxy terminal of a troponins Tnl, TnC or TnT, or fragment thereof to generate modified troporxii ⁇ s having the appropriate low pi.
  • Fusion or linkage between the troponin protein and the carboxy terminal fusion partner may be by any suitable means, e.g., by conventional covalent or ionic bonds, protein fusions, or hetero-bifunctional cross- linkers, e.g., carbodiimide, glutaraldehyde, and the like. Such techniques are known in the art and readily described in conventional chemistry and biochemistry texts. Additionally, conventional linker or spacer sequences which simply provide for a desired amount of space between the second protein partner and the troponin protein may also be constructed into the modified fusion protein. The design of such linkers is well known to those of skill in the art.
  • modified troponin fusion proteins may also be dialyzed into stable solutions as described above, and/or lyophilized as described above.
  • the troponin proteins may be assembled into a hetero- multimeric troponin protein complex.
  • Each member of the multimer is selected from a troponin protein or functional fragment thereof which differs from the other members of the multimer by mammalian species origin, by tissue source, by isoform or by method of production.
  • one such multimer may be formed of a recombinant human cardiac troponin I complexed to a recombinant skeletal troponin T, and recombinant human cardiac troponin C.
  • the complexed troponins may be recombinant or native proteins, wildtype or modified proteins.
  • the troponins of the multimer may be expressed recombinantly in a host cell.
  • the multimer can be a heterodimer, formed, for instance, of the assembly of TnC complexed to a Tnl.
  • Another desirable dimer is the complex formed by a TnC complexed to a TnT. Still another desirable dimer is formed by a Tnl complexed to a TnT.
  • the multimer can be a heterotrimer of TnC, Tnl and TnT, in the three dimensional structure dictated by their assembly in a host cell.
  • Complexes formed by functional fragments of these troponins are also included. Specific linear sequences of the different troponins in any order may be produced by fusion as described above. These multimeric complexes may be dialyzed and/or lyophilized as described above. It is anticipated that other troponins which may form complexes may also be used in the low ionic strength solutions of this invention.
  • the assembly of troponin multimers is accomplished by expressing the gene encoding each troponin (or a functional fragment thereof) on a separate plasmid under the control of regulatory sequences directing the expression of the protein in a host cell.
  • the selected troponin genes on selected expression plasmids are co-transfected into a host cell. Once the host cell is cultured, the troponins are expressed and assemble within the cell. The cell is then lysed by conventional techniques and the complex isolated. In the case of the trimer, three separate plasmids may be designed and co-transfected into the same cell.
  • two or more of the genes encoding the troponins or functional fragments may be placed on the same plasmid under the control of the same, or different promoter regulators.
  • the host cell may be transfected with a single plasmid containing all two or three of the troponins, and the culturing and isolation of the complex would occur in the manner described above.
  • troponin complexes isolated from the host cells are stable, soluble molecules. This aspect of the invention provides a complex directly isolated from the host cell, therefore bypassing the need to form the complex from the isolated components in vi tro .
  • modified proteins described above, or the complexes described above, as well as the individual troponins of this invention can be expressed in recombinant host cells, e.g., mammalian, bacterial, fungal, insect, etc., by resort to recombinant DNA technology using genetic engineering techniques given the specific teachings of the invention provided herein. The same or similar techniques may also be employed to generate other embodiments of this invention.
  • a nucleotide molecule which contains the nucleotide sequence encoding a modified protein or complex described above, optionally under the control of regulatory sequences directing expression of the protein in a selected host cell may be designed.
  • a conventional expression vector or recombinant plasmid is produced by placing coding sequences for the modified troponins or complexes in operative association with conventional regulatory control sequences capable of controlling the replication and expression in, and/or secretion from, a host cell.
  • Regulatory sequences include promoter sequences, e.g., CMV promoter, and optional signal sequences.
  • the troponin molecules may be expressed individually under the control of individual regulatory sequences, or in tandem, as in known in the art.
  • a selected host cell is transfected or co-transfected by conventional techniques with either a single vector expressing a single troponin or two or more troponions, or co-transfected with more than one plasmid vector to create the transfected host cell of the invention comprising the recombinant modified troponin or troponin complex.
  • the transfected cell is then cultured by conventional techniques to produce the proteins or complex of the invention.
  • the production of the troponin complex which includes the association of individual troponins with each other is measured in the culture by an appropriate assay, such as ELISA or RIA. Similar conventional techniques may be employed to construct other molecules of this invention.
  • Suitable vectors for the cloning and subcloning steps employed in the methods and construction of the compositions of this invention may be selected by one of skill in the art.
  • the conventional pUC series of cloning vectors may be used.
  • One vector used is pUC19, which is commercially available from supply houses, such as Amersham (Buckinghamshire, United Kingdom) or Pharmacia (Uppsala, Sweden) .
  • any vector which is capable of replicating readily has an abundance of cloning sites and selectable genes (e.g., antibiotic resistance) , and is easily manipulated, may be used for cloning.
  • the selection of the cloning vector is not a limiting factor in this invention.
  • the vectors employed for expression of the recombinant proteins, modified proteins and/or complexes according to this invention may be selected by one of skill in the art from any conventional vectors. See, for example, the vectors employed in the examples.
  • the vectors also contain selected regulatory sequences (such as CMV promoters) which direct the replication and expression of heterologous DNA sequences in selected host cells. These vectors contain the above described DNA sequences which code for the troponin protein(s).
  • the vectors may incorporate selected troponin sequences modified by the insertion of desirable restriction sites for ready manipulation.
  • the expression vectors may also be characterized by genes suitable for amplifying expression of the heterologous DNA sequences, e.g., the mammalian dihydrofolate reductase gene (DHFR) .
  • Other preferable vector sequences include a polyadenylation (poly A) signal sequence, such as from bovine growth hormone (BGH) and the betaglobin promoter sequence (betaglopro) .
  • poly A polyadenylation
  • BGH bovine growth hormone
  • betaglopro betaglobin promoter sequence
  • replicons e.g. replicons, selection genes, enhancers, promoters, signal sequences and the like
  • selection genes e.g. replicons, selection genes, enhancers, promoters, signal sequences and the like
  • Other appropriate expression vectors of which numerous types are known in the art for mammalian, bacterial, insect, yeast, and fungal expression may also be selected for this purpose.
  • the present invention also encompasses a cell transfected with a recombinant plasmid containing the coding sequences of the modified troponin molecules or complexes.
  • Host cells useful for the cloning and other manipulations of these cloning vectors are also conventional. However, most desirably, cells from various strains of E. coli are used for replication of the cloning vectors and other steps in the construction of the recombinant proteins and complexes of this invention.
  • Suitable host cells or cell lines for the expression of the troponin proteins and complexes of the invention are preferably bacterial cells [see, e.g., Pl ⁇ ckthun, A., 1992, Immunol . Rev. , 130:151-188] .
  • the tendency of proteins expressed in bacterial cells to be in an unfolded or improperly folded form or in a non- glycosylated form does not pose as great a concern as troponins are not normally glycosylated and can be engineered for exported expression thereby reducing the high concentration that facilitates misfolding. Nevertheless, any recombinant troponin produced in a bacterial cell would be screened for retention of immunoreactivity.
  • E. coli used for expression are well-known as host cells in the field of biotechnology.
  • Various strains of B. subtilis, Streptomyces, other bacilli and the like may also be employed in this method. See, also the E. coli strain used in the following examples.
  • Other E. coli expression systems are described in Studier, F.W. et al, 1990, Meth. Enzymol., 185:60-89.
  • mammalian cells such as CHO, COS, a fibroblast cell (e.g., 3T3) , and myeloid cells, and more preferably a CHO or a myeloid cell.
  • Human cells may be used, thus enabling the molecule to be modified with human glycosylation patterns.
  • other eukaryotic cell lines may be employed.
  • strains of yeast cells known to those skilled in the art are also available as host cells, as well as insect cells, e.g. Drosophila and Lepidoptera and viral expression systems. See, e.g. Miller et al . , 1986, Genetic Engineering, 8:277-298 and references cited therein.
  • the transfection methods required to produce the host cells of the invention, and culture methods necessary to produce the troponin molecules or complexes of the invention from such host cells are all conventional techniques.
  • the proteins or complexes of the invention may be purified from the cell culture contents according to standard procedures of the art, including ammonium sulfate precipitation, affinity columns, column chromatography, gel electrophoresis and the like. Such techniques are within the skill of the art and do not limit this invention.
  • dialyzed solutions or lyophilized compositions containing the recombinant troponins, modified troponin proteins and/or complexes described above are useful as calibrators, controls or standards in diagnostic assays for diagnosis of damage to heart or skeletal muscle.
  • the stable solutions and/or lyophilized compositions of the inventions may be useful to replace the controls or standards in any assay format which requires a standard.
  • assays are immunoassays, such as described in Larue, C. et ai; Styba et al ; Wu et al ; Muller-Bardorff et al , and Severina, M. et al , UK Patent Application No. 2,275,774; European patent application No. 743,522; International application No. W096/33415; Canadian patent application No. 2,130,280 and United States Patent No. 5,560,937, all cited above in the background.
  • compositions of this invention are useful in a variety of immunoassays for measuring the level, or detecting the presence or absence of a mammalian troponin protein in a patient sample.
  • the assay methods entail the use of antibodies to the selected troponin to be measured, and signal generating second antibodies or conventional signal systems to measure the level of the selected troponin in the patient's serum or plasma sample.
  • the measured patient troponin level is then compared with a troponin protein standard and a determination is made whereby the patient's level is equivalent, absent, lower or elevated with respect to the standard.
  • the standard in any suitable assay may be replaced with a stable aqueous, acid-dialyzed solution of a recombinant troponin protein as described above.
  • the standard may be replace with a stable lyophilized acid-dialyzed composition of a recombinant troponin protein, which lyophilized composition may be reconstituted to a stable liquid form by the addition of water alone.
  • the nature of the assay does not limit the application of the compositions of this invention.
  • the present invention provides a diagnostic kit which may be used in a clinical laboratory to aid in the diagnosis or assessment of the condition of a patient suspected of having a disorder resulting in cardiac or skeletal muscle damage. The methods and assay components described herein for the collection and measurement of the troponin in serum or plasma may be efficiently utilized in the assembly of such a kit for the detection of troponin using the compositions of this invention as the standard.
  • the kit according to this invention would contain a composition of this invention as the standard, control or calibrator, i.e., a stable aqueous, acid-dialyzed solution of a recombinant troponin protein, as described herein or a stable dry composition formed by lyophilized an acid-dialyzed solution of a recombinant troponin protein as described, or undialyzed modified troponins or troponin complexes of the invention.
  • a suitable kit may also contain an appropriate binding ligand capable of binding the troponin, an appropriate assay indicator molecule, reverse phase cartridges, assay buffers, matrix buffers and other conventional elements.
  • Such an appropriate binding ligand may be selected by one of skill in the art and may be, for example, an antibody, a receptor, or other conventional ligand.
  • This kit may be employed for the performance of one or more assay methods. Components of the kit may vary according to the purposes of the assay.
  • kits, and the method of the invention provides an easy and accurate method for measuring troponin in serum or plasma. It is further anticipated that use of the multimeric complexes as the control or calibrator, may permit diagnostic evaluations even more accurate than those permitted by use of a single troponin protein as the calibrator.
  • the components of the kit and the type of assay for which it is intended is not a limitation of this invention, a kit for any assay employing a troponin standard may contain the compositions of this invention.
  • Still other utilities of the present invention include research uses, such as uses in methods for studying normal and pathological functions of the heart, skeletal muscle or any other tissue source from which a troponin is derived.
  • compositions of this invention are useful in assays to determine the concentration of a troponin for other than diagnostic use, or for purification techniques, or to generate antibodies, all by conventional methods.
  • the following examples illustrate the method of preparing a stable formulation of a human troponin protein or fragment or modification thereof. These examples are illustrative only and do not limit the scope of the present invention.
  • the following examples demonstrate human cardiac troponin I and modifications prepared according to embodiments of this invention.
  • the HcTnl preparations provide a calibrator/control standard for use in assays for circulating cardiac troponin I and thus serve as an aid in the diagnosis of acute myocardial infarction and other related disorders.
  • human cardiac Tnl which include: wild type HcTnl dialyzed and lyophilized according to this invention; modified HcTnl with a C terminal addition of 6 lysines, 5 histidines and 1 aspartic acid (HcTnI-K 6 -H 5 -D) ; modified HcTnl with a C terminal addition of 3 leucines alternating with 3 histidines (HcTnl-[LH] 3 ) ; a fusion protein formed of HcTnl and a carboxy terminal fusion partner, carp parvalbumin; a fusion protein formed by HcTnl fused to human cardiac troponin C (HcTnl-HcTnC) . Also illustrated is the recombinant expression of a composition according to this invention of the isoform 3 of HcTnT and its reactivity in an immunoassay, as well as preparations of the complexes of this invention.
  • EXAMPLE 1 RECOMBINANT HUMAN CARDIAC TROPONIN I Recombinant human cardiac troponin I (HcTnl) was made by extraction of total RNA from human heart following the method of Chomcynski, P., and Sacci, N., 1987, Anal . Biochem. , 162: 156-159. RNA was transcribed into a cDNA using reverse transcriptase, cDNA Cycle Kit for RT-PCR (Invitrogen, San Diego, CA) .
  • HcTnl Using the published DNA sequence of HcTnl [Vallins et al , cited above; which is SEQ ID NO: 1 with the modification of a codon for Thr at amino acid position 86], a 3' oligonucleotide complementary to the 3' end of the coding region of the HcTnl gene was synthesized for use as the annealing primer for synthesis of the first strand of cDNA. The first strand of cDNA generated by reverse transcriptase was then used as a template for PCR amplification.
  • the PCR reaction was primed using the 3' oligonucleotide and a 5' oligonucleotide synthesized to correspond to the 5' end of the coding region for HcTnl.
  • Each primer contained a restriction site at its 5' end to facilitate subsequent subcloning.
  • the PCR cycles were as follows: 2 minutes at 94°C, 30 cycles of 30 seconds at 95°C, 2 minutes at 50°C, 2 minutes at 72°C with the last cycle ending in 10 minutes at 72°C.
  • the PCR product was isolated on a low melt agarose gel, cut out and cleaned with gene clean (BIO 101, Vista, CA) .
  • the product and prokaryotic plasmid vector pET lid (Novagen, Madison, WI) containing a multiple cloning site were digested with restriction enzymes Ncol and BamHl (Gibco-BRL, Gaithersburg, MD) .
  • the two DNA strands were ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, IN) . E.
  • coli DH5 ⁇ a high transformation efficiency host, was transformed with the insert- containing plasmid.
  • DH5 ⁇ is used for transformations from ligation reactions because it is 10 times more efficient for transformation than BL21 and it is used for amplification of the DNA.
  • This vector is not able to express the target protein however, and BL21 must be used with pET vectors for this purpose.
  • other E. coli strains and other vectors serving the same purposes can also be used.
  • Colonies of DH5 ⁇ that contained the plasmid were selected by growth on LB agar containing ampicillin.
  • the plasmid contains the sequence coding for ⁇ lactamase production, thereby conferring resistance to ampicillin to the transformed bacteria.
  • the plasmid DNA was isolated by standard alkaline lysis method and sequenced using the Sequenase DNA sequencing kit (United States Biochemical, Cleveland, OH) .
  • the sequence of the HcTnl cDNA was found to be identical to the published sequence for this molecule [Armour, K.L. et al , 1993, Gene, 131:287-292; SEQ ID NO: 1]). These sequences are also similar to that described in Vallins et al .
  • E. coli BL21 (DE3) , a preferred host for pET vectors, was transformed with the vector.
  • the culture was grown n enriched media containing yeast extract, tryptone and M9 minimal salts (Sigma, St. Louis, MI) in the presence of 200 ⁇ g/ml ampicillin (plasmid resistance marker) to mid log phase and induced by making the culture 1 mM in isopropyl-B-D-thiogalactoside (IPTG; Boehringer Mannheim, Indianapolis, IN) .
  • Recombinant HcTnl was isolated from the bacterial culture by sonication of the bacterial pellet in 6M urea, 10 mM sodium citrate, pH 5.0, 2 mM EDTA, ImM dithiothreitol (DTT) .
  • the sonicate was centrifuged at 48,000 xg.
  • the supernatant was loaded on a CM-52 column equilibrated in the same buffer. The column was eluted with a 500:500 ml 0 - 0.5M NaCl gradient.
  • fractions containing HcTnl were pooled and dialyzed against 4 liters of 4M urea, 50 mM Tris, pH 7.5, IM NaCl and 1 mM DTT, 4 liters of 2M urea, 50 mM Tris, pH 7.5, IM NaCl and 1 mM
  • TnC affinity column which consisted of cyanogen bromide activated sepharose 4B coupled with rabbit skeletal TnC as described [Potter, J.D, 1982, Meth. Enzymol., 85:241-263] .
  • the column was equilibrated in the same buffer before the protein was loaded. After the protein was bound the column was washed and eluted with a 125:125 ml gradient from 0M urea, 0M EDTA to 6M urea, 3mM EDTA.
  • HcTnl was judged to be >95% pure based on observation of Coomassie blue stained protein bands on the SDS-PAGE gel of Fig. 1.
  • EXAMPLE 2 RECOMBINANT MODIFIED HcTnl WITH A CARBOXY TAIL Recombinant HcTnl described in Example 1 above was modified to add six lysines, five histidines and one aspartate to its C-terminal end (HcTnI-K 6 -H 5 -D [SEQ ID NO: 5] ) . This modification was made to change the isoelectric point of the protein, thereby improving the solubility and stability of the resulting molecule.
  • the HcTnl cDNA described in Example 1 above [SEQ ID NO: 1] was used as a template for PCR.
  • the cDNA encoding this protein was synthesized using PCR to add the C terminal modifications to the HcTnl.
  • the PCR reaction was primed using the 5' oligonucleotide used for the synthesis of HcTnl as described in Example 1 and a 3' primer having the sequence 5' GT GGATCC TCA GTG ATG GTG ATG GTG ATG TTT c ⁇ ⁇ c ⁇ ⁇ c ⁇ GCT CTC AAA CTT TTT CTT GCG G 3' [ SE Q ID NO: 3].
  • sequence of this 3' oligo encodes reading from its 3' end contains a sequence complementary to the nucleotides 630-609 in the HcTnl sequence of SEQ ID NO: 1 (underlined) , followed by the codons coding for 6 lysines and 6 histidines followed by a translational stop codon and a BamHl restriction site.
  • the PCR product was purified on an agarose gel, digested with BamHl and Ncol and ligated with a similarly digested pET lid plasmid. Using the procedure as previously described in Example 1, the E. coli DH5 ct was transformed with the ligated plasmid and colonies were selected by growth on LB agar containing ampicillin. The plasmid DNA was isolated from bacterial cultures and sequenced.
  • the bacterial pellet was sonicated in 50 mM sodium phosphate, pH 8.0. 300 mM NaCl and 6M urea. The sonicate was centrifuged at 48,000 xg and the supernatant was applied to a Ni 2+ affinity (Qiagen, Chatsworth, CA) column equilibrated with the same buffer. The column was washed with 50 mM sodium phosphate, pH 6.0, 300 mM NaCl, 6M urea and 10% glycerol. The bound protein was eluted with a 100:100 ml gradient 0 - 0.4M imidazole. The modified HcTnI-K 6 -H 5 -D was pure as eluted from the Ni 2+ affinity column judged by SDS-PAGE.
  • HcTnl and HcTnC were expressed as a single protein with the N-terminal being Tnl and the C-terminal being TnC (HcTnl-HcTnC fusion) .
  • the addition of the calcium binding protein HcTnC was made to provide more favorable solubility properties and to improve the solubility of the resulting fusion protein.
  • the cDNA encoding this protein was synthesized by a two step PCR procedure. Two PCR reactions were used to generate the intermediate cDNA's needed. In the first PCR reaction, the 5' primer encoded part of the plasmid vector upstream of the coding region; the 3' primer used was a synthesized oligonucleotide sequence: 5'
  • This sequence is a complementary sequence encoding the C terminal eight amino acids of HcTnl followed by the N terminal eight amino acids of HcTnC and the template used was HcTnl plasmid DNA.
  • the product of this PCR reaction was the DNA sequence encoding the entire amino acid sequence of HcTnl followed by the sequence coding for the first eight amino acids of HcTnC.
  • the 5' primer used was a synthesized oligonucleotide sequence: 5' AGGGCCGCAAGAAAAAG TTTGAGAGCATGGATGACATCTACAAGGCTGGCTGCGGTAG 3' [SEQ ID NO: 7].
  • the 3' primer was a complementary primer that encodes part of the plasmid vector downstream of the insert, and the template was HcTnC plasmid DNA.
  • the cDNA coding for HcTnC was generated from RT-PCR as described for HcTnl above using the published sequence to synthesize appropriate 5' and 3' primers [Gahlmann, R. et al, cited above] and ligated into a plasmid vector.
  • the product of the second PCR product was a sequence encoding the C terminal eight amino acids of HcTnl followed by the entire sequence coding for HcTnC.
  • Both PCR products were purified on an agarose gel and used as templates/primers for a third PCR reaction.
  • This reaction also used as primers, a sequence of the plasmid upstream of the coding region and another complementary to a region downstream of the coding sequence.
  • some of the first and second PCR sequences act as primers and templates for each other, so that full length products coding for HcTnl followed by HcTnC are obtained in the first cycles of PCR.
  • This cDNA was restriction digested using BamHl and Ncol and ligated with a similarly digested pET lid plasmid.
  • DH5 ⁇ was transformed with the resulting vector and colonies selected by growth on LB agar containing ampicillin.
  • the plasmid DNA was isolated from bacterial cultures and sequenced. The sequence was found to be as predicted, namely, the full sequence coding for HcTnl followed immediately by the full sequence coding for HcTnC.
  • the HTnl portion of the protein has the DNA sequence as shown in SEQ ID NO: 1 and the HTnC portion of the fusion protein has the DNA sequence as published in Gahlmann, R. et al , cited above, i.e., from nucleotide 631 to 1116 of SEQ ID NO:8.
  • the plasmid was then used to transform E. coli BL 21 (DE3) . Cultures were grown in enriched media to mid log phase and induced with 1 mM IPTG. The bacterial pellet was sonicated in 50 mM Tris, pH 8.0, 5 mM EDTA, 0.1 mM DTT, 6M urea.
  • the supernatant was applied to a DE-52 column equilibrated with the same buffer.
  • the column was washed and then eluted with a 500:500 ml gradient 0-0.6 M NaCl.
  • the protein bound to DE-52 which is a characteristic of TnC but not Tnl. It eluted at an ionic strength between 1.67 and 5.6 mS/cm.
  • the fractions containing HcTnl-HcTnC fusion protein were pooled and the dialyzed pool was loaded on a S-Sepharose column equilibrated with he same buffer, washed and eluted with a 200:200 ml gradient 0.1- 0.3M NaCl.
  • HcTnl-HcTnC fusion protein eluted at an ionic strength between 7.0 and 8.0 mS/cm. Some additional HcTnl-HcTnC fusion protein was eluted from the column with a 0.4 M NaCl step, ionic strength 14 mS/cm. This protein was judged to be pure by SDS-PAGE.
  • the DNA sequence encoding this fusion protein HcTnl- HcTnC is shown in SEQ ID NO: 8 and the deduced amino acid sequence of the fusion protein as SEQ ID NO: 9.
  • Nucleotide sequence positions #631-633 of SEQ ID NO: 8 of the wild type DNA sequence represents the translational stop codon. This codon terminates translation of the messenger into protein and cannot appear at this position in the fusion proteins or translation will be terminated before the full length protein is produced.
  • HcTnl-CARP PARVALBUMIN FUSION PROTEIN HcTnl and carp parvalbumin were expressed as a single fusion protein with HcTnl being the N-terminal portion and carp parvalbumin (Pv) being the C-terminal portion (HcTnl- Pv) [see, e.g., Coffe, CJ. and Bradshaw, R.A., 1973, CL_ Biol. Chem., 248:3305-3312] .
  • Carp parvalbumin is a calcium binding protein and, as in the HTnl-HTnC fusion protein, this modification was made to provide favorable solubility properties and to improve the solubility of the resulting fusion protein.
  • This cDNA was synthesized using a two step PCR procedure.
  • the first PCR step used HcTnl plasmid DNA as the template.
  • the 5' primer was the promoter region of the bacterial plasmid.
  • the 3' primer was a synthesized oligonucleotide having the sequence 5' AGCGTCGTTCAGAAC
  • PCR product sequence was that of HcTnl with the first 30 base pairs of parvalbumin on its 3' end.
  • the second PCR template was a carp parvalbumin insert in a bacterial plasmid vector DNA.
  • the 5' primer used was a synthesized oligonucleotide having the sequence: 5 f AGGGCCG CAAGAAAAAGTTTGAGAGCATGGCTTTCGCTGGTGTTCTGAACGACGCTG [SEQ ID NO: 11].
  • the 3' primer was complementary to a portion of the plasmid downstream of the multiple cloning site.
  • the resulting PCR product DNA sequence was that of carp parvalbumin with the last 26 base pairs of HcTnl on the 5' end. These two PCR products were used as primers and templates for each other as described for the construction of the HcTnl-HcTnC fusion protein in a third, overlap PCR reaction.
  • the product of this final PCR reaction was a nucleotide sequence encoding the complete HcTnl sequence of SEQ ID NO: 1 followed by the complete carp parvalbumin sequence, i.e., nucleotides 631-960 of SEQ ID NO: 12 and amino acid 191-299 of SEQ ID NO: 13. Both proteins were encoded as a single fusion product.
  • the PCR DNA was restriction digested with Ncol and BamHl.
  • the digested DNA was ligated with a similarly digested bacterial pET lid plasmid.
  • the insert containing plasmid was used to transform E. coli DH5 ⁇ . Plasmid containing colonies were selected by growth on LB agar containing ampicillin. Plasmid DNA was isolated and sequenced. The sequence was as predicted as that of HcTnl followed directly by that of the published sequence for carp parvalbumin.
  • Plasmid DNA was used to transform E. coli BL21 (DE3) . Cultures were grown in enriched media to mid log phase and induced with 1 mM Tris, pH 8.0, 0.1M NaCl, 0.1 mM PMSF, 1 ⁇ M pepstatin A, 1 ⁇ M leupeptin. The sonicate was centrifuged at 48,000 xg and the supernatant was loaded on a S-Sepharose column equilibrated with the same buffer. The protein bound to the column and was eluted with a salt gradient.
  • HcTnl-Pv The DNA sequence of this modification, HcTnl-Pv, is shown in SEQ ID NO: 12 and the deduced amino acid sequence is shown in SEQ ID NO: 13.
  • Nucleotide sequence positions #631-633 of the DNA sequence of HcTnl represents the translational stop codon. This codon terminates translation of the messenger into protein and must not appear at this position in the fusion proteins or translation will be terminated before the full length protein is produced.
  • EXAMPLE 5 HcTnl MODIFIED WITH A HISTIDINE LEUCINE PEPTIDE
  • HcTnl was modified to add an alternating 3 histidine 3 leucine tag to the C-terminal end of the molecule (HcTnl-[HL] 3 ) . This modification was made to change the isoelectric point of the protein, thereby improving the solubility and stability of the resulting molecule.
  • the cDNA encoding this protein was synthesized by PCR using the described recombinant HcTnl [SEQ ID NO: 1] as the template, a 5' primer encoding part of the plasmid upstream of the insert, and as a 3' primer a synthesized oligonucleotide: 5'GTGGATCCTCAGAGATGGAGATGGAGATGGCTCT CAAACTTTTTCTTGCGG 3' [SEQ ID NO: 14].
  • the sequence of this 3' oligo reading from its 3' end contains a sequence complementary to the nucleotides 630-609 in the HcTnl sequence of SEQ ID NO: 1 (underlined) , followed by codons coding for 3 sets of alternating histidines and leucines, a translational stop codon and a BamHl restriction site.
  • the PCR product was ligated to a bacterial pET lid plasmid as described in detail for the other HcTnl modifications sequenced and expressed.
  • the DNA sequence of this modification, HcTnl-[HL] 3 is shown in SEQ ID NO: 15 and the deduced amino acid sequence is shown in SEQ ID NO: 16.
  • EXAMPLE 6 DIALYSIS OF HcTnl's IN LOW IONIC STRENGTH SOLUTIONS FOLLOWED BY LYOPHILIZATION AND RECONSTITUTION Aliquots of recombinant human cardiac HcTnl, HcTnI-K 6 - H 5 -D, HcTnl-Pv and HcTnl-HcTnC were prepared and purified as described in Examples 1-4 above. Each protein was dialyzed over several days against 4 times 4 liters of 1 mM HCl.
  • Recombinant rabbit skeletal troponin T (rskTnT) was also expressed and purified as described in Potter, cited above, and then dialyzed as described for the Tnl's above. Each protein suspension was then aliquoted and lyophilized. Immediately upon completion of lyophilization, a set of aliquots of each protein was resuspended in a volume of distilled water equal to the aliquot volume before lyophilization. Additional aliquots of each lyophilized protein were resuspended after storage at -20°C for one week and one month. Samples of the protein at each stage of the process were kept at -80°C for later analysis.
  • the protein concentrations and reactivity with a monoclonal antibody before and after dialysis, lyophilization and reconstitution were tested as described below. Approximate concentration of each of the proteins before dialysis, after dialysis and after each reconstitution were determined as follows. The concentration of all protein suspensions was determined by densitometry on SDS PAGE (UVP Imagestore and Sigma Gel densitometry software, Jandel Scientific, San Rafael, CA) . In order to estimate the concentration of the modified Tnl's, the recombinant (wild-type) HcTnl [SEQ ID NO: 1] was used as a standard. This HcTnl is unmodified as cloned from human cardiac tissue [Armour et al , cited above] .
  • This wild type Tnl preparation was accepted to be at a concentration of 0.6 mg/mL as determined by BCA assay (Pierce, Rockford, IL) , Coomassie assay and extinction. Conventional protein assays are commercially available from BioRAd, Hercules, CA, or otherwise are well known in the art (extinction coefficients) .
  • the wild type, recombinant HcTnl was loaded on to an SDS gel in decreasing volumes in order to establish a calibration curve. This curve was then used to determine the concentration of the modified Tnl's that were loaded on to the same gel. The values obtained from this experiment were used as the starting values for all the Tnl's. These values were then used to set up calibration curves for the individual proteins to compare the concentrations after each step of dialysis, lyophilization and reconstitution.
  • Total Protein Before Dialysis refers to the amount of each protein obtained after purification by column chromatography. Each of the proteins were in solutions containing 6M urea and a salt concentration ranging from 0.3 M to IM at this stage.
  • Total Protein After Dialysis refers to the amount of protein remaining after dialysis in lmM HCl.
  • the proteins identified in Table I above were used to set up ELISA assays to determine the immunoreactivity of each protein after dialysis, after lyophilization and after reconstitution.
  • the proteins 200 fmol, 100 fmol, and 50 fmol of each protein
  • a monoclonal antibody, 2A7-1E7 specific for HcTnl was reacted with the protein bound to the plate at a concentration of 5 pmole of antibody/well for one hour at room temperature. Examples of suitable anti-HcTnl antibodies are described in Larue et al , cited above.
  • the binding of the primary monoclonal antibody to the proteins was visualized by reacting the bound antibody with a secondary antibody, i.e., goat anti- mouse IgG conjugated with horseradish peroxidase (Sigma, St. Louis, MO) .
  • a secondary antibody i.e., goat anti- mouse IgG conjugated with horseradish peroxidase (Sigma, St. Louis, MO) .
  • the amount of primary antibody bound is detected by addition of the chromogenic substrate 2, 2'- azino-bis (3-ethylbenz-thiazoline-6-sulfonic acid) diammonium salt substrate (Sigma, St. Louis, MO) for the enzyme label on the secondary antibody.
  • the amount of color produced is measured spectrophotometrically at 405 nm and is proportional to the amount of primary antibody bound.
  • Tables II through V below report the immunoreactivity results for each protein, at varying concentrations: (1) in the dialyzed solutions according to the invention; (2) after lyophilization of the dialyzed solutions and immediate reconstitution following lyophilization (first reconstitution) ; and (3) after the dialyzed solution is lyophilized and stored for one week at -20°C prior to reconstitution (second reconstitution) .
  • the percents in the parenthesis are the percent of immunoreactivity in each preparation as compared to the reactivity after dialysis but before lyophilization (100% in all cases) . Values listed are the mean of four duplicate wells. The optical density at a wavelength of 405 nanometers was measured. Due to the method of quantitation, the tables compare a particular protein to itself, after dialysis, and both before and after lyophilization. The tables do not compare results between proteins.
  • stable standards and calibrators for use in a cardiac troponin I clinical immunoassays can be produced by preparing a dialyzed solution according to one embodiment of this invention, or preparing a dialyzed, lyophilized composition, reconstitutable in water according to another embodiment of this invention.
  • troponin proteins, modified proteins, fusion proteins and complexes described by this invention will also provide stable dialyzed and dialyzed and lyophilized standards for use in diagnostic assays.
  • Table VI illustrates the stability of wild type HcTnl stored at -80°C in the presence of 6M urea and high salt and HcTnl stored at 0°C in the presence of 6M urea and high salt.
  • Table VII illustrates the stability of HcTnI-K 6 H 5 D stored at -80°C in the presence of 6M urea and high salt and HcTnI-K 6 Hj,D stored at 0°C in the presence of 6M urea and high salt .
  • Table 8 illustrates the stability of HcTnl-Pv stored at -80°C in the presence of 6M urea and high salt and HcTnl-Pv stored at 0°C in the presence of 6M urea and high salt.
  • HcTnl molecule enough to be stored at 0°C in urea without the loss of immunoreactivity. However, this molecule can also be stored under the conditions of the present invention just as well.
  • EXAMPLE 9 ADVANTAGES OF HcTnl-Pv
  • the HcTnl-Pv molecule which was not dialyzed and/or lyophilized according to one embodiment of this invention, was shown to have an additional advantageous characteristic in that it is not susceptible to the formation of interchain disulfide bonds as the other three HcTnl molecules.
  • Fig. 1 shows the proteins on SDS-PAGE in the absence of the reducing agent, ⁇ - mercaptoethanol. All of the HcTnl's show bands at the position of dimers formed from these molecules with the exception of HcTnl-Pv.
  • HcTnT cardiac troponin T
  • the calibrator/standard utilized in these assays is bovine cardiac troponin T [Wu et al . , cited above] .
  • An improvement over the prior art is the provision by this invention of HcTnT as the calibrator/control standard.
  • HcTnT in a clinical assay format is presently problematic for the same reasons as described for human cardiac troponin I, i.e., inadequate amounts of tissue for isolation of the native molecule; difficulties in purification due to the instability and insolubility of both the native and recombinant molecules.
  • HcTnT human cardiac troponin T
  • HcTnT Recombinant human cardiac troponin T
  • isoform 3 was cloned by reverse transcriptase PCR as described for HcTnl above.
  • HcTnT was made by extraction of total RNA from adult human heart [Chomcynski and Sacci, cited above] . The RNA was transcribed into a cDNA copies using reverse transcriptase, cDNA Cycle Kit for RT-PCR (Invitrogen, San Diego, CA) .
  • the oligo included the translational stop codon and a sequence representing a BamHl restriction site.
  • the first strand of cDNA generated by reverse transcriptase was then used as a template for PCR amplification.
  • the PCR reaction was primed using the previously described 3' oligonucleotide and a 5' oligonucleotide synthesized to correspond to the 5' end of the coding region for cTnT.
  • the 5' oligo represents the first 20 nucleotides of HcTnT with a modification to include an Ncol site (CCATGG) . This modification results in a change in the second amino acid from serine to alanine.
  • Each primer contained a restriction site at its 5' end to facilitate subsequent subcloning.
  • PCR cycles were as follows: 2 minutes at 94° C, 30 cycles of 30 seconds at 95° C, 2 minutes at
  • the PCR product was isolated on a low melt agarose gel, cut out and cleaned with gene clean (BIO 101, Vista, CA) .
  • the product and a prokaryotic plasmid vector containing a multiple cloning site were digested with Neol and Bam HI.
  • the two DNA strands were ligated using T4 DNA ligase (Boerhinger Mannheim, Indianapolis, IN) and E. coli
  • DH5 ⁇ was transformed with the insert containing plasmid.
  • Colonies of DH5 ⁇ that contained the plasmid were selected by growth on LB agar containing ampicillin.
  • the plasmid contains the sequence coding for ⁇ lactamase production therefore conferring resistance to ampicillin to the transformed bacteria only.
  • the plasmid DNA was isolated from the host bacteria by standard alkaline lysis method and sequenced (Sequenase, United States Biochemical, Cleveland, OH) .
  • the sequence of the troponin T (HcTnT 3 ) cDNA was found to be identical to the published sequence for the predominant adult isoform of this molecule, referred to as isoform T [Anderson et al , cited above] .
  • the expression host E. coli BL21(DE3) pLysS was then transformed with the vector.
  • the culture was grown in enriched media (Yeast extract, tryptone and M9 minimal slats, Sigma, St. Louis, MI) in the presence of 200 ⁇ g/ml ampicillin (plasmid resistance marker) to mid log phase and induced by making the culture 1 mM in TPTG (Boehringer Mannheim, Indianapolis, IN) .
  • Recombinant human cardiac troponin T was isolated from the bacterial culture by sonication of the bacterial pellet in 6M urea, 10 mM Sodium citrate, pH 7.0, 2 mM EDTA, lmM DTT.
  • the sonicate was centrifuged at 48,000 xg. The supernatant was then adjusted to pH 5.0 and centrifuged again. The supernatant from this spin was loaded on an S-Sepharose column equilibrated in the same buffer. The column was eluted with a 600:600 ml, 0-0.6M NaCl gradient. The fractions containing HcTnT were pooled and dialyzed against 4 X 4 liters of 6M urea, 20 mM Tris, pH 7.8, lmM EDTA and 0.3 mM DTT and loaded on to a Q-Sepharose column. The column was equilibrated in the same buffer before the protein was loaded. After the protein was bound the column was washed and eluted with a 500:500ml, 0- lMNaCl gradient Human cTnT was judged to be pure by SDS-PAGE.
  • HcTnT isoform T3 is shown in SEQ ID NO: 17; and the deduced amino acid sequence is shown in SEQ ID NO: 18.
  • Recombinant HcTnT dialyzed according to the present invention into a stable solution, or dialyzed and lyophilized according to the present invention provides readily available, stable and soluble preparations of HcTnT for use in diagnostic assays.
  • the results of SDS-PAGE gel are shown in Fig. 5.
  • EXAMPLE 13 TROPONIN COMPLEXES Complexes of recombinant human troponins are produced by expression of the proteins in bacterial expression hosts. Within the troponin complex (i.e., TnC-Tnl-TnT in equimolar ratio) as it appears naturally in muscle, Tnl and TnT are soluble in low ionic strength solutions. These molecules are also more stable with the complex than as isolated proteins [Larue et al, cited above; and Kluwe et al , cited above] . The production of a dimeric or trimeric complex using native human cardiac TnC, Tnl and/or TnT has been described in vi tro [Larue et al , cited above] . The construction of a vector expressing all three components of chicken skeletal troponin as a whole complex has also been described [Malnic, B. et al , 1994, Eur. J. Biochem., 224:49- 54].
  • the present invention provides recombinant heterodimeric complexes of troponins as well as a recombinant heterotrimeric complex.
  • These complexes are stable, soluble molecules that can be used as calibrator/control standard in clinical assays detecting HcTnl or HcTnT.
  • These complexes may be prepared into stable dialyzed solutions according to one embodiment of the method of this invention.
  • these complexes may be prepared into stable, dialyzed and lyophilized compositions according to another embodiment of the method of this invention.
  • the complexes are a further improvement over the current available troponin standards, as it is not known how the troponins, HcTnl and HcTnT are released into the circulation from the damaged heart tissue.
  • a bacterial plasmid has been constructed that contains the coding sequences for both HcTnl and HcTnC in tandem on the same plasmid.
  • the plasmid vector, pET lid described above, containing the coding sequence for HcTnC [SEQ ID NO:19] was digested with restriction enzymes Bgl II and Bam HI (Gibco, Gaithersburg, MD) .
  • the resulting DNA fragment consisted of the promoter region of the plasmid followed by the coding sequence for HcTnC. This fragment was isolated on an agarose gel, cut out and cleaned with gene clean (BIO 101, Vista, CA) .
  • a second pET vector, pET 3d, that contained the coding sequence for HcTnl was digested with Bam HI. This linearized plasmid was also cleaned as above and a ligation reaction was set up to join the promoter/TnC fragment with the linearized plasmid using T4 DNA ligase (Boehringer Mannheim, Indianapolis, IN) .
  • the enzymes Bam HI and Bgl II produce cuts that have complimentary overhangs, so that DNA digested with Bam HI can ligate to DNA digested with Bgl II and vice versa. It was expected that a certain proportion of the ligated plasmids would contain the promoter/HcTnC sequence in the proper orientation for expression.
  • E. coli DH5 was transformed with the ligation reaction and transformed bacteria were selected by growth on LB agar plates containing ampicillin. Small plasmid preps were made from colonies growing on the agar plate and digested with Eco RV (Gibco, Gaithersburg, MD) . This enzyme produced fragment lengths that indicate the presence and the orientation of the HcTnC/promoter DNA into the plasmid.
  • a plasmid prep shown to contain the desired restriction fragment lengths was then used to transform the expression host E. coli BL-21 (DE3) pLysS. Bacteria containing the plasmid were again selected on LB agar plates containing ampicillin. Cultures of colonies selected from this plate were then grown in enriched media containing ampicillin as described in the previous examples and checked for expression of the proteins by lysis of the centrifuged bacterial pellet in SDS-PAGE sample buffer and electrophoresis on SDS-PAGE gel. All cultures tested demonstrated expression of both HcTnC and HcTnl (see Fig. 2) . As illustrated in Fig.
  • the band corresponding to the position of HcTnl was not as heavy as that corresponding to HcTnC as is the case when these proteins are expressed separately.
  • a Western blot using a monoclonal antibody specific for HcTnl was performed. The Western blot confirmed that the band was HcTnl.
  • the bacteria were centrifuged and the pellets resuspended in 6M urea, 50 mM Tris pH8.0, 1 mM CaCl 2 , 2 mM ⁇ - mercaptoethanol .
  • the resuspended bacteria were then sonicated for a total of 10 minutes and centrifuged at 48,000 x g for 20 minutes.
  • the supernatant was dialyzed against 50 mM Tris, pH 8.0, 2 mM CaCl 2 , 1 mM BME and partially purified on a DEAE Sepharose column equilibrated with the same buffer. The column was washed and eluted with a 500:500 mL gradient of 0- 0.5M NaCl.
  • the HcTnT as cloned, is expressed, purified and stabilized as described in the previous examples for the HcTnl proteins.
  • the cDNA is also used as part of another construct expressing HcTnC, I and T together on one plasmid as described above for HcTnC and HcTnl. These molecules form the complete troponin complex as expressed by the bacteria.
  • the cDNA encoding HcTnT [SEQ ID NO: 17] was introduced into the plasmid following the TnC insert.
  • the plasmid containing Tnl/TnC was cut with BamHl.
  • a BglII/BamHl fragment containing the coding sequence for HcTnT was ligated with the linearized plasmid.
  • the ligation reaction was used to transform DH5 host bacteria and selected as previously described. Plasmids containing the proper size restriction fragments were selected and used to transform the expression host BL-21 (DE3) and BL-21 (DE3) pLysS. These bacteria were grown overnight and pelleted.
  • the pellets were resuspended in SDS-PAGE buffer and electrophoresed.
  • the proteins were transferred to nitrocellulose for detection by Western Blot.
  • a single blot using antibodies against HcTnl, HcTnT and HcTnC demonstrated the expression of all three subunits from a single plasmid (see Fig. 6, lanes 1- 3) .
  • multimeric complexes may be dialyzed into stable solutions and optionally lyophilized as described above. Thus, they are similarly useful as calibrators or controls for diagnostic assays.
  • EXAMPLE 14 STABILITY OF COMPLEXES The stability of the troponin complex was evaluated by assembling the subunits in vi tro. The subunits were mixed together in equimolar ratio. The HcTnl and HcTnT subunits were in 1 mM HCl and the HcTnC was in 50 mM Tris pH8.0, 1 mM CaCl 2 . These subunits were then dialyzed against either HCl or 5mM ammonium bicarbonate, four changes of 1 liter each over a period of two days. Since no precipitate was observed in any of the dialyzed samples, it was concluded that the subunits had complexed.
  • HcTnC precipitates at low pH and HcTnl and HcTnT are insoluble, as isolated subunits, in 5 mM ammonium bicarbonate. After dialysis, an aliquot was kept as a liquid, while the remaining volume was lyophilized. An SDS-PAGE gel was run on these samples after dialysis was complete (see Fig. 7) . As can be seen, all of the subunits are present in the correct stoichiometric ratio. The samples were then stored at 4°C if liquid or at ambient temperature if lyophilized for a period of two weeks. The lyophilized samples were then reconstituted in the same volume of distilled water and are shown in Fig. 8, lanes 1-4. As can be seen from the Fig. 8, all of the complexes are the same as after dialysis (Fig.
  • GAC ATA GAG GCA AAA GTC ACC AAG AAC ATC ACG GAG ATT GCA GAT CTG 384 Asp Ile Glu Ala Lys Val Thr Lys Asn Ile Thr Glu Ile Ala Asp Leu 115 120 125
  • Lys Asn lie Asp Ala Leu Ser Gly Met Glu Gly Arg Lys Lys Lys Phe 195 200 205
  • GAC ATA GAG GCA AAA GTC ACC AAG AAC ATC ACG GAG ATT GCA GAT CTG 384 Asp Ile Glu Ala Lys Val Thr Lys Asn Ile Thr Glu Ile Ala Asp Leu 115 120 125
  • MOLECULE TYPE other nucleic acid
  • GAC ATA GAG GCA AAA GTC ACC AAG AAC ATC ACG GAG ATT GCA GAT CTG 384 Asp Ile Glu Ala Lys Val Thr Lys Asn Ile Thr Glu Ile Ala Asp Leu 115 120 125
  • GAG CAG AAA AAT GAG TTC AAG GCA GCC TTC GAC ATC TTC GTG CTG GGC 720 Glu Gin Lys Asn Glu Phe Lys Ala Ala Phe Asp Ile Phe Val Leu Gly 225 230 235 240
  • Glu Ser Met Asp Asp lie Tyr Lys Ala Ala Val Glu Gin Leu Thr Glu 210 215 220
  • GAC ATA GAG GCA AAA GTC ACC AAG AAC ATC ACG GAG ATT GCA GAT CTG 384 Asp Ile Glu Ala Lys Val Thr Lys Asn Ile Thr Glu Ile Ala Asp Leu 115 120 125
  • GAC GGT AAA ATC GGT GTT GAC GAA TTC ACC GCT CTG GTT AAA GCA 957
  • Asp Gly Lys lie Gly Val Asp Glu Phe Thr Ala Leu Val Lys Ala 305 310 315
  • GAG GAG GAG AAC AGG AGG AAG GCT CAG GAT GAG GCC CGG AAG AAG AAG 528 Glu Glu Glu Asn Arg Arg Lys Ala Gin Asp Glu Ala Arg Lys Lys Lys 165 170 175
  • CAG ACA GAG CGG AAA AGT GGG AAG AGG CAG ACT GAG CGG GAA AAG AAG 624 Gin Thr Glu Arg Lys Ser Gly Lys Arg Gin Thr Glu Arg Glu Lys Lys 195 200 205

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Toxicology (AREA)
  • Analytical Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Cette invention concerne des procédés et trousses de dosage perfectionnés permettant de déceler des modifications des taux de troponines humaines dans un échantillon prélevé sur un patient. Dans ces procédés, on utilise en tant que solutions de référence soit une solution aqueuse, stable et ayant subi une dialyse par acide, d'une protéine telle que la troponine, ladite solution ayant un PH compris entre 2 environ et 5 environ, soit des compositions lyophilisées dérivées de ces solutions aqueuses. L'invention concerne également des troponines modifiées, des protéines de fusion et des hétéro-multimères constitués de protéines de type troponines ou de fragments fonctionnels de ces protéines.
PCT/US1997/006147 1996-04-16 1997-04-14 Preparations stabilisees de troponines humaines et modifications de ces troponines, procedes diagnostiques de dosage et trousses de dosage WO1997039132A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU26671/97A AU2667197A (en) 1996-04-16 1997-04-14 Stabilized preparations of human troponins and modifications thereof, diagnostic assay methods and assay kits

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US1577296P 1996-04-16 1996-04-16
US60/015,772 1996-04-16
US83374397A 1997-04-11 1997-04-11
US08/833,743 1997-04-11

Publications (2)

Publication Number Publication Date
WO1997039132A1 true WO1997039132A1 (fr) 1997-10-23
WO1997039132A9 WO1997039132A9 (fr) 1997-12-24

Family

ID=26687778

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1997/006147 WO1997039132A1 (fr) 1996-04-16 1997-04-14 Preparations stabilisees de troponines humaines et modifications de ces troponines, procedes diagnostiques de dosage et trousses de dosage

Country Status (2)

Country Link
AU (1) AU2667197A (fr)
WO (1) WO1997039132A1 (fr)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999031235A1 (fr) * 1997-12-18 1999-06-24 Spectral Diagnostics, Inc. Polypeptides a chaine unique comprenant la troponine i et la troponine c
WO2003025205A2 (fr) * 2001-09-19 2003-03-27 Medigene Ag Kinase regulee extracellulaire 2 (erk2)
EP1512695A1 (fr) * 2003-09-04 2005-03-09 BIOMAY Produktions- und Handels- Aktiengesellschaft Polypeptides hypoallergéniques à base de parvalbumin de poisson
US6867011B1 (en) * 1996-12-05 2005-03-15 Bio-Rad Pasteur Synthetic bioepitope compounds which can be used as standards in the biological assays of Troponin I
US7078486B2 (en) 1999-12-10 2006-07-18 Spectral Diagnostics, Inc. Single-chain polypeptides comprising troponin I and troponin C
WO2007040559A2 (fr) * 2004-11-17 2007-04-12 Bioveris Dosage par electrochimiluminescence
US7479278B2 (en) * 1998-10-21 2009-01-20 Spectral Diagnostics, Inc Troponin I polypeptide fragments and uses thereof
JP2012188403A (ja) * 2011-03-11 2012-10-04 Sanyo Chem Ind Ltd 凍結乾燥方法
US8993517B2 (en) 2001-12-21 2015-03-31 Human Genome Sciences, Inc. Albumin fusion proteins
CN111812326A (zh) * 2020-07-23 2020-10-23 四川携光生物技术有限公司 一种定量检测pd-l1与pd-1结合物含量的试剂盒
CN113125745A (zh) * 2019-12-31 2021-07-16 瑞博奥(广州)生物科技股份有限公司 一种心脏功能检测试剂盒

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2275774A (en) * 1993-02-23 1994-09-07 Pasteur Sanofi Diagnostics Stabilized composition of troponin
WO1995012672A1 (fr) * 1993-11-04 1995-05-11 Medical Research Council Production et utilisation de polypeptides marques au moyen de molecules de liaison

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2275774A (en) * 1993-02-23 1994-09-07 Pasteur Sanofi Diagnostics Stabilized composition of troponin
WO1995012672A1 (fr) * 1993-11-04 1995-05-11 Medical Research Council Production et utilisation de polypeptides marques au moyen de molecules de liaison

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
LARUE C ET AL: "NEW MONOCLONAL ANTIBODIES AS PROBES FOR HUMAN CARDIAC TROPONIN I: EPITOPIC ANALYSIS WITH SYNTHETIC PEPTIDES", MOLECULAR IMMUNOLOGY, vol. 29, no. 2, 1 January 1992 (1992-01-01), pages 271 - 278, XP000400710 *
OJIMA T ET AL: "AMINO ACID SEQUENCE OF C-TERMINAL 17 KDA CNBR-FRAGMENT OF AKAZARA SCALLOP TROPONIN-I", JOURNAL OF BIOCHEMISTRY, vol. 117, no. 1, January 1995 (1995-01-01), pages 158 - 161, XP002028679 *

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6867011B1 (en) * 1996-12-05 2005-03-15 Bio-Rad Pasteur Synthetic bioepitope compounds which can be used as standards in the biological assays of Troponin I
US6077676A (en) * 1997-12-18 2000-06-20 Spectral Diagnostics, Inc. Single-chain polypeptides comprising troponin I and troponin C
WO1999031235A1 (fr) * 1997-12-18 1999-06-24 Spectral Diagnostics, Inc. Polypeptides a chaine unique comprenant la troponine i et la troponine c
US7479278B2 (en) * 1998-10-21 2009-01-20 Spectral Diagnostics, Inc Troponin I polypeptide fragments and uses thereof
US7078486B2 (en) 1999-12-10 2006-07-18 Spectral Diagnostics, Inc. Single-chain polypeptides comprising troponin I and troponin C
WO2003025205A2 (fr) * 2001-09-19 2003-03-27 Medigene Ag Kinase regulee extracellulaire 2 (erk2)
WO2003025205A3 (fr) * 2001-09-19 2004-01-29 Medigene Ag Kinase regulee extracellulaire 2 (erk2)
US8993517B2 (en) 2001-12-21 2015-03-31 Human Genome Sciences, Inc. Albumin fusion proteins
US9296809B2 (en) 2001-12-21 2016-03-29 Human Genome Sciences, Inc. Albumin fusion proteins
US9221896B2 (en) 2001-12-21 2015-12-29 Human Genome Sciences, Inc. Albumin fusion proteins
EP1512695A1 (fr) * 2003-09-04 2005-03-09 BIOMAY Produktions- und Handels- Aktiengesellschaft Polypeptides hypoallergéniques à base de parvalbumin de poisson
WO2007040559A3 (fr) * 2004-11-17 2007-07-26 Bioveris Dosage par electrochimiluminescence
WO2007040559A2 (fr) * 2004-11-17 2007-04-12 Bioveris Dosage par electrochimiluminescence
JP2012188403A (ja) * 2011-03-11 2012-10-04 Sanyo Chem Ind Ltd 凍結乾燥方法
CN113125745A (zh) * 2019-12-31 2021-07-16 瑞博奥(广州)生物科技股份有限公司 一种心脏功能检测试剂盒
CN111812326A (zh) * 2020-07-23 2020-10-23 四川携光生物技术有限公司 一种定量检测pd-l1与pd-1结合物含量的试剂盒

Also Published As

Publication number Publication date
AU2667197A (en) 1997-11-07

Similar Documents

Publication Publication Date Title
Moroianu et al. The binding site of karyopherin alpha for karyopherin beta overlaps with a nuclear localization sequence.
Blatter et al. Domain organization of RNA polymerase α subunit: C-terminal 85 amino acids constitute a domain capable of dimerization and DNA binding
Méthot et al. A region rich in aspartic acid, arginine, tyrosine, and glycine (DRYG) mediates eukaryotic initiation factor 4B (eIF4B) self-association and interaction with eIF3
US4745055A (en) Fused protein for enzyme immunoassay system
WO1997039132A1 (fr) Preparations stabilisees de troponines humaines et modifications de ces troponines, procedes diagnostiques de dosage et trousses de dosage
WO1997039132A9 (fr) Preparations stabilisees de troponines humaines et modifications de ces troponines, procedes diagnostiques de dosage et trousses de dosage
Redwood et al. Binding and regulatory properties of expressed functional domains of chicken gizzard smooth muscle caldesmon
KR101645113B1 (ko) 가용성 면역반응성 트레포네마 팔리둠 ｔｐｎ４７ 항원
US20100291543A1 (en) Homogeneous in vitro fec assays and components
JP2006036782A (ja) トロポニンｉの生物学的適用における標準尺度として有用な合成ビエピトープ化合物
WO1986006742A1 (fr) Proteine fusionnee pour des systemes d'essais immunologiques a enzymes
CA2509484A1 (fr) Particules stabilisees de chimeres de hbc immunogenes
Watanabe et al. High-affinity binding of Escherichia coli SecB to the signal sequence region of a presecretory protein.
Hildebrand et al. Resolution of the steroid-binding and dimerization domains of human sex hormone-binding globulin by expression in Escherichia coli
Padilla et al. High-level expression of fully active human glutaredoxin (thioltransferase) in E. coli and characterization of Cys7 to Ser mutant protein
Novy et al. Expression of smooth muscle and nonmuscle tropomyosins in Escherichia coli and characterization of bacterially produced tropomyosins
CA2381439C (fr) Polypeptides a chaine unique comprenant des fragments n-terminal de troponine i et de troponine c
Asami et al. An approach to the removal of yeast specific O-linked oligo-mannoses from human midkine expressed in Pichia pastoris using site-specific mutagenesis
JPWO2017217514A1 (ja) 肝型脂肪酸結合蛋白質標品、該標品を評価する方法、該標品を用いる測定における肝型脂肪酸結合蛋白質に起因する測定値の変動幅を抑制する方法、肝型脂肪酸結合蛋白質、該蛋白質をコードするｄｎａ、該ｄｎａで形質転換された細胞、該蛋白質の製造方法、肝型脂肪酸結合蛋白質の検量線を作成する方法、及び該蛋白質を定量する方法
CN100489101C (zh) G-eGFP蛋白及其制备方法与应用
Käkönen et al. Purification and characterization of recombinant osteocalcin fusion protein expressed inEscherichia coli
SCHLOTMANN et al. Degradation of the DNA‐Binding Domain of Wild‐Type and i− dlac Repressors in Escherichia coli
Xiong et al. Purification and characteristics of recombinant mouse metallothionein-I from Escherichia coli
Jiang et al. Interaction of glucose transporter 1 with anion exchanger 1 in vitro
JP4193499B2 (ja) 組換え発光蛋白質およびその複合体

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA JP

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE

COP Corrected version of pamphlet

Free format text: PAGES 81-86,CLAIMS,ADDED

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: JP

Ref document number: 97537274

Format of ref document f/p: F

NENP Non-entry into the national phase

Ref country code: CA

122 Ep: pct application non-entry in european phase