WO1997031646A1 - Comodulateur de l'antagoniste du recepteur des steroides et ses methodes d'utilisation - Google Patents

Comodulateur de l'antagoniste du recepteur des steroides et ses methodes d'utilisation Download PDF

Info

Publication number
WO1997031646A1
WO1997031646A1 PCT/US1997/002954 US9702954W WO9731646A1 WO 1997031646 A1 WO1997031646 A1 WO 1997031646A1 US 9702954 W US9702954 W US 9702954W WO 9731646 A1 WO9731646 A1 WO 9731646A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
hnra
com
antagonist
molecule
Prior art date
Application number
PCT/US1997/002954
Other languages
English (en)
Inventor
Kathryn B. Horwitz
Twila A. Jackson
Original Assignee
University Of Colorado
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University Of Colorado filed Critical University Of Colorado
Priority to AU19753/97A priority Critical patent/AU1975397A/en
Publication of WO1997031646A1 publication Critical patent/WO1997031646A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/72—Receptors; Cell surface antigens; Cell surface determinants for hormones
    • C07K14/721—Steroid/thyroid hormone superfamily, e.g. GR, EcR, androgen receptor, oestrogen receptor
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • This invention relates to the field of steroid hormones, specifically, steroid receptor binding proteins and assay methods for identifying steroid antagonists.
  • nuclear hormone receptor superfamily includes the receptors for steroid hormones, thyroid hormones, lipophilic vitamins such as vitamins A and D, and the orphan receptors, which have a structure consistent with other superfamily members but have no identified ligands (Evans (1988) Science 240:889-895) .
  • the receptors regulate gene expression by interacting with specific DNA sequences (hormone response elements, or "HREs") in the promoters of target genes (Glass (1994) Endocr. Rev. 15:391-407) .
  • Nuclear receptors are grouped into two subfamilies: the thyroid/retinoic acid/vitamin D receptor (TRV) family and the steroid receptor (R s ) family.
  • Steroid hormone receptors bind to their respective HREs in a ligand-dependent manner whereas some receptors such as the thyroid hormone receptor (T 3 R) and retinoic acid receptor (RAR/RXR) bind to their response elements in a ligand-independent manner.
  • T 3 R thyroid hormone receptor
  • RAR/RXR retinoic acid receptor
  • TRV receptors bind DNA at HREs to actively repress transcription of their target genes.
  • unactivated, ligand-free steroid receptors do not bind DNA.
  • dimeric steroid receptors bind to HREs present in the promoters of genes to regulate gene transcription.
  • mice proteins which act as a co-repressor of ligand- mdependent T 3 R/RAR repression of transcription (H ⁇ rlein et al. (1995) Nature 377:397-403; Chen & Evans (1995) Nature 377:454-457; Burns et al. (1995) Proc. Natl . Acad. Sci. 92:9525-9529) .
  • These co-repressors specifically bind with DNA-bound T 3 R or RAR in the absence of ligand, but not in its presence.
  • These co-repressors fail to interact with unliganded members of the steroid receptor subfamily.
  • Steroid receptors play a role in normal health and in a spectrum of disease states, including cancer, inflammation, endocrine disorders, and oral contraception.
  • the natural steroid hormones produced by endocrine glands bind to steroid hormone receptors m target organs .
  • the natural steroid hormones include estrogens, progestms, androgens, glucocorticoids and mmeralocorticoids. These hormones are defined as agonists, and hormone-receptor complexes modulate specific gene transcription by either increasing or decreasing transcription rate.
  • Steroid agonists have pleiotropic physiological actions m a number of tissues, for example, estradiol and progesterone regulate gene transcription in the kidney, ovary, cervix, uterus, bone, skin, breast, heart, pituitary and brain.
  • Hormones of the steroid receptor subfamily are used to treat many disorders and are used in healthy people for oral contraception and hormone replacement therapy, among others. It is often medically desirable to block the actions of steroid hormone agonists. For this reason, researchers have synthesized steroid receptor antagonists that are used in breast, endometrial and prostate cancer treatment as agents to prevent cancer development or block abnormal growths, and as contraceptive agents. These antagonists ligands also bind to the steroid receptors, but in general, they have effects that are opposite to the ones produced by the agonists.
  • steroid receptor antagonists are complex. They often have dual agonist/antagonist effects.
  • an antagonist may have 5-10% of the biological activity of an agonist; thus, the antagonist may block the activity of the agonist, resulting in substantially decreased agonist activity.
  • Antagonists may also have the desired antagonist effect in one tissue (for example, the breast) , but may have an agonist effect in another tissue (for example, the uterus) .
  • the agonist effect of an antagonist may or may not be an unwanted side-effect.
  • an antagonist ligand may initially have the desired inhibitory effect on the tumor, but with time, the ligand switches to an agonist-like effect and the cancer then resumes growing. This is clearly a dangerous side-effect, often described as "resistance" to treatment.
  • HBD ligand-activated hormone binding domain
  • hNRA-coM human nuclear receptor antagonist co-modulators
  • the hNRA-coM molecules encoded by the nucleotide sequences of SEQ ID NOs:l-18 specifically bind a nuclear steroid hormone receptor- antagonist complex and mediate the biological activity of the antagonist-bound receptor.
  • the hNRA-coMs of the invention do not bind a nuclear steroid hormone receptor- agonist complex.
  • the invention features a substantially pure human nuclear steroid hormone receptor co-modulator molecule encoded by any one of the nucleotide sequences of SEQ ID NOs:l-18 and characterized as binding a nuclear steroid hormone receptor-antagonist complex.
  • the invention includes the specific proteins disclosed, as well as closely related proteins and peptides that are identified and isolated by the use of probes or antibodies prepared from the nucleotide and amino acid sequences herein disclosed. This can be done using standard techniques, e.g., by screening a genomic cDNA or combinatorial chemical library with a probe having all or part of the nucleotide sequence of the disclosed hNRA-coM proteins.
  • the invention further includes synthetic polypeptides having all or part of the sequences of the hNRA-coM molecules disclosed herein.
  • hNRA-coM molecules include functional fragments of the proteins and peptides shown, as long as the activity of hNRA-coM molecule, e.g., its ability to bind a steroid receptor-antagonist complex, remains. Smaller peptides containing the biological activity of hNRA-coM are included in the invention.
  • the invention features isolated and purified nucleotide sequences which encode the hNRA-coM molecules of the invention.
  • the nucleotide sequence is a nucleotide sequence selected from the group consisting of SEQ ID N0s:l-18.
  • the nucleotide sequence has the nucleotide sequence of SEQ ID NO:17 or SEQ ID NO: 18.
  • the nucleotide sequence is the nucleotide sequence comprising both SEQ ID NO:17 and SEQ ID NO: 18.
  • the nucleotide sequences of SEQ ID NOs: 17-18 encode different portions of a single hNRA-coM peptide molecule which binds antagonist-occupied nuclear steroid hormone receptor.
  • the hNRA-coM molecules of the invention bind a steroid hormone receptor when the ligand binding site is occupied by an antagonist, but not when the ligand binding site is occupied by an agonist.
  • the hNRA- coM molecules- of the invention are useful to screen candidate nuclear steroid hormone receptor ligands which are potential steroid antagonists.
  • the invention features a method for identifying potential steroid receptor antagonists by contacting a steroid receptor with a test ligand, such that a receptor-ligand complex is formed, contacting the receptor-ligand complex with a hNRA-coM molecule, and detecting hNRA-coM binding to the receptor- ligand complex. Binding of hNRA-coM molecule to the complex indicates that the bound ligand is a candidate steroid antagonist. Absence of binding indicates that the bound ligand is not a steroid antagonist, and may be a steroid agonist.
  • the hNRA-coM molecules of the invention modulate the biological activity of a steroid receptor-antagonist complex by blocking the agonist biological activity of the steroid antagonist and promoting the antagonist activity.
  • the hNRA-coM molecules of the invention are therapeutically useful for treating medical conditions related to steroid antagonist treatment, and are useful for eliminating unwanted agonist side-effects resulting from steroid antagonist treatments.
  • the invention features a method of providing hNRA-coM molecules to a subject in need of steroid antagonist treatment in order to block the undesirable agonist effect of a steroid antagonist .
  • a hNRA-coM molecule can be provided to a specific cell, tissue, or organ target where it is desirable to block the agonist action of a steroid antagonist.
  • Methods of targeting compounds to a specific site in the body are known in the art .
  • portions of DNA encoding an hNRA-coM molecule may be introduced into cells that underexpress an hNRA- coM protein.
  • the expression of an endogenous hNRA-coM molecule may be increased by administration of an agent which enhances hNRA-coM gene transcription.
  • the hNRA-coM molecule of the invention is therapeutically useful in increasing the agonist action of an steroid antagonist when the agonist action of the steroid antagonist is blocked by the presence of endogenous hNRA-coM molecule.
  • the expression of endogenous hNRA-coM molecule may be removed by administration of a therapeutic reagent which decreases the level of hNRA-coM molecule transcription or translation. Nucleic acid sequences that interfere with hNRA-coM expression at the translational level can be used.
  • the therapeutic agent is an antisense polynucleotide able to bind hNRA-coM protein mRNA.
  • the therapeutic agent is an antibody that specifically binds the endogenous hNRA-coM molecule thus inhibiting hNRA-coM binding to a nuclear receptor-antagonist complex.
  • the therapeutic agent can be administered in site- specifically where needed, e.g., targeted to a specific tissue.
  • the expression of an endogenous hNRA-coM molecule may be inhibited by administration of an agent which inhibits hNRA-coM gene transcription.
  • the hNRA-coM molecules of the invention are therapeutically useful in modulating the biological activity of a dual action antagonist (e.g., an antagonist having partial agonist activity) .
  • a dual action antagonist e.g., an antagonist having partial agonist activity
  • the cellular availability of the hNRA-coM molecule to the ligand/receptor complex is increased; to enhance the agonist effects of the ligand, the availability of the hNRA-coM to the ligand/receptor complex is decreased.
  • a dual action antagonist e.g., an antagonist having partial agonist activity
  • the hNRA-coM molecules of the invention can be used to identify candidate steroid antagonists.
  • Another advantage is that the invention provides a rapid and convenient assay for identifying steroid antagonists.
  • Figs. 1A-1R shows partial nucleotide sequences for a human nuclear steroid receptor antagonist co-modulator molecules (hNRA-coM) .
  • Fig. 2 is a schematic diagram of the hNRA-coM DNA sequence TJ53 (SEQ ID NOs:17-18) aligned to the mouse TRV receptor co-repressor sequence.
  • Fig. 3 is a schematic representation of the interaction between the "bait" construct (LexA:PR HBD fusion protein) and protein X:Gal activation domain fusion protein in the yeast two hybrid system.
  • the interaction between the bait construct and protein X results in expression of histidine (growth selection) and j ⁇ -galactosidase (blue color) .
  • a human nuclear steroid receptor antagonist co-modulator (hNRA-coM molecule) " includes a plurality of hNRA-coM proteins and peptides able to bind a steroid antagonist-receptor complex.
  • hNRA-coM molecule a molecule encoded by any one of the nucleotide sequences of SEQ ID NOs: 1-18 which is characterized by its ability to bind an antagonist-occupied nuclear steroid receptor.
  • an hNRA-coM molecule shall mean a naturally occurring, recombinant, or synthetic full length protein or fragment thereof encoded by a nucleotide sequence substantially similar (e.g., 90% or greater homology) to a portion of the nucleotide sequences of SEQ ID NOs:1-18, and capable of binding the antagonist-occupied steroid receptor complex.
  • an hNRA-coM molecule shall mean a naturally occurring, recombinant, or synthetic amino acid sequence encoded by a nucleotide sequence substantially similar (e.g., 90% or greater homology) to a portion of the naturally occurring hNRA-coM molecule encoded by the nucleotide sequence of SEQ ID NO:17 and/or SEQ ID NO: 18, and able to bind the antagonist-occupied steroid receptor complex.
  • steroid receptor or “nuclear steroid receptor is” meant a protein that is a ligand-activated transcription factor, and belongs to the steroid receptor subfamily of nuclear receptors.
  • Steroid receptors proteins which structurally resemble and have the biological activity of a steroid hormone-activated transcription factor.
  • Steroid receptors contain all or part of a DNA binding domain and a hormone (or ligand) binding domain, and include orphan receptors for unknown ligands whose structure resembles that of steroid receptors.
  • steroid receptor ligand is meant a natural or synthetic compound which binds the nuclear steroid receptor to form a receptor-ligand complex.
  • ligand includes agonists, antagonists, and compounds with partial agonist/antagonist action.
  • steroid receptor agonist is meant a compound which binds the nuclear steroid receptor to form a receptor-agonist complex.
  • the receptor-agonist complex binds specific regions of DNA termed hormone response elements (HREs) .
  • HREs hormone response elements
  • Natural steroid hormone agonists include estradiol, progesterone, androgens, glucocorticoids, and mineralocorticoids.
  • steroid receptor antagonist is meant a compound that has a biological effect opposite to that of an agonist.
  • An antagonist binds the nuclear steroid receptor and blocks the action of a steroid receptor agonist by competing with the steroid agonist for receptor.
  • An "antagonist” is defined by its ability to block the actions of an agonist.
  • Steroid receptor antagonists include "pure” antagonists, as well as compounds with partial agonist/antagonist action. A pure antagonist effectively competes with an agonist for receptor binding, without itself having agonist actions.
  • a partial antagonist may be less effective at competing with an agonist for receptor binding, or may be equally effective at binding the receptor but have only 5-10% of the agonist action than that of the agonist being competed with.
  • nucleotide sequence is meant a sequence of deoxyribonucleo ides or ribonucleotides m the form of a separate fragment or as a component of a larger construct.
  • DNA encoding portions or all of the proteins of the invention can be assembled from cDNA fragments or from oligonucleotides that provide a synthetic gene which can be expressed in a recombinant transcriptional unit.
  • Nucleotide sequences of the invention include DNA, RNA, and cDNA sequences, and can be derived from natural sources or synthetic sequences synthesized by methods known to the art.
  • isolated nucleotide sequence is meant a nucleotide sequence that is not immediately contiguous (i.e., covalently linked) with either of the coding sequences with which it is immediately contiguous (i.e., one at the 5' end and one at the 3' end) in the naturally-occurring genome of the organism from which the nucleotide sequence is derived.
  • the term therefore includes, for example, a recombinant nucleotide sequence which is incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule independent of other sequences. It also includes a recombinant DNA which is part of a hybrid gene encoding additional polypeptide sequences.
  • the isolated and purified nucleotide sequences of the invention also include nucleotide sequences that hybridize under stringent conditions to the nucleotide sequences specified herein.
  • stringent conditions means hybridization conditions that guarantee specificity between hybridizing nucleotide sequences, such as those described herein, or more stringent conditions.
  • posthybridization washing conditions including temperature and salt concentrations, which reduce the number of nonspecific hybridizations such that only highly complementary sequences are identified (Sambrook et al . (1989) in Molecular Cloning, 2d ed. ; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, hereby specifically incorporated by reference) .
  • the isolated and purified nucleotide sequences of the invention also include sequences complementary to the nucleotide encoding hNRA-coM molecules (antisense sequences) .
  • Antisense nucleic acids are DNA or RNA molecules that are complementary to at least a portion of a specific mRNA molecule (Weintraub (1990) Scientific American 262:40) .
  • the invention includes all antisense nucleotide sequences capable of inhibiting production of hNRA-coM proteins. In the cell, the antisense nucleic acids hybridize to the corresponding mRNA, forming a double-stranded molecule.
  • Antisense oligomers of about 15 nucleotides are preferred, since they are easily synthesized and introduced into a target hNRA-coM- producing cell.
  • the use of antisense methods to inhibit the translation of genes is known in the art, and is described, e.g., in Marcus-Sakura (1988) Anal. Biochem. 172:289.
  • Ribozymes are RNA molecules possessing the ability to specifically cleave other single-stranded RNA in a manner analogous to DNA restriction endonucleases. Through the modification of nucleotide sequences encoding these RNAs, molecules can be engineered to recognize specific nucleotide sequences in an RNA molecule and cleave it (Cech (1988) J. Amer. Med. Assn. 260:3030) . A major advantage of this approach is that, because they are sequence-specific, only mRNAs with particular sequences are inactivated.
  • the hNRA-coM molecules of the invention can also be used to produce antibodies that are immunoreactive or bind epitopes of the hNRA-coM molecules. Accordingly, one aspect of the invention features antibodies to the hNRA-coM molecules of the invention.
  • the antibodies of the invention include polyclonal antibodies which consist of pooled monoclonal antibodies with different epitopic specificities, as well as distinct monoclonal antibody preparations. Monoclonal antibodies are made from antigen-containing fragments of the hNRA-coM molecules by methods known in the art (See, for example, Kohler et al . (1975) Nature 256:495) .
  • antibody as used herein includes intact molecules as well as fragments thereof, such as Fa, F(ab') 2 ' an d Fv, which are capable of binding the epitopic determinant.
  • Antibodies that bind hNRA-coM molecules can be prepared using intact polypeptides or fragments containing small peptides of interest as the immunizing antigen.
  • the polypeptide or peptide used to immunize an animal can be derived from translated cDNA or chemically synthesized, and can be conjugated to a carrier protein, if desired. Commonly used carriers that are chemically coupled to peptides include bovine serum albumin and thyroglobulin.
  • the coupled peptide is then used to immunize the animal (e.g., a mouse, a rat, or a rabbit) .
  • Antibodies produced by recombinant methods known in the art are also included (Russell et al . (1993) Nucleic Acid Res. 21:1081-1085; McCaffert et al . (1990) Nature 348:552-554; Duehas & Borrebaeck (1994) Bio/Technology 12 :999-1002) .
  • substantially pure is meant a compound, such as an hNRA-coM molecule, which is substantially free of other proteins, lipids, carbohydrates, or other materials with which it is naturally associated.
  • a substantially pure hNRA-coM - 14 - molecule is at least 60%, by weight, free of other components, more preferably at least 75%, even more preferably at least 90%, and most preferably at least 99%, by weight, hNRA-coM protein.
  • One skilled in the art can purify hNRA-coM using standard techniques for protein purification, for example, by extraction from a natural source; by expression of a recombinant nucleic acid encoding a hNRA-coM molecule or by chemically synthesizing the protein.
  • the substantially pure protein will yield a single band on a non-reducing polyacrylamide gel.
  • the purity of the hNRA-coM molecule can be determined by any appropriate method, e.g., column chromatography, polyacrylamide gel electrophoresis, HPLC analysis, and/or amino-terminal amino acid sequence analysis.
  • host cell By the term “host cell” is meant a cell in which a vector can be propagated and its DNA expressed. The term also includes any progeny of the subject host cell. It is understood that all progeny may not be identical to the parental cell since there may be mutations that occur during replication. However, such progeny are included when the term "host cell” is used. Methods of stable transfer in which the exogenous DNA is continuously maintained in the host are known in the art . Suitable host cells for use in the invention include microbial, yeast, insect, and mammalian organisms.
  • telomere sequence can be present in the vector operably linked to regulatory elements, for example, the promoter.
  • Such expression vectors contain a promoter sequence which facilitates the efficient transcription in the host of the inserted nucleic acid sequence.
  • the expression vector typically contains an origin of replication, a promoter, as well as specific nucleotide sequences which allow phenotypic selection of the transformed cells.
  • the expressed nucleotide sequence is also, if desired, translated into the hNRA-coM protein.
  • treatment generally mean obtaining a desired pharmacologic and/or physiologic effect .
  • the effect may be prophylactic in terms of completely or partially preventing a disease or symptoms thereof and/or may be therapeutic in terms of a partial or complete cure for a disease or medical condition and/or adverse effect attributable to a medical condition.
  • treatment is intended to mean providing a therapeutically detectable and beneficial effect of a patient suffering from condition resulting from a steroid antagonist .
  • therapeutic reagent a compound or molecule that achieves the desired effect on an steroid antagonist-related condition when administered to a subject in need thereof.
  • terapéuticaally effective amount is meant an amount of a reagent sufficient to decrease, prevent or enhance the symptoms associated with a steroid antagonist-related condition.
  • steroid antagonist-related condition or "antagonist-related condition” is meant a medical condition resulting, at least in part, from antagonist binding to nuclear steroid receptors to form an antagonist-steroid receptor complex.
  • an antagonist-related condition may result from administration of a progesterone antagonist (or antiprogestin) to a healthy female subject for use as a contraceptive through the ability of the antiprogestin to block the actions of progesterone at the ovary and - 16 - uterus.
  • an antagonist-related condition includes the therapeutic use of an antiprogestin in a female subject with breast cancer to block the growth- promoting effect of progesterone at the tumor.
  • the antiprogestin block of progesterone action at a specific site may be undesirable, e.g., at the bone.
  • the hNRA-coM molecules of the invention are useful to modulate the undesirable antagonist effects of antiprogestins at specific sites such as the bone.
  • An antagonist-related condition may result when an antagonist is intentionally administered therapeutically, for example, when an active antagonist is prevented from having its desired biological effect at a target tissue because of the presence of endogenous hNRA-coM protein.
  • modulation of antagonist activity may include inhibitory or stimulatory effects, where the effect is opposite to that effect produced by an agonist.
  • the present invention is particularly useful for enhancing steroid antagonist activity by providing a hNRA-coM molecule in cells underexpressing hNRA-coM, or for reducing antagonist activity by blocking hNRA-coM molecule expression in cells overexpressing hNRA-coM, or in which any expression of hNRA-coM is undesirable.
  • enhancing steroid antagonist activity is meant producing a stronger or more specific antagonist effect .
  • M hNRA-coM dominant negative mutant a hNRA-coM variant having one or more mutations in its encoding nucleotide sequence relative to the natural sequence, which binds to the antagonist-occupied receptor complex but does not enhance antagonist activity.
  • a dominant negative mutant hNRA-coM molecule would compete with the endogenous protein for binding to the antagonist-occupied receptor complex, inhibiting or decreasing the biological effectiveness of the endogenous protein.
  • hNRA-coM dominant positive mutant a hNRA-coM variant having one or more mutations m its encoding nucleotide sequence relative to the natural sequence, which binds to the antagonist-occupied receptor complex and enhances antagonist activity to a greater extent than the natural molecule.
  • reducing or “inhibiting” steroid antagonist activity is meant producing a weakened antagonist effect or eliminating an antagonist effect.
  • the invention provides substantially pure human nuclear steroid receptor antagonist co-modulator protein and peptide molecules (hNRA-coMs) , characterized as cellular proteins or peptides which bind the nuclear steroid receptor-antagonist complex.
  • the hNRA-coM molecules of the invention are comprised of the nucleotide sequences of SEQ ID NOs: 1-18.
  • LexA/DNA-bmdmg domain-progesterone receptor fusion proteins were used in a generic two-hybrid screen to isolate progesterone receptor mteractors expressed in yeast from a HeLa cell library (Example 1) .
  • Progesterone is a key hormone involved in the development, growth and maintenance of female reproductive function.
  • Progesterone antagonists block the progesterone receptor signal transduction pathway. They are therefore indicated for pregnancy termination, for contraception, for the treatment of endomet ⁇ osis and uterine fibroids, and for the therapy of progesterone-dependent breast cancers.
  • the molecular mechanism by which antiprogestins repress progesterone receptor-regulated transcription are unknown, but they could involve factors that block the activity of the basal transcriptional machinery.
  • hge progesterone receptor hinge region
  • HBD hormone binding domain
  • TJ53 (SEQ ID NO: 17) is a 3.2 kb clone encoding the interaction domain of a nuclear steroid receptor antagonist co-modulator. Its association with the HBD of the progesterone receptor is destabilized by the absence of hormone. TJ53 shares partial homology to the mouse nuclear receptor co- repressor protein found to specifically interact with the thyroid hormone/retinoic acid/vitamin D subfamily of nuclear receptors (H ⁇ rlein et al . (1995) Nature 377:397- 403; Chen et al . (1995) Nature 377:454; Burris et al . (1995) Proc. Natl . Acad. Sci . 92:9525) (Fig. 2) .
  • the underlying mechanisms that render one ligand an antagonist, and another, often structurally very similar ligand, an agonist have not been known. It is also not known why some ligands have dual agonist/antagonist actions.
  • the present invention is the first demonstration that recruitment of a cellular protein factor to the ligand/receptor complex is involved in distinguishing agonists from antagonists.
  • the invention provides nucleotide sequences encoding human nuclear co-modulator protein and peptide molecules that bind antagonist-occupied nuclear steroid receptors.
  • These nucleotide sequences include DNA, cDNA, and RNA sequences which encode the hNRA-coM molecules of the invention. It is also understood that all nucleotide sequences encoding all or a portion of the hNRA-coM molecules of the invention are also included herein, as long as they encode a molecule with hNRA-coM activity, e.g., capable of binding an antagonist-occupied steroid receptor complex.
  • Such nucleotide sequences include naturally occurring, synthetic, and intentionally manipulated nucleotide sequences.
  • hNRA-coM nucleotide sequences may be subjected to site-directed mutagenesis, which may result in dominant negative or dominant positive hNRA-coM mutant molecules.
  • the nucleotide sequence for the hNRA-coM molecules of the invention also include antisense sequences.
  • the nucleotide sequences of the invention further include sequences that are degenerate as a result of the genetic code.
  • the nucleotide sequences encoding the hNRA-coM molecules of the invention include SEQ ID NOs: 1-18.
  • a complementary sequence may include the antisense nucleotide.
  • the sequence is RNA
  • the deoxynucleotides A, G, C, and T of the sequences shown are replaced by the ribonucleotides A, G, C, and U, respectively.
  • fragments of the above-identified nucleic acid sequences that are at least 15 bases in length, which is sufficient to permit the fragment to selectively hybridize to DNA or RNA that encodes hNRA-coM molecule under physiological conditions.
  • the fragments should hybridize to DNA or RNA encoding hNRA-coM molecule under stringent conditions, e.g., conditions which avoid non-specific binding (Sambrook et al . (1989) supra) .
  • modifications may be deliberate, as by site-directed mutagenesis, or may be spontaneous. All of the proteins produced by these modifications are included herein. Further, deletions of one or more amino acids can also result m modification of the structure of the resultant molecule without significantly altering its biological activity. This can lead to the development of small active molecules with may have a broader utility. For example, one may remove ammo or carboxy terminal amino acids which are not required for hNRA-coM biological activity, or that enhance its activity in a dominant positive or dominant negative manner.
  • DNA sequences encoding hNRA-coM molecules can be expressed in vi tro by DNA transfer into a suitable host cell. Transformation of a host cell with recombinant DNA may be carried out by conventional techniques as are well known to those skilled in the art.
  • the hNRA-coM molecules of the invention can also be used to produce antibodies which are immunoreactive or bind to epitopes of the hNRA-coM proteins and peptides.
  • Antibodies which consist essentially of pooled monoclonal antibodies with different epitopic specificities, as well as distinct monoclonal antibody preparations are provided.
  • Monoclonal antibodies are made from antigen- containing fragments of the protein by methods well known in the art.
  • the present invention provides novel assay useful in identifying steroid receptor ligands having antagonist activities.
  • the hNRA-coM molecules of the invention are useful in identifying nuclear steroid receptor ligands which are steroid antagonists, as they bind to an antagonist- receptor complex but not to an agonist-receptor complex.
  • the hNRA-coM molecule TJ53 encoded by the nucleotide sequences SEQ ID NOs :17- 18
  • a steroid receptor is contacted with a test ligand such that a receptor-ligand complex is formed, the complex is contacted with an hNRA-coM molecule, and the formation of a receptor-ligand-hNRA-coM complex is detected.
  • Detection of the receptor-ligand- hNRA-coM complex may be accomplished in a number of ways. Binding of hNRA-coM molecule indicates that the bound ligand is a candidate antagonist. Non-binding of hNRA- coM molecule to the complex indicates that the bound ligand is not an antagonist, and may be a steroid agonist.
  • the method of the invention may be practiced in a variety of ways known to the art.
  • the assay components may be present in solution.
  • Methods for determining optimal concentrations of each reagent are known in the art, as well as methods for optimizing conditions, e.g., temperature, incubation times, pH, etc-. , to provide a rapid and reproducible screening method.
  • the binding of hNRA-coM to the receptor-ligand complex can be determined in variety of ways known to the art.
  • the hNRA-coM molecule may be labeled and the presence of label in the receptor-ligand complex determined.
  • interactions between hNRA-coM and steroid receptors can be measured by "pulldown" affinity chromatography between a resin-bound glutathione-S- transferase-steroid receptor fusion protein and a His- tagged hNRA-coM fusion protein that can be identified with antibodies having a fluorescent or a radioactive label .
  • the ligand dependency of the interaction can be monitored by methods known to the art. Formation of a receptor-ligand-hNRA-coM complex is compared to complex binding in the presence of a steroid agonist (control) .
  • binding of hNRA-coM to the receptor-ligand complex will be 50% or more greater when the ligand is an antagonist relative to an agonist; more preferably, hNRA- coM binding will be 75% or more greater to an antagonist- receptor complex relative to the agonist-receptor complex; most preferably, hNRA-coM binding will be 90% or more greater when the ligand is an antagonist.
  • a candidate antagonist identified by the assay method of the invention can be tested in an animal model of steroid antagonist actions.
  • cells and animals in which the endogenous nucleotide sequence encoding the hNRA-coM molecule has been deleted and/or which are transfected with a nucleotide sequence encoding a hNRA-coM molecule.
  • Such cells and animals can be engineered by molecular recombinant and transgenic methods known in the art.
  • Such cells and animals are useful for measurement of the trans ⁇ riptional activity of a ligand-occupied steroid receptor in the presence or absence of recombinant hNRA-coM.
  • the hNRA- coM molecules of the invention are able to bind to the steroid receptor-antagonist complex to mediate its biological activity.
  • antagonist-bound receptor may bind either a co-repressor factor, such as that described by Horlein et al . (1995) supra for TRV receptors, or a co- activator factor, such as those described by Halachmi et al . (1994) supra, Cavailles et al . (1994) supra, and Baniahmad (1995) supra.
  • Binding of the hNRA-coM molecules of the invention to the antagonist-receptor complex allows the antagonist to be biologically active and/or may be required for full antagonist activity. Binding of hNRA-coM may also block binding to the antagonist-occupied receptor complex by other co- activator factors which could inhibit or diminish antagonist activity. Thus, the hNRA-coM proteins of the invention enhance antagonist action.
  • the invention provides a therapeutically useful method for promoting the in vivo antagonist activity of an antagonist where it is clinically desirable by increasing the cellular levels of hNRA-coM. This may be achieved by providing a sense polynucleotide sequence
  • hNRA-coM the DNA coding strand
  • a hNRA-coM molecule a hNRA-coM dominant positive mutant hNRA-coM molecule into the cell by methods known in the art. It can also include administration of a factor which enhances hNRA-coM gene transcription.
  • the method of the invention includes administration of a therapeutically effective amount of a hNRA-coM molecule to enhance steroid antagonist activity.
  • Therapeutic formulations of hNRA-coM molecules for treating antagonist-related conditions are prepared for storage by mixing one or more hNRA-coM molecules having the desired degree of purity with optional physiologically acceptable carriers, excipients, or stabilizers (Remington's Pharmaceutical Sciences.
  • Acceptable carriers, excipients, or stabilizers are non-toxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counter ions such as sodium; and/or non-ionic surfactants such as Tween, Pluronics, or polyethylene glycol, or sorbitol.
  • hNRA-coM is also suitably linked to one of a variety of nonproteinaceous polymers, e.g., polyethylene glycol, polypropylene glycol, or polyoxyalkylenes, in the manner set forth in U.S. Patent Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417;
  • nonproteinaceous polymers e.g., polyethylene glycol, polypropylene glycol, or polyoxyalkylenes
  • the amount of carrier used in a formulation may range from about 1 to 99%, preferably from about 80 to 99%, optimally between 90 and 99% by weight .
  • the hNRA-coM molecules to be used for in vivo administration must be sterile. This is readily accomplished by methods known in the art, for example, by filtration through sterile filtration membranes, prior to or following lyophilization and reconstitution. The hNRA-coM molecule ordinarily will be stored in lyophilized form or in solution.
  • Therapeutic hNRA-coM compositions generally are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.
  • hNRA-coM may be in a chronic fashion using, for example, one of the following routes: injection or infusion by intravenous, intraperitoneal, intracerebral, intramuscular, intraocular, intraarterial, or intralesional routes, orally or using sustained- release systems as noted below.
  • hNRA-coM is administered continuously by infusion or by periodic bolus injection if the clearance rate is sufficiently slow, or by administration into the blood stream or lymph.
  • the preferred administration mode is targeted to the a specific tissue so as to direct the molecule to the source of antagonist action.
  • sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing the protein, which matrices are in the form of shaped articles, e.g., films, or microcapsules.
  • sustained-release matrices include polyesters, hydrogels (e.g., poly(2-hydroxyethyl- methacrylate) as described by Langer et al . (1981) J. Biomed. Mater. Res. 15:167-277 and Langer (1982) Chem. Tech. 12:98-105, or poly(vinyl alcohol)) , polylactides (U.S. Patent No.
  • the hNRA-coM molecule also may be entrapped in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization (for example, hydroxymethylcellulose or gelatin-microcapsules and poly- [methylmethacylate] microcapsules, respectively) , in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) , or in macroemulsions .
  • colloidal drug delivery systems for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules
  • macroemulsions for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules
  • polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid enable release of molecules for over 100 days, certain hydrogels release molecules for shorter time periods.
  • encapsulated molecules When encapsulated molecules remain in the body for a long time, they may denature or aggregate as a result of exposure to moisture at 37°C, resulting in a loss of biological activity and possible changes in immunogenicity. Rational strategies can be devised for stabilization depending on the mechanism involved, e.g., using appropriate additives, and developing specific polymer matrix compositions.
  • Sustained-release hNRA-coM compositions also include liposomally entrapped hNRA-coM.
  • Liposomes containing hNRA-coM are prepared by methods known per se : DE 3,218,121; Epstein et al . (1985) Proc . Natl . Acad. Sci. USA 82:3688-3692; Hwang et al . (1980) Proc. Natl. Acad. Sci. USA 77:4030-4034; EP 52,322; EP 36,676; EP 88,046; EP 143,949; EP 142,641; Japanese patent application 83-118008; U.S. Patent Nos.
  • the liposomes are of the small (about 200-800 Angstroms) unilamellar type in which the lipid content is greater than about 30 mol% cholesterol, the selected proportion being adjusted for the optimal hNRA-coM therapy.
  • a specific example of a suitable sustained-release formulation is in EP 647,449.
  • An effective amount of hNRA-coM to be employed therapeutically will depend, for example, upon the therapeutic objectives, the route of administration, and the condition of the patient. Accordingly, it will be necessary for the clinician to titer the dosage and modify the route of administration as required to obtain the optimal therapeutic effect.
  • a typical daily dosage of a hNRA-coM molecule used alone might range from about 1 ⁇ g/kg to up to 100 mg/kg of patient body weight or more per day, depending on the factors mentioned above, preferably about 10 ⁇ g/kg/day to 50 mg/kg/day.
  • Nucleotide sequences can be therapeutically administered by various techniques known to those skilled in the art. Delivery of hNRA-coM nucleotide sequences can be achieved using free polynucleotide or a recombinant expression vector such as a chimeric virus or a colloidal dispersion system. Especially preferred for therapeutic delivery of nucleotide sequences is the use of targeted liposomes.
  • Targeting of the therapeutic reagent to specific tissues is desirable to increase the efficiency of delivery.
  • the targeting can be achieved by passive mechanisms via the route of administration. Active targeting to specific tissues can also be employed.
  • the use of liposomes, colloidal suspensions, and viral vectors allows targeting to specific tissues by changing the composition of the formulation containing the therapeutic reagent, for example, by including molecules that act as receptors for components of the target tissues. Examples include sugars, glycoplipids, polynucleotides, or proteins. These molecules can be included with the therapeutic reagent. Alternatively, these molecules can be included by indirect methods, for example, by inclusion of a polynucleotide that encodes the molecule, or by use of packaging systems that provide targeting molecules.
  • the hNRA-coM molecules of the invention act as co-repressor factors which enhance the in vivo biological activity of steroid antagonists. Where it is desirable to suppress steroid antagonist activity in vi vo, suppression can be achieved by administering a therapeutic reagent that inhibits hNRA-coM function or activity.
  • Such therapeutic reagents can be used alone or in combination with other therapeutic reagents, for example, with chemotherapeutic agents in the treatment of malignancies.
  • the therapeutic reagents which may be employed are compounds which inhibit hNRA-coM expression, function, or activity, including nucleotides, polypeptides, and other molecules such as antisense oligonucleotides and ribozymes, and dominant negative mutants which can be made according to the invention and techniques known to the art.
  • Dominan -negative forms of hNRA-coM which effectively displace or compete with hNRA-coM for substrate binding and/or phosphorylation can be used to decrease the inhibitory activity of receptor-antagonist complexes.
  • Reagents which inhibit or decrease the expression of the endogenous hNRA-coM gene are also useful.
  • hNRA-coM Receptor Antagonist Co-Modulator Proteins
  • CCCAGATCTTCACTTTTTATGAAAGAGAAG antisense primer
  • the primers contain restriction enzyme sites that allow in-frame cloning into the lexA fusion vector.
  • the amplified hPR hgeHBD 637 _ 933 DNA was digested with EcoRI and BamHI and ligated into the BTM116 vector.
  • the BTM:hgeHBD vector was used as the "bait" plasmid in the yeast two-hybrid assay to (Fields & Song (1989) Nature 340:245-246) . Yeast strains.
  • the L40 yeast strain (MATa, his ⁇ 300, trpl-901, leu2-3+112, ade2, LYS: : (lexAop) 4 -HIS3 , URA3 : : (lexAop) 8 -LacZ, GAL4, gal80) was used in the yeast two-hybrid assay (provided by Dr. S. Hollenberg) .
  • Two hybrid library screen A Gal4 activation domain/HeLa cDNA fusion library was purchased from Clontech Laboratories, Inc., and screened using the BTM.-hgeHBD vector (Fig. 3) .
  • the BTM:hgeHBD construct was transformed into L40 cells using a the lithium acetate yeast transformation methods (Schiestl (1989) Curr. Genet. 16:339-346) to create L40 :PR-hgeHBD. Then L40 :PR-hgeHBD stain was transformed with the HeLa activation domain cDNA library. Eight million primary transformants were plated on -THULL plates (SD/-trp, - his, -ura, -leu, -lys) containing 1 ⁇ M RU486. His + colonies exhibiting S-galactosidase activity using the filter lift assay were further characterized. Electrocompetent HB101 E.
  • L40 was transformed with a) the positive library clones (autonomous activation control) ; b) BTM116 and the library clones (lexA interactor control) ; c) BTM:lamin and the library clones (nonspecific interaction control) ; and d) BTM:hgeHBD and the library clones (true positive control) .
  • clone TJ53 human N-coR
  • an additional control omitted hormone treatment.
  • the unliganded BTM:hgeHBD failed to interact with the pGADGH:hNRA-coM. Only the RU486-occupied BTM:hgeHBD interacted with hNRA-coM.
  • TJ1-TJ131 Figs. 1A-1R
  • 22 size variants were selected for sequencing (SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 , SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO:17, and SEQ ID NO:18) .
  • the sequences obtained were compared to Genebank sequences. Several unique cDNA sequences were determined.
  • sequences of SEQ ID NO: 17- 18 encode a single protein having partially homology to the mouse nuclear receptor co-repressor protein that binds the thyroid hormone/retinoic acid/vitam D subfamily of nuclear receptors (H ⁇ rlem et al . (1995) Nature 377:397-403; Chen et al. (1995) Nature 377:454; Burns et al . (1995) Proc. Natl. Acad. Sc . 92:9525) .
  • L7 is a cytosolic ribosomal protein involved in translation.
  • TJ21 (SEQ ID NO: 6) shares partial homology to the human Ku autoantigen p70 subunit.
  • TJ53 SEQ ID NO: 17
  • LexA-DBD-PR HBD LexA-DBD-PR HBD
  • library fusion protein which is the Gal4 activation domain fused to the interaction domain of hNAR-coM.
  • the interaction between these two fusion proteins was observed to occur only after treatment of yeast with the antiprogestin RU486, scored in a secondary screen by the presence of blue j ⁇ -gal + cells previously selected for growth on histidine drop-out plates in the primary screen (Fields S Song (1989) Nature 340:245-246 Example 3. Therapeutic Use of hNRA-coM Molecule.
  • Tam ⁇ xifen an antiestrogen
  • Tamoxifen is expected to behave in vivo as an estrogen antagonist by inhibiting estrogen-stimulated growth of tumor tissue in the breast.
  • tamoxifen acts like an estrogen agonist, e.g., by stimulating growth of endometrial cancers.
  • This is achieved by delivery of a hNRA-coM molecule to the uterus.
  • Such local delivery can be achieved by introducing hNRA-coM encoding nucleotide sequences packaged into targeted liposomes into the uterus from an intrauterine devise inserted vaginally.
  • yeast two-hybrid system is used in a ligand screen.
  • Yeast cells of the L40 genetic strain are engineered to contain plasmids expressing a fusion protein of LexA-DBD and the HBD region of the desired steroid receptor (e.g., the estrogen receptor) in conjunction with a plasmid expressing a fusion protein of the Gal4 activation domain fused to the interaction domain of hNRA-coM.
  • the cells are then contacted with a candidate steroid receptor ligand.
  • yeast cells are engineered by methods known in the art (see, for example, Guthrie & Fink (1991) Guide to Yeast Genetics and Molecular Biology, Methods Enzymol .
  • the cells are then engineered to express a plasmid encoding the desired steroid receptor (e.g., estrogen receptor) , and a plasmid expressing a promoter containing the appropriate response element (e.g., estrogen response element) fused to a reporter gene, for example, / S-galactosidase.
  • the cells are contacted with the candidate ligand previously identified in the first screen as an antagonist (e.g., antiestrogen) .
  • the candidate ligand has partial agonist activity. If the desired candidate ligand is a "pure" antagonist, a ligand having partial agonist activity would be discarded.
  • the second screening method can be used to select "pure" antagonists from among ligands having mixed antagonist/agonist activities.
  • CACATTNCCA CACAACATAC GAGCCGGAAG CATAATGTGT AAAGCCTGGG GTGCCTAATG 180
  • MOLECULE TYPE cDNA
  • FEATURE (A) NAME/KEY: N is unknown, M is A or C, S is C or G, K is G or
  • N is unknown, Y is C or T/U
  • CCCATCTCCC CACCCCAGGT TCCGGGTGTG CATGAGAAAC AGGACAGCTT GCTGCTCTTG 60
  • TCTNNANGCC ATTCTTTTGC TGATCCCGCC AGTAACCTTG GGCTGGA 347

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Toxicology (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Endocrinology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention porte sur de nouvelles molécules comodulatrices de l'antagoniste du récepteur nucléaire des hormones stéroïdiennes humaines se fixant au complexe antagoniste du récepteur. Lesdites molécules servent à une évaluation rapide des antagonistes des ligands du récepteur des stéroïdes et à moduler l'activité in vivo des antagonistes des stéroïdes.
PCT/US1997/002954 1996-02-28 1997-02-20 Comodulateur de l'antagoniste du recepteur des steroides et ses methodes d'utilisation WO1997031646A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU19753/97A AU1975397A (en) 1996-02-28 1997-02-20 Steroid receptor antagonist co-modulator and methods for using same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US60740996A 1996-02-28 1996-02-28
US08/607,409 1996-02-28

Publications (1)

Publication Number Publication Date
WO1997031646A1 true WO1997031646A1 (fr) 1997-09-04

Family

ID=24432141

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1997/002954 WO1997031646A1 (fr) 1996-02-28 1997-02-20 Comodulateur de l'antagoniste du recepteur des steroides et ses methodes d'utilisation

Country Status (2)

Country Link
AU (1) AU1975397A (fr)
WO (1) WO1997031646A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999054728A2 (fr) * 1998-04-23 1999-10-28 Karo Bio Usa, Inc. Methode permettant de prevoir la capacite de composes de moduler l'activite biologique de recepteurs
US9182408B2 (en) * 2004-09-16 2015-11-10 Valneva Method of screening by using conformation sensitive peptides

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
MOL. ENDO., January 1995, Vol. 9, No. 1, SEOL et al., "Isolation of Proteins that Interact Specifically with the Retinoid X Receptor: Two Novel Orphan Receptors", pages 72-85. *
MOL. ENDO., October 1996, Vol. 10, No. 5, HORWITZ et al., "Nuclear Receptor Coactivators and Corepressors", pages 1167-1177. *
NATURE, 05 October 1995, Vol. 377, CHEN et al., "A Transcriptional Co-Repressor that Interacts with Nuclear Hormone Receptors", pages 454-457. *
NATURE, 05 October 1995, Vol. 377, HORLEIN et al., "Ligand-Independent Repression by the Thyroid Hormone Receptor Mediated by a Nuclear Receptor Co-Repressor", pages 397-403. *
NUCLEIC ACIDS RES., October 1993, Vol. 21, No. 2, HEMMERICH et al., "Structural and Functional Properties of Ribosomal Protein L7 from Humans and Rodents", pages 223-231. *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999054728A2 (fr) * 1998-04-23 1999-10-28 Karo Bio Usa, Inc. Methode permettant de prevoir la capacite de composes de moduler l'activite biologique de recepteurs
WO1999054728A3 (fr) * 1998-04-23 2000-02-10 Novalon Pharmaceutical Corp Methode permettant de prevoir la capacite de composes de moduler l'activite biologique de recepteurs
US9182408B2 (en) * 2004-09-16 2015-11-10 Valneva Method of screening by using conformation sensitive peptides

Also Published As

Publication number Publication date
AU1975397A (en) 1997-09-16

Similar Documents

Publication Publication Date Title
Rodgers et al. Expression and localization of matrilysin, a matrix metalloproteinase, in human endometrium during the reproductive cycle
Horwitz The molecular biology of RU486. Is there a role for antiprogestins in the treatment of breast cancer?
Mayo et al. Inhibin A-subunit cDNAs from porcine ovary and human placenta.
Tewari et al. Rapid Induction in Regenerating Liver of RL/IF-1 (an ΙκΒ That Inhibits NF-κΒ, RelB-p50, and c-Rel-p50) and PHF, a Novel κΒ Site-Binding Complex
Sorensen et al. Biphenotypic sarcomas with myogenic and neural differentiation express the Ewing's sarcoma EWS/FLI1 fusion gene
Christian et al. Functional association of PR and CCAAT/Enhancer-Binding Proteinβ isoforms: Promoter-dependent cooperation between PR-B and Liver-Enriched Inhibitory Protein, or Liver-Enriched Activatory Protein and PR-A in human endometrial stromal cells
Schams et al. Expression and localisation of oestrogen and progesterone receptors in the bovine mammary gland during development, function and involution
CH694204A5 (de) Mit dem IGF-1 Rezeptor wechselwirkende Proteine (IIPs), Nukleinsaeuren, die fuer diese codieren, und deren Verwendungen
KR19980041692A (ko) 신규한 에스트로겐 수용체
KR100536394B1 (ko) Fas/ap01수용체들의기능조절인자
MXPA97004765A (en) Improvements in or that are related to the endometr function
CA2302169A1 (fr) Inhibiteurs du phenomene d'activation ne dependant pas de l'androgene et ayant un effet sur le recepteur de l'androgene
Hoare et al. Identification of a GABPα/β binding site involved in the induction of oxytocin receptor gene expression in human breast cells. Potentiation by c-Fos/c-Jun
Zhu et al. Ferritin heavy chain is a progesterone-inducible marker in the uterus during pregnancy
JPH11502402A (ja) レチノイドｘ受容体相互作用性ポリペプチドならびに関連する分子および方法
JPH09502094A (ja) 老化細胞由来ｄｎａ合成阻害因子
Gu et al. Cloning of a DNA binding protein that is a tyrosine kinase substrate and recognizes an upstream initiator-like sequence in the promoter of the preprodynorphin gene
Aiello et al. Characterization and hepatic expression of rat alpha 1-inhibitor III mRNA.
Muñiz et al. Transcriptional regulation of cyclin D2 by the PKA pathway and inducible cAMP early repressor in granulosa cells
US20070020266A1 (en) Gpr54 receptor agonist and antagonist useful for the treatment of gonadotropin related diseases
Somers et al. Luteinization in primates is accompanied by loss of a 43-kilodalton adenosine 3', 5'-monophosphate response element-binding protein isoform
EP0887081A2 (fr) Kinase régulée par les glucocorticoides du sérum humain, une cible pour maladies rénales chroniques
WO1997031646A1 (fr) Comodulateur de l'antagoniste du recepteur des steroides et ses methodes d'utilisation
AU785439B2 (en) Hormone receptor modulation
DE10139874A1 (de) Humane Mater-Proteine

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: CA

122 Ep: pct application non-entry in european phase