Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6811—Selection methods for production or design of target specific oligonucleotides or binding molecules
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P11/00—Drugs for disorders of the respiratory system
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P17/00—Drugs for dermatological disorders
  • A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P17/00—Drugs for dermatological disorders
  • A61P17/06—Antipsoriatics
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P19/00—Drugs for skeletal disorders
  • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P25/00—Drugs for disorders of the nervous system
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
  • A61P31/04—Antibacterial agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
  • A61P35/04—Antineoplastic agents specific for metastasis
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P37/00—Drugs for immunological or allergic disorders
  • A61P37/02—Immunomodulators
  • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
  • A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P9/00—Drugs for disorders of the cardiovascular system
  • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
  • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
  • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
  • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
  • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
  • G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
  • G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
  • G01N2333/4701—Details
  • G01N2333/4724—Lectins
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
  • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
  • G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
  • G01N2333/7056—Selectin superfamily, e.g. LAM-1, GlyCAM, ELAM-1, PADGEM
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
  • G01N2333/90—Enzymes; Proenzymes
  • G01N2333/914—Hydrolases (3)
  • G01N2333/948—Hydrolases (3) acting on peptide bonds (3.4)
  • G01N2333/95—Proteinases, i.e. endopeptidases (3.4.21-3.4.99)
  • G01N2333/964—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue
  • G01N2333/96425—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals
  • G01N2333/96427—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals in general
  • G01N2333/9643—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals in general with EC number
  • G01N2333/96433—Serine endopeptidases (3.4.21)

Definitions

• Described herein are methods for identifying and preparing high-affinity nucleic acid ligands to lectins.
• Lectins are carbohydrate binding proteins.
• the method utilized herein for identifying such nucleic acidligands is called SELEX, an acronym for Systematic Evolution ofLigands by Exponential enrichment.
• WGA wheatgerm agglutinin
• L-selectin L-selectin
• E-selectin E-selectin
• P-selectin P-selectin
• carbohydrate portions ofglyco-conjugates are information rich molecules (N.
• proteins mediate a diverse array ofbiological processes which include: trafficking oflysosomal enzymes, clearance ofserum proteins, endocytosis, phagocytosis, opsonization, microbial and viral infections, toxinbinding, fertilization, immune and inflammatory responses, cell adhesion and migration in development and in pathological conditions such as metastasis.
• trafficking oflysosomal enzymes clearance ofserum proteins, endocytosis, phagocytosis, opsonization, microbial and viral infections, toxinbinding, fertilization, immune and inflammatory responses, cell adhesion and migration in development and in pathological conditions such as metastasis.
• Roles in symbiosis and host defense have been proposed for plant lectins but remain controversial. While the functional role ofsome lectins is well understood, that ofmany others is understood poorly or not at all.
• the hepatic asialoglycoproteinreceptor specifically binds galactose andN-acetylgalactose and thereby mediates the clearance ofserumglycoproteins that present terminal N-acetylgalactose or galactose residues, exposedby the prior removal ofa terminal sialic acid.
• the human mannose-binding protein is a serum protein thatbinds terminal mannose, fucose and N-acetylglucosamine residues. These terminal residues are common on microbes butnot mammalian glyco-conjugates.
• the binding specificity ofMBP constitutes anon-immune mechanismfordistinguishing selffrom non-selfand mediates host defense through opsonization andcomplement fixation.
• Influenzavirus hemagglutinin mediates the initial step ofinfection, attachment to nasal epithelial cells, by binding sialic acid residues ofcell-surface receptors.
• the diversity oflectin mediated functions provides avast array ofpotential therapeutic targets for lectin antagonists. Both lectins thatbindendogenous carbohydrates andthose thatbind exogenous carbohydrates are target candidates.
• antagonists to the mammalian selectins, afamily ofendogenous carbohydratebinding lectins may have therapeutic applications in avariety of leukocyte-mediated disease states.
• Inhibition ofselectin binding to its receptor blocks cellular adhesion and consequently may be useful in treating inflammation, coagulation, transplant rejection, tumor metastasis, rheumatoid arthritis, reperfusion injury, stroke, myocardial infarction, burns, psoriasis, multiple sclerosis, bacterial sepsis, hypovolaemic andtraumatic shock, acute lung injury, andARDS.
• the selectins, E-, P- and L-, are three homologous C-type lectins that recognize the tetrasaccharide, sialyl-Lewis x (C. Foxall et al, 1992, J. Cell Biol. 117,895-902). Selectins mediate the initial adhesion ofneutrophils andmonocytes to activated vascular endothelium at sites ofinflammation (R. S. Cotran et al., 1986, J. Exp. Med.164, 661-; M. A. Jutila et al., 1989, J. Immunol.143,3318-; J. G. Geng et al., 1990, Nature, 757; U. H.
• L-selectin is responsible for the homing oflymphocytes to peripheral andmesenteric lymphnodes (W. M.
• CD22 ⁇ , CD23, CD44 and sperm lectins (A. Varki, 1993, Glycobiol.3, 97-130; P.M. Wassarman, 1988, Ann. Rev. Biochem.57, 415-442).
• CD22 ⁇ is involved in early stages ofB lymphocyte activation; antagonists may modulate the immune response.
• CD23 is the low affinity IgE receptor; antagonists may modulate the IgE response in allergies and asthma.
• CD44 binds hyaluronic acid and thereby mediates cell/cell and cell/matrix adhesion; antagonists may modulate the inflammatory response.
• Sperm lectins are thought to be involved in sperm/egg adhesion and in the acrosomal response; antagonists may be effective contraceptives, eitherby blocking adhesion orby inducing apremature, spermicidal acrosomal response.
• Antagonists to lectins thatrecognize exogenous carbohydrates may have wide application forthe prevention ofinfectious diseases.
• Many viruses influenza A, B and C; Sendhi, Newcastle disease, coronavirus, rotavirus, encephalomyelitis virus, enchephalomyocarditis virus, reovirus, paramyxovirus
• Glycobiol.3, 97-130 Similarly colonization/infection strategies ofmany bacteria utilize cell surface lectins to adhere to mammalian cell surface glyco-conjugates. Antagonists to bacterial cell surface lectins are expected to have therapeutic potential for a wide spectrum ofbacterial infections, including: gastric (Helicobacterpylori), urinary tract (E. coli), pulmonary (Klebsiellapneumoniae, Stretococcus
• aeruginosa infection is based on three observations. First, abacterial cell surface, GalNAc ⁇ 1-4Gal binding lectin mediates infection by adherence to asialogangliosides ( ⁇ GM1 and ⁇ GM2) ofpulmonary epithelium (L. Imundo et al., 1995, Proc. Natl. Acad. Sci 92, 3019-3023). Second, in vitro, the binding ofP. aeruginosa is competed by the gangliosides' tetrasaccharide moiety, Gal ⁇ 1-3GalNAc ⁇ 1-4Gal ⁇ 1-4Glc.
• Non-bacterial microbes thatutilize lectins to initiate infection include
• Entamoebahistalytica (aGal specific lectin thatmediates adhesion to intestinal mucosa; W.A. Petri, Jr., 1991, AMS News 57:299-306) and Plasmodium faciparum (a lectin specific for the terminal Neu5Ac(a2-3)Gal ofglycophorin A of erthrocytes; PA. Orlandi et al., 1992, J. Cell Biol.116:901-909). Antagonists to these lectins are potential therapeutics for dysentery and malaria.
• Toxins are another class ofproteins that recognize exogenous carbohydrates (K-A Karlsson, 1989, Ann. Rev. Biochem.58:309-350). Toxins are complex, two domain molecules, composed ofa functional and a cell recognition/adhesion domain.
• the adhesion domain is often a lectin (i.e., bacterial toxins: pertussis toxin, cholera toxin, heat labile toxin, verotoxin and tetanus toxin; plant toxins: ricin and abrin).
• Lectin antagonists are expected to prevent these toxins frombinding their target cells and consequently to be useful as antitoxins.
• MBP/IgG immunocomplexes may contribute to host tissue damage through complement activation.
• the eosinophil basic protein is cytotoxic. Ifthe cytotoxicity is mediatedby the lectin activity ofthis protein, then a lectin antagonistmay have therapeutic applications in treating eosinophilmediated lung damage.
• Lectin antagonists may also be useful as imaging agents or diagnostics.
• E-selectin antagonists may be used to image inflamed endothelium.
• antagonists to specific serum lectins i.e. mannose-binding protein, may also beuseful in quantitatingproteinlevels.
• Lectins are often complex, multi-domain, multimeric proteins.
• CRDs ofmammalian lectins fall into three phylogenetically conservedclasses: C-type, S-type and P-type (K. Drickamer and M.E. Taylor, 1993, Annu. Rev. Cell Biol.9, 237-264).
• C-type lectins require Ca ++ forligandbinding, are extracellular membrane and soluble proteins and, as a class, bind a variety ofcarbohydrates.
• S-type lectins are most active underreducing conditions, occurboth intra- and extracellularly, bind ⁇ -galactosides and do not require Ca ++ .
• P-type lectins bind mannose 6-phosphate as their primary ligand.
• lectin specificity is usually expressed in terms ofmonosaccharides and/or oligosacchrides (i.e., MBP binds mannose, fucose andN- acetylglucosamine), the affinity formonosaccharides is weak.
• the dissociation constants formonomeric saccharides are typically in the millimolarrange (Y.C. Lee, 1992, FASEB J.6:3193-3200; G.D. Glick et al., 1991, J Biol.Chem.266:23660- 23669; Y. Nagata and M.M. Burger, 1974, J. Biol. Chem.249:116-3122).
• Co-crystals ofMBP complexed with mannose oligomers offer insight into the molecular limitations on affinity and specificity ofC-type lectins (W.I. Weis et al., 1992, Nature 360:127-134; K. Drickamer, 1993, Biochem. Soc. Trans.21:456- 459).
• the 3- and 4-hydroxyl groups ofmannose form coordination bonds with bound Ca ++ ion #2 and hydrogen bonds with glutamic acid (185 and 193) and asparagine (187 and 206).
• the limited contacts between the CRD and bound sugar are consistent with its spectrum ofmonosaccharide binding; N-acetylglucosamine has equatorial 3- and 4-hydroxyls while fucose has similarly configured hydroxyls at the 2 and 3 positions.
• the affinity ofthe mannose-binding protein and other lectins fortheirnatural ligands is greater than that for monosaccharides. Increased specificity and affinity can be accomplished by establishing additional contacts between aprotein and its ligand (K.
• Drickamer, 1993, supra) eitherby 1) additional contacts withthe terminal sugar (i.e., chickenhepatic lectin binds N-acetylglucose amine with greater affinity than mannose or fucose suggesting interaction with the 2-substituent); 2) clustering ofCRDs forbinding complex oligosaccharides (i.e., the mammalian asialylglycoprotein receptor); 3) interactions with additional saccharide residues (i.e., the lectin domain ofselectins appears to interactwithtwo residues ofthe tetrasaccharide sialyl-Lewis x : with the chargedterminal residue, sialic acid, and withthe fucose residue; wheat germ agglutinin appears to interact with all three residues oftrimers ofN-acetylglucosamine); orby 4) contacts with anon- carbohydrate portion ofa glyco-protein.
• the terminal sugar i.e., chickenhepatic lectin bind
• the first approach has had limited success.
• homologues of sialic acid have been analyzed for affinity to influenzavirus hemagglutinin (SJ. Watowich et al.1994, Structure 2:719-731).
• the dissociation constants ofthe best analogues are 30 to 300 ⁇ M which is only 10 to 100-foldbetter than the standard monosaccharide.
• sialyl-Lewis a and sialyl-Lewis x have IC50S of220 ⁇ M and750 ⁇ M, respectively, for the inhibition ofthe binding ofan
• Lectins are nearly ideal targets for isolation ofantagonists by SELEX technology described below. The reason is that oligonucleotide ligands that are boundto thecarbohydratebinding sitecanbe specifically elutedwiththerelevant sugar(s). Oligonucleotide ligands with affinities that are several orders ofmagnitude greaterthan that ofthe competing sugarcan be obtainedby the appropriate manipulation ofthenucleic acidligand to competitorratio. Since the carbohydrate binding site is the active site ofa lectin, essentially all ligands isolatedby this procedure will be antagonists. In addition, these SELEX ligands will exhibit much greater specificity than monomeric and oligomeric saccharides.
• the SELEX method involves selection from a mixture ofcandidate oligonucleotides and step-wise iterations ofbinding, partitioning and amplification, using the same general selection scheme, to achieve virtually any desiredcriterion of binding affinity and selectivity.
• the SELEX method includes steps ofcontacting the mixture with the targetunder conditions favorable forbinding, partitioning unboundnucleic acids from those nucleic acids which have bound specifically to targetmolecules, dissociating the nucleic acid-targetcomplexes, amplifying the nucleic acids dissociatedfrom the nucleic acid-target complexes to yield aligand-enrichedmixture ofnucleic acids, then reiterating the steps ofbinding, partitioning, dissociating and amplifying through as many cycles as desired to yield highly specific, high affinity nucleic acid ligands to the targetmolecule.
• Theophylline and Caffeine describes amethod foridentifying highly specific nucleic acid ligands able to discriminate between closely relatedmolecules, termed Counter-SELEX.
• Chemi-SELEX describes methods for covalently linking aligand to its target.
• the SELEX method encompasses the identification ofhigh-affinity nucleic acid ligands containing modified nucleotides conferring improved characteristics on the ligand, such as improved in vivo stability orimproved delivery characteristics. Examples of such modifications include chemical substitutions at the ribose and/or phosphate and/orbase positions.
• SELEX-identifiednucleic acid ligands containing modified nucleotides are described in United States Patent Application Serial No. 08/117,991, filed September 8, 1993, entitled "High Affinity Nucleic Acid Ligands Containing Modified Nucleotides," that describes oligonucleotides containing nucleotide derivatives chemically modified at the 5- and 2'-positions ofpyrimidines.
• Patent Application Serial No.08/264,029 filed June 22, 1994, entitled “Novel Method ofPreparation of2' ModifiedPyrimidine IntramolecularNucleophilic Displacement," describes novel methods formaking 2'-modified nucleosides.
• the SELEX method also includes combining the selectednucleic acidligands withnon-oligonucleotide functional units and United States Patent Application Serial No.08/234,997, filed April 28, 1994, entitled "Systematic Evolution ofLigands by Exponential
• the presentinvention applies the SELEX methodology to obtain nucleic acid ligands to lectin targets.
• Lectin targets, or lectins include all the non-enzymatic carbohydrate-binding proteins ofnon-immune origin, which include, but are not limited to, those described above.
• the present invention includes methods ofidentifying and producing nucleic acidligands to lectins andthe nucleic acid ligands so identified and produced. More particularly, nucleic acid ligands are provided that are capable ofbinding specifically toWheatGerm Agglutinin (WGA), L-Selectin, E-selectin andP-selectin.
• nucleic acid ligands and nucleic acid ligand sequences to lectins comprising the steps of(a) preparing acandidate mixture ofnucleic acids, (b) partitioningbetween members of said candidate mixture on thebasis ofaffinity to said lectin, and (c) amplifying the selectedmoleculesto yield amixture ofnucleic acids enrichedfornucleic acid sequences with arelatively higher affinity forbinding to saidlectin.
• thepresentinvention includes thenucleic acidligandsto lectins identified according to the above-described method, including those ligands to Wheat Germ Agglutinin listed in Table 2, those ligands to L-selectin listed in Tables 8,12 and 16, and those ligands to P-selectin listed inTables 19 and 25. Additionally, nucleic acid ligands to E-selectin and serummannose binding protein areprovided. Also included arenucleic acidligands to lectins that are substantially homologous to any ofthe given ligands and that have substantially the same ability to bind lectins and antagonize the ability ofthe lectin tobind carbohydrates. Further includedin this invention are nucleic acid ligands to lectins thathave substantially the same structural form as the ligands presentedherein and thathave substantially the same ability tobind lectins and antagonize the ability ofthe lectin tobind carbohydrates.
• Thepresentinvention also includes modifiednucleotide sequences based on the nucleic acid ligands identified herein and mixtures ofthe same.
• the present invention also includes the use ofthe nucleic acidligandsin therapeutic, prophylactic and diagnostic applications.
• Figure 1 shows consensus hairpin secondary structures for WGA 2'-NH 2 RNA ligands: (a) family 1, (b) family 2 and (c) family 3. Nucleotide sequence is in standard one letter code. Invariantnucleotides are in bold type. Nucleotides derived from fixed sequence are in lowercase.
• Figure 2 shows binding curves for the L-selectin SELEX second and ninth round 2'-NH 2 RNA pools to peripheral blood lymphocytes (PBMCs).
• Figure 3 shows binding curves for random 40N72-NH 2 RNA (SEQ ED
• PBMC peripheral blood lymphocytes
• Figure 4 shows the results of a competition experiment in which the binding of5 nM 32 P-labeled F14.12 (SEQ ID NO: 78) to PBMCs (10 7 /ml) is competed with increasing concentrations ofunlabeled F14.12 (SEQ ID NO: 78).
• RNA Bound equals 100 x (netcounts bound in the presence ofcompetitor/net counts boundin the absence ofcompetitor).
• Figure 5 shows the results of a competition experimentin which the binding of5 nM 32 P-labeled F14.12 (SEQ ID NO: 78) to PBMCs (10 7 /ml) is competed withincreasing concentrations oftheblockingmonoclonal anti-L-selectin antibody, DREG-56, or an isotype matched, negative control antibody.
• RNABound equals 100 x (net counts bound in the presence ofcompetitor/net counts bound in the absence ofcompetitor).
• FIG. 6 shows the results ofacompetitive ELISA assay in which the binding ofsolubleLS-Rg to immobilized sialyl-Lewis x /BSAconjugates is competed with increasing concentrations ofunlabeledF14.12 (SEQID NO: 78). Binding of LS-Rg was monitored with an HRP conjugated anti-human IgG antibody. LS-Rg Bound equals 100x (OD 450 in the presence ofcompetitor)/(OD 450 in the absence ofcompetitor). The observed OD450 was corrected fornonspecific binding by subtracting the OD 450 in the absence ofLS-Rg from the experimental values. In the absence ofcompetitorthe OD 450 was 0.324 and in the absence ofLS-Rg 0.052.
• Binding ofLS-Rg requires divalent cations; in the absence ofcompetitor, replacement of Ca++/Mg ++ with4 mM EDTA reduced the OD 450 to 0.045.
• Figure 7 shows hairpin secondary structures for representative L-selectin 2'NH 2 RNA ligands: (a) F13.32 (SEQ. ID NO: 67), family I; (b) 6.16 (SEQ. ID NO: 67), family I; (b) 6.16 (SEQ. ID NO: 67), family I; (b) 6.16 (SEQ. ID NO: 67), family I; (b) 6.16 (SEQ. ID NO:
• Figure 8 shows a schematic representation ofeach dimeric and mutimeric oligonucleotide complex: (a) dimeric branched oligonucleotide; (b) multivalent streptavidin/bio-oUgonucleotide complex (A: streptavidin; B: biotin); (c) dimeric dumbell oligonucleotide; (d) dimeric fork oligonucleotide.
• Figure 9 shows binding curves for the L-selectin SELEX fifteenth round ssDNA pool to PBMCs (10 7 /ml).
• Figure 10 shows the results ofacompetition experimentin which the binding of2 nM 32 P-labeled round 15 ssDNA to PBMCs (10 7 /ml) is competed with increasing concentrations ofthe blocking monoclonal anti-L-selectin antibody, DREG-56, or an isotype matched, negative control antibody.
• RNA Bound equals 100 x (net counts bound in the presence ofcompetitor/net counts bound in the absence ofcompetitor).
• Figure 11 shows L-selectin specific binding ofLD201T1 (SEQ ID NO: 185) to human lymphocytes and granulocytes in whole blood
• a FITC-LD201T1 binding to lymphocytes is competedby DREG-56, unlabeled LD201T1, and inhibitedby EDTA.
• b F1TC-LD201T1 binding to granulocytes is competed by DREG-56, unlabeled LD201T1, and inhibited by EDTA.
• Figure 12 shows the consensus hairpin secondary structures for family 1 ssDNA ligands to L-selectin.
• Nucleotide sequence is in standard one letter code. Invariant nucleotides are in bold type. The base pairs at highly variable positions are designatedN-N'.
• To the right ofthe stem is a matrix showing the number of occurances ofparticularbase pairs for the position in the stem that is on the same line.
• Figure 13 shows that in vitro pre-treatment ofhuman PBMC withNX288 (SEQ ID NO: 193) inhibits lymphocyte trafficking to SOD mouse PLN.
• Human PBMC were purified from heparinised blood by a Ficoll-Hypaque gradient, washed twice with HBSS (calcium/magnesium free) and labeled with 51 Cr (Amersham). After labeling, the cells were washed twice with HBSS (containing calcium and magnesium) and 1% bovine serum albumin (Sigma).
• HBSS containing calcium and magnesium
• bovine serum albumin Sigma
• the cells were either untreated ormixed with either 13 pmol ofantibody (DREG-56 orMEL-14), or4, 1, or 0.4 nmol ofmodified oligonucleotide.
• 13 pmol ofantibody DREG-56 orMEL-14
• DREG-56 orMEL-14 13 pmol ofantibody
• MEL-14 13 pmol ofantibody
• a blood sample taken and the mice were euthanised.
• PLN, MLN, Peyer's patches, spleen, liver, lungs, thymus, kidneys and bone marrow were removed and the counts incorporated into the organs determined by a Packard gamma counter. Values shown represent the mean ⁇ s.e. oftriplicate samples, and are representative of3 experiments.
• Figure 14 shows that pre-injection ofNX288 (SEQ ID NO: 193) inhibits human lymphocyte trafficking to SCID mouse PLN and MLN.
• Human PBMC were purified, labeled, and washed as described above.
• Cells were prepared as described in Figure 13.
• Female SCID mice (6-12 weeks of age) were injected intravenously with 2x10 6 cells. One to 5 min prior to injecting the cells, the animals were injected with either 15 pmol DREG-56 or4 nmol modified oligonucleotide. Animals were scarificed 1 hour after injection ofcells. Counts incorporated into organs were quantified as described in Figure 13. Values shown represent the mean ⁇ s.e. of triplicate samples, and are representative of2 experiments.
• Figure 15 shows the consensus hairpin secondary structures for 2'-F RNA ligands to L-selectin.
• Nucleotide sequence is in standard one letter code. Invariant nucleotides are in bold type. The base pairs at highly variablepositions are designated N-N'.
• N-N' The base pairs at highly variablepositions are designated N-N'.
• To the right ofthe stem is a matrix showing the number of occurances ofparticularbasepairs forthe position in the stemthat is on the same line.
• Figure 16 shows the consensus hairpin secondary structures for 2'-F RNA ligands toP-selectin.
• Nucleotide sequence is in standard one lettercode. Invariant nucleotides are in bold type. Thebasepairs athighly variablepositions are designatedN-N'. To the right ofthe stem is amatrix showing the number of occurances ofparticularbase pairs forthe position in the stemthatis on the same line.
• This.application describes high-affinity nucleic acid ligands tolectins identified through the method known as SELEX.
• SELEX is described in U.S.
• the SELEX process may be definedby the following series ofsteps:
• a candidate mixture ofnucleic acids ofdiffering sequence is prepared.
• the candidate mixture generally includes regions offixed sequences (i.e., each of the members ofthe candidate mixture contains the same sequences in the same location) and regions ofrandomized sequences.
• the fixed sequence regions are selected either: (a) to assist in the amplification steps describedbelow, (b) to mimic a sequence known to bind to the target, or (c) to enhance the concentration ofa given structural arrangementofthe nucleic acids in the candidate mixture.
• the randomized sequences can be totally randomized (i.e., the probability offinding abase at any position being one in four) or only partially randomized (e.g., the probability of finding abase at any location can be selected at any level between 0 and 100 percent).
• the candidate mixture is contacted with the selectedtarget under conditions favorable forbinding between the target and members ofthe candidate mixture. Under these circumstances, the interaction between the target and the nucleic acids ofthe candidate mixture can be considered as forming nucleic acid- target pairs between the target and those nucleic acids having the strongest affinity forthe target.
• nucleic acids with the highest affinity forthe target arepartitioned fromthose nucleic acids with lesser affinity to the target. Because only an extremely small number ofsequences (andpossibly only one molecule ofnucleic acid) corresponding to the highest affinity nucleic acids existin the candidate mixture, it is generally desirable to setthe partitioning criteria so that asignificantamountofthe nucleic acids in the candidate mixture (approximately .05-50%) are retained during partitioning.
• nucleic acids selected duringpartitioning as having the relatively higheraffinity to the target are then amplifiedto create a new candidate mixture that is enriched in nucleic acids having a relatively higher affinity for the target.
• the newly formed candidate mixture contains fewer and fewer unique sequences, and the average degree ofaffinity ofthe nucleic acids to the target will generally increase.
• the SELEX process will yield a candidate mixture containing one or a small number ofunique nucleic acids representing those nucleic acids from the original candidate mixture having the highest affinity to the targetmolecule.
• the SELEX Patent Applications describe and elaborate on this process in great detail. Included are targets that can be used in the process; methods for partitioning nucleic acids within a candidate mixture; and methods for amplifying partitionednucleic acids to generate enriched candidate mixture.
• the SELEX Patent Applications also describe ligands obtained to anumber oftarget species, including bothprotein targets where the protein is and is not a nucleic acid binding protein.
• This invention also includes the ligands as described above, wherein certain chemical modifications are made in order to increase the in vivo stability ofthe ligand or to enhance or mediate the delivery ofthe ligand.
• modifications include chemical substitutions at the sugar and/ orphosphate and/or base positions ofa given nucleic acid sequence. See, e.g., U.S. Patent Application Serial No.08/117,991, filed September 9, 1993, entitled "High Affinity Nucleic Acid Ligands Containing ModifiedNucleotides" which is specifically incorporated herein by reference.
• U.S. Patent Application Serial No.07/964,624 filed October 21, 1992 ('624), now U.S.
• Patent No.5,496,938 methods are described for obtaining improved nucleic acid ligands after SELEX has been performed.
• the '624 application entitled “Methods ofProducing Nucleic AcidLigands,” is specifically incorporated herein by reference.
• Further included in the '624 patent are methods for determining the three- dimensional structures ofnucleic acid ligands. Such methods include mathematical modeling and structure modifications ofthe SELEX-derived ligands, such as chemical modification and nucleotide substitution. Othermodifications are known to one ofordinary skill in the art. Suchmodifications may be made post-SELEX (modification ofpreviously identifiedunmodified ligands) orby incorporation into the SELEX process.
• nucleic acid ligands ofthe invention can be complexed with various other compounds, including butnot limited to, lipophilic compounds ornon-immunogenic, highmolecularweightcompounds.
• Lipophilic compounds include, but are not limited to, cholesterol, dialkyl glycerol, and diacyl glycerol.
• Non-immunogenic, high molecularweight compounds include, but are notUmitedto, polyethylene glycol, dextran, albumin andmagnetite.
• the nucleic acid ligands described herein can be complexed with a lipophilic compound (e.g., cholesterol) or attached to orencapsulated in a complex comprised oflipophilic components (e.g., aliposome).
• the complexed nucleic acid ligands can enhance the cellularuptake ofthe nucleic acid ligands by a cell for delivery ofthe nucleic acid ligands to an intracellulartarget.
• the complexed nucleic acid ligands can also have enhancedpharmacokinetics and stability.
• United States PatentApplication Serial Number 08/434,465, filed May 4, 1995, entitled "Nucleic Acid Ligand Complexes,” which is herein incorporated by reference describes a method for preparing a therapeutic or diagnostic complex comprised ofa nucleic acid ligand and alipophilic compound or a non-immunogenic, high molecular weight compound.
• nucleic acid ligands identifiedby such methods are useful for both therapeutic and diagnostic purposes.
• Therapeutic uses include the treatment orprevention ofdiseases or medical conditions in human patients. Many ofthe therapeutic uses are described in the background ofthe invention, particularly, nucleic acid ligands to selectins are useful as anti- inflammatory agents. Antagonists to the selectins modulate extravasion of leukocytes at sites ofinflammation and thereby reduce neutrophil caused host tissue damage. Diagnostic utilization may include both in vivo or in vitro diagnostic applications.
• the SELEX method generally, and the specific adaptations ofthe SELEX method taught and claimed herein specifically, are particularly suited for diagnostic applications. SELEX identifies nucleic acid ligands that are able to bind targets with high affinity and with surprising specificity. These characteristics are, ofcourse, the desired properties one skilled in the art would seek in a diagnostic ligand.
• the nucleic acid ligands ofthe presentinvention mayberoutinely adapted for diagnostic purposes according to any number oftechniques employed by those skilled in the art. Diagnostic agents need only be able to allow the user to identify the presence ofagiven targetat aparticularlocale orconcentration. Simply the ability to formbinding pairs with the target may be sufficientto trigger apositive signal for diagnostic purposes. Those skilled in the art would also be able to adapt any nucleic acid ligandby procedures knowninthe art to incorporate alabeling tag in order to track the presence ofsuch ligand. Such atag couldbe used in anumber ofdiagnostic procedures.
• the nucleic acid ligands to lectin, particularly selectins, describedherein may specifically be used foridentification ofthe lectinproteins.
• SELEX provides high affinity ligands ofa target molecule. This represents a singular achievement that is unprecedented in the field ofnucleic acids research.
• the presentinvention applies the SELEXprocedure to lectin targets. Specifically, the presentinvention describes the identification ofnucleic acid ligands to Wheat Germ Agglutinin, and the selectins, specifically, L-selectin, P-selectin and E-selectin. In the Example section below, the experimental parameters used to isolate andidentify the nucleic acid ligands to lectins are described.
• the nucleic acidligand (1) binds to the targetin amanner capable of achieving the desired effect on the target; (2) be as small as possible to obtain the desired effect; (3) be as stable as possible; and (4) be a specific ligand to the chosen target. In most situations, it is preferred that the nucleic acid ligandhave the highest possible affinity to the target.
• a SELEX experiment was performed in search of nucleic acid ligands with specific high affinity forWheat Germ Agglutinin from a degenerate library containing 50 random positions (50N).
• This invention includes the specific nucleic acid ligands to Wheat Germ Agglutinin shown in Table 2 (SEQ ID NOS: 4-55), identified by the methods described in Examples 1 and 2.
• RNA ligands containing 2'-NH 2 modified pyrimidines are provided.
• the scope ofthe ligands covered by this invention extends to all nucleic acid ligands ofWheat Germ Agglutinin, modified and unmodified, identified according to the SELEX procedure. More specifically, this invention includes nucleic acid sequences that are substantially homologous to the ligands shown in Table 2. By substantially homologous it is meant a degree ofprimary sequence homology in excess of70%, mostpreferably in excess of80%.
• this invention also includes nucleic acid ligands that have substantially the same ability to bind Wheat Germ Agglutinin as the nucleic acid ligands shown in Table 2.
• Substantially the same ability to bindWheat GermAgglutinin means that the affinity is within a few orders ofmagnitude ofthe affinity ofthe ligands described herein. It is well within the skill ofthose of ordinary skill in the art to determine whether agiven sequence --substantially homologous to those specifically described herein --has substantially the same ability to bindWheat Germ Agglutinin.
• RNA ligands containing 2'-NH2 or 2'-F pyrimidines and ssDNA ligands are provided.
• the scope ofthe ligands covered by this invention extends to all nucleic acid ligands of L-selectin, modified and unmodified, identified according to the SELEX procedure. More specifically, this invention includes nucleic acid sequences that are
• substantially homologous to the ligands shown in Tables 8, 12 and 16.
• substantially homologous it is meant a degree ofprimary sequence homology in excess of70%, most preferably in excess of80%.
• a review ofthe sequence homologies ofthe ligands ofL-selectin shown in Tables 8, 12 and 16 shows that sequences with little or no primary homology may have substantially the same ability to bind L-selectin.
• this invention also includes nucleic acid ligands that have substantially the same ability to bind L-selectin as the nucleic acid ligands shown in Tables 8, 12 and 16.
• Substantially the same ability to bind L- selectin means thatthe affinity is within a few orders ofmagnitude ofthe affinity of the ligands described herein. It is well within the skill ofthose ofordinary skill in the art to determine whether a given sequence -- substantially homologous to those specifically described herein -- has substantially the same ability to bind L-selectin.
• SELEX experiments were performed in search of nucleic acid ligands with specific high affinity for P-selectin from degenerate libraries containing 50 random positions (50N).
• This invention includes the specific nucleic acid ligands to P-selectin shown in Tables 19 and 25 (SEQ ID NOS: 199- 247 and 251-290), identifiedby the methods described in Examples 27, 28, 35 and 36.
• RNA ligands containing 2'-NH 2 and 2'-F pyrimidines are provided.
• the scope ofthe ligands covered by this invention extends to all nucleic acidligands ofP-selectin, modified andunmodified, identified according to the SELEX procedure.
• this invention includes nucleic acid sequences that are substantially homologous to the ligands shown in Tables 19 and 25.
• substantially homologous it is meant a degree ofprimary sequence homology in excess of70%, most preferably in excess of80%.
• a review ofthe sequence homologies ofthe ligands ofP-selectin shown in Tables 19 and 25 shows that sequences with little orno primary homology may have substantially the same ability to bindP-selectin.
• this invention also includes nucleic acid ligands that have substantially the same ability to bind P-selectin as the nucleic acid ligands shown in Tables 19 and 25.
• Substantially the same ability to bind P-selectin means that the affinity is within a few orders ofmagnitude ofthe affinity ofthe ligands described herein. It is well within the skill ofthose ofordinary skill in the art to determine whether a given sequence--substantially homologous to those specifically described herein-- has substantially the same ability to bind P-selectin.
• a SELEX experiment was performed in search of nucleic acid ligands with specific high affinity for E-selectin from a degenerate library containing 40 random positions (40N).
• This invention includes specific nucleic acid ligands to E-selectin identified by the methods described in Example 40.
• the scope ofthe ligands coveredby this invention extends to all nucleic acidligands ofE-selectin, modified and unmodified, identified according to the SELEX procedure.
• the presentinvention includes multivalent Complexes comprising the nucleic acid ligands ofthe invention.
• the mulivalent Complexes increase the binding energy to facilitate betterbinding affinities through slower off- rates ofthe nucleic acid ligands.
• the multivalent Complexes may be useful at lower doses than their monomeric counterparts.
• high molecularweight polyethylene glycol was included in some ofthe Complexes to decrease the in vivo clearance rate ofthe Complexes.
• nucleic acid ligands to L-selectin were placed in multivalent Complexes.
• nucleic acid ligands to lectins described herein are useful as pharmaceuticals.
• This invention also includes amethod for treating lectin-mediated diseases by administration ofa nucleic acid ligand capable ofbinding to alectin.
• compositions ofthe nucleic acid ligands may be administered parenterally by injection, although othereffective administration forms, such as intraarticularinjection, inhalant mists, orally active formulations, transdermal iontophoresis or suppositories, are also envisioned.
• One preferred carrier is physiological saline solution, but it is contemplated that otherpharmaceutically acceptable carriers may alsobe used.
• the carrier and the ligand constitute aphysiologically-compatible, slow release formulation.
• the primary solvent in such acarrier may be either aqueous ornon- aqueous in nature.
• the carrier may contain otherpharmacologically- acceptable excipients for modifying ormaintaining the pH, osmolarity, viscosity, clarity, color, sterility, stability, rate ofdissolution, or odor ofthe formulation.
• the carrier may contain still otherpharmacologically-acceptable excipients formodifying ormaintaining the stability, rate ofdissolution, release, or absorption ofthe ligand.
• excipients are those substances usually and customarily employedto formulate dosages for parental administration in eitherunitdose or multi-dose form.
• the therapeutic composition may be stored in sterile vials as a solution, suspension, gel, emulsion, solid, or dehydrated or lyophilized powder. Such formulations may be stored either in aready to use form orrequiring reconstitution immediatelypriorto administration.
• the mannerof administering formulations containing nucleic acid ligands for systemic delivery may be via subcutaneous, intramuscular, intravenous, intranasal orvaginal orrectal suppository.
• nucleic acid ligands to lectins described herein are useful as
• Examples 1-6 describe identification and characterization of2'-NH 2 RNA ligands to Wheat Germ Agglutinin.
• Examples 7-12 described identification and
• Examples 13-21 describe identification and characterization ofssDNA ligands to L-selectin.
• Examples 22-25 describe identification and characterization of2'-F RNA ligands to L-selectin.
• Example 26 describes identification ofssDNA ligands to P-selectin.
• Examples 27- 39 describes identification and characterization of2-NH 2 and 2'-F RNA ligands to
• Example 40 describes identification ofnucleic acid ligands to E-selectin.
• WheatGermLectin (Triticum vulgare) Sepharose 6MB beads were purchased from PharmaciaBiotech. Wheat GermLectin, Wheat Germ Agglutinin, andWGA are usedinterchangeably herein. FreeWheat GermLectin (Triticum vulgare) and all otherlectins were obtained from E YLaboratories; methyl-oc-D- mannopyranoside was from Calbiochem andN-acetyl-D-glucosamine, GlcNAc, and the trisaccharide N N N'-triacetylchitotriose, (GlcNAc)3, were purchased from
• HBSS Hanks' Balanced Salt Solutions
• CaCl 2 1.3 mM CaCl 2 , 5.0 mM KCl, 0.3 mM KH 2 PO 4 , 0.5 mM MgCl2-6H 2 O, 0.4 mM MgSO 4 .7H 2 O, 138 mM NaCl, 4.0 mM NaHCO 3 , 0.3 mM Na 2 HPO 4 , 5.6 mM D-Glucose; GibcoBRL).
• HBSS Hanks' Balanced Salt Solutions
• the DNA template forthe initial RNA pool contained 50 random nucleotides, flanked by N95' and 3' fixed regions (50N9) 5' gggaaaagcgaaucauacacaaga-50N- gcuccgccagagaccaaccgagaa 3' (SEQ ID NO: 1). All C and U have 2-NH2 substituted for 2'-OH for ribose.
• the primers for the PCR were the following: 5' Primer 5' taatacgactcactatagggaaaagcgaatcatacacaaga 3' (SEQ ID NO: 2) and 3' Primer 5' ttctcggttggtctctggcggagc 3' (SEQ ED NO: 3).
• the fixed regions ofthe starting randompool include DNA primer annealing sites for PCR and cDNA synthesis as well as the consensus T7 promoter region to allow in vitro
• PCR conditions were 50 mM KCl, 10 mM Tris-Cl, pH 8.3, 0.1% Triton X-100, 7.5 mM MgCl 2 , 1 mM ofeach dATP, dCTP, dGTP, and dTTP, and 25 U/ml ofTaq DNA polymerase.
• Transcription reactions contained 5 mM DNA template, 5 units/ ⁇ l T7 RNA polymerase, 40 mM Tris-Cl (pH 8.0), 12 mM MgCl 2 , 5 mM DTT, 1 mM spermidine, 0.002% Triton X-100, 4 % PEG 8000, 2 mM each of 2'-OH ATP, 2'- OH GTP, 2'-NH2 CTP, 2'-NH 2 UTP, and 0.31 mM ⁇ - 32 P 2'-OH ATP.
• the strategy forpartitioningWGA/RNA complexes fromunbound RNA was 1) to incubate the RNApool with WGA immobilized on sepharose beads; 2) to remove unboundRNA by extensive washing; and 3) to specifically elute RNA molecules bound at the carbohydrate binding site by incubating the washedbeads in buffer containing high concentrations of(GlcNAc)3.
• the SELEX protocol is outlined inTable 1.
• TheWGA density on Wheat GermLectin Sepharose 6MB beads is approximately 5 mg/ml ofgel or 116 ⁇ M (manufacturer's specifications). Mter extensive washing in HBSS, the immobilized WGA was incubated with RNA at roomtemperature for 1 to 2 hours in a2 ml siliconized column with constantrolling (Table 1). Unbound RNA was removed by extensive washing with HBSS. Bound RNA was eluted as two fractions; first, nonspecifically eluted RNAwas removed by incubating and washing with 10 mMmethyl- ⁇ -D-mannopyranoside in HBSS (Table 1).
• anitrocellulose filter partitioning method was used to determine the affinity ofRNA ligands forWGA and for other proteins.
• Filter discs nitrocellulose/cellulose acetate mixed matrix, 0.45 ⁇ m pore size, Millipore; or pure nitrocellulose, 0.45 ⁇ m pore size, Bio-Rad
• Reaction mixtures containing 32 P labeled RNA pools and unlabeledWGA. were incubated in HBSS for 10 min at room temperature, filtered, and then immediately washed with4 ml HBSS.
• the filters were air-dried and counted in aBeckman LS6500 liquid scintillation counter without fluor.
• WGA is a homodimer, molecular weight 43.2 kD, with 4 GlcNAc binding sites per dimer.
• RNA ligandbinding site permonomer (two per dimer).
• the monomerconcentration is defined as 2 times the dimer concentration.
• Kd equilibrium dissociation constant
• Kds were determined by least square fitting ofthe data points using the graphics program Kaleidagraph (Synergy Software, Reading , PA).
• the sixth and eleventh round PCR products were re-amplified with primers which contain a BamH1 or a EcoR1 restriction endonuclease recognition site. Using these restriction sites the DNA sequences were inserted directionally into the pUC18 vector. These recombinant plasmids were transformedintoE. coli strain JM109
• Plasmid DNA was prepared according to the alkaline hydrolysis method (Zhou et al., 1990 Biotechniques 8:172-173) and about 72 clones were sequenced using the Sequenase protocol (United States Biochemical
• Agglutination is areadily observed consequence ofthe interaction ofalectin with cells andrequires that individual lectin molecules crosslinktwo ormore cells. Lectin mediated agglutination canbe inhibitedby sugars with appropriate specificity.
• Visual assay ofthe hemagglutinating activity ofWGA and the inhibitory activity of RNA ligands, GlcNAc and (GlcNAc)3 was made in Falcon roundbottom 96 well microtiterplates,-using sheep erythrocytes. Each well contained 54 ⁇ l of erythrocytes (2.5 x 10 8 cells/ml) and 54 ⁇ l oftest solution.
• each test solution contained aWGA dilution from a4-fold dilution series.
• the final WGA concentrations ranged from 0.1 pM to 0.5 ⁇ M.
• the test solutions contained 80 nMWGA (monomer) and a dilution from a4-fold dilution series ofthe designated inhibitor. Reaction mixtures were incubated at room temperature for 2 hours, afterwhich time no changes were observed in the precipitation patterns oferythrocytes.
• erythrocytes settle as a compactpellet.
• the starting RNA library for SELEX contained approximately 2 x 10 15 molecules (2 nmol RNA).
• the SELEX protocol is outlined in Table 1. Binding ofrandomized RNA to WGA is undetectable at 36 ⁇ M WGA monomer. The dissociation constant ofthis interaction is estimated to be >4mM.
• the percentage ofinput RNA eluted by (GlcNAc)3 increased from 0.05 % in the first round, to 28.5 % in round 5 (Table 1).
• the bulk Kd ofround 5 RNA was 600 nM (Table 1).
• consensus sequences offamily 1 and 2 are flanked by complementary sequences 5 ormore nucleotides in length. These complementary sequences are not conserved and the majority include minor discontinuities. Family 3 also exhibits flanking complementary sequences, but these are more variable in length and structure and utilize two nucleotide pairs ofconserved sequence.
• the dissociation constants forrepresentative members offamilies 1-9 and orphan ligands were determined by nitrocellulose filter binding experiments and are listed in Table 3. These calculations assume one RNA ligandbinding site perWGA monomer. Atthe highestWGA concentration tested (36 ⁇ M WGA monomer), binding ofrandom RNA is not observed, indicating aK d atleast 100-fold higher than the protein concentration or > 4 mM.
• the range ofmeasured dissociation constants is 1.4 nM to 840 nM.
• the dissociation constants ofthese ligands are estimated to be greater than 20 ⁇ M.
• eleventh round isolates have higher affinity than those from the sixth round.
• the affinity ofWGA ligands 6.8, 11.20 and 11.24 (SEQ ID NOS: 13, 40, and 19) for GlcNAc binding lectins from Ulexeuropaeus, Datura stramonium and Canavalia ensiformis were determined by nitrocellulose partitioning. The results of this determination are shown in Table 4.
• the ligands are highly specific forWGA.
• the affinity ofligand 11.20 for WGA is 1,500, 8,000 and >15,000 fold greater than it is for the U. europaeus, D. stramonium and C. ensiformis lectins, respectively.
• the 8,000 fold difference in affinity for ligand 11.20 exhibited by T. vulgare and D.
• stramonium compares to a 3 to 10 fold difference in their affinity for oligomers ofGlcNAc and validates the proposition that competitive elution allows selection ofoligonucleotide ligands with much greater specificity than monomeric and oligomeric saccharides (J.F.Crowley et al., 1984, Arch. Biochem. and Biophys.231:524-533; Y.Nagata and M.Burger, 1974, supra; J-P.Privat et al., FEBS Letters 46:229-232).
• RNA ligand and a carbohydrate bind a common site, then binding of the RNA ligand is expected to be competitively inhibited by the carbohydrate.
• oligonucleotide ligands bind exclusively to carbohydrate binding sites, inhibition is expected to be complete at high carbohydrate concentrations.
• RNA ligands 6.8 and 11.20 (SEQ ID NO: 13 and 40) completely inhibit WGA mediated agglutination ofsheep erythrocytes (Table 6).
• Ligand 11.24 (SEQ ID NO: 19) is not as effective, showing only partial inhibition at 2 ⁇ M, the highest concentration tested (Table 6).
• (GlcNAc)3 and GlcNAc completely inhibit agglutination at higher concentrations, 8 ⁇ M and 800 ⁇ M, respectively, (Table 6; Monsigny et al., supra).
• the inhibition ofagglutination varifies the proposition that ligands isolated by this procedure will be antagonists oflectin function. Inhibition also suggests that more than one RNA ligand is bound perWGA dimer, since agglutination is a function ofmultiple carbohydrate binding sites.
• Nonconserved sequences especially those that vary in length are not apt to be directly involved in function, while highly conserved sequence are likely to be directly involved.
• LS-Rg is a chimeric protein in which the extracellular domain ofhuman L- selectin isjoined to the Fc domain of a human G2 immunoglobulin (Norgard et al.,
• ES-R g , PS-R g and CD22 ⁇ -R g are analogous constructs ofE-selectin, P-selectin and CD22 ⁇ joined to a human G1
• the nucleotide sequence ofthe synthetic DNA template for the LS-Rg SELEX was randomized at 40 positions. This variable region was flanked by N75' and 3' fixed regions (40N7).40N7 transcript has the sequence 5' gggaggacgaugcgg-40N-cagacgacucgcccga 3' (SEQ ID NO: 64). All C and U have 2-NH 2 substituted for 2'-OH on the ribose.
• the primers for the PCR were the following:
• the fixed regions include primer annealing sites for PCR and cDNA synthesis as well as a consensus T7 promoter to allow in vitro transcription.
• the initial RNA pool was made by first Klenow extending 1 nmol ofsynthetic single stranded DNA and then transcribing the resulting double stranded molecules with T7 RNA polymerase. Klenow extension conditions: 3.5 nmols primer 5N7, 1.4 nmols 40N7, IX Klenow Buffer, 0.4 mM each ofdATP, dCTP, dGTP and dTTP in a reaction volume of 1 ml.
• RNA was the template for AMV reverse transcriptase mediated synthesis ofsingle-stranded cDNA.
• These single-stranded DNA molecules were converted into double-stranded transcription templates by PCR amplification.
• PCR conditions were 50 mM KCl, 10 mM Tris-Cl, pH 8.3, 7.5 mM MgCl2, 1 mM ofeach dATP, dCTP, dGTP, and dTTP, and25 U/ml ofTaq DNA polymerase.
• Transcription reactions contained 0.5 mM DNA template, 200 nM T7 RNA polymerase, 80 mM HEPES (pH 8.0), 12 mMMgCl 2 , 5 mM DTT, 2 mM spermidine, 2 mM each of 2-OH ATP, 2'-OH GTP, 2'-NH 2 CTP, 2'-NH 2 UTP, and 250 nM ⁇ - 32 P 2'-OH ATP.
• RNA pool was incubated withLS-Rg immobiUzed on protein A sepharose beads in HSMC buffer.
• the unbound RNA was removed by extensive washing.
• the RNA molecules bound atthe carbohydrate binding site were specifically elutedby incubating the washedbeads in HMSC buffer containing 5 mMEDTA in place ofdivalent cations. The 5 mM elution was followed by anon-specific 50 mM EDTA elution.
• LS-Rg was coupled to protein A sepharose beads according to the manufacturer's instructions
• the 5 mM EDTA elution is avariation of a specific site elution strategy. Although it is not apriori as specific as elution by carbohydrate competition, itis a general strategy for C-type (calcium dependent binding) lectins and is apractical alternative when the cost and/or concentration ofthe requiredcarbohydrate competitor is unreasonable (as is the case with sialyl-Lewis x ). This scheme is expected to be fairly specific forligands that formbonds withthe lectin's bound
• the density of immobilized LS-Rg was 16.7 pmols/ ⁇ l ofProtein A Sepharose 4 Fast Flow beads.
• the density ofLS-Rg was reduced (Tables 7a and 7b), as needed, to increase the stringency ofselection.
• the SELEX was branched and continued in parallel at 4°C (Table 7a) and at roomtemperature (Table 7b). Wash and elution buffers were equilibrated to the relevant incubation temperature.
• SELEX was often done at more than one LS-Rg density. In each branch, the eluted material from only one LS-Rg density was carried forward.
• RNA was batch adsorbed to 100 ⁇ l ofprotein A sepharose beads for 1 hour in a 2 ml siliconized column. Unbound RNA and RNA eluted with minimal washing (two volumes) were combined andused for SELEX input material. For SELEX, extensively washed, immobilized LS-Rg was batch incubated with pre-adsorbed RNA for 1 to 2 hours in a 2 ml siliconized column with constant rocking. Unbound RNA was removed by extensive batch washing (200 to 500 ⁇ l HSMC/wash).
• Bound RNA was eluted as two fractions; first, bound RNA was eluted by incubating and washing columns with 5 mM EDTA in HSMC without divalent cations; second, the remaining elutable RNA was removed by incubating and/orwashing with 50 mM EDTA in HSMC without divalents.
• the percentage of input RNA that was eluted is recorded in Tables 7a and 7b.
• an equal volume of protein A sepharose beads without LS-Rg was treated identically to the SELEX beads to determine background binding. All unadsorbed, wash and eluted fractions were countedin aBeckman LS6500 scintillation counter in orderto monitor each round ofSELEX.
• anitrocellulose filter partitioning method was used to determine the affinity ofRNA ligands forLS-Rg and for otherproteins.
• Filter discs nitrocellulose/cellulose acetate mixed matrix, 0.45 ⁇ m pore size, MilHpore
• Reaction mixtures containing 32 P labeled RNA pools and unlabeled LS-Rg, were incubated in HSMC for 10 - 20 min at 4°C, room temperature or 37°C, filtered, and then immediately washed with 4 ml HSMC at the same temperature.
• LS-Rg is a dimeric protein that is the expression product ofa recombinant gene constructedby fusing the DNA sequence that encodes the extracellulardomains ofhuman L-selectin to the DNA that encodes a human IgG 2 Fc region.
• affinity calculations we assume one RNA ligandbinding site perLS-Rg monomer (two per dimer). The monomer concentration is defined as 2 times the LS-Rg dimer concentration.
• Kd equilibrium dissociation constant
• Biphasic binding can be described as the binding oftwo affinity species that are not in equilibrium. Biphasic binding data were evaluated with the equation
• Kds were determined by least square fitting
• Kds were determined by least square fitting ofthe data points using the graphics program Kaleidagraph (Synergy Software, Reading , PA).
• PBMCs humanperipheral blood mononuclear cells
• the mononuclear cell layer was coUected, diluted in 10 ml ofCa ++ /Mg ++ -free DPBS (DPBS(-); Gibco 14190- 029) and centrifuged (225 g) for 10 minutes atroom temperature. Cell pellets from two gradients were combined, resuspended in 10 ml ofDPBS(-) and recentrifuged as described above. These pellets were resuspendedin 100 ⁇ l of SMHCK buffer supplemented with 1% BSA. CeUs were counted in a hemocytometer, diluted to
• LS-Rg to sialyl-Lewis x was tested in competive ELISA assays (C. Foxall et al., 1992, supra).
• competive ELISA assays C. Foxall et al., 1992, supra.
• the wells ofCorning 25801
• 96 well microtiter plates were coatedwith 100 ng ofa sialyl-Lewis x /BSA conjugate, air dried overnight, washed with 300 ⁇ l ofPBS(-) and then blocked with 1% BSA in
• RNA ligands were incubated with LS-Rg in SHMCK/1% BSA at room temperature for 15 min. Afterremoval ofthe blocking solution, 50 ⁇ l ofLS-Rg (10nM) or a LS-Rg (10nMVRNA ligand mix was added to the coated, blocked wells and incubated at roomtemperature for 60 minutes. The binding solution was removed, wells were washed with 300 ⁇ l ofPBS(-) and then probed with HRP conjugated anti-human IgG, at room temperature to quantitate LS- Rg binding. After a 30 minute incubation at roomtemperature in the darkwith OPD peroxidase substrate (Sigma P9187), the extent ofLS-Rg binding and percent inhibition was determined from the OD450.
• OPD peroxidase substrate Sigma P9187
• the SELEX protocol is outlined in Tables 7a and 7b and Example 7.
• the dissociation constant of randomized RNA to LS-Rg is estimated to be approximately 10 ⁇ M. No difference was observed in the RNA elution profiles with 5 mM EDTA from SELEX and background beads for rounds 1 and 2, while the 50 mM elution produced a 2-3 fold excess overbackground (Table 7a).
• the 50 mM eluted RNA from rounds 1 and 2 were amplified for the input material for rounds 2 and 3, respectively.
• Binding experiments with 6th round RNA revealed that the affinity ofthe evolving pool for L-selectin was temperature sensitive. Beginning with round 7, the SELEX was branched; one branch was continued at 4 °C (Table 7a) while the other was conducted at room temperature (Table 7b).
• Bulk sequencing of6th, 13th (rm temp) and 14th (4 °C) RNA pools revealed noticeable non-randomness atround six and dramatic non-randomess at the later rounds.
• the 6th round RNA bound monophasically at4°C with a dissociation constant ofapproximately 40 nM, while the 13th and 14th round RNAs bound biphasically with high affinity Kds of approximately 700 pM.
• the molar fraction ofthe two pools thatbound with high affinity were 24 % and 65 %, respectively.
• the binding ofall tested pools required divalent cations.
• the Kds ofthe 13th and 14th round pools increased to 45 nM and 480 nM, respectively (HSMC, minus Ca + +
• ligands were cloned and sequenced from rounds 6, 13 (rm temp) and 14 (4 °C). Sequences were aligned manually and with the aid of a computer program that determines consensus sequences from frequently occurring local alignments.
• ligand sequences are shown in standard single lettercode (Cornish-Bowden, 1985 NAR 13: 3021-3030). The letter/number combination before the ".” in the ligandname indicates whether it was cloned from the round 6, 13 or 14 pools. Only the evolved random region is shown in Table 8. Any portion ofthe fixed region is shown in lower case letters. By definition, each clone includes boththe evolved sequence and the associated fixedregion, unless specifically stated otherwise. From the sixth, thirteenth and fourteenth rounds, respectively, 26 of48, 8 of24 and 9 of70 sequenced ligands were unique. A unique sequence is operationally defined as one that differs from all others by three ormore nucleotides.
• Ligands from family II dominate the final rounds: 60/70 ligands in round 14 and 9/24 in round 13.
• Family II is representedby three mutational variations of a single sequence.
• One explanation for the recovery of a single lineage is that the ligand's information content is extremely high and was therefore represented by a unique species in the starting pool.
• Family II ligands were not detected in the sixth round which is consistent with a low frequency in the initialpopulation.
• An alternative explanation is sampling error. Note that a sequence ofquestionable relationship was detected in the sixth round.
• Family HI has two additional, variably spaced sequences, AGUC and ARUUAG, that may be conserved.
• the tetranucleotide AUGW is found in the consensus sequence offamiHes I,III, and VII and in families II, VIII and IX. Ifthis sequence is significant, it suggests that the conserved sequences of ligands offamily VIII are circularly permuted.
• the sequence AGAA is found in the consensus sequence offamiHes IV and VI and in famiHes X and XIII.
• ligands bind monophasically with dissociation constants ranging from 50 pM to 15 nM at 4 °C. Some ofthe highest affinity ligands bind
• the affinity ofL-selectin ligands to ES-Rg, PS-Rg and CD22 ⁇ -Rg were determined by nitrocellulose partitioning as described in Example 7. As indicated in Table 10, the ligands are highly specific for L-selectin. In general, a ligand's affinity forES-Rg is 10 3 -fold lower and that forPS-Rg is about 10 4 -fold less than for LS-Rg. Binding above background is not observed for CD22 ⁇ -Rg at the highest protein concentration tested (660 nM), indicating that ligands do notbind the Fc domain ofthe chimeric constructs nor do they have affinity for the sialic acidbinding site ofan unrelated lectin.
• the cloned ligand, F14.12 (SEQ ID NO: 78), also binds in a saturable fashion with a dissociation constant of 1.3 nM, while random 40N7 (SEQ ID NO: 64) resembles round 2 RNA ( Figure 3).
• the saturability ofbinding is confirmedby the data in Figure 4; > 90% of5 nM 32 P-labeled F14.12 RNA binding is competed by excess cold RNA. Specificity is demonstrated by the results in Figure 5; binding of5 nM
• OHgonucleotide ligands eluted by 2-5 mM EDTA, are expected to derive part oftheirbinding energy from contacts with the lectin domain's bound Ca ++ and consequently, are expected to compete with sialyl-Lewis x forbinding.
• Lewis x was determined by competition ELISA assays. As expected, 4 mM EDTA reduced LS-Rg binding 7.4-fold, while 20 mM round 2 RNA did not inhibit LS-Rg binding. Carbohydrate binding is known to be Ca ++ dependent; the affinity of round 2 RNA is too low to bind 10 nM LS-Rg (Table 7).
• RNA inhibits LS-Rg binding in a concentration dependentmannerwith an IC 50 ofabout 10 nM ( Figure 6). Complete inhibition is observed at 50 nM F14.12. The observed inhibition is reasonable under the experimental conditions; the Kd ofF14.12 atroom temperature is about 1 nM (Table 9) and 10 nM LS-Rg is 20 nM binding sites.
• Nonconserved sequences especially those that vary in length are not apt tobe directly involved in function, while highly conserved sequence are likely to be directly involved.
• the proposed structure for family El is also a hairpin with the conserved sequence, AACAUGAAGUA, contained within a variable length loop (Figure 7b).
• the 5'-halfofthe stem is 5'-fixed sequence which may account in part for the less highly conserved sequence, AGUC.
• the buffer for SELEX experiments was 1 mM CaCl 2 , 1 mMMgCl 2 , 100 mM NaCl, 10.0 mM HEPES, pH 7.4.
• the buffer for all binding affinity experiments differed from the above in containing 125 mM NaCl, 5 mM KCl, and 20 mM HEPES, pH 7.4.
• the strategy used for this ssDNA SELEX is essentially identical to that described in Example 7, paragraph B except as noted below.
• the nucleotide sequence ofthe synthetic DNA template forthe LS-Rg SELEX was randomized at 40 positions. This variable region was flanked by BH 5' and 3' fixed regions.
• the random DNA template was termed 40BH (SEQ ID NO: 126) and had the following sequence: 5'-ctacctacgatctgactagc ⁇ 40N>gcttactctcatgtagttcc-3'.
• the fixed regions include primer annealing sites for PCR
• the initial DNA pool contained 500 pmols ofeach oftwo types of single-stranded DNA: 1) synthetic ssDNA and 2) PCR amplified, ssDNA from 1 nmol ofsynthetic ssDNA template.
• PCR conditions were 50 mM KCl, 10 mM Tris-Cl, pH 8.3, 7.5 mM MgCl2, 1 mM ofeach dATP, dCTP, dGTP, and dTTP and 25 U/ml ofthe Stoffei fragment ofTaq DNA polymerase.
• double stranded DNAs were end-labeled using ⁇ 32 P-ATP.
• Complementary strands were separated by electrophoresis through an 8% polyacrylamide/7M urea gel. Strand separation results from the molecular weight difference ofthe strands due to biotintylation of the 3' PCR primer.
• DNA strands were separated prior to end labelling in order to achieve high specific activity. Eluted fractions were processed by ethanol precipitation.
• PBMCs peripheral blood mononuclear cells
• PBMC peripheral blood mononuclearcells
• the final concentration ofwhole blood was at least70% (v/v). Stained, concentrated whole blood was diluted 1/15 in 140 mM NaCl, 5 mM KCl, 1 mM MgCl 2 , 1 mM CaCl 2 , 20 mM HEPES pH 7.4, 0.1% bovine serum albumin and 0.1% NaN 3 immediately prior to flow cytometry on aBecton-Dickinson FACS CaHbur. Lymphocytes and granulocytes were gated using side scatter and
• Dimeric oligonucleotides were synthesized by standard solid state processes, with initiation from a 3'-3' Symmetric Linking CPG (Operon, Alameda, CA).
• Branched complexes contain two copies ofa truncated L-selectin DNA ligand, each ofwhich is linked by the 3' end to the above CPG via a five unit ethylene glycol spacer (Figure 8A). Each ligandis labeled with a fluorescein phosphoramidite at the 5' end (Glen Research, Sterling, VA). Branched dimers were made for 3 truncates ofLD201T1 (SEQ ID NO: 142). The truncated ligands used were LD201T4 (SEQ ID NO: 187), LD201T10 (SEQ ED NO: 187) and LD201T1 (SEQ ED NO: 185). Branched dimers were purified by gel electrophoresis. Synthesis ofMultivalentBiotintylated-DNA Ligand/Streptavidin Complexes
• Multivalent oligonucleotide complexes were produced by reacting
• biotintylated DNAligands with eitherfluorescein orphycoerythrin labeled streptavidin (SA-FITC, SA-PE, respectively) ( Figure 8B).
• Streptavidin (SA) is a tetrameric protein, each subunit ofwhich has a biotin binding site.5' and 3' biotintylated DNAs were synthesized by Operon Technologies, Inc (Alameda. CA) using BioTEG and BioTEG CPG (Glen Research, Sterling, VA), respectively. The expected stoichiometry is 2 to 4 DNA molecules per complex. SA/bio-DNA complexes were made for 3 truncates ofLD201(SEQ ID NO: 142).
• the truncated ligands were LD201T4 (SEQ ID NO: 187), LD201T10 (SEQ ID NO: 188) and LD201T1 (SEQ ID NO: 185).
• the bio-DNASA multivalent complexes were generated by incubating biotin modified oligonucleotide (1 mM) and fluoroscein labeled streptavidin (0.17 mM) in 150 mM NaCl, 20 mM HEPES pH 7.4 at room temperature for at least 2 hours. Oligonucleotide-streptavidin complexes were used directly fromthe reaction mixture without additional purification ofthe Complex from free streptavidin or oligonucleotide.
• a "dumbell" DNA dimercomplex was formulated from ahomobifunctional N-hydroxysuccinimidyl (orNHS) active esterofpolyethelene glycol, PEG 3400 MW, and a 29mer DNA oligonucleotide, NX303 (SEQ ID NO: 196), having a 5' terminal Amino Modifier C6 dT (Glen Research) and a 3'-3' terminal
• NX303 is a truncate ofLD201 (SEQ ID NO: 142).
• the conjugation reaction was in DMSO with 1% TEA with excess equivalents ofthe DNA ligand to PEG.
• the PEG conjugates were purified from the free oligonucleotideby reversephase chromatography.
• the dimer was then purified from the monomerby anion exchange HPLC.
• the oligonucleotide was labeled at the 5' terminus with fluorescein as previously described.
• a photo-crossHnking version ofDNA ligandLD201T4 (SEQ ID NO: 187) was synthesized by replacing nucleotide T15 ( Figure 12) with 5-bromo-deoxyuracil.
• Precipitated material was centrifuged, vacuum dried and resuspended in 100 ⁇ l 0.1 M Tris pH 8.0, 10 mM CaCl2- Fourty-five ⁇ g chymotrypsin were added and after 20 min at 37 degrees C, the material was loaded onto an 8% polyacrylamide/7 M urea/ IXTBE gel and electrophoresed until the xylene cyanole had migrated 15 cm.
• the gel was soaked for 5 min in IX TBE and then blotted for 30 min at 200 mAmp in IXTBE onto Immobilon-P (MiUipore). The membrane was washed for 2 min in water, air dried, and an autoradiograph taken.
• the peptide was sequenced by Edman degradation, and the resulting sequence was LEKTLP_SRSYY.
• the blank residue corresponds to the crossHnked amino acid, F82 ofthe lectin domain.
• Human PBMC were purified from heparinised blood by a Ficoll-Hypaque gradient, washed twice with HBSS (calcium/magnesium free) and labeled with 51Cr (Amersham). After labeling, the cells were washed twice with HBSS (containing calcium and magnesium) and 1% bovine serum albumin (Sigma).
• HBSS containing calcium and magnesium
• bovine serum albumin Sigma.
• Female SCED mice (6-12 weeks ofage) were injected intravenously with 2x10 6 cells. The cells were eitheruntreated or mixed with either 13 pmol ofantibody (DREG-56 or MEL- 14), or4, 1, or 0.4 nmol ofmodified oligonucleotide (synthesis described below).
• mice were anesthetized, a blood sample taken and the mice were euthanised.
• PLN, MLN, Peyer's patches, spleen, liver, lungs, thymus, kidneys and bone marrow were removed and the counts incorporated into the organs determined by aPackard gamma counter.
• PBMC peripheral blood mononuclear cells
• the molarratio, PEG:oligo, in the reactions was from 3:1 to 10:1.
• the reactions were performed in 80:20 (v:v) 100 mM borate bufferpH 8: DMFat 37° C for one hour.
• SLe x -BSA (Oxford GlycoSystems, Oxford, UK) in IX PBS, without CaCl 2 and MgCl 2 , (GEBCO/BRL) was immobilized at 100 ng/well onto a microtiterplate by overnight incubation at 22°C. The wells were blocked for 1 h with the assay buffer consisting of20mM HEPES, 111 mM NaCl, 1 mM CaCl 2 , 1 mM MgCl 2 , 5 mM KCl, 8.9 mM NaOH, final pH 8, and 1% globulin-free BSA (Sigma).
• reaction mixtures incubated for90 min with orbital shaking, contained 5 nML-Selectin-Rg, a 1:100 dilution ofanti-human IgG-peroxidase conjugate (Sigma), and 0-50 nM ofcompetitor in assay buffer. Afterincubation, the plate was washed with BSA-free assay buffer to remove unbound chimera-antibody complex and incubated for 25 min with O- phenylenediarnine dihydrochloride peroxidase substrate (Sigma) by shaking in the dark at 22°C. Absorbance was read at 450 nm on a Bio-Kinetics Reader, Model EL312e (Bio-Tek Instruments, Website.). Values shown represent the mean ⁇ s.e from duplicate, ortriplicate, samples from one representative experiment.
• the initial round ofSELEX was performed at 4 °C with an LS-Rg density of 16.7 pmol/ ⁇ l ofprotein A sepharose beads. Subsequent rounds were at room temperature except as noted in Table 11. The 2 mM EDTA elution was omitted from rounds 1-3. The signal to noise ratio ofthe 50 mM EDTA elution in these three rounds was 50, 12 and 25, respectively (Table 11). These DNAs were amplified for the inputmaterials ofrounds 2-4. Beginning with round 4, a 2 mM EDTA elution was added to the protocol. In this and all subsequent rounds, the 2 mM EDTA eluted DNA was ampHfied forthe nextround's inputmaterial.
• Binding experiments with 7th round DNA revealed that the affinity ofthe evolving pool forL-selectin was weakly temperature sensitive (Kds: 60 nM, 94 nM and 230 nM at 4 °C, room temperature and 37 °C, respectively).
• Kds 60 nM, 94 nM and 230 nM at 4 °C, room temperature and 37 °C, respectively.
• rounds 8, 13, 16 and 17 were performed at 37 °C.
• the affinity ofround 15 ssDNA was optimal at room temperature (160 pM), with 3-fold higher Kds at4 °C and 37 °C.
• TACAAGGYGYTAVACGTA SEQ ID NO: 181.
• the conservation ofthe CAAGG and ACG and their 6 nucleotide spacing is nearly absolute (Table 12).
• the consensus sequence is flanked by variable but
• ssDNA family I and 2'-NH2 family I share a common sequence, CAAGGCG and CAAGGYG, respectively.
• Family 2 is represented by a single sequence and is related to family 1.
• Families 4-6 are each defined by a small number ofligands which limits confidence in their consensus sequence, while family 7 is defined by a single sequence which precludes determination ofa consensus. Family 5 appears to contain two conserved sequences, AGGGT and RCACGAYACA, the positions of which are circularly permuted.
• the dissociation constants range from43 pM to 1.8 nM which is at least a 5x10 3 to 2x10 5 fold improvement overrandomized ssDNA (Table 13).
• the Kds range from 130 pM to 23 nM.
• the extent of temperature sensitivity varies from insensitive (ligands LD122 and LD127 (SEQ ID NO: 159 and 162)) to 80-fold (ligand LD112 (SEQ ID NO: 135)).
• the affinity ofthose from round 15 is greater than that of those from round 13.
• the difference in affinity at room temperature and 37°C is about 4-fold.
• the affinity ofrepresentative cloned ligands forLS-Rg, ES-Rg, PS-Rg, CD22 ⁇ -Rg and WGA was determined by nitrocellulose partitioning and the results shown in Table 14.
• the ligands are highly specific forL-selectin.
• the affinity for ES-Rg is about 10 3 -fold lower and that for PS-Rg is about 5x10 3 -fold less than for LS-Rg. Binding above background is not observed for CD22 ⁇ -Rg or forWGA at
• Round 15 ssDNA pool was tested forits ability to bind to L-selectin presented in the context ofaperipheral bloodmononuclearcell surface as described in Example 13, paragraph E.
• the evolved pool was tested both for affinity and for specificity by competition with an anti-L-selectin monoclonal antibody.
• Figure 9 shows that the round 15 ssDNA pool binds isolated PBMCs with a dissociation constant ofapproximately 1.6 nM and, as is expected for specific binding, in a saturable fashion.
• Figure 10 directly demonstrates specificity ofbinding; in this experiment, binding of2 nM 32 P-labeled round 15 ssDNA is completely competed by the anti-L-selectin blocking monoclonal antibody, DREG-56, but is unaffected by an isotype-matched irrelevant antibody.
• LD201T1 SEQ ID NO: 185. was shown to bind human PBMC with high affinity. Binding was saturable, divalent cation dependent, and blocked by DREG-56.
• Nonconserved sequences especially those that vary in length are not apt to be directly involved in function, while highly conserved sequence are likely to be directly involved.
• DREG56 is an anti-L-selectin, adhesion blocking monoclonal antibody that is known to bind to the lectin domain. Binding ofthree unrelated ligands, LD201T1 (SEQ ED NO: 185), LD174T1 (SEQ ID NO: 194) and LD196T1 (SEQ ID NO: 195), to LS-Rg was blocked by DREG-56, but not by an isotype-matched control.
• LD201T1, LD174T1, orLD196T1 prevented radio-labeled LD201T1 from binding to LS-Rg, consistent with the premise that the ligands bind the same or overlapping sites.
• IfT15 ofLD201T4 (SEQ ID NO: 187; Figure 12) is replaced with 5-bromo- uracil, the resulting DNA photo-crosslinks at high yield (17%) to LS-Rg following irradiation with an excimer laser as described in Example 13, paragraph G.
• the high yield ofcrosslinking indicates apoint contact between the protein and T15. Sequencing ofthe chymotryptic peptide corresponding to this point contact revealed apeptide deriving from the lectin domain; F82 is the crossHnking amino acid. Thus, F82 contacts T15 in a stacking arrangement that permits high yieldphoto- crossHnking.
• F82 is adjacent to the proposed carbohydrate binding site.
• this photo-crosslink provides direct evidence that ligandLD201 makes contact with the lectin domain ofLS-Rg and provides an explanation for the function ofthe oligonucleotides in either stericaUy hindering access to the carbohydrate binding site or in altering the conformation ofthe lectin domain upon DNA binding.
• LD227T1 (SEQ ID NO: 192) derived from LD201 (SEQ ID NO: 173) and LD227 (SEQ ID NO: 134), respectively, bind with 20-fold and 100-fold lower affinity than their full length progenitors.
• the affinity ofLD201T3 (SEQ ID NO: 186), a41 nucleotide truncate ofligandLD201, is reduced about 15-fold compared to the full length ligand, while the affinity ofthe 49-mer LD201T1 (SEQ ID NO: 185) is not significantly altered (Tables 12 and 13).
• the added stem is separated from the consensus stem by a single stranded bulge.
• the two ligands single stranded bulges differ in length and have unrelated sequences.
• LD201's bulge is at the 5'-end ofthe original stem base while that ofLD227 is at the 3'-end.
• the two ligands do notpresent an obvious consensus structure. Removal ofthe loop (LD201) or scrambling or truncating the sequence (LD227) diminishes affinity, suggesting that the bulged sequences may be directly involved in binding.
• Sialyl Lewis x is the minimal carbohydrate ligand boundby selectins.
• the ability ofssDNA ligands to inhibit the binding ofL-selectin to Sialyl Lewis x was determinedin competition ELISA assays as described in Example 13, paragraph I.
• LD201T1 SEQ ID NO: 185
• LD174T1 SEQ ED NO: 194
• LD196T1 SEQ ID NO: 185
• Lymphocyte trafficking to peripheral lymph nodes is extremely dependent on L-selectin. Since the ssDNA ligands binds to human but not rodentL-selectin, a xenogeneic lymphocyte trafficking system was established to evaluate in vivo efficacy. Human PBMC, labeled with 51 Cr, were injected intravenously into SCED mice. Cell trafficking was determined 1 hour later. In this system, human cells traffic to peripheral and mesenteric lymph nodes (PLN and MLN). This
• Multivalent Complexes were made in which two nucleic acid ligands to L- selectin were conjugated together. Multivalent Complexes ofnucleic acid ligands are described in copending United States Patent Application Serial Number08/434,465, filed May 4, 1995, entitled “Nucleic AcidLigand Complexes” which is herein incorporatedby reference in its entirety. These multivalent Complexes were intended to increase the binding energy to faciHtate betterbinding affinities through slower off-rates ofthe nucleic acid ligands. These multivalent Complexes may be useful atlowerdoses than theirmonomeric counterparts.
• nucleic acid ligands incorporated into the Complexes were LD201T1 (SEQ ID NO: 185), LD201T4 (SEQ ID NO: 187), LD201T10 (SEQ ID NO: 188) andNX303 (SEQ ED NO: 196).
• Multivalent selectin nucleic acid ligand Complexes were produced as described in Example 13, paragraphF.
• Kinetic competition experiments were performed on monomeric nucleic acid ligands and multivalent Complexes. Kinetic competition experiments were performed with PBMC purified lymphocytes. Cells were stained as described above butused 10 nM oligonucleotide. The off-rate formonomeric, dimeric and multivalent Complexes was determinedby addition of500 nM unlabeled
• oHgonucleotide to cells stained with fluorescently labeled ligandsand measurement of the change in the mean fluorescence intensity as afunction oftime.
• the dissociation rate of a monomeric LD201T1 fromL-selectin expressing human lymphocytes was approximately 0.005 sec-1, corresponding to ahalf-life ofroughly 2.4 minutes.
• TheLD201T1 branched dimer andbiotin conjugate multivalentComplexes exhibited apparent off-rates several times slower than that observedfor the monomeric ligand and as slow or slower than that observed for the anti-L-selectin blocking antibody DREG56, determined under the same conditions.
• a multivalent Complex containing anon-bindingnucleic acid sequence did not stain cells underidentical conditions and didnotcompete in the off-rate experiments.
• the off-rate ofthe LD201T4 dumbell and forkdimers is faster than the LD201T1 branched dimer and is betterthan all monomers tested.
• the initial RNA pool was made by first Klenow extending 3 nmol of synthetic single stranded DNA and then transcribing the resulting double stranded molecules withT7 RNApolymerase. Klenow extension conditions: 6 nmols primer 5N7, 3 nmols 30N7 or 40n7, IX Klenow Buffer, 1.8 mM each ofdATP, dCTP, dGTP and dTTP in a reaction volume of0.5 ml.
• RNA was the template for AMV reverse transcriptase mediated synthesis ofsingle-stranded cDNA.
• These single-stranded DNA molecules were converted into double-stranded transcription templatesby PCR amplification.
• PCR conditions were 50 mM KCl, 10 mM Tris-Cl, pH 8.3, 7.5 mM MgCl2, 0.2 mM ofeach dATP, dCTP, dGTP, and dTTP, and 100 U/ml ofTaq DNA polymerase.
• Transcription reactions contained one third ofthe purified PCR reaction, 200 nM T7 RNA polymerase, 80 mM HEPES (pH 8.0), 12 mM MgCl2, 5 mM DTT, 2 mM spermidine, 1 mM each of2'-OH ATP, 2'-OH GTP, 3 mM each of2'-F CTP, 2'-F UTP, and 250 nM ⁇ - 32 P 2'-OH ATP. Note that in all transcription reactions 2'-F CTP and 2'-F UTP replaced CTP and UTP.
• LS-Rg/RNA complexes from unbound RNA is outlined in Table 15 and is essentially identical to that ofExample 7, paragraph B.
• the density of immobilized LS-Rg was 10 pmols/ ⁇ l ofProtein A Sepharose 4 Fast Flow beads.
• LS-Rg was coupled to protein A sepharose beads according to the manufacturer's instructions (Pharmacia Biotech).
• the density ofLS-Rg was reduced (Table 15), as needed, to increase the stringency ofselection.
• both SELEXes were branched. One branch was continued as previously described (Example 7, paragraph B).
• the second branch ofboth SELEXes the RNA pool was pre-annealed to oHgonucleotides that are
• BoundRNA was eluted as two fractions; first, bound RNA was eluted by incubating and washing columns with 100 ⁇ L 5 mM EDTA in SHMCK 140 withoutdivalent cations; second, the remaining elutable RNAwas removedbyincubating and/or washingwith 500 ⁇ L 50 mMEDTAin SHMCK 140 withoutdivalents.
• the percentage ofinput RNA thatwas eluted is recorded in Table 22.
• an equal volume of protein A sepharose beads withoutLS-Rg was treated identicaUy to the SELEX beads to determine backgroundbinding. All unadsorbed, wash andeluted fractions were counted in aBeckman LS6500 scintillation counter in orderto monitoreach round ofSELEX.
• the 5 mMEDTA eluates were processedforuse in the following round (Table 15).
• the RNA was reverse transcribed into cDNA by AMV reverse transcriptase either at48°C for 15 minutes andthen 65°C for 15 minutes in 50 mM Tris-Cl pH (8.3), 60 mMNaCl, 6 mMMg(OAc) 2 , 10 mM DTT, 200 pmol DNAprimer, 0.5 mM each ofdNTPs, and 0.4 unit/ ⁇ L AMV RT.
• Transcripts ofthe PCR product were used to initiate the next round of SELEX.
• anitro cellulose filter partitioning method was used to determine the affinity ofRNA ligands forLS-Rg and for otherproteins.
• Filter discs nitrocellulose/cellulose acetate mixed matrix, 0.45 ⁇ mpore size, Millipore
• Reaction mixtures containing 32 P labeled RNA pools and unlabeled LS-Rg. were incubated in SHMCK 140 for 10 - 20 min at 37 °C, and then immediately washedwith 3 ml SHMCK 140.
• the filters were air-dried and counted in aBeckmanLS6500 liquid scintillation counterwithout fluor.
• binding studies employed 96 well micro-titer manifolds essentially as described in Example 13, paragraph E.
• 12throundPCRproducts were re-amplified with primers which contain either aBamHl or aHinDIII restriction endonuclease recognition site. Using these restriction sites, the DNA sequences were inserted directionally into the pUC9 vector. These recombinantplasmids were transformed into E. coli strain D ⁇ 5a (Life Technologies, Gaithersburg, MD). Plasmid DNA was prepared according to the alkaline lysis method (Quiagen, QIAwell, Chattsworth CA). Approximately 300 clones were sequenced using the ABI Prism protocol (Perkin Elmer, Foster City, CA). Sequences are shown in Table 16.
• Binding ofevolved ligands to L-selectin presented in the context ofa cell surface was testedby flow cytometry experiments with human lymphocytes.
• peripheral blood mononuclear cells were purified on histoplaque by standard techniques.
• PBMC peripheral blood mononuclear cells
• fluorescein labeledFTTC-LD201T1 SEQ ED NO: 185
• SMHCKbuffer 140 mM NaCl, 1 mM MgCl 2 , 1 mM CaCl 2 , 5 mM, KCl, 20 mM HEPES pH 7.4, 8.9 mM NaOH, 0.1% (w/v) BSA, 0.1% (w/v) sodium azide
• the SELEX protocol is outlined in Table 15 and Example 22. All rounds were selected at 37°C. The dissociation constant ofrandomized RNA to LS-Rg is estimated tobe approximately 10 ⁇ M. After six rounds the pool affinities had improved to approximately 300 nM. An aliquot ofthe RNA recovered fromthe seventh round was used as the starting material forthe first counter-selected rounds. Five rounds ofcounter-selection and five additional standard rounds were performed in parallel.
• ligand sequences are shown in standard single letter code (Cornish-Bowden, 1985 NAR 13: 3021-3030). Fixed region sequence is shown in lower case letters. By definition, each clone includes both the evolved sequence and the associated fixed region, unless specifically stated otherwise. A unique sequence is operationally defined as one that differs from all others by three or more nucleotides. Sequences that were isolated more than once are indicated by the parenthetical number, (n), following the ligand isolate number.
• the 30N7 and 40N7 SELEX final pools shared acommon major sequence family, even though identical sequences from the two SELEXes are rare (Table 16). Most ligands (72 ofthe 92 unique sequences) from the 30N7 and 40N7 SELEXes contain one oftwo related sequence motifs, RYGYGUUUUCRAGY or
• RYGYGUUWWUCRAGY These motifs define family 1. Within the family there are three subfamilies. Subfamily la ligands (53/66) contain an additional sequence motif, CUYARRY, one nucleotide 5' to the family 1 consensus motifs. Subfamily lb (9/66 unique sequences) lacks the CUYARRY motif. Subfamily lc (5/66) is also missing the CUYARRY motif, has an A inserted between the Y and G ofconsensus YGUU and lacks the consensus GA base pair. The significance ofthe sequence subfamilies is reflected in the postulated secondary structure ofthe ligands (Example 25).
• Family 3 has a short, unreliable consensus motif(Table 16).
• the dissociation constants range from 34 pM to 315 nM at 37 °C. Binding affinity is not expected to be temperature sensitive since selection was at 37°C and 2'-F RNA forms thermal stable structures, but binding has not been tested at lower temperatures. For the mostpart, the extreme differences in affinity may be related to predicted secondary structure (Example 25).
• FITC-conjugated DNA ligandFTTC-LD201T1 (SEQ ED NO: 185) in the presence of increasing concentrations ofunlabeled 2'-F ligands as describedinExample 22, paragraphE.
• Ligands LF1513 (SEQ ID NO: 321), LF1514 (SEQID NO: 297), LF1613 (SEQEDNO:331)andLF1618 (SEQ ID NO: 351) inhibitedthe binding ofFITC-LD201T1 in a concentration dependent manner, withcomplete inhibition observed at competitor concentrations of 10 to 300 nM.
• Nonconserved sequences especially those that vary in length are not apt to be directly involved in function, while highly conserved sequence are likely tobe directly involved.
• the deduced secondary structure offamily la ligands fromcomparative analysis of21 unique sequences is a hairpin motif (Figure 15) consisting ofa4 to 7 nucleotide terminal loop, a 6 base upper stem and a lower stem of4 or more base pairs.
• the consensus terminal loops are either aUUUU tetraloop or a UUWWU pentaloop. Hexa- and heptaloops are relatively rare.
• the upperandlower stems are delineatedby a7 nucleotide bulge in the 5'-halfofthe stem. Four ofthe six base pairs in the upper stem and all base pairs in the lowerstem are supportedbyWatson- Crickcovariation.
• the loop closing GC While the otheris a non-standard GA.
• the lower stem is most often 4 or 5 base pairs longbut canbe extended. While the sequence oftheupper stemis strongly conserved, that ofthe lower stemis not, withthe possible exception ofthe YR' basepair adjacent to the internal bulge. This base pair appears to covary with the 3' position ofthe 7 nucleotidebulge in amannerwhichminimizes the HkeHhood ofextending the upper stem. Both the sequence (CUYARRY) andlength (7 nt) of the bulge are highly conserved.
• the 7 nucleotide bulge, the upper stem and the 5' and 3' positions ofthe terminal loop are most apt to be directly involved in L- selectin binding.
• the 5' U and 3' U ofthe terminal loop, the invariant GC and GAbase pairs ofthe upper stem and the conserved C, U and A ofthe bulge are the mostly likely candidates.
• the lower stem because ofits variability in length and sequence, is less likely to be directly involved.
• the deduced secondary structure offamily lb is similar to that offamily la, except thatthe upper stem is usually 7 base pairs in length and that the single strandedbulge which does not have ahighly conserved consensus is only 4 nucleotide long.
• This structure may be an acceptable variation ofthe 1a secondary structure with the upper stem's increased length allowing a shorterbulge; the affinity ofligandLF1511 (SEQ ID NO: 332) is 300 pM.
• LF1618 (SEQ ID NO: 351), permits aUUUU tetraloop and "upper" stemof7 base pairs but has neither a lower stemnorthe consensus 7 nucleotide bulge sequence of la.
• the upper stem differs fromthose of la and lb in that it has an unpaired A adjacent to the loop closing G and does not have the invariant GAbase pair of 1a and 1b.
• the affinity ofLF1618 is amodest 10 nM which suggests that family lc forms aless successful structure.
• Predictions ofminimal high affinity sequences forfarmly 1 ligands canbe made and serve as apartial test ofthe postulated secondary structure. Truncates which include only the upper stem and terminal loop, LF1514T1 (SEQEDNO: 385) orthese two elementsplus the 7 nucleotide bulge sequence, LF1514T2 (SEQED NO: 386), axe not expectedto bindwithhigh affinity. On the otherhand, there is a reasonable, but notrigorous, expectation that ligands truncatedatthebase ofthe lowerconsensus stem, LF1514T4 (SEQ ID NO: 387) andLF1807T4 (SEQ ED NO: 388), will bind with high affinity.
• PS-Rg is a chimeric protein in which the lectin, EGF, and the first two CRD domains ofhuman P-selectin arejoined to the Fc domain ofahuman G1
• PS-Rg is a chimeric protein in which the extracellular domain ofhuman P- selectin isjoined to the Fc domain of a human G2 immunoglobulin (Norgard et al., 1993, PNAS 90:1068-1072).
• ES-Rg and CD22 ⁇ -Rg are analogous constructs ofE- selectin and CD22 ⁇ joined to a human Gl immunoglobulinFc domain (R.M.
• the nucleotide sequence ofthe synthetic DNA template for the PS-Rg SELEX was randomized at 50 positions. This variable region was flanked by N85' and 3' fixed regions.
• the transcript 50N8 has the sequence 5' gggagacaagaauaaacgcucaa-50N-uucgacaggaggcucacaacaggc 3' (SEQ ED NO: 390). All C and U have 2'-F substituted for 2'-OH on the ribose.
• the primers for the PCR were the following:
• the fixedregions includeprimerannealing sites forPCR and cDNA synthesis as well as aconsensus T7 promoter to allow in vitro transcription.
• the initial RNA pool was made by first Klenow extending 1 nmol ofsynthetic single stranded DNA and then transcribing the resulting double stranded molecules with T7 RNA polymerase. Klenow extension conditions: 3.5 nmols primer 5N8, 1.4 nmols 40N8, IX Klenow Buffer, 0.4 mM each ofdATP, dCTP, dGTP and dTTP in a reaction volume of 1 ml.
• RNA was the template for AMV reverse transcriptase mediated synthesis ofsingle stranded cDNA.
• These single-stranded DNA molecules were converted into double-stranded transcription templates by PCR amplification.
• PCR conditions were 50 mM KCl, 10 mM Tris-Cl, pH 8.3, 7.5 mM MgCl2, 1 mM ofeach dATP, dCTP, dGTP, and dTTP, and 25 U/ml ofTaq DNA polymerase.
• Transcription reactions contained 0.5 mM DNA template, 200 nM T7 RNA polymerase, 40 mM Tris-HCl (pH 8.0), 12 mM MgCl2, 5 mM DTT, 1 mM spermidine, 4% PEG 8000, 1 mM each of2'-OH ATP and 2'-OH GTP, 3.3 mM each of 2'-F CTP and 2'-F UTP, and 250 nM ⁇ - 32 P 2'-OH ATP.
• the density of immobilized PS-Rg was 20 pmols/ ⁇ l ofProtein A Sepharose 4 Fast Flow beads.
• the density ofPS-Rg was reduced (Table 18), as needed, to increase the stringency ofselection.
• SELEX was often done at more than one PS-Rg density. At each round, the eluted material from only one PS-Rg density was carried forward.
• RNA was batch adsorbed to 100 ⁇ l ofprotein A sepharose beads for 1 hourin a 2 ml siliconized column. Unbound RNA and RNA eluted with minimal washing (two volumes) were combined and used for SELEX input material. For SELEX, extensively washed, immobilized PS-Rg was batch incubated with pre-adsorbed RNA for 0.5 to 1 hours in a 2 ml siliconized column with frequent mixing. Unbound RNA was removed by extensive batch washing (500 ⁇ l HSMC/wash).
• Bound RNA was eluted as two fractions; first, bound RNA was eluted by incubating and washing columns with 5 mM EDTA in HSMC without divalent cations; second, the remaining elutable RNA was removedby incubating and/or washing with 50 mM EDTA in HSMC without divalents.
• the percentage ofinput RNA that was eluted is recorded in Table 18.
• an equal volume of protein A sepharose beads without PS-Rg was treated identically to the SELEX beads to determine background binding. All unadsorbed, wash and eluted fractions were counted in a Beckman LS6500 scintillation counter in order to monitor each round ofSELEX.
• RNA was resuspended in 80 ⁇ l ofH 2 O and 40 ⁇ l were reverse transcribed into cDNAby AMV reverse transcriptase at48°C for 30 minutes, in 50 mM Tris-Cl pH (8.3), 60 mM NaCl, 6 mM Mg(OAc) 2 , 10 mM DTT, 200 pmol DNA primer, 0.4 mM each ofdNTPs, and 0.4 unit/ ⁇ l AMV RT. Transcripts ofthe PCRproduct were used to initiate the next round ofSELEX.
• a nitrocellulose filter partitioning method was used to determine the affinity ofRNA ligands for PS-Rg and forotherproteins.
• FUter discs nitrocellulose/cellulose acetate mixed matrix, 0.45 ⁇ m pore size, Millipore
• RNA pools and unlabeled PS-Rg were incubated in HSMC for 10 - 20 min at 4°C, roomtemperature or 37 °C, filtered, and then immediately washed with 4 ml HSMC at the same temperature.
• the filters were air-dried and counted in aBeckman LS6500 liquid scintillation counterwithout fluor.
• PS-Rg is a dimeric protein that is the expression product ofa recombinant gene constructed by fusing the DNA sequence that encodes the extracellular domains ofhuman P-selectin to the DNA that encodes a human IgG 1 Fc region.
• the monomer concentration is defined as 2 times the PS-Rg dimer concentration.
• Kd equilibrium dissociation constant
• Twelfth round PCRproducts were re-amplified with primers which contain either aBamHl or aHinDIII restriction endonuclease recognition site. Using these restriction sites, the DNA sequences were inserted directionally into the pUC9 vector. These recombinant plasmids were transformed into E. coli strain JM109 (Life Technologies, Gaithersburg, MD). Plasmid DNA was prepared according to the alkaline hydrolysis method (PERFECTprep, 5'-3', Boulder, CO).
• RNA ligands 32 P-labeled at the 5'-end for the 3' boundary and 32 P-labeled at the 3'-end for the 5' boundary, are hydrolyzed in 50 mM Na2CO 3 pH 9 for 8 minutes at 95°C.
• the resulting partial hydrolysate contains apopulation ofend-labeled molecules whose hydrolyzedends correspond to each ofthe purine positions in the full length molecule.
• the hydrolysate is incubated with PS-Rg (atconcentrations 5- fold above, below and atthe measured Kd for the ligand).
• the RNA concentration is significantly lower than the Kd.
• the reaction is incubated atroom temperature for 30 minutes, filtered, and then immediately washed with 5 ml HSMC at the same temperature.
• RNA is extracted from the filter and then electrophoresed on an 8% denaturing gel adjacent to hydrolyzed RNA whichhas not been incubated with PS-Rg. Analysis is as described in Tuerk et. al.1990, J. Mol. Biol.213: 749.
• RNA ligands are then incubated with concentrations ofPS-Rg 2-fold above and 2.5-foldbelow the Kd ofthe unmodified ligandat roomtemperature for 30 minutes, filtered, and then immediately washed with 5 ml HSMC at the same temperature.
• the bound RNA is extracted from the filter and then hydrolyzed with 50 mM
• Unselected RNA Na2CO3 pH 9 for 8 minutes at 95°C in paraUel with RNA which has not been exposed to binding and filtration (Unselected RNA).
• Unselected RNA The Selected RNA is then electrophoresed on a20% denaturing gel adjacent to Unselected RNA.
• the ratio ofintensities ofthe Unselected:Selectedbands that correspondto the position in question are calculated.
• the Unselected:Selectedratio when the position is mixed is compared to the mean ratio forthatposition from experiments inwhich,the position is notmixed. If the Unselected:Selectedratio of the mixedposition is significantly greater than that when theposition is not mixed, 2'-OMe may increase affinity. Conversely, if the ratio is significantly less, 2'-OMe may decrease affinity. Ifthe ratios are not significantly different, 2'-OMe substitution has no affect.
• Vacutainer 6457 tubes Within 5 minutes ofcollection, 485 ⁇ l ofblood was stimulated with 15 ⁇ l Bio/DataTHROMBINEX for 5 minutes at room temperature. A 100 ⁇ l aliquot ofstimulatedblood was transferred to 1 ml ofBB- (140 mM NaCl,
• CD61 orPE conjugated anti-CD62 antibody (Becton Dickinson) was incubated for
• RNA ligands were incubated with PS-Rg in HSMC/1% BSA at room temperature for 15 min.
• PS-Rg (lOnM) or a PS-Rg (10nM)/RNA ligand mix was addedto the coated, blocked wells and incubated at room temperature for 60 minutes. The binding solution was removed, wells were washed with 300 ⁇ l ofPBS(-) and then probed with HRP conjugated anti-human IgG, at room temperature to quantitate PS- Rg binding. After a 30 minute incubation atroomtemperature in the dark with OPD peroxidase substrate (Sigma P9187), the extent ofPS-Rg binding and percent inhibition was determined from the OD450.
• OPD peroxidase substrate Sigma P9187
• the starting RNA pool for SELEX contained approximately 10 15 molecules (1 nmol RNA).
• the SELEXprotocol is outlinedin Table 18.
• the dissociation constant ofrandomized RNA to PS-Rg is estimated tobe approximately 2.5 ⁇ M.
• An eight-fold difference was observed in the RNA elution profiles with 5 mM EDTA from SELEX and background beads for rounds 1 and 2, while the 50 mM elution produced a 30-40 fold excess over background Table 18.
• the 5 mM and 50 mM eluted RNAs were pooled and processed for the next round. Beginning with round 4, only the 5 mM eluate was processed for the following round.
• the density ofimmobilized PS-Rg was reduced five fold in round 2 and again in round three withoutgreatly reducing the fraction eluted fromthe column.
• the density ofimmobilized PS-Rg was further reduced 1.6-fold in round 4 and remained atthis density until round 8, with furtherreductions in protein density at laterrounds.
• the affinity ofthe selected pools rapidly increased and the pools gradually evolvedbiphasic binding characteristics.
• Binding experiments with 12th roundRNA revealed that the affinity ofthe evolving pool for P-selectin was not temperature sensitive.
• Bulk sequencing of2nd, 6th, 11th and 12th RNA pools revealed noticeable non-randomnessby round twelve.
• the 6th round RNA bound monophasicaUy at 37°C with adissociation constant ofapproximately 85 nM, while the 11th and 12throundRNAs bound biphasicaUy with high affinity Kds ofapproximately 100 and 20 pM, respectively.
• the binding ofall tested pools required divalent cations. In the absence ofdivalent cations, the Kds ofthe 12th round pools increased to > 10 nM.
• the 12th round pool showed high specificity for PS-Rg with measured Kd's of 1.2 ⁇ M and 4.9 ⁇ M for ES-Rg and LS-Rg, respectively.
• ligand sequences are shown in standard single letter code (Cornish-Bowden, 1985 NAR 13: 3021-3030). Fixed region sequence is shown in lower case letters. By definition, each clone includes both the evolved sequence and the associated fixed region, unless specifically stated otherwise. Fromthe twelfth round, 21 of44 sequenced ligands were unique. A unique sequence is
• Family 1 is defined by 23 ligands from 13 independent lineages.
• the consensus sequence is composed oftwo variably spaced sequences, CUCAACGAMC and CGCGAG (Table 19).
• CUCAA of the consensus is from 5' fixed sequence which consequently minimizes variability and in turn reduces confidence in interpreting the importance ofCUCAA orthe paired GAG (see Example 27).
• Families 2-5 are each represented by multiple isolates ofa single sequence which precludes determination ofconsensus sequences.
• the dissociation constants forrepresentative ligands were determined by nitrocellulose filterbinding experiments and are Hsted in Table 20. These calculations assume two binding sites per chimera.
• the affinity of randomRNA is estimated to be approximately 2.5 ⁇ M.
• ligands bind monophasically with dissociation constants ranging from 15 pM to 450 pM at 37 °C. Some ofthe highest affinity ligands bind biphasicaUy. FuU length ligands offamiHes 1-4 show no temperature dependence. The observed affinities substantiate the proposition that it is possible to isolate oHgonucleotide ligands witii affinities that are several orders ofmagnitude greater than that ofcarbohydrate ligands.
• the affinity ofP-selectin ligands to ES-Rg, LS-Rg and CD22 ⁇ -Rg were determined by nitrocellulose partitioning. As indicated in Table 20, the ligands are highly specific for P-selectin. In general, a ligand's affinity for ES-Rg and LS-Rg is atleast 10 4 -fold lower than for PS-Rg. Binding above background is not observed for CD22 ⁇ -Rg at the highest protein concentration tested (660 nM), indicating that ligands do notbind the Fc domain ofthe chimeric constructs nor do they have affinity forthe sialic acidbinding site ofthis unrelated lectin. The specificity of oligonucleotideligand binding contrasts sharply with the binding ofcognate carbohydrates by the selectins and confirms the propositionthat SELEX ligands will have greater specificity than carbohydrate ligands.
• OHgonucleotide ligands eluted by 2-5 mM EDTA, are expected to derive part oftheirbinding energy from contacts with the lectin domain's bound Ca ++ and consequently, are expected to compete with sialyl-Lewis x forbinding.
• the selected oligonucleotide ligands competitively inhibit PS-Rg binding to immobilized sialyl-Lewis x withIC50s ranging from 1 to 4 nM (Table 20).
• ligandPF377 SEQ ID NO: 206 has an IC50 ofapproximately 2 nM. Complete inhibition is attained at 10 nM ligand.
• Nonconserved sequences especially those that vary in length are not apt to be directly involved in function, while highly conserved sequences are likely to be directly involved.
• Boundary experiments were performed on anumber ofP-selectin ligands as described in Example 27 and the results are shown in Table 21.
• the results for family 1 ligands are consistent with their proposed secondary structure.
• the composite boundary species vary in size from 38-90 nucleotides, but are 40-45 nucleotides in family 1. Affinities ofthese truncated ligands are shown in Table 22.
• the truncates lose no more than 10-fold in affinity in comparison to the full length, effectively inhibit the binding ofPS-Rg to sialyl-Lewis x and maintain binding specificity for PS-Rg (Table 22). These data validate the boundary method foridentifying the minimalhigh affinity binding element ofthe RNAligands.
• Binding to platelets is P-selectin specific by the criteria that 1)
• the SELEX procedure is described in detail in US patent 5,270,163 and elsewhere.
• the nucleotide sequence ofthe synthetic DNA template forthe PS-Rg SELEX was randomized at 50 positions. This variable region was flanked by N85' and 3' fixed regions.
• the transcript 50N8 has the sequence 5' gggagacaagaauaaac gcucaa-50N-uucgacaggaggcucacaacaggc 3' (SEQ ED NO: 248). All C and U have 2'-NH2 substituted for 2'-OH on the ribose.
• the primers for the PCR were the following:
• a nitrocellulose filterpartitioning method was used to determine the affinity of RNA ligands for PS-Rg and for other proteins. Either a Gibco BRL 96 well manifold, as described inExample 23 or a 12 well MilHpore manifold (Example 7C) was used forthese experiments. Binding data were analyzed as described in Example 7, paragraph C.
• Twelfth round PCR products were re-amplified with primers which contain eitheraBamHl oraHinDEIIIrestriction endonuclease recognition site.
• RNA contained approximately 10 15 molecules (1 nmol 2'-NH 2 RNA).
• the dissociation constant ofrandomized RNA to PS-Rg is estimated to be approximately 6.4 ⁇ M.
• the SELEX protocol is outlined in Table 24.
• the initial round ofSELEX was performed at 37°C with an PS-Rg density of20 pmol/ ⁇ l ofprotein A sepharose beads. Subsequent rounds were all at 37°C. In the firstround there was no signal above background for the 5 mM EDTA elution, whereas the 50 mM EDTA elution had a signal 7 fold above background, consequently, the two elutions were combined and processed for the next round. This scheme was continued through round 6. Starting with round seven only the 5 mM eluate was processed for the next round. To increase the stringency ofselection, the density ofimmobilized PS-Rg was reduced ten fold in round 6 with further reductions in protein density at later rounds. Under these conditions a rapid increase in the affinity ofthe selected pools was observed.
• Binding experiments with 12th round RNA revealed that the affinity ofthe evolving pool for P-selectin was temperature sensitive despite performing the selection at 37°C, (Kds: 13 pM, 91 pM and 390 pM at 4°C, room temperature and 37 °C, respectively).
• Bulk sequencing ofRNA pools indicated dramatic non- randomness at round 10 with not many visible changes in round 12.
• Ligands were cloned and sequenced from round 12.
• each clone includes both the evolved sequence and the associated fixed region, unless specifically stated otherwise. From the twelfth round, 40/61 sequenced ligands were unique. A unique sequence is operationally defined as one that differs from all others by three or more nucleotides. Sequences that were isolated more than once are indicated by the parenthetical number, (n), following the ligand isolate number.
• Ligands from family 1 dominate the final pool containing 16/61 sequences, which are derived frommultiple lineages. Families 2 and 3 are represented by slight mutational variations ofa single sequence. Sequences labeled as "others" do not have any obvious similarities. Family 1 is characterized by the consensus sequence GGGAAGAAGAC (SEQ ID NO: 291).
• the dissociation constants ofrepresentative ligands are shown in Table 26. These calculations assume two RNA ligand binding sites per chimera. The affinity ofrandom 2-NH 2 RNA is estimated to be approximately 10 ⁇ M.
• the dissociation constants range from 60 pM to 50 nM which is at least a 1x10 3 to 1x10 5 fold improvement over randomized 2'-NH 2 RNA (Table 26).
• FITC-labeled ligand PA350 (FITC-350) (SEQ ID NO: 252) was tested for its abUity to bind to P-selectin presented in the context ofaplatelet cell surface by flow cytometry experiments as described in Example 23, paragraph G.
• FITC-PA350 for binding to P-selectin was tested by competition experiments in which FTTC-PA350 and unlabeled blocking monoclonal antibody Gl were simultaneously added to stimulated platelets. Gl effectively competes with FTTC-PA350 for binding to platelets, while an isotype matched control has little orno effect which demonstrates that FTTC-PA350 specifically binds to P-selectin.
• the specificity ofbinding is further verified by the observation that oligonucleotide binding is saturable; binding of 10 nM FTTC-PA350 is inhibited by 200 nM unlabeled PA350.
• the binding of FTTC-PA350 is dependent on divalent cations; at 10 nM FTTC-PA350 activated platelets are not stained in excess ofautofluorescence in the presence of5 mM EDTA.
• ligands PA341 SEQ ID NO: 251
• PA350 SEQ ID NO: 252
• IC50s IC50s ranging from 2 to 5 nM (Table 26). This result is typical ofhigh affinity ligands andis reasonable underthe experimental conditions.
• the IC50s ofligands whose Kds are much lower than the PS-Rg concentration (10 nM) are limited by the protein concentration and are expected to be approximately one halfthe PS-Rg concentration.
• ES-Rg is a chimeric protein in which the extracellular domain ofhuman E- selectin isjoined to the Fc domain ofahuman Gl immunoglobulin (R.M. Nelson et al., 1993, supra). Purified chimera were provided by A.Varki. Unless otherwise indicated, all materials used in this SELEX are similar to those ofExamples 7 and 13.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Engineering & Computer Science (AREA)
• Organic Chemistry (AREA)
• General Health & Medical Sciences (AREA)
• Medicinal Chemistry (AREA)
• Public Health (AREA)
• General Chemical & Material Sciences (AREA)
• Pharmacology & Pharmacy (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Animal Behavior & Ethology (AREA)
• Veterinary Medicine (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Immunology (AREA)
• Biomedical Technology (AREA)
• Hematology (AREA)
• Molecular Biology (AREA)
• Urology & Nephrology (AREA)
• Rheumatology (AREA)
• Analytical Chemistry (AREA)
• Dermatology (AREA)
• Biochemistry (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Microbiology (AREA)
• Oncology (AREA)
• Biotechnology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Physics & Mathematics (AREA)
• Neurosurgery (AREA)
• Vascular Medicine (AREA)
• Diabetes (AREA)
• Neurology (AREA)
• Transplantation (AREA)
• Communicable Diseases (AREA)
• Pain & Pain Management (AREA)
• Heart & Thoracic Surgery (AREA)
• Cardiology (AREA)

Priority Applications (6)

Applications Claiming Priority (8)

Related Parent Applications (4)

Related Child Applications (3)

Publications (1)

Family

ID=27504168

Family Applications (1)

Country Status (5)

Families Citing this family (1)

Citations (3)

Family Cites Families (4)

• 1996
  • 1996-06-05 JP JP9501770A patent/JPH11507526A/ja active Pending
  • 1996-06-05 CA CA002223275A patent/CA2223275A1/en not_active Abandoned
  • 1996-06-05 WO PCT/US1996/009455 patent/WO1996040703A1/en active Application Filing
  • 1996-06-05 EP EP96923232A patent/EP0840739A4/en not_active Withdrawn
  • 1996-06-05 AU AU64507/96A patent/AU725590B2/en not_active Ceased
• 2008
  • 2008-09-04 JP JP2008227400A patent/JP2009039126A/ja active Pending

Patent Citations (3)

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events