WO1997035975A1 - Represseur de transcription du type e2f et adn qui le code - Google Patents

Represseur de transcription du type e2f et adn qui le code Download PDF

Info

Publication number
WO1997035975A1
WO1997035975A1 PCT/GB1997/000833 GB9700833W WO9735975A1 WO 1997035975 A1 WO1997035975 A1 WO 1997035975A1 GB 9700833 W GB9700833 W GB 9700833W WO 9735975 A1 WO9735975 A1 WO 9735975A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
nucleic acid
ema
substance
acid molecule
Prior art date
Application number
PCT/GB1997/000833
Other languages
English (en)
Inventor
Tony Kouzarides
Christian Hagemeier
Original Assignee
Cancer Research Campaign Technology Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GBGB9606284.9A external-priority patent/GB9606284D0/en
Application filed by Cancer Research Campaign Technology Limited filed Critical Cancer Research Campaign Technology Limited
Priority to AU21680/97A priority Critical patent/AU2168097A/en
Publication of WO1997035975A1 publication Critical patent/WO1997035975A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C07K14/4703—Inhibitors; Suppressors
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention relates to a novel transcription factor, to DNA encoding it and to the application of these in diagnosis and therapy in particular of proliferative disorders such as cancer, indications being that the gene is able to stimulate cell proliferation and has the characteristics of an oncogene.
  • E2F/DP family of transcription factors play a key role in regulating the mammalian cell cycle. They activate genes required for S-phase and in doing so can ultimately promote cell proliferation. Both E2F and DP family members have been shown to be oncogenic and E2F1 has been demonstrated to be a potent inducer of S-phase (Lam, E. -F. et al . Current Opinion in Cell Biology 1994, 6: 859-866) .
  • the transcription activation capacity (and hence the oncogenicity) of the E2F/DP family is kept in check by the Retinoblastoma tumour suppressor family of proteins (RB, pl07, 0130) .
  • RB Retinoblastoma tumour suppressor family of proteins
  • Members of this family bind to a transcriptional activation domain within the E2F protein.
  • the RB protein family members can silence the transcriptional activation capacity of the E2F/DP proteins and thus cause arrest in the Gl-phase of the cell cycle.
  • Release of RB from E2F/DP results in S-phase induction. This release is mediated by phosphoryla ion events (on RB and E2F) carried out by cyclin/CDK complexes towards the end of the Gl phase (Whyte, P. The retinoblastoma protein and its relatives. Seminars in Cancer Biology 1995, 6: 83-90) .
  • E2F1-5 There are five identified members of the E2F family (E2F1-5) and three members of the DP family (DPI-3) . All E2F members can form heterodimers with all DP members. These heterodimers can bind and transactivate the promoters of S- phase genes.
  • the E2F and DP proteins share a common class of DNA binding and dimersation domain which allows them to form heterodimers and bind "E2F" binding sites co-operatively.
  • the E2F family members have other sequences in common. They all have a highly conserved "marked box", whose function is unknown, and a transcriptional ' activation domain at the C-terminus which contains the binding site for the RB family of proteins (Fig. 4B) .
  • DP family of proteins do not possess any similarity to E2F proteins outside the DNA binding domain. However, they do contain highly conserved sequences which define this family.
  • the activity of the various E2F/DP heterodimers comes from the transcriptional activity of the E2F partner. No activation functions have been attributed to DP proteins.
  • the activation capacity of the E2F/DP complexes is negatively regulated by different members of the RB family: i.B binds and represses E2F1-3 whereas pl07 and pl30 can bind and repress E2F4 and ⁇ 2F5.
  • E2F-like sites within promoters, which act as negative regulatory elements. Mutagenesis of such sites leads to an increase in activity of the promoter (Lam E.W. and Watson R.J. (1993) EMBO J. , 12.7: 2705-2713, and Zwicker J. et. al., (1995), EMBO J. 14.18: 4514-4522) . Indeed there is evidence that the E2F-RB complex may negatively regulate expression of certain promoters (Weintraub et al . , Nature, (1992) 858, 259-261) .
  • RB can repress the basal activity of promoters even in the absence of E2F if it is directed to the promoter via a heterologous DNA binding domain (Weintraub S.J. et al . , Nature, 375, 812-815) .
  • E2F-like protein which has been called EMA.
  • This protein, EMA does not represent another E2F family member (i.e. it is not “E2F- related”) but is "E2F-like” because it shares some but not all the sequence characteristics of the E2F family.
  • Figure 1 shows the DNA sequence and predicted amino acid sequence of the new "E2F-like" murine clone EMA
  • Figure 2 shows the coding DNA sequence for human EMA.
  • Figure 3 shows the human EMA amino acid sequence encoded by the DNA sequence of Figure 2.
  • Figure 4a Amino-acid sequence of mouse EMA.
  • Figure 4 (a) Alignment of mouse EMA with dE2F (ref 10) , E2F-1 (refs 11, 12), E2F-2 (ref 13) , E2F-3 (ref 13) , E2F-4 (ref 6) and E2F-5 (ref 15) .
  • Solid bars on top of the aligned sequences indicate the DNA-binding, dimerisation and activation domain including the RB-binding site, as well as the Marked Box.
  • FIG. 1 is a diagrammatic representation of the sequences within EMA which show similarity to E2F family members, E2F1-5. This represents a schematic of the alignment in (a) showing the percentage of identical amino- acid residues within the DNA-binding (DBD) and dimerisation domain (DD) and the Marked Box (MB) between mouse EMA and each E2F family member. The activation domain of the E2Fs is shown in black.
  • DBD DNA-binding
  • DD dimerisation domain
  • MB Marked Box
  • Figure 4 (c) Northern blot analyses of EMA mRNA isolated from various tissues.
  • a mouse tissue Northern blot (Clontech) was probed with a 683 bp EMA cDNA probe
  • Each lane contains poly(A)+ RNA from the indicated tissues. Size markers are given on the left in kilobases. Reprobing of the identical blot with a GAPDH probe (bottom panel) " allowed quantitative evaluation of the signals shown as bar charts in the top panel.
  • EMA binds DP-1 in vi tro .
  • EMA amino acids 62-272
  • E2F-1 and human cytomegalovirus IE2 as positive and negative controls, respectively, were translated in reticulocyte lysate, radioactively labelled and subjected to a glutathione S-transferase (GST) -pulldown assay using GST-DP-1 and GST as indicated. 25% of the input protein is shown.
  • GST glutathione S-transferase
  • Figure 5a Rationale of a modified binding site selection assay.
  • Mixed bacterial lysates containing GST-EMA and GST-DP-1 were collected .on glutathione-agarose-beads prior to incubation with a pool of double stranded binding site selection oligonucleotides containing a randomised central portion (see Methods) .
  • Functional GST-EMA/GST-DP-l heterodimers on beads were expected to bind specific oligonucleotides (SO) presenting a high affinity binding site but not to non-specific oligonucleotides (NSO) .
  • SO specific oligonucleotides
  • NSO non-specific oligonucleotides
  • oligonucleotides were amplified via defined regions flanking the randomised core region of the double stranded oligonucleotides and re-incubated with the protein-loaded beads. ' This procedure was repeated four times before selected oligonucleotides were sequenced.
  • Figure 5(b) All sequences obtained through the binding site selection assay are shown. A statistical evaluation of each selected positic ⁇ h is given. The core region of the consensus sequence is boxed.
  • FIGS. 5 (c) and 5 (d) Gel retardation assay using the E2F site (TTTCGCGC) of the adenoviral E2 promoter (ref 16) or the double stranded oligonucleotide number 12 from the binding site selection assay (TTTCCCGC) . Probes were incubated with GST fusion proteins of E2F-1, DP-l and/or EMA as indicated. 1000 fold excess of specific (SC) and non ⁇ specific competitor (NC) was used as shown.
  • SC specific
  • NC non ⁇ specific competitor
  • Figure 6 EMA contains a transcriptional repressor activity.
  • Figure 6 (a) Constructs used in transient transfection assays.
  • FIG. 6(b) Transient transfection assays in Hela cells using 7 mg of G5TKCAT (ref 23) and 1 mg of control plasmid pSG5 (none) or 1 mg of GAL fusion plasmids as indicated. A typical result of a CAT assay is shown.
  • Figure 6(c) Average of three independent experiments (two for GALE2F284-359 and GALRB) . Quantitative analyses of CAT activity was done using a phosphoimager (Biorad) .
  • EMA is a cell cycle regulatory protein.
  • NIH3T3 cells were transfected with a CD20 expression plasmid (pSG5- CD20) in combination with CMV expression vectors pCMVBamNEO (control) , pCMVEMA (EMA) and pCMVE2F-l (E2F-1) . 24 hours after transfection cells were analysed by FACS. The DNA histograms show the cell cycle profiles of CD20-positive cells and contain data from at least 5000 cells each. EMA, was identified in a two hybrid screen in yeast cells as described in detail hereinafter.
  • the _cDNA clones of EMA, isolated in the two hybrid screen did not represent the full length gene.
  • the sequence of the clone isolated had high sequence similarity to the leucine zipper and marked box of the E2F family.
  • a full- length cDNA was isolated from a mouse cDNA library. This full length cDNA was sequenced and the sequence is shown in Figure 1 herein.
  • murine EMA contains a number of features that make it E2F-like: it has a basic DNA binding motif, a HLH region, a leucine zipper motif and a marked box ( Figures 1, 4a and 4b) .
  • the 819 base pair open reading frame translates into a protein of 272 amino-acids with a predicted molecular mass of 30 kDa.
  • sequence analysis indicates between 25% and 28% identity of EMA to E2F1-5 and drosophila E2F.
  • it also contains novel features which provide indication that its function is distinct from that of other E2F members. Firstly, it has a distinct N-terminus, unrelated to other E2F's.
  • EMA does not contain a transcriptional activation domain. The end of the EMA protein sequence falls just short of the transcriptional activation domain present at the C-terminus of all E2F proteins.
  • EMA can bind to the DPI protein.
  • EMA/DP1 heterodimers bind a novel binding site with the concensus sequence ttTCCCGCCtttt (EMA-binding site) .
  • the EMA protein can repress transcription. This is as a result of its N-terminal domain which has no sequence similarity to the E2F family.
  • the EMA-binding site represents a transcriptional repressor element .
  • EMA can induce cells to enter the S-phase of the cell cycle.
  • EMA is a repressor of transcription of genes which have EMA-binding sites
  • II has the characteristics of an oncogene since it is sufficient to induce S-phase
  • III EMA is not a relative of the E2F family but has distinct characteristics that make it a member of a novel subgroup of "E2F-like" genes.
  • EMA is a regulator of cell proliferation. Its ability to repress transcription is likely to be a novel mechanism by which it can control the cell cycle. Controlling or reversing the function of EMA should therefore result in the suppression of the cell's ability to proliferate.
  • the availability of the murine sequence can be used to obtain corresponding proteins from other species such as humans.
  • the murine sequence or a part thereof can be used as a probe to isolate genomic sequences from for example human cell sources (see for example Maniatis et al . 1982 Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press N.Y. Chapters 1-11) .
  • the sequence of Figure 1 could be used to design oligonucleotide primers in order to amplify cDNA of EMA from human cell sources using for example the polymerase chain reaction (PCR) .
  • PCR polymerase chain reaction
  • a human EMA encoding sequence is provided in Figure 2 with the encoded polypeptide sequence shown in Figure 3.
  • the human sequence was isolated by standard hybridisation methods using the mouse EMA sequence as a probe. Over the first 62 amino acids, 54 of the residues of the human EMA are identical with the mouse - as discernible by comparison of the amino acid sequences of Figure 1 and Figure 3. Furthermore, the encoding nucleic acid sequences are highly homogenous.
  • the detection of EMA provides for a diagnostic test for proliferative disorders involving disruption of cell-cycle and/or cell growth regulation, such as cancer, in particular by detecting elevated levels of RNA, DNA or protein in tumour cells.
  • detection of the mutation in an individual could be indicative of a predisposition to, e.g., cancer.
  • the detection could be carried out at the protein level, for example utilising antibodies which were specific for the EMA protein, or at the DNA level or RNA for example by using probes which recognise the EMA gene sequence.
  • the probes may be used as primers in an amplication process for example, using the polymerase chain reaction (PCR) .
  • the antibodies or probes or primers may be formed into a diagnostic kit.
  • the probes or primers used may comprise a nucleotide sequence which comprises or hybridises with at least a part of the sequence of Figure 1 and/or the human equivalent of said sequence ( Figure 2) .
  • the probe or primer will be of such a size that it specifically hybridizes with the sequence of Figure 1 and/or Figure 2 under stringent hybridisation conditions.
  • stringent hybridisation conditions are conventional in the art and include for example those defined in
  • EMA oncogenic properties
  • expression of EMA may be inhibited by administering an agent which inhibits expression of the EMA gene.
  • an agent which inhibits expression of the EMA gene.
  • An example of such an agent comprises an anti-sense DNA/RNA construct which is of sufficient length to hybridize to the sequence of Figure 1 and/or the human equivalent thereof ( Figure 2) and prevent, wholly or partially, expression of the EMA protein .
  • the effect of EMA may be countered at the protein level for example by administration of an blocking agent such as an antibody or antibody fragment which inhibits EMA function.
  • an blocking agent such as an antibody or antibody fragment which inhibits EMA function.
  • a dominant negative approach can be used to block the function of EMA.
  • agents which prevent the dimerisation with a partner of EMA (DP) or which prevent the binding of EMA to the E2F-like site may be employed.
  • Reagents of this type suitably comprise a peptide or a mimetic thereof .
  • the designing of mimetics to a known pharmaceutically active compound is a known approach to the development of pharmaceuticals based on a "lead" compound. This might be desirable where the active compound is difficult or expensive to synthesise or where it is unsuitable for a particular method of administration, eg peptides are unsuitable active agents for oral compositions as they tend to be quickly degraded by proteases in the alimentary canal.
  • Mimetic design, synthesis and testing is generally used to avoid randomly screening large number of molecules for a target property.
  • the pharmacophore Once the pharmacophore has been found, its structure is modelled to according its physical properties, eg stereochemistry, bonding, size and/or charge, using data from a range of sources, eg spectroscopic techniques, X-ray diffraction data and NMR. Computational analysis, similarity mapping (which models the charge and/or volume of a pharmacophore, rather than the bonding between atoms) and other techniques can be used in this modelling process.
  • a range of sources eg spectroscopic techniques, X-ray diffraction data and NMR.
  • Computational analysis, similarity mapping which models the charge and/or volume of a pharmacophore, rather than the bonding between atoms
  • other techniques can be used in this modelling process.
  • the three-dimensional structure of the ligand and its binding partner are modelled. This can be especially useful where the ligand and/or binding partner change conformation on binding, allowing the model to take account of this the design of the mimetic .
  • a template molecule is then selected onto which chemical groups which mimic the pharmacophore can be grafted.
  • the template molecule and the chemical groups grafted on to it can conveniently be selected so that the mimetic is easy to synthesise, is likely- to be pharmacologically acceptable, and does not degrade in vivo, while retaining the biological activity of the lead compound.
  • the mimetic or mimetics found by this approach can then be screened to see whether they have the target property, or to what extent they exhibit it. Further optimisation or modification can then be carried out to arrive at one or more final mimetics for in vi vo or clinical testing.
  • the agent may be administered to a patient in the form of a pharmaceutical composition for example in which the agent is combined with a pharmaceutically acceptable carrier or excipient .
  • Carriers may be solid or liquid such as water, saline or aqueous alcohol such as ethanol, as conventional in the art. Such compositions form a further aspect of the invention.
  • the administration may be systemic or targeted, the latter employing direct (eg topical) application of the therapeutic agent to the target cells or the use of targeting systems such as antibody or cell specific ligands. Targeting may be desirable for a variety of reasons; for example if the agent is unacceptably toxic, or if it would otherwise require too high a dosage, or if it would not otherwise be able to enter the target cel ls .
  • these agents could be produced in the target cells by expression from an encoding gene introduced into the cells, eg in a viral vector (a variant of the VDEPT technique - see below) .
  • the vector could be targeted to the specific cells to be treated, or it could contain regulatory elements which are switched on more or less selectively by the target cells.
  • the agent could be administered in a precursor form, for conversion to the active form by an activating agent produced in, or targeted to, the cells to be treated.
  • an activating agent produced in, or targeted to, the cells to be treated.
  • This type of approach is sometimes known as ADEPT or VDEPT; the former involving targeting the activating agent to the cells by conjugation to a cell- specific antibody, while the latter involves producing the activating agent, eg an enzyme, in a vector by expression from encoding DNA in a viral vector (see for example, EP-A- 415731 and WO 90/07936) .
  • a method of identifying a predisposition to cancer or other disorder of cell proliferation comprises probing DNA from a subject with a probe which comprises part or all of the corresponding wild type sequence of a gene which encodes EMA as described herein.
  • Peptide reagents of the invention can be prepared using conventional techniques. For example, they may be prepared using chemical techniques such as solid phase techniques, after which they are cleaved from the solid phase support such as resin and purified using chromatographic techniques such as high performance liquid chromatography.
  • the peptides are obtained by expression of nucleic acid which encodes them.
  • a nucleic acid in accordance with the invention is obtained either using chemical synthesis or obtained from natural sources and optionally subjected to amplification using for example PCR techniques.
  • the nucleic acid is incorporated into an expression vector or plasmid using conventional techniques and a host cell transformed with said vector, or plasmid.
  • Suitable host cells may be prokaryotic or eukaryotic. Transformed host cells are then cultured and EMA protein is recovered from the culture.
  • Such vectors, host cells and the preparation methods form further aspects of the invention.
  • telomere sequences e.g., a telomere sequence which has been modified
  • useful expression vectors include segments of chromosomal, non-chromosomal and synthetic DNA sequences, such as various known derivatives of SV40 and known bacterial plasmids, in particular plasmids from E_ ⁇ coli, such as col El,-pCRl, pBR322, pMB9, pET-3A and their derivatives, wider host range plasmids, e.g., RP4, phage DNAs, e.g., the numerous derivatives of phage ⁇ , e.g., NM989, and other DNA phages, e.g., M13 and filamentous single-stranded DNA phages, yeast plasmids, such as the 2 ⁇ plasmid or derivatives thereof, and vectors derived from combinations of plasmids and phage DNAs, such as plasmids which have been modified
  • Vectors suitably contain expression control sequences operatively linked to the nucleic acid of the invention.
  • expression control sequences include promoters, enhancers, splicing signals, and polyadenylation signals, depending upon the nature of the cells and the host cell .
  • Suitable promoters include the early and late promoters of SV40, adenovirus or cytomegalovirus immediate early promoter, the lac system, the trp system, the TAC or TRC system, T7 promoter whose expression is directed by T7 RNA polymerase, the major operator and promoter regions of page ⁇ , the control regions for fd coat protein, the promoter for 3-phosphoglycerate kinase or other glycolytic enzymes, the promoters of acid phosphatase, e.g., Pho5 , the promoters of the yeast ⁇ -mating factors, the polyhedron promoter of the baculovirus system.
  • expression control sequences would be the cytomegalovirus promoter or the adenovirus major late-promoter augmented by the SV40 enhancer.
  • Suitable host cells include conventional eukaryotic and prokaryotic hosts, such as strains of E. coli. Pseudomonas. Bacillus, Streptomyces, Saccharomyces, Trichodermas. and other fungi, animal cells, such as Chinese hamster ovary (“CHO") and mouse cells in culture, African green monkey cells, such as COS 1, COS 7, BSC 1, BSC 40, and BMT 10, insect cells in culture, human cells in culture and plant cells in culture.
  • CHO Chinese hamster ovary
  • African green monkey cells such as COS 1, COS 7, BSC 1, BSC 40, and BMT 10 insect cells in culture, human cells in culture and plant cells in culture.
  • nucleic acid molecule which has a nucleotide sequence encoding a polypeptide which includes an amino acid sequence shown for EMA in the figures.
  • Mouse EMA amino acid sequence is shown in Figure 1, along with mouse encoding DNA sequence.
  • Human EMA amino acid sequence- is shown in Figure 3 , the human encoding DNA sequence being shown in Figure 2.
  • the coding sequence may be that shown for EMA in the figures, or it may be a mutant, variant, derivative or allele of the sequence.
  • the sequence may differ from that shown by a change which is one or more of addition, insertion, deletion and substitution of one or more nucleotides of the sequence shown. Changes to a nucleotide sequence may result in an amino acid change at the protein level, or not, as determined by the genetic code.
  • nucleic acid according to the present invention may include a sequence different from the sequence shown for EMA in the figures yet encode a polypeptide with the same amino acid sequence.
  • the amino acid sequence of the complete mouse EMA polypeptide shown in the figures consists of 272 residues, while the human EMA polypeptide shown in Figure 3 consists of 281 residues.
  • the encoded polypeptide may comprise an amino acid sequence which differs by one or more amino acid residues from the amino acid sequence shown for EMA in the figures.
  • Nucleic acid encoding a polypeptide which is an amino acid sequence mutant, variant, derivative or allele of the sequence shown for EMA in the figures is further provided by the present invention. Such polypeptides are discussed below. Nucleic acid encoding such a polypeptide may show in its coding sequence greater than about 60% homology with the coding sequence shown for EMA in the figures, greater than about 70% homology, greater than about 80% homology, greater than about 90% homology or greater than about 95% homology.
  • E2Fsl-5 are excluded from the present invention.
  • EMA is functionally distinct from E2F family members.
  • EMA is a transcriptional repressor.
  • nucleic acid according to the present invention is provided as an isolate, in isolated and/or purified form, or free or substantially free of material with which it is naturally associated, such as free or substantially free of nucleic acid flanking the gene in the human genome, except possibly one or more regulatory sequence (s) for expression.
  • Nucleic acid may be wholly or partially synthetic and may include genomic DNA, cDNA or RNA. Where nucleic acid according to the invention includes RNA, reference to the sequence shown should be construed as reference to the RNA equivalent, with U substituted for T.
  • nucleic acid sequences encoding all or part of the EMA gene and/or its regulatory elements can be readily prepared by the skilled person using the information and references contained herein and techniques known in the art (for example, see Sambrook, Fritsch and Maniatis, "Molecular
  • the sequences can be incorporated in a vector having control sequences operably linked to the EMA nucleic acid to control its expression.
  • the vectors may include other sequences such as promoters or enhancers to drive the expression of the inserted nucleic acid, nucleic acid sequences so that the polypeptide with EMA function is produced as a fusion and/or nucleic acid encoding secretion signals so that the polypeptide produced in the host cell is secreted from the cell.
  • the polypeptide can then be obtained by transforming the vectors into host cells in which the vector is functional, culturing the host cells so that the polypeptide is produced and recovering the polypeptide from the host cells or the surrounding medium.
  • Prokaryotic and eukaryotic cells are used for this purpose in the art, including strains of E. coli, yeast, and eukaryotic cells such as COS or CHO cells.
  • the choice of host cell can be used to control the properties of the polypeptide expressed in those cells, e.g. controlling where the polypeptide is deposited in the host cells or affecting properties such as its glycosylation.
  • PCR techniques for the amplification of nucleic acid are described in US Patent No. 4,683,195. In general, such techniques require that sequence information from the ends of the target sequence is known to allow suitable forward and reverse oligonucleotide primers to be designed to be identical or similar to the polynucleotide sequence that is the target for the amplification.
  • PCR comprises steps of denaturation of template nucleic acid (if double-stranded) , annealing of primer to target, and polymerisation.
  • the nucleic acid probed or used as template in the amplification reaction may be genomic DNA, cDNA or RNA.
  • PCR can be used to amplify specific sequences from genomic DNA, specific RNA sequences and cDNA transcribed from mRNA, bacteriophage or plasmid sequences.
  • the EMA nucleic acid sequences provided herein readily allow the skilled person to design PCR primers .
  • References for the general use of PCR techniques include Mullis et al, Cold Spring Harbor Symp. Quant. Biol., 51:263, (1987), Ehrlich (ed) , PCR technology, Stockton Press, NY, 1989, Ehrlich et al, Science, 252:1643-1650, (1991) , "PCR protocols; A Guide to Methods and Applications", Eds. Innis et al, Academic Press, New York, (1990) .
  • antisense oligonucleotide sequences based on the EMA nucleic acid sequences described herein.
  • Antisense oligonucleotides may be designed to hybridise to the complementary sequence of nucleic acid, pre-mRNA or mature mRNA, interfering with the production of polypeptide encoded by a given DNA sequence (e.g. either native polypeptide or a mutant form thereof) , so that its ⁇ expression is reduce or prevented altogether.
  • antisense techniques can be used to target the control sequences of the EMA gene, e.g.
  • antisense oligonucleotides can interfere with EMA control sequences.
  • the construction of antisense sequences and their use is described in Peyman and Ulman, Chemical Reviews, 90:543-584, (1990) , and Crooke, Ann. Rev. Pharmacol. Toxicol. , 32:329- 376, (1992) .
  • an oligonucleotide e.g. for use in PCR or anti-sense regulation, may particularly be designed to be complementary for the N-terminal region of EMA,which is not found in members of the E2F family.
  • the nucleic acid sequences provided for EMA in the figures are useful for identifying nucleic acid of interest (and which may be according to the present invention) in a test sample.
  • the present invention provides a method of obtaining nucleic acid of interest, the method including hybridisation of a probe, particularly an EMA-specific probe, having a sequence which is a fragment of the sequence shown in the figures or a complementary sequence, to target nucleic acid.
  • Hybridisation is generally followed by identification of successful hybridisatrion and isolation of nucleic acid which has hybridised to the probe, which may involve one or more steps of PCR.
  • Nucleic acid according to the present invention is obtainable using one or more oligonucleotide probes or primers designed to hybridise with one or more fragments of the nucleic acid sequence shown in the figures, particularly fragments of relatively rare sequence, based on codon usage or statistical analysis.
  • a primer designed to hybridise with a fragment of the nucleic acid sequence shown in the above figures may be used in conjunction with one or more oligonucleotides designed to hybridise to a sequence in a cloning vector within which target nucleic acid has been cloned, or in so-called "RACE" (rapid amplification of cDNA ends) in which cDNA' s in a library are ligated to an oligonucleotide linker and PCR is performed using a primer which hybridises with the sequence shown in the figures and a primer which hybridises to the oligonucleotide linker.
  • RACE rapid amplification of cDNA ends
  • Such oligonucleotide probes or primers, as well as the full- length sequence (and mutants, alleles, variants and derivatives) are also useful in screening a test sample containing nucleic acid for the presence of alleles, mutants and variants, especially those that confer susceptibility or predisposition to proliferative disorders, including cancers, the probes hybridising with a target sequence from a sample obtained from the individual being tested.
  • the conditions of the hybridisation can be controlled to minimise non-specific binding, and preferably stringent to moderately stringent hybridisation conditions are preferred.
  • the skilled person is readily able to design such probes, label them and devise suitable conditions for the hybridisation reactions, assisted by textbooks such as Sambrook et al (1989) and Ausubel et al (1992) .
  • the probes may also be used to determine whether mRNA encoding EMA is present in a cell or tissue.
  • Nucleic acid isolated and/or purified from one or more cells may be probed under conditions for selective hybridisation and/or subjected to a specific nucleic acid amplification reaction such as the polymerase chain reaction (PCR) .
  • PCR polymerase chain reaction
  • cloning it may be necessary for one or more gene fragments to be ligated to generate a full-length coding sequence. Also, where a full-length encoding nucleic acid molecule has not been obtained, a smaller molecule representing part of the full molecule, may be used to obtain full-length clones. Inserts may be prepared from partial cDNA clones and used to screen cDNA libraries. The full-length clones isolated may be subcloned into expression vectors and activity assayed by transfection into suitable host cells, e.g. with a reporter plasmid.
  • a method may include hybridisation of one or more (e.g. two) probes or primers to target nucleic acid. Where the nucleic acid is double-stranded DNA, hybridisation will generally be preceded by denaturation to produce single-stranded DNA.
  • the hybridisation may be as part of a PCR procedure, or as part of a probing procedure not involving PCR.
  • An example procedure would be a combination of PCR and low stringency hybridisation.
  • a screening procedure chosen from the many available to those skilled in the art, is used to identify successful hybridisation events and isolated hybridised nucleic acid.
  • Binding of a probe to target nucleic acid may be measured using any of a variety of techniques at the disposal of those skilled in the art.
  • probes may be radioactively, fluorescently or enzymatically labelled.
  • Other methods not employing labelling of probe include examination of restriction fragment length polymorphisms, amplification using PCR, RNAase cleavage and allele specific oligonucleotide probing.
  • Probing may employ the standard Southern blotting technique. For instance DNA may be extracted from cells and digested with different restriction enzymes. Restriction fragments may then be separated-by electrophoresis on an agarose gel, before denaturation and transfer to a nitrocellulose filter. Labelled probe may be hybridised to the DNA fragments on the filter and binding determined. DNA for probing may be prepared from RNA preparations from cells.
  • Preliminary experiments may be performed by hybridising under low stringency conditions various probes to Southern blots of DNA digested with restriction enzymes. Suitable conditions would be achieved when a large number of hybridising fragments were obtained while the background hybridisation was low. Using these conditions nucleic acid libraries, e.g. cDNA libraries representative of expressed sequences, may be searched.
  • oligonucleotide probes or primers may be designed, taking into account the degeneracy of the genetic code, and, where appropriate, codon usage of the organism from the candidate nucleic acid is derived.
  • An oligonucleotide for use in nucleic acid amplification may have about 10 or fewer codons (e.g. 6, 7 or 8) , i.e. be about 30 or fewer nucleotides in length (e.g. 18, 21 or 24) .
  • Generally specific primers are upwards of 14 nucleotides in length, but not more than 18- 20. Those skilled in the art are well versed in the design of primers for use processes such as PCR.
  • oligonucleotides may be used in anti-sense regulation, as discussed above, though longer polynucleotides may also be used.
  • a further aspect of the present invention provides an oligonucleotide or polynucleotide fragment of the nucleotide sequence shown for EMA in the figures or a complementary sequence, in particular for use in a method of obtaining and/or screening nucleic acid, and/or anti-sense regulation of gene expression.
  • the sequences referred to above may be modified by addition, substitution, insertion or deletion of one or more nucleotides, but preferably without abolition of ability to hybridise selectively with nucleic acid with the sequence shown for EMA in the figures, that is wherein the degree of homology of the oligonucleotide or polynucleotide with the sequence given is sufficiently high.
  • oligonucleotides according to the present invention that are fragments of the sequences shown for EMA in the figures, or any allele associated with susceptibility to cancer or other disorder of cell proliferation, are at least about 10 nucleotides in length, more preferably at least about 15 nucleotides in length, more preferably at least about 20 nucleotides in length.
  • fragments themselves individually represent aspects of the present invention.
  • Fragments and other oligonucleotides may be used as primers or probes as discussed but may also be generated (e.g. by PCR) in methods concerned with determining the presence in a test sample of a sequence indicative of susceptibility to cancer or other disorder of cell-cycle regulation.
  • nucleic acid in diagnostic and/or prognostic contexts, for instance in determining susceptibility to, e.g., cancer, and other methods concerned with determining the presence of sequences indicative of, e.g., cancer susceptibility are discussed below.
  • Nucleic acid according to the present invention may in principle be used in methods of gene therapy, for instance in treatment of individuals with the aim of preventing or curing (wholly or partially) cancer or other disorder involving loss of proper regulation of the cell-cycle and/or cell growth.
  • Nucleic acid according to the present invention such as a full-length coding sequence or oligonucleotide probe or primer, may be provided as part of a kit, e.g. in a suitable container such as a vial in which the contents are protected from the external environment.
  • the kit may include instructions for use of the nucleic acid, e.g. in PCR and/or a method for determining the presence of nucleic acid of interest in a test sample.
  • a kit wherein the nucleic acid is intended for use in PCR may include one or more other reagents required for the reaction, such as polymerase, nucleosides, buffer solution etc.
  • the nucleic acid may be labelled.
  • a kit for use in determining the presence or absence of nucleic acid of interest may include one or more articles and/or reagents for performance of the method, such as means for providing the test sample itself, e.g. a swab for removing cells from the buccal. cavity or a syringe for removing a blood sample (such components generally being sterile) .
  • the present invention provides an apparatus for screening for EMA nucleic acid, the apparatus comprising storage means including the EMA nucleic acid sequence as set out in the figures, or a fragment thereof, the stored sequence being used to compare the sequence of the test nucleic acid to determine the presence of mutations.
  • a convenient way of producing a polypeptide according to the present invention is to express nucleic acid encoding it, by use of the nucleic acid in an expression system. The use of expression system has reached an advanced degree of sophistication today.
  • the present invention also encompasses a method of making a polypeptide (as disclosed) , the method including expression from nucleic acid encoding the polypeptide (generally nucleic acid according to the invention) .
  • This may conveniently be achieved by growing a host cell in culture, containing such a vector, under appropriate conditions which cause or allow expression of the polypeptide.
  • Polypeptides may also be expressed in in vitro systems, such as reticulocyte lysate.
  • Suitable host cells include bacteria, eukaryotic cells such as mammalian and yeast, and baculovirus systems.
  • Mammalian cell lines available in the art for expression of a heterologous polypeptide include Chinese hamster ovary cells, HeLa cells, baby hamster kidney cells, COS cells and many others.
  • a common, preferred bacterial host is E. coli.
  • Suitable vectors can be chosen or constructed, containing appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate.
  • Vectors may be plasmids, viral e.g. 'phage, or phagemid, as appropriate.
  • plasmids viral e.g. 'phage, or phagemid, as appropriate.
  • a further aspect of the present invention provides a host cell containing nucleic acid as disclosed herein.
  • the nucleic acid of the invention may be integrated into the genome (e.g. chromosome) of the host cell. Integration may be promoted by inclusion of sequences which promote recombination with the genome, in accordance with standard techniques.
  • the nucleic acid may be on an extra-chromosomal vector within the cell.
  • a still further aspect provides a method which includes introducing the nucleic acid into a host cell.
  • the introduction which may (particularly for in vi tro introduction) be generally referred to without limitation as "transformation", may employ any available technique.
  • suitable techniques may include calcium phosphate transfecti ⁇ h, DEAE-Dextran, electroporation, liposome-mediated transfection and transduction using retrovirus or other virus, e.g. vaccinia or, for insect cells, baculovirus.
  • suitable techniques may include calcium chloride transformation, electroporation and transfection using bacteriophage.
  • direct injection of the nucleic acid could be employed.
  • Marker genes such as antibiotic resistance or sensitivity genes may be used in identifying clones containing nucleic acid of interest, as is well known in the art.
  • the introduction may be followed by causing or allowing expression from the nucleic acid, e.g. by culturing host cells (which may include cells actually transformed although more likely the cells will be descendants of the transformed cells) under conditions for expression of the gene, so that the encoded polypeptide is produced. If the polypeptide is expressed coupled to an appropriate signal leader peptide it may be secreted from the cell into the culture medium.
  • a polypeptide may be isolated and/or purified from the host cell and/or culture medium, as the case may be, and subsequently used as desired, e.g. in the formulation of a composition which may include one or more additional components, such as a pharmaceutical composition which includes one or more pharmaceutically acceptable excipient ⁇ , vehicles or carriers ( e . g . see below) .
  • nucleic acid may take place in vivo by way of gene therapy, as discussed below.
  • a host cell containing nucleic acid according to the present invention may be comprised (e.g. in the soma) within an organism which is an animal, particularly a mammal, which may be human or non-human, such as rabbit, guinea pig, rat, mouse or other•rodent, cat, dog, pig, sheep, goat, cattle or horse, or which is a bird, such as. a chicken. Genetically modified or transgenic animals or birds comprising such a cell are also provided as further aspects of the present invention.
  • This may have a therapeutic aim.
  • the presence of a mutant, allele or variant sequence within cells of an organism, particularly when in place of a homologous endogenous sequence, may allow the organism to be used as a model in testing and/or studying the role of the EMA gene or substances which modulate activity of the encoded polypeptide in vitro, indicated to be of therapeutic potential .
  • host cells may be used as a nucleic acid factory to replicate the nucleic acid of interest in order to generate large amounts of it. Multiple copies of nucleic acid of interest may be made within a cell when coupled to an amplifiable gene such as .DHFR.
  • Host cells transformed with nucleic acid of interest may be cultured under suitable conditions, e.g. in a fermenter, taken from the culture and subjected to processing to purify the nucleic acid. Following purification, the nucleic acid or one or more fragments thereof may be used as desired, for instance in a diagnostic or prognostic assay as discussed elsewhere herein.
  • a further aspect of the present invention provides a polypeptide which has the amino acid sequence shown for EMA in the figures, which may be in isolated and/or purified form, free or substantially free of material with which it is naturally associated, such as other polypeptides or such as human polypeptides other than EMA polypeptide or (for example if produced by expression in a prokaryotic cell) lacking in native glycosylation, e.g. unglycosylated.
  • Polypeptides which are amino acid sequence variants, alleles, derivatives or mutants are also provided by the present invention.
  • a polypeptide which is a variant, allele, derivative or mutant may have an amino acid sequence which differs from that given for EMA in the figures by one or more of addition, substitution, deletion and insertion of one or more amino acids.
  • Preferred such polypeptides have EMA function, as discussed herein.
  • Preferred polypeptides may have immunological cross-reactivity with an antibody reactive the EMA polypeptide for which the sequence is given in the figures, particularly an N-terminal portion such as that shown to have transcriptional repressor activity.
  • Preferred polypeptides may share an epitope with the EMA polypeptide for which the amino acid sequence is shown in the figures (as determined for example by immunological cross-reactivity between the two polypeptides) , particulary an N-terminal portion such as that shown to have transcriptional repressor activity.
  • a polypeptide according to the invention may be immunologically distinct from E2F polypeptides.
  • a polypeptide which is an amino acid sequence variant, allele, derivative or mutant of the amino acid sequence shown for EMA in the figures may comprise an amino acid sequence which shares greater than about 35% sequence identity with the sequence shown, greater than about 40%, greater than about 50% " , greater than about 60%, greater than about 70%, greater than about 80%, greater than about 90% or greater than about 95%.
  • the sequence may share greater than about 60% similarity, greater than about 70% similarity, greater than about 80% similarity, greater than about 90% similarity or greater than about 95% similarity with the amino acid sequence shown for EMA in the figures.
  • Particular amino acid sequence variants may differ from those shown for EMA in figures by insertion, addition, substitution or deletion of 1 amino acid, 2, 3, 4, 5-10, 10- 20 20-30, 30-50, 50-100, 100-150, or more than 150 amino acids.
  • Homology and/or identity percentages may be considered over the full-length of the protein, but may be considered over only a portion, such as a region which has transcriptional repressor activity.
  • the above considerations of homologies may in certain embodiments be made in relation to an N-terminal portion of the EMA- polypeptide for which the sequence is shown in the figures, particular a portion of about 20 amino acids, or about 30 amino acids, or about 40 amino acids, or about 50 amino acids, or about 60 amino acids, or the 62 amino acid portion used in the experiments described below.
  • the present invention also includes active portions, fragments, derivatives and functional mimetics of the EMA polypeptides of the invention.
  • An "active portion” or EMA polypeptide means a peptide which is less than said full length polypeptide, but which retains a biological activity of EMA, particularly transcriptional repressor function.
  • a "fragment" of the EMA polypeptide means a stretch of amino acid residues of at least about five to seven contiguous amino acids, often at least about seven to nine contiguous amino acids, typically at least about nine to 13 contiguous amino acids and, most preferably, at least about 20 to 30 or more contiguous amino acids, e.g. about 40 amino acids, about 50 amino acids, about 60 amino acids, or 62 amino acis. Fragments of the EMA polypeptide sequence may include antigenic determinants or epitopes useful for raising antibodies to a portion of the EMA amino acid sequence.
  • a “derivative" of the EMA polypeptide or a fragment thereof means .a polypeptide modified by varying the amino acid sequence of the protein, e.g. by manipulation of the nucleic acid encoding the protein or by altering the protein itself. Such derivatives of the natural amino acid sequence may involve insertion, addition, deletion or substitution of one or more amino acids, without fundamentally altering the essential activity of the wild type polypeptide.
  • “Functional mimetic” means a substance which may not contain an active portion of the EMA amino acid sequence, and probably is not a peptide at all, but which retains the essential biological activity of natural EMA polypeptide. The design and screening of candidate mimetics is described in detail above.
  • a polypeptide according to the present invention may be isolated and/or purified (e.g. using an antibody) for instance after production by expression from encoding nucleic acid (for which see below) .
  • Polypeptides according to the present invention may also be generated wholly or partly by chemical synthesis.
  • the isolated and/or purified polypeptide may be used in formulation of a composition, which may include at least one additional component, for example a pharmaceutical composition including a pharmaceutically acceptable excipient, vehicle or carrier.
  • a composition including a polypeptide according to the invention may be used in prophylactic and/or therapeutic treatment as discussed below.
  • a polypeptide, peptide fragment, allele, mutant or variant according to the present invention may be used as an immunogen or otherwise in obtaining specific antibodies.
  • Antibodies are useful in purification and other manipulation of polypeptides and peptides, diagnostic screening and therapeutic contexts. This is discussed further below.
  • a polypeptide according to the present invention may be used in screening for molecules which affect or modulate its activity or function. Such molecules may be useful in a therapeutic (possibly-including prophylactic) context.
  • a further important use of the EMA polypeptides is in raising antibodies that have the property of specifically binding to the EMA polypeptides, or fragments or active portions thereof.
  • Monoclonal antibodies can be subjected to the techniques of recombinant DNA technology to produce other antibodies or chimeric molecules which retain the specificity of the original antibody. Such techniques may involve introducing DNA encoding the immunoglobulin variable region, or the complementarity determining regions (CDRs) , of an antibody to the constant regions, or constant regions plus framework regions, of a different immunoglobulin. See, for instance, EP-A-184187, GB-A-2188638 or EP-A-239400.
  • a hybridoma producing a monoclonal antibody may be subject to genetic mutation or other changes, which may or may not alter the binding specificity of antibodies produced.
  • EMA polypeptides enable for the first time the production of antibodies able to bind it specifically, particularly antibodies which do not bind E2F polypeptides such as those for which the sequences are shown in the figures.
  • a further aspect of the present invention provides an antibody able to bind specifically to the EMA polypeptide whose sequence is given in figures.
  • Such an antibody may be specific in the sense of being able to distinguish between the polypeptide it is able to bind and other human polypeptides for which it has no or substantially no binding affinity (e.g. a binding affinity of about lOOOx worse) .
  • Specific antibodies bind an epitope on the molecule which is either not present or is not accessible on other molecules.
  • Antibodies according to the present invention may be specific for the wild-type polypeptide.
  • Antibodies according to the invention may be specific for a particular mutant, variant, allele or derivative polypeptide as between that molecule and the wild-type polypeptide, so as to be useful in diagnostic and prognostic methods as discussed below.
  • Antibodies are also useful in purifying the polypeptide or polypeptides to which they bind, e.g. following production by recombinant expression from encoding nucleic acid.
  • Preferred antibodies according to the invention are isolated, in the sense of being free from contaminants such as antibodies able to bind other polypeptides and/or free of serum components. Monoclonal antibodies are preferred for some purposes, though polyclonal antibodies are within the scope of the present invention.
  • Antibodies may be obtained using techniques which are standard in the art. Methods of producing antibodies include immunising a mammal (e.g. mouse, rat, rabbit, horse, goat, sheep or monkey) with the protein or a fragment thereof. Antibodies may be obtained from immunised animals using any of a variety of techniques known in the art, and screened, preferably using binding of antibody to antigen of interest. For instance, Western blotting techniques or immunoprecipitation may be used (Armitage et al, Nature,
  • Isolation of antibodies and/or antibody- producing cells from an animal. may be accompanied by a step of sacrificing the animal.
  • an antibody specific for a protein may be obtained from a recombinantly produced library of expressed immunoglobulin variable domains, e.g. using lambda bacteriophage or filamentous bacteriophage which display functional immunoglobulin binding domains on their surfaces; for instance see WO92/01047.
  • the library may be naive, that is constructed from sequences obtained from an organism which has not been immunised with any of the proteins (or fragments) , or may be one constructed using sequences obtained from an organism which has been exposed to the antigen of interest .
  • Antibodies according to the present invention may be modified in a number of ways. Indeed the term “antibody” should be construed as covering any binding substance having a binding domain with the required specificity. Thus the invention covers antibody fragments, derivatives, functional equivalents and homologues of antibodies, including synthetic molecules and molecules whose shape mimics that of an antibody enabling it to bind an antigen or epitope.
  • Example antibody fragments capable of binding an antigen or other binding partner are the Fab fragment consisting of the VL, V ⁇ , Cl and CHI domains; the Fd fragment consisting of the VH and CHI domains; the Fv fragment consisting of the VL and VH domains of a single arm of an antibody; the dAb fragment which consists of a VH domain; isolated CDR regions and F(ab')2 fragments, a bivalent fragment including two Fab fragments linked by a disulphide bridge at the hinge region.
  • Single chain Fv fragments are also included.
  • a hybridoma producing a monoclonal antibody according to the present invention may be subject to genetic mutation or other changes. It will further be understood by those skilled in the art that a monoclonal antibody can be subjected to the techniques of recombinant DNA technology to produce other antibodies or chimeric molecules which retain the specificity of the original antibody. Such techniques may involve introducing DNA encoding the immunoglobulin variable region, or the complementarity determining regions (CDRs) , of an antibody to the constant regions, or constant regions plus framework regions, of a different immunoglobulin. See, for instance, EP-A-184187, GB-A- 2188638 or EP-A-0239400. Cloning and expression of chimeric antibodies are described in EP-A-0120694 and EP-A-0125023.
  • Hybridomas capable of producing antibody with desired binding characteristics are within the scope of the present invention, as are host cells, eukaryotic or prokaryotic, containing nucleic acid encoding antibodies (including antibody fragments) and capable of their expression.
  • the invention also provides methods of production of the antibodies including growing a cell capable of producing the antibody under conditions in which the antibody is produced, and preferably secreted.
  • the reactivities of antibodies on a sample may be determined by any appropriate means. Tagging with individual reporter molecules is one possibility.
  • the reporter molecules may directly or indirectly generate detectable, and preferably measurable, signals.
  • the linkage of reporter molecules may be directly or indirectly, covalently, e.g. via a peptide bond or non-covalently. Linkage via a peptide bond may be as a result of recombinant expression of a gene fusion encoding antibody and reporter molecule.
  • fluorochromes include fluorescein, rhodamine, phycoerythrin and Texas Red.
  • Suitable chromogenic dyes include diaminobenzidine.
  • Other reporters include macro olecular colloidal particles or particulate material such as latex beads that are coloured, magnetic or paramagnetic, and biologically or chemically active agents that can directly or indirectly cause detectable signals to be visually observed, electronically detected or otherwise recorded.
  • These molecules may be enzymes which catalyse reactions that develop or change colours or cause changes in electrical properties, for example. They may be molecularly excitable, such that electronic transitions between energy states result in characteristic spectral absorptions or emissions. They may include chemical entities used in conjunction with biosensors. Biotin/avidin or biotin/streptavidin and alkaline phosphatase detection systems may be employed.
  • the mode of determining binding is not a feature of the present invention and those skilled in the art are able to choose a suitable mode according to their preference and general knowledge.
  • Antibodies according to the present invention may be used in screening for the presence of a polypeptide, for example in a test sample containing cells or cell lysate as discussed, and may be used in purifying and/or isolating a polypeptide according to the present invention, for instance following production of the polypeptide by expression from encoding nucleic acid therefor. Antibodies may modulate the activity of the polypeptide to which they bind and so, if that polypeptide has a deleterious effect in an individual, may be useful in a therapeutic context (which may include prophylaxis) .
  • An antibody may be provided in a kit, which may include instructions for use of the antibody, e.g. in determining the presence of a particular substance in a test sample.
  • One or more other reagents may be included, such as labelling molecules, buffer solutions, elutants and so on. Reagents may be provided within containers which protect them from the external environment, such as a sealed vial.
  • a number of methods are known in the art for analysing biological samples from individuals to determine whether the individual carries an EMA allele predisposing them to disease.
  • the purpose of such analysis may be used for diagnosis or prognosis, and serve to detect the presence of, e.g., an existing cancer, to help identify the type of cancer, to assist a physician in determining the severity or likely course of the cancer and/or to optimise treatment of it.
  • the methods can be used to detect alleles that are statistically associated with a susceptibility to cancer or other proliferative disorder in the future, e.g. early onset cancer, identifying individuals who would benefit from regular screening to provide early diagnosis of cancer.
  • the methods divide into those screening for the presence of EMA nucleic acid sequences and those that rely on detecting the presence or absence of EMA polypeptide.
  • the methods make use of biological samples from individuals that are suspected of contain the nucleic acid sequences or polypeptide. Examples of biological samples include blood, plasma, serum, tissue samples, tumour samples, saliva and urine.
  • Exemplary approaches for detecting EMA nucleic acid or polypeptides include:
  • a “specific binding pair” comprises a specific binding member (sbm) and a binding partner (bp) which have a particular specificity for each other and which in normal conditions bind to each other in preference to other molecules.
  • specific binding pairs are antigens and antibodies, molecules and receptors and complementary nucleotide sequences. The skilled person will be able to think of many other examples and they do not need to be listed here. Further, the term “specific binding pair” is also applicable where either or both of the specific binding member and the binding partner comprise a part of a larger molecule.
  • the specific binding pair are nucleic acid sequences, they will be of a length to hybridise to each other under the conditions of the assay, preferably greater than 10 nucleotides long, more preferably greater than 15 or 20 -nucleotides long.
  • the EMA nucleic acid in the sample will initially be amplified, e.g. using PCR, to increase the amount of the analyte as compared to other sequences present in the sample. This allows the target sequences to be detected with a high degree of sensitivity if they are present in the sample. This initial step may be avoided by using highly sensitive array techniques that are becoming increasingly important in the art .
  • the identification of the EMA gene and its implication with disorders of cell proliferation paves the way for aspects of the present invention to provide the use of materials and methods, such as are disclosed and discussed above, for establishing the presence or absence in a test sample of an variant form of the gene, in particular an allele or variant specifically associated with cancer. This may be for diagnosing a predisposition of an individual to cancer. It may be for diagnosing cancer of a patient with the disease as being associated with the gene.
  • a variant form of the gene may contain one or more insertions, deletions, " substitutions and/or additions of one or more nucleotides compared with the wild-type sequence which may or may not disrupt the gene function. Differences at the nucleic acid level are not necessarily reflected by a difference in the amino acid sequence of the encoded polypeptide. However, a mutation or other difference in a gene may result in a frame-shift or stop codon, which could seriously affect the nature of the polypeptide produced, or a point mutation or gross mutational change to the encoded polypeptide, including insertion, deletion, substitution and/or addition of one or more amino acids or regions in the polypeptide.
  • a mutation in a promoter sequence or other regulatory region may prevent or reduce expression from the gene or affect the processing or stability of the mRNA transcript.
  • Tests may be carried out on preparations containing genomic DNA, cDNA and/or mRNA.
  • Testing cDNA or mRNA has the advantage of the complexity of the nucleic acid being reduced by the absence of intron sequences, but the possible disadvantage of extra time and effort being required in making the preparations.
  • RNA is more difficult to manipulate than DNA because of the wide-spread occurrence of RN' ases .
  • Nucleic acid in a test sample may be sequenced and the sequence compared with the sequence shown in the figures, to determine whether or not a difference is present. If so, the difference can be compared with known susceptibility alleles to determine whether the test nucleic acid contains one or more of the variations indicated, or the difference can be investigated for association with cancer.
  • nucleic acid for testing may be prepared from nucleic acid removed from cells or in a library using a variety of other techniques such as restriction enzyme digest and electrophoresis.
  • Nucleic acid may be screened using a variant- or allele-specific probe.
  • a probe corresponds in sequence to a region of the EMA gene, or its complement, containing a sequence alteration known to be associated with susceptibility to cancer or other proliferative disorder.
  • specific hybridisation of such a probe to test nucleic acid is indicative of the presence of the sequence alteration in the test nucleic acid.
  • more than one probe may be used on the same test sample.
  • Allele- or variant-specific oligonucleotides may similarly be used in PCR to specifically amplify particular sequences if present in a test sample.
  • Assessment of whether a PCR band contains a gene variant may be carried out in a number of ways familiar to those skilled in the art.
  • the PCR product may for instance be treated in a way that enables one to display the mutation or polymorphism on a denaturing polyacrylamide DNA sequencing gel, with specific bands that are linked to the gene variants being selected.
  • An alternative or supplement to looking for the presence of variant sequences in a test sample is to look for the presence of the normal sequence, e.g. using a suitably specific oligonucleotide probe or primer.
  • RN'ase A cleaves at the site of a mis-match. Cleavage can be -detected by electrophoresing test nucleic acid to which the relevant probe or probe has annealed and looking for smaller molecules (i.e. molecules with higher electrophoretic mobility) than the full length probe/test hybrid.
  • Other approaches rely on the use of enzymes such as resolvases or endonucleases.
  • an oligonucleotide probe that has the sequence of a region of the normal EMA gene (either sense or anti-sense strand) in which mutations associated with, e.g., cancer susceptibility are known to occur may be annealed to test nucleic acid- and the presence or absence of a mis-match determined. Detection of the presence of a mis-match may indicate the presence in the test nucleic acid of a mutation associated with, e.g., cancer susceptibility.
  • cancer susceptibility may be annealed to test nucleic acid and the presence or absence of a mis-match determined.
  • the absence of a mis-match may indicate that the nucleic acid in the test sample has the normal sequence.
  • a battery of probes to different regions of the gene may be employed.
  • the presence of differences in sequence of nucleic acid molecules may be detected by means of restriction enzyme digestion, such as in a method of DNA fingerprinting where the restriction pattern produced when one or more restriction enzymes are used to cut a sample of nucleic acid is compared with the pattern obtained when a sample containing the normal gene or a variant or allele is digested with the same enzyme or enzymes.
  • the presence of absence of a lesion in a promoter or other regulatory sequence may also be assessed by determining the level of mRNA production by transcription or the level of polypeptide production by translation from the mRNA.
  • a test sample of nucleic acid may be provided for example by extracting nucleic acid from cells, e.g. in saliva or preferably blood, or for pre-natal testing from the a nion, placenta or foetus itself .
  • a sample may be tested for the presence of a binding partner for a specific binding member such as an antibody (or mixture of antibodies) , specific for one or more particular variants of the EMA polypeptide shown in the figures, or a mutant, variant or allele thereof.
  • a binding partner for a specific binding member such as an antibody (or mixture of antibodies) , specific for one or more particular variants of the EMA polypeptide shown in the figures, or a mutant, variant or allele thereof.
  • a sample may be tested for the presence of a binding partner for a specific binding member such as an antibody (or mixture of antibodies) , specific for the EMA polypeptide shown in the figures.
  • a binding partner for a specific binding member such as an antibody (or mixture of antibodies) , specific for the EMA polypeptide shown in the figures.
  • the sample may be tested by being contacted with a specific binding member such as an antibody under appropriate conditions for specific binding, before binding is determined, for instance using a reporter system as discussed.
  • a specific binding member such as an antibody under appropriate conditions for specific binding
  • different reporting labels may be employed for each antibody so that binding of each can be determined.
  • a specific binding member such as an antibody may be used to isolate and/or purify its binding partner polypeptide from a test sample, to allow for sequence and/or biochemical analysis of the polypeptide to determine whether it has the sequence and/or properties of the EMA polypeptide whose sequence is shown in the figures, or if it is a mutant or variant form.
  • Amino acid sequence is routine in the art using automated sequencing machines .
  • the EMA polypeptides, antibodies, peptides and nucleic acid of the invention can be formulated in pharmaceutical compositions.
  • These compositions may comprise, in addition to one of the above substances, a pharmaceutically acceptable excipient, carrier, buffer, stabiliser or other materials well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient.
  • a pharmaceutically acceptable excipient e.g. oral, intravenous, cutaneous or subcutaneous, nasal, intramuscular, intraperitoneal routes.
  • compositions for oral administration may be in tablet, capsule, powder or liquid form.
  • a tablet may include a solid carrier such as gelatin or an adjuvant.
  • Liquid pharmaceutical compositions generally include a liquid carrier such as water, petroleum, animal or vegetable oils, mineral oil or synthetic oil. Physiological saline solution, dextrose or other saccharide solution or glycols such as ethylene glycol, propylene glycol or polyethylene glycol may be included.
  • the active ingredient will be in the form of a parenterally acceptable aqueous solution which is pyrogen-free and has suitable pH, isotonicity and stability.
  • a parenterally acceptable aqueous solution which is pyrogen-free and has suitable pH, isotonicity and stability.
  • isotonic vehicles such as Sodium Chloride Injection, Ringer's Injection, Lactated Ringer's Injection.
  • Preservatives, stabilisers, buffers, antioxidants and/or other additives may be included, as required.
  • administration is preferably in a "prophylactically effective amount” or a "therapeutically effective amount” (as the case may be, although prophylaxis may be considered therapy) , this being sufficient to show benefit to the individual.
  • a prophylaxis may be considered therapy
  • the actual amount administered, and rate and time-course of administration, will depend on the nature and severity of what is being treated. Prescription of treatment, e.g.
  • targeting therapies may be used to deliver the active agent more- specifically to certain types of cell, by the use of targeting systems such as antibody or cell specific ligands.
  • Targeting may be desirable for a variety of reasons; -for example if the agent is unacceptably toxic, or if it would otherwise require too high a dosage, or if it would not otherwise be able to enter the target cells.
  • these agents could be produced in the target cells by expression from an encoding gene introduced into the cells, eg in a viral vector (a variant of the VDEPT technique - see below) .
  • the vector could be targeted to the specific cells to be treated, or it could contain regulatory elements which are switched on more or less selectively by the target cells.
  • the agent could be administered in a precursor form, for conversion to the active form by an activating agent produced in, or targeted to, the cells to be treated.
  • an activating agent produced in, or targeted to, the cells to be treated.
  • This type of approach is sometimes known as ADEPT or VDEPT; the former involving targeting the activating agent to the cells by conjugation to a cell- specific antibody, while the latter involves producing the activating agent, eg an enzyme, in a vector by expression from encoding DNA in a viral vector (see for example, EP-A- 415731 and WO 90/07936) .
  • a composition may be administered alone or in combination with other treatments, either simultaneously or sequentially dependent upon the condition to be treated.
  • nucleic acid encoded an authentic biologically active EMA polypeptide could be used in a method of gene therapy, to treat a patient who is unable to synthesize the active polypeptide or unable to synthesize it at the normal level, thereby providing the effect provided by wild-type and suppressing the occurrence of cancer and/or reduce the size or extent of existing defects in cell-cycle and/or growth regulation in the target cells.
  • Vectors such as viral vectors have been used in the prior art to introduce genes into a wide variety of different target cells. Typically the vectors are exposed to the target cells so that transfection can take place in a sufficient proportion of the cells to provide a useful therapeutic or prophylactic effect from the expression of the desired polypeptide.
  • the transfected nucleic acid may be permanently incorporated into the genome of each of the targeted tumour cells, providing long lasting effect, or alternatively the treatment may have to be repeated periodically.
  • vectors both viral vectors and plasmid vectors
  • a number of viruses have been used as gene transfer vectors, including papovaviruses, such as SV40, vaccini-a virus, herpesviruses, including HSV and EBV, and retroviruses.
  • papovaviruses such as SV40
  • vaccini-a virus such as SV40
  • herpesviruses including HSV and EBV
  • retroviruses including vaccini-a virus
  • retroviruses including HSV and EBV
  • retroviruses include vaccini-a virus, cowpoviruses, cowpoviruses, and the like.
  • Many gene therapy protocols in the prior art have used disabled murine retroviruses.
  • nucleic acid into cells includes electroporation, calcium phosphate co-precipitation, mechanical techniques such as microinjection, transfer mediated by liposomes and direct DNA uptake and receptor- mediated DNA transfer.
  • the aim of gene therapy using nucleic acid encoding an EMA polypeptide, or an active portion thereof is to increase the amount of the expression product of the nucleic acid in cells in which the level of the wild- type polypeptide is absent or present only at reduced levels.
  • Such treatment may be therapeutic in the treatment of cells which are already cancerous or pre-cancerous or prophylactic in the treatment of individuals known through screening to have an EMA susceptibility allele and hence a predisposition to cancer.
  • Receptor-mediated gene transfer in which the nucleic acid is linked to a protein ligand via polylysine, with the ligand being specific for a receptor present on the surface of the target cells, is an example of a technique for specifically targeting nucleic acid to particular cells.
  • Antisense technology based on EMA nucleic acid sequences is discussed above.
  • a polypeptide according to the present invention may be used in screening for molecules which affect or modulate its activity or function. Such molecules may be useful in a therapeutic (possibly including prophylactic) context.
  • a method of screening for a substance which modulates activity of a polypeptide may include contacting one or more test substances with the polypeptide in a suitable reaction medium, testing the activity of the treated polypeptide and comparing that activity with the activity of the polypeptide in comparable reaction medium untreated with the test substance or substances. A difference in activity between the treated and untreated polypeptides is indicative of a modulating effect of the relevant test substance or substances.
  • Combinatorial library technology provides an efficient way of testing a potentially vast number of different substances for ability to modulate activity of a polypeptide.
  • Such libraries and their use are known in the art.
  • the use of peptide libraries is preferred.
  • test substances Prior to or as well as being screened for modulation of activity, test substances may be screened for ability to interact with the polypeptide, e.g. in a yeast two-hybrid system (which requires that both the polypeptide and the test substance can be expressed in yeast from encoding nucleic acid) .
  • This may be used as a coarse screen prior to testing a substance for actual ability to modulate activity of the polypeptide.
  • the screen could be used to screen test substances for binding to a specific binding partner, to find mimetics of the polypeptide, e.g. for testing as therapeutics.
  • the substance may be investigated further. Furthermore, it may be manufactured and/or used in preparation, i.e. manufacture or formulation, of a composition such " as a medicament, pharmaceutical composition or drug. These may be administered to individuals .
  • the present invention extends in various aspects not only to a substance identified using a nucleic acid molecule as a modulator of polypeptide activity, in accordance with what is disclosed herein, but also a pharmaceutical composition, medicament, drug or other composition comprising such a substance, a method comprising administration of such a composition to a patient, e.g. for treatment (which may include preventative treatment) of, e.g., cancer, use of such a substance in manufacture of a composition for administration, e.g. for treatment of a disorder of cell proliferation, and a method of making a pharmaceutical composition comprising admixing such a substance with a pharmaceutically acceptable excipient, vehicle or carrier, and optionally other ingredients.
  • a pharmaceutical composition, medicament, drug or other composition comprising such a substance, a method comprising administration of such a composition to a patient, e.g. for treatment (which may include preventative treatment) of, e.g., cancer, use of such a substance in manufacture of a composition for administration, e
  • a substance identified using as a modulator of polypeptide function may be peptide or non-peptide in nature.
  • Non- peptide "small molecules" are often preferred for many in vivo pharmaceutical uses. Accordingly, a mimetic or mimic of the substance (particularly if a peptide) may be designed for pharmaceutical use.
  • nucleic acid constructs in which a site recognised by EMA and at which, on binding, EMA represses transcription from an operably-linked promoter may be used to assess the effect a test substance has on EMA function, by determination of promoter activity.
  • Promoter activity is used to refer to ability to initiate transcription.
  • the level of promoter activity is quantifiable for instance by assessment of the amount of mRNA produced by transcription from the promoter or by assessment of the amount of protein product produced by translation of mRNA produced by transcription from the promoter.
  • the amount of a specific mRNA present in an expression system may be determined for example using specific oligonucleotides which are able to hybridise with the mRNA and which are labelled or may be used in a specific amplification reaction such as the polymerase chain reaction.
  • Use of a reporter gene facilitates determination of promoter activity by reference to protein production.
  • the promoter is operably linked to a gene, e.g. a coding sequence.
  • the gene may be transcribed into mRNA which may be translated into a peptide or polypeptide product which r be detected and preferably quantitated following expression.
  • a gene whose encoded product may be assayed following expression is termed a "reporter gene", i.e. a gene which "reports" on promoter activity.
  • the reporter gene preferably encodes an enzyme which catalyses a reaction which produces a detectable signal, preferably a visually detectable signal, such as a coloured product.
  • Many examples are known, including S-galactosidase and luciferase.
  • -galactosidase activity may be assayed by production of blue colour on substrate, the assay being by eye or by use of a spectrophotometer to measure absorbance. Fluorescence, for example that produced as a result of luciferase activity, may be quantitated using a spectrophotometer. Radioactive assays may be used, for instance using chloramphenicol acetyltransferase, which may also be used in non-radioactive assays. The presence and/or amount of gene product resulting from expression from the reporter gene may be determined using a molecule able to bind the product, such as an antibody or fragment thereof. The binding molecule may be labelled directly or indirectly using any standard technique.
  • nucleic acid constructs comprising a promoter and a reporter gene may be employed in screening for a substance able to modulate the repressor activity of EMA on the promoter.
  • a substance able to up-regulate expression of the promoter i.e. antagonise the repressor function of EMA
  • a method of screening for ability of a substance to modulate activity of EMA may comprise contacting an expression system, such as a host cell, containing a nucleic acid construct as discussed with a test or candidate substance and determining expression of the reporter gene.
  • the level of expression in the presence of the test substance may be compared with the level of expression in the absence of the test substance.
  • a difference in expression in the presence of the test substance may indicate ability of the substance to modulate EMA function.
  • a promoter construct may be introduced into a cell line using any technique previously described to produce a stable cell line containing the reporter construct integrated into the genome.
  • the cells may be grown and incubated with test compounds for varying times.
  • the cells may be grown in 96 well plates to facilitate the analysis of large numbers of compounds.
  • the cells may then be washed and the reporter gene expression analysed. For some reporters, such as luciferase the cells will be lysed then analysed.
  • the substance may be investigated further. Furthermore, it may be manufactured and/or used in preparation, i.e. manufacture or formulation, of a composition such as a medicament, pharmaceutical composition or drug. These may be administered to individuals.
  • the yeast to hybrid system is based on a protein interaction assay in yeast (Fields and Song. 1989. Nature 340, 245-246) .
  • the following protocol contains several modifications of the original Fields strategy and facilitates large scale library screens. It has been designed and optimised and was first used by Ann Vojtek to isolate c-raf and a-raf clones (Vojtek et al. 1993. Cell 74, 205-214) .
  • the method described below is essentially identical to the one outlined in Vojtek et al. It uses the same set of vectors (the different bait constructs are described below) , yeast strains and in particular the cDNA library.
  • the Two Hybrid System is based on an in vivo yeast protein interaction assay. In general yeast are transformed with a reporter gene construction which expresses a selective marker protein. The promoter of that gene has been designed such that it contains binding site for the
  • LexA DNA-binding protein Gene expression from that plasmid is usually very low.
  • Two more expression vectors are transformed into the yeast containing the selectable marker expression plasmid. " The first of those two vectors is based on pBTM116. It contains the coding sequence for the full length LexA gene linked to a multiple cloning site. This multiple cloning site is used to clone a gene of interest in frame on to the LexA coding region.
  • the second yeast expression vector contains the activation domain of the herpes simplex transactivator VP16 fused to random sequences of a cDNA library. Those two plasmids should facilitate expression from the reporter construct containing the selectable marker only when the LexA fusion construct (bait) interacts with a peptide sequence derived from the cDNA library.
  • Amino Acids 146-410 of a human DP-l clone were amplified by PCR and cloned as an EcoRl BamHI fragment in frame with the LexA gene in pBTM116.
  • the resulting plasmid was called pBTMDPl (146-410) .
  • the LexA DP-l fusion protein induced a beta-galactosidase activity considerably below the level found to be induced by pBTM116.
  • the BTM vector system contains the TRP1 gene which allows selection of transformed yeast on tryptophan negative plates .
  • the pVP16 cDNA library vector carries the LEU2 gene which allows selection on Leucine negative plates.
  • the mouse embryo cDNA library cloned next to the activation domain of VP16 was generated by " random primed synthesis of 9.5/10.5 CD1 mouse embryo poly A+ RNA.
  • the vast majority of inserts had a length of 400 - 600 nucleotides.
  • the first construct has a selectable marker, the LYS2 gene, which allows growth on Lysine negative plates. It contains the coding region for the histidine gene under the control of a promoter containing four binding sites for the LexA operator.
  • the second reporter gene has a URA3 gene as selectable marker which allows growth on uracil negative plates. It contains the coding region for the lacZ gene controlled by a promoter containing eight binding sites for the lexA protein.
  • the LexA DP-l fusion plasmid was first introduced into L40 by selecting for growth on tryptophan minus plates after a small scale transformation. The resulting strain was used to grow a 2 ml overnight culture in yeast selective medium minus tryptophan and minus uracil. Thereafter, the culture was diluted with 100 ml of the same medium. The next day the mid log phase culture should be used to inoculate 1 litre of YPAD medium (pre-warmed to 30°C) . The optical density at 600 nm should be about 0.3. This culture is grown at 30°C for 3 hours. During this time the cells should roughly double in number.
  • Yeast were pelletted at 2500 rpm for 5 minutes at room temperature and re-suspended in 500 ml of TE. After a re-spin the cells were taken up in 10 ml of 100 mM Li Ac in 0.5 x TE. To this a mixture of 0.5 ml of 10 mg/ml denatured salmon sperm DNA and 200 ⁇ g of library plasmid is added. The suspension is mixed well. After this 70 ml of a solution containing 100 mM LiAc, 40% PEG-3350 in 1 x TBE was added and mixed well. This mixture was incubated for 30 minutes at 30°C.
  • the 'transformation mixture was then transferred to a sterile 2 litre beaker and 8.8 ml of DMSO was added. After mixing the suspension was heat shocked at 42°C in a water bath for 6 minutes. Thereafter, the suspension was diluted with 200 ml of YPA and rapidly cooled to room temperature in a water bath.
  • cells were pelletted at 2500 rpm for 5 minutes at room temperature and washed twice with selective medium omitting tryptophan, histidine, uracil and leucine (- THULL) .
  • the final pellet was resuspended in 10 ml of -THULL medium and plated in aliquots of 100 ⁇ l on plates made from -THULL media. After 2-3 days colonies were picked to a grid.
  • a nitrocellulose filter lift was used in a beta- galactosidase filter assay for analysis of lacZ induction.
  • Viable cells were recovered from colonies and grown in a 50 ml overnight culture with the appropriate selection. The next morning cells were pelletted at 2500 rpm for 5 minutes at room temperature. Pellets were resuspended in 0.3 ml of lysis buffer (2.5 M LiCl, 50 mM Tris-Cl (pH 8.0) , 4% Triton X-100, 62.5 mM EDTA) . At this stage solution were transferred to 1.5 ml tubes and 150 ml of glass beads (0.45 - 0.50 mm) together with 0.3 ml phenol/chloroform were added. After vigorous shaking for 1 minute samples were centrifuged for 1 minute and the aqueous phase transferred to a new tube. DNA was precipitated twice with ethanol and resuspended in 25 ml TE followed by electroporation of DNA into E.coli.
  • lysis buffer 2.5 M LiCl, 50 mM Tris-Cl (pH 8.0) , 4% Triton X-
  • the bait construct used in the screen contained the heterodimerisation domain of DP-l most of the positive clones were considered to be one form of already identified E2F's (E2F 1-5) . Therefore, DNA from positive colonies was spotted to a grid and hybridised to radioactively labelled cDNA probes from full length E2F 1-5. The hybridisation was done using standard filter hybridisation techniques under stringent conditions. This screening for know DP-l interacting proteins yielded six groups of cDNAs. Five of them were identified as E2F 1-5. However, one of our 68 clones did not hybridise to any of the probes under stringent conditions.
  • EMA Fig. 4a
  • Sequence analysis revealed high sequence similarity to E2F family. Features found conserved in all E2F family members, such as the DNA-binding and also dimerisation domain are highly conserved in EMA (Fig. 4b) . However, most strikingly the EMA protein lacks the activation domain found at the C-terminus of all known E2Fs (Fig. 4a-b) . Consequently, EMA also lacks the binding site for RB. This primary structure of EMA provides indication that, despite being E2F-like, EMA has functions fundamentally different from E2Fs .
  • EMA mRNA is expressed in a wide variety of tissues and the size of the EMA transcript is in good agreement with that of the EMA cDNA we isolated (Fig. 4c) .
  • Reprobing the blot in Figure 4c with a GAPDH probe demonstrated that EMA is expressed at similar levels in the different tissues tested.
  • EMA binds to DP-l in a GST-pulldown experiment but not to a GST control (Fig. 4d) .
  • no significant binding of EMA to GST-EMA or GST-E2F-1 was detected (data not shown) , suggesting that EMA preferentially heterodimerises with DP family members .
  • the EMA/DP-1-specific core sequence falls within the consensus E2F-binding site identified by a binding site selection assay on a RB-bound E2F activity (T-C/G-C/G-C/G-G-C) (ref 17) . Therefore, EMA/DP-1 appears to recognise only a subset of E2F-binding sites with high affinity. This explains the lack of binding to the viral E2 promoter E2F- binding site which deviates from the core EMA/DP-1 site by a single residue. We next asked whether EMA/DP-1 could bind to the specifically selected binding site under gel-shift conditions.
  • Figure 5d shows that EMA only recognises the selected binding site (core: T-C-C-C-G-C) in co-operation with DPI but does not recognise the E2F-binding site of the E2 promoter (T-C-G-C-G-C) .
  • This binding is specific since it can be completed for with a specific but not with a non ⁇ specific competitor.
  • E2F-1 can specifically bind to both sites and can do so in the absence of DP-l (Fig. 5c) .
  • This experiment confirms the result obtained with the binding site selection assay and supports the view that EMA/DP-1 heterodimers recognise only a particular subset of E2F-binding sites.
  • T-C-C-C-G-C A search for the EMA/DP-1 core binding site (T-C-C-C-G-C) identified this sequence in the promoter region of the B-myb (ref 18) , c-myc (refs 19) , human thymidine kinase (ref 20) and human cyclin A (refs 21, 22) genes.
  • B-myb ref 18
  • c-myc c-myc
  • human thymidine kinase ref 20
  • human cyclin A cyclin A
  • pAlOCAT shows a readily detectable basal activity when transfected into HeLa cells (Fig. 6b) .
  • pAlOCAT-EMA showed a markedly reduced level of expression compared to pAlOCAT (Fig. 6b) .
  • EMA can function as a .transcriptional repressor
  • Fig. 6c high basal level promoter 5GALTKCAT
  • the GALEMA fusion protein can reduce the "basal" level of the reporter plasmid by about six fold (Fig. 6d) .
  • EMA lacks the complete C-terminus of the E2Fs, the EMA N-terminus was most likely to confer the repressor activity.
  • 62 N-terminal amino-acids of EMA were fused onto GAL4 this construct repressed transcription to an even higher level than the full length GALEMA fusion (Fig. 6d) .
  • This repression was not due to sterical hindrance since a transcriptionally insert fragment of E2F-1 containing amino acids 284-359 (ref 25) " had no significant effect on the activity of the 5GTKCAT reporter (Fig. 6d) .
  • EMA contains an independent repressor domain within its N- terminus, a region not conserved in any of the E2F family members.
  • EMA transiently transfected HeLa cells either with an expression vector for EMA (pCIEMA) or with control plasmids pCMVE2F-l or pCINEO (Clontech) .
  • pCIEMA expression vector for EMA
  • pCMVE2F-l control plasmids
  • pCINEO control plasmids
  • EMA transfected cells showed a similar cell cycle profile as cells expressing E2F-1.
  • the Gl population was markedly decreased and the S/G2 population markedly increased, compared to cells transfected with the control plasmid (Fig. 7) .
  • EMA represents a member of a novel class of transcription factor with a E2F-binding site Modulating Activity: EMA can bind a subset of E2F sites along with DP-l. In addition, like E2F family members, EMA has the capacity to stimulate cell cycle progression. Our results indicate, however, that the mechanism by which EMA regulates the cell cycle is distinct from that of the E2F family. Cell cycle progression mediated by E2F1 requires the activation domain which is missing in EMA. The unique transcriptional repression characteristics of EMA may be responsible for its effects on the cell cycle. Identification of cellular promoters repressed by EMA in vivo will shed light on the mechanism by which EMA is able to act as an S-phase inducing transcription factor.
  • the yeast two hybrid system was kindly provided by S. M. Hollenberg and used essentially as previously reported (ref 26) .
  • the bait construct expressing DP-l amino acids 146 - 410 was constructed by amplifying the appropriate region of DP-l by PCR using gene specific sense
  • the amplified product was cloned into pBTM116 resulting in pBTMDP-1.
  • the library used in the screen was a 9.5/10.5 day mouse embryonic cDNA library (kindly provided by S. M. Hollenberg) .
  • An EMA fragment identified in the screen containing DNA sequence corresponding to amino-acids 141-259 was used to isolate a full length cDNA clone of EMA from an adult murine liver ⁇ zap library (Stratagene) . Two independent clones were isolated.
  • pING14-EMADN contains the coding region for amino acids 62-272.
  • pGEX-2TK-EMA was constructed by amplifying the entire coding region of EMA using gene specific sense (5'AGGAGGATCCGAATTCATGAGTCAGCAGCG GACGGC3') and anti-sense primers (5'ATGCACTAGTACACT GGATGGGGCACATGATTC3' ) . The amplimer was cloned directionally into pGEX-2TK.
  • pGEXDP-1 (ref 27) and pGEXE2F- 1 (ref 11) were described before.
  • pCMV-EMA was constructed by inserting a full length EMA cDNA into pRcCMV
  • pCMVGT-EMA was made by amplifying the EMA coding sequence with the aforementioned primers and cloning of the amplimer into the Gal-fusion plasmid pCMVGT (T.K., unpublished) .
  • pCMVGT-EMA(N) was made by inserting amplified EMA DNA sequences corresponding to the first 62 amino acids of EMA (sense primer:
  • pGALRB was constructed by cloning the RB coding region corresponding to amino-acids 378-928 directionally into pHKG4 (ref 28) .
  • a murine multiple tissue Northern blot (Clontech) was probed with a random primed cDNA fragment of EMA according to the manufacturer's instructions. As a control the identical blot was hybridised with a Ps tl -Xbal fragment of the GAPDH gene (kindly provided " by M. W. Hentze) . Quantitative evaluation was done using a phosphoimager (Biorad) .
  • Oligonucleotides used to produce and amplify the probe were as follows: BSS-1: 5' CGGGTCTAGATCTGTGAGATCAG-N16-GAGAC TGAGCGTGAATTCCGTC3' ; BSS-2 : 5' CGGGTCTAGATCTGTGAGATCAG3' , BSS-3: 5'GACGGAATTCACGCTCAGTCTC3' .
  • BSS-3 was annealed to BSS-1 and Klenow enzyme used to fill in the overhang.
  • the probe can be amplified using BSS-2 and BSS-3 as primers. It contains restriction sites for subcloning and diagnostic purposes.
  • Approximately 20 pg of double stranded probe was incubated with 500 ng of GST fusion proteins for 1 h at room temperature in 200 ⁇ l binding buffer (in mM: 20 HEPES, pH 7.4; 100 KCl; 1 MgCl 2 ; 0.1 EDTA; 1 DTT; 8% glycerol; 30 ⁇ g BSA and 1 ⁇ g ssDNA) . After washes in binding buffer specifically bound probe was eluted and amplified by PCR. 5 ⁇ l of the amplification product were used as probe for the next round of selection. After five rounds of selection the products were subcloned into Bluescript SK (Stratagene) and DNA from individual clones was subjected to sequence analysis .
  • binding buffer in mM: 20 HEPES, pH 7.4; 100 KCl; 1 MgCl 2 ; 0.1 EDTA; 1 DTT; 8% glycerol; 30 ⁇ g BSA and 1 ⁇ g ssDNA
  • probe Approximately 1 pg of probe was incubated with 5 ng of GST- E2F-1, 20 ng of GST-DP Z 1 and/or 30 ng of GST-EMA at conditions previously described (ref 13) .
  • Cells were trypsinized, fixed in 75% ethanol on ice for several hours, and stained with 50 ⁇ g/ml of propidium iodide containing 0.2 mg/ml of RNase. Flow cytometry analysis was performed on a Becton-Dickinson FACScan. Using the CellQuest software gates were selected for single cells within a normal size range. The propidium iodide signal was used as measure for DNA content. The DNA histograms each contain data from.50000 cells.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Nouveau facteur de transcription, ADN qui le code, polypeptides qui le lient, fragments de peptides, mimétiques, oligonucléotides et techniques faisant appel à ceux-ci. Le facteur de transcription, pour lequel des séquences de souris et d'êtres humains sont présentées, a une certaine ressemblance avec le facteur E2F, mais, contrairement à ce dernier, il s'agit d'un répresseur de transcription. Il contribue à la prolifération des cellules et semble avoir des propriétés oncogènes.
PCT/GB1997/000833 1996-03-26 1997-03-25 Represseur de transcription du type e2f et adn qui le code WO1997035975A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU21680/97A AU2168097A (en) 1996-03-26 1997-03-25 E2f-like transcription repressor and dna encoding it

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
GB9606284.9 1996-03-26
GBGB9606284.9A GB9606284D0 (en) 1996-03-26 1996-03-26 Novel transcription factor and DNA encoding it
GB9702813.8 1997-02-12
GBGB9702813.8A GB9702813D0 (en) 1996-03-26 1997-02-12 Novel transcription factor and dna enoding it

Publications (1)

Publication Number Publication Date
WO1997035975A1 true WO1997035975A1 (fr) 1997-10-02

Family

ID=26308987

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB1997/000833 WO1997035975A1 (fr) 1996-03-26 1997-03-25 Represseur de transcription du type e2f et adn qui le code

Country Status (2)

Country Link
AU (1) AU2168097A (fr)
WO (1) WO1997035975A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999060407A1 (fr) * 1998-05-15 1999-11-25 Cancer Research Campaign Technogoly Limited Analyses, techniques et dispositifs permettant de moduler l'activite de e2f

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
OUELLETTE, MICHEL M. ET AL: "Complexes containing the retinoblastoma gene product recognize different DNA motifs related to the E2F binding site", ONCOGENE (1992), 7(6), 1075-81 CODEN: ONCNES;ISSN: 0950-9232, XP002036017 *
SARDET C ET AL: "E2F-4 and E2F-5, two members of the E2F family, are expressed in the early phases of the cell cycle.", PROC NATL ACAD SCI U S A, MAR 14 1995, 92 (6) P2403-7, UNITED STATES, XP002036019 *
WEINTRAUB SJ ET AL: "Mechanism of active transcriptional repression by the retinoblastoma protein.", NATURE, JUN 29 1995, 375 (6534) P812-5, ENGLAND, XP002036018 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999060407A1 (fr) * 1998-05-15 1999-11-25 Cancer Research Campaign Technogoly Limited Analyses, techniques et dispositifs permettant de moduler l'activite de e2f
US6890709B1 (en) 1998-05-15 2005-05-10 Chroma Therapeutics Limited Assays, methods and means for modulating e2f activity

Also Published As

Publication number Publication date
AU2168097A (en) 1997-10-17

Similar Documents

Publication Publication Date Title
Guan et al. Isolation and characterization of p19INK4d, a p16-related inhibitor specific to CDK6 and CDK4.
AU707636B2 (en) Materials and methods relating to the identification and sequencing of the BRCA2 cancer susceptibility gene and uses thereof
JP3294575B2 (ja) Ｉｇｆ−１レセプターと相互作用するタンパク質、それをコードする遺伝子及びそれらの使用
US5863757A (en) Transcription factor DP-1
US5759803A (en) Recombinant retinoblastoma-associated protein 1 (E2F-1) polypeptides and cDNA
US6306648B1 (en) Cyclin-C variants, and diagnostic and therapeutic uses thereof
US7205124B1 (en) Utrophin gene promoter
EP0738277A1 (fr) Nouvelles proteines se liant a la proteine du retinoblastome et sequences d'adn de codage de ces dernieres
GB2307477A (en) Materials and methods relating to the identification and sequencing of the BRCA2 cancer susceptibility gene and uses thereof
US5504192A (en) Human insulin receptor endocytic code binding protein
WO1997035975A1 (fr) Represseur de transcription du type e2f et adn qui le code
US20040072268A1 (en) Methods for regulating BRCA1-BRCA2-containing complex activity
US6689584B1 (en) Transcriptional regulatory factor
US7348407B2 (en) Stress-responsive activator of p300 (strap) protein
US6294384B1 (en) Compositions and methods based upon an isoform of p53
US20060281078A1 (en) Human fast-1 gene
WO2002050249A2 (fr) Interactions proteine-proteine
KR101083852B1 (ko) 유전자 전사 조절제 및 히스톤 탈아세틸화효소 저해 화합물의 스크리닝 방법
US7160677B1 (en) Transcription factor DP-1
CA2288335A1 (fr) Domaine de l'activateur transcriptionnel de brca2 et ses utilisations
US6566054B1 (en) Cyclin dependent kinase mutants, and diagnostic and therapeutic uses related thereto
AU696986C (en) Novel proteins which bind to retinoblastoma protein and their encoding DNA equences
EP1162460A1 (fr) Méthode de criblage des modulateurs de méthyltransférase Suv39h2 et de la gamétogenèse
US20020165352A1 (en) Protein-protein interactions
US20030032592A1 (en) Protein-protein interactions

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH HU IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TR TT UA UG US UZ VN YU AM AZ BY KG KZ MD RU TJ TM

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH KE LS MW SD SZ UG AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: JP

Ref document number: 97534141

Format of ref document f/p: F

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

NENP Non-entry into the national phase

Ref country code: CA

122 Ep: pct application non-entry in european phase