WO1996039195A2 - Oligonucleotide chimiquement modifie pour mutagenese dirigee sur site - Google Patents

Oligonucleotide chimiquement modifie pour mutagenese dirigee sur site Download PDF

Info

Publication number
WO1996039195A2
WO1996039195A2 PCT/US1996/008883 US9608883W WO9639195A2 WO 1996039195 A2 WO1996039195 A2 WO 1996039195A2 US 9608883 W US9608883 W US 9608883W WO 9639195 A2 WO9639195 A2 WO 9639195A2
Authority
WO
WIPO (PCT)
Prior art keywords
oligonucleotide
gene
psoralen
supf
dna
Prior art date
Application number
PCT/US1996/008883
Other languages
English (en)
Other versions
WO1996039195A3 (fr
Inventor
Peter M. Glazer
Pamela A. Havre
Original Assignee
Yale University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yale University filed Critical Yale University
Priority to AU60432/96A priority Critical patent/AU6043296A/en
Publication of WO1996039195A2 publication Critical patent/WO1996039195A2/fr
Publication of WO1996039195A3 publication Critical patent/WO1996039195A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/15—Nucleic acids forming more than 2 strands, e.g. TFOs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/351—Conjugate
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/351—Conjugate
    • C12N2310/3511—Conjugate intercalating or cleaving agent

Definitions

  • Gene therapy is the introduction into a cell of an entire replacement copy of a defective gene to treat human, animal and plant genetic disorders.
  • the introduced gene via genetic recombination, replaces the endogenous gene.
  • This approach requires complex delivery systems to introduce the replacement gene into the cell, such as genetically engineered viruses, or viral vectors.
  • oligonucleotides can bind as third strands of DNA in a sequence specific manner in the major groove in polypurine/polypyrimidine stretches in duplex DNA.
  • a polypyrimidine oligonucleotide binds in a direction parallel to the purine strand in the duplex, as described by Moser and Dervan, Science 238:645 (1987), Praseuth et al., Proc. Natl. Acad. Sci. USA 85:1349 (1988), and Mergny et al., Biochemistry 30:9791 (1991).
  • a polypurine strand binds anti- parallel to the purine strand, as described by Beal and Dervan, Science 251:1360 (1991).
  • the specificity of triplex formation arises from base triplets (AAT and GGC in the purine motif) formed by hydrogen bonding; mismatches destabilize the triple helix, as described by Mergny et al., Biochemistry 30:9791 (1991) and Beal and Dervan, Nuc. Acids Res. 11:2773 (1992).
  • triplex forming oligonucleotides have been found useful for several molecular biology techniques.
  • triplex forming oligonucleotides designed to bind to sites in gene promoters have been used to block DNA binding proteins and to block transcription both in vitro and in vivo.
  • a method for site-directed mutagenesis of a target DNA molecule would be a useful in achieving successful gene or anti-viral therapy. Such a method would also be a useful research tool for genetic engineering or for studying genetic mechanisms such as DNA repair.
  • a mutagenic, triplex-forming oligonucleotide and methods for use thereof are described herein.
  • An oligonucleotide capable of forming a triple strand with a specific DNA segment of a target gene DNA is chemically modified to incorporate a mutagen.
  • the modified oligonucleotide hybridizes to a chosen site in the target gene, forming a triplex region, thereby bringing the attached mutagen into proximity with the target gene and causing a mutation at a specific site in the gene.
  • the mutation activates, inactivates, or alters the activity and function of the target gene.
  • the mutagenic oligonucleotide is useful for mutagenic repair that may restore the DNA sequence of the target gene to normal.
  • the target gene is a viral gene needed for viral survival or reproduction or an oncogene causing unregulated proliferation, such as in a cancer cell
  • the mutagenic oligonucleotide is useful for causing a mutation that inactivates the gene to incapacitate or prevent reproduction of the virus or to terminate or reduce the uncontrolled proliferation of the cancer cell.
  • the mutagenic oligonucleotide is also a useful anti-cancer agent for activating a repressor gene that has lost its ability to repress proliferation.
  • the mutagenic triplex-forming oligonucleotide is also particularly useful as a molecular biology research tool to cause site- directed or targeted mutagenesis.
  • Site-directed mutagenesis is useful for targeting a normal gene and for the study of mechanisms such as DNA repair.
  • Targeted mutagenesis of a specific gene in an animal oocyte, such as a mouse oocyte provides a useful and powerful tool for genetic engineering for research and therapy and for generation of new strains of "transmutated" animals and plants for research and agriculture.
  • Figure 1 is a schematic representation showing a psoralen- linked triplex-forming oligonucleotide for targeted mutagenesis of the lambda genome.
  • a map of the lambda supF genome is shown, including the target gene for site-directed mutagenesis, the supF suppressor tRNA gene.
  • Above the partial sequence of the supF gene (positions 149 to 183, Sequence ID No.
  • the site of triplex formation at positions 167-176 is indicated by the placement of the triplex-forming oligonucleotide, pso- AG10 (wherein pso is an abbreviation for 4'hydroxymethyl-4,5',8- trimethylpsoralen, and wherein AGIO is an abbreviation for 5 AGGAAGGGGG 3' , Sequence ID No. 1).
  • the arrow indicates that the psoralen moiety is targeted to the A:T base pair at position 167.
  • the lambda vector carries the cl lambda repressor gene which is used to assess non-targeted mutagenesis.
  • Figures 2a and 2b show the partial sequence of the supF gene (positions 82-183, Sequence ID No. 9, and positions 39-57, Sequence ID No. 10) and also show a sequence analysis of targeted mutagenesis in the supF gene by the psoralen-linked triplex-forming oligonucleotide (pso- AGIO).
  • pso- AGIO psoralen-linked triplex-forming oligonucleotide
  • mutations produced by pso- AGIO and UVA are indicated above each base pair, with the listed base representing the change from the sequence in the top strand.
  • the + signs below the sequence are sites at which mutations are known to produce a detectable phenotype change, demonstrating that the use of supF in this assay does not bias detection at any particular site.
  • DNA sequence data was obtained by automated methods after polymerase chain reaction amplification of the supF genes from lambda phage plaques in accordance with the method of Connell et al., Biotechniques 5:342 (1987).
  • Figure 2b is a compilation of mutations induced in supF by 8-methoxypsoralen and UVA in mouse L- cells using the lambda supF vector of Figure 1 or generated using a plasmid shuttle vector in monkey Vero cells in accordance with the method of Bredberg and Nachmansson, Carcinogenesis 8:1923 (1987), to compare the mutations produced in supF by free psoralen with those produced by the triplex forming oligonucleotide AGIO.
  • Figure 3 is a schematic representation of the strategy for targeted mutagenesis of SV40 DNA, wherein positions 149-183, Sequence ID No. 8, of the supF gene are shown.
  • the 10 base triplex-forming oligonucleotide, psoralen-AGlO (wherein psoralen is an abbreviation for 4'hydroxymethyl-4,5',8-trimethylpsoralen and wherein AGIO is an abbreviation for 5' AGGAAGGGGG 3' , Sequence ID No. 1), is shown directly above its targeted sequence in the supF gene (base pairs 167- 176), contained within the SV40 vector, pSP189.
  • Psoralen-AGlO is incubated with the SV40 vector DNA to allow site-specific triplex formation.
  • Photoactivation of the psoralen by irradiation with long wave ultraviolet light (320-400 nm) is designed to generate an adduct at the targeted base pair (167), as indicated by the arrow.
  • the oligo-plasmid complex is then transfected into monkey COS-7 cells and allowed to replicate for 48 hours.
  • the DNA is used to transform E. coli SY204 lacZl25 (Am). Transformants are selected on ampicillin plates containing X-gal and isopropylthio- ⁇ -D- galactoside (IPTG) for detection and isolation of mutants (white colonies) in which the supF gene has been inactivated by mutation.
  • Figure 4 is a schematic representation showing the basis of a restriction enzyme protection assay, using Hini I digestion, to detect site- specific triplex formation within the supF gene, wherein a partial sequence is shown, Sequence ID No. 8.
  • Digestion of the unprotected 250 bp supF PCR fragment with Hint I is expected to yield three fragments of sizes 150, 65, and 35 bp.
  • fragments of sizes 150 and 100 bp are predicted.
  • Figures 5A and 5B show the partial sequence of the supF gene (positions 82-183, Sequence ID No. 9, and positions 39-57, Sequence ID No. 10) and also show a sequence analysis of targeted mutagenesis in the supF gene within the pSP189 SV40 vector by the psoralen-linked triplex- forming oligonucleotide, psoralen- AGIO.
  • Figure 5A point mutations produced by psoralen-AGlO and UVA are indicated above each base pair, with the listed base representing the change from the sequence in the top strand. Deletion mutations are presented below the supF sequence, indicated by dashed lines.
  • Figure 5B is a compilation of mutations induced in supF by 8-methoxypsoralen and UVA in mouse L-cells using a lambda phage shuttle vector or generated in monkey Vero cells using an SV40 shuttle vector (pZ189) almost identical to the one used in this study to show for comparison the mutations that can be produced in supF by free psoralen.
  • Figure 6 is a schematic representation of the strategy for targeted mutagenesis of SV40 DNA in monkey COS cells.
  • Psoralen was incorporated by synthesis into a triplex-forming oligonucleotide as psoralen phosphoramidite.
  • the SV40 shuttle vector, pSupFGl was a derivative of pSP189 and carried triplex-binding sites, which were engineered in to the supF gene.
  • the plasmid is transfected into monkey COS-7 cells. Subsequently, the oligonucleotide, pso-AG30, wherein AG30 is Sequence ID No. 6, is added to the cells, which are allowed to replicate for 48 hours.
  • Photoactivation of the psoralen by irradiation with long wave ultraviolet light is designed to generate mutations.
  • the DNA is used to transform E. coli SY204 lacZ125 (Am). Transformants are selected on ampicillin plates containing X-gal and IPTG for detection and isolation of mutants (white colonies) in which the supF gene has been inactivated by mutation.
  • Figure 7 is the nucleotide sequence and two-dimensional structure of a modified supF gene, designated supFGla. Positions 99- 189, or positions 18 to 102 of Sequence ID No. 9, with the addition of CGGCCG, are shown before modification. An A:T to C:G transversion was incorporated into the sequence, along with a compensatory T:A to G:C change at bp 101 to maintain base pairing in the amino acid acceptor stem of the mature tRNA thereby eliminating an interruption at bp 167 in the polypurine/polypyrimidine run. In addition, a 12 bp polypurine/polypyrimidine sequence, Sequence ID No.
  • FIG. 11 was inserted between bp 183 and 184 to extend the length of the polypurine/polypyrimidine run in the gene to 30 bp.
  • This construct contains a 30 bp polypurine site with two interruptions.
  • Pso-Sequence ID No. 6 is shown at the bottom of the page along with a double stranded version of Sequence ID nO. 6, which together represent the predicted triple helix.
  • Figure 8 is the nucleotide sequence Sequence ID No. 12, and two-dimensional structure of a modified supF gene, designated supFG2. This sequence contains a 43 bp polypurine site and two interruptions.
  • Figure 9 is a graph of percent maximum binding versus oligonucleotide concentration (M) of the mutagenic oligonucleotides pso- AGIO (open squares) and pso-AGT30 (diamonds).
  • Figure 10 is a sequence analysis of sequences of mutations targeted to the supF gene within an SV40 vector (pSupFGla showing Sequence ID No. 11 with Sequence ID No. 9) by treatment of COS cells with pso-AGT30 and UVA.
  • a mutagenic triplex-forming oligonucleotide and methods of use in gene therapy, anti- viral therapeutics, scientific research, and genetic engineering of cells, ariimals and plants are provided.
  • the mutagenic oligonucleotide binds with specificity to a chosen site in a target DNA molecule, forming a triplex region, thereby bringing the attached mutagen into proximity with the target site and causing a mutation therein.
  • the mutation activates, inactivates or alters the activity and function of a gene containing the target site.
  • the oligonucleotide is a synthetic or isolated oligonucleotide capable of binding or hybridizing with specificity to a predetermined region of a double-stranded DNA molecule to form a triple-stranded structure.
  • the predetermined region of the double-stranded molecule contains or is adjacent to the defective or essential portion of a target gene, such as the site of a mutation causing a genetic defect, a site causing oncogene activation, or a site causing the inhibition or inactivation of an oncogene suppressor.
  • the gene is a human gene.
  • the oligonucleotide is a single-stranded DNA molecule between 7 and 40 nucleotides in length, most preferably 10 to 20 nucleotides in length for in vitro mutagenesis and 20 to 30 nucleotides in length for in vivo mutagenesis.
  • the base composition is preferably homopurine or homopyrimidine.
  • the base composition is polypurine or polypyrimidine.
  • other compositions are also useful.
  • the preferred conditions under which a triple-stranded structure will form and the desired nucleotide composition of the third strand are well known to those skilled in the art. (See for example, Moser and Dervan, Science 238:645 (1987); Praseuth et al., Proc.
  • the mutagenic oligonucleotide hybridizes to the target nucleic acid molecule under conditions of high stringency and specificity. Most preferably, the oligonucleotide binds in a sequence- specific manner in the major groove of duplex DNA. Reaction conditions for in vitro triple helix formation of an oligonucleotide probe or primer to a nucleic acid sequence vary from oligonucleotide to oligonucleotide, depending on factors such as oligonucleotide length, the number of G:C and A:T base pairs, and the composition of the buffer utilized in the hybridization reaction. A mutagenic oligonucleotide substantially complementary, based on the third strand binding code, to the target region of the double-stranded nucleic acid molecule is preferred.
  • a useful measure of triple helix formation is the equilibrium dissociation constant, K,j, of the triplex, which can be estimated as the concentration of mutagenic oligonucleotide at which triplex formation is half-maximal.
  • the oligonucleotide has a binding affinity for the target sequence in the range of physiologic interactions.
  • the preferred mutagenic oligonucleotide has a K d less than or equal to approximately 8 X 10 7 M. Most preferably, the K d is less than or equal to 8 X 10 "9 M in order to achieve significant intracellular interactions.
  • the oligonucleotide is chemically modified to include a mutagen at either the 5' end, 3' end, or internal portion so that the mutagen is proximal to the site in the gene requiring modification.
  • the mutagen is incorporated into the oligonucleotide during nucleotide synthesis.
  • commercially available compounds such as psoralen C2 phosphoramidite (Glen Research, Sterling, VA) are inserted into a specific location within an oligonucleotide sequence in accordance with the methods of Takasugi et al., Proc. Natl. Acad. Sci. U.S.A.
  • the mutagen may also be attached to the oligonucleotide by a covalent bond.
  • the mutagen is attached to the oligonucleotide by a linker, such as sulfo-m-maleimidobenzoly-N- hydroxysucciatamide ester (sulfo-MBS, Pierce Chemical Co., Rockford, IL) in accordance with the methods of Liu et al., Biochem. 18:690-697 (1979) and Kitagawa and Ailawa, J. Biochem. 79:233-236 (1976), both of which are incorporated by reference herein.
  • the mutagen is attached to the oligonucleotide by photoactivation, which causes the mutagen, such as psoralen, to bind to the oligonucleotide.
  • the mutagen can be any chemical capable of causing a mutation at the desired site of the double-stranded DNA molecule.
  • the mutation restores the normal, functional sequence of the gene, inactivates an oncogene or activates an oncogene suppressor, or alters the function or inactivates a viral gene.
  • the chemical mutagen can either cause the mutation spontaneously or subsequent to activation of the mutagen, such as, for example, by exposure to light.
  • Preferred mutagens include psoralen, which requires activation by UVA irradiation, acridine orange, which can be activated by UVA irradiation and can be effective in the absence of light, and alkylating agents, cis-platinum analogs, hematoporphyrins and hematoporphyrin derivatives, mitomycin C, radionuclides such as 125 I, 35 S and 32 P, and molecules that interact with radiation to become mutagenic, such as boron that interacts with neutron capture and iodine that interacts with auger electrons.
  • acridine orange can be used to cause a frame shift mutation, useful for gene inactivation.
  • light can be delivered to cells on the surface of the body, such as skin cells, by exposure of the area requiring treatment to a conventional light source.
  • Light can be delivered to cells within the body by fiber optics or laser by methods known to those skilled in the art.
  • Targeted fluorogens that provide sufficient light to activate the light-activated mutagens can also provide a useful light source.
  • the mutagenic oligonucleotides are dissolved in a physiologically-acceptable carrier, such as an aqueous solution or are incorporated within liposomes, and the carrier or liposomes are injected into the organism undergoing genetic manipulation, such as an animal requiring gene therapy or anti- viral therapeutics.
  • a physiologically-acceptable carrier such as an aqueous solution or are incorporated within liposomes
  • the carrier or liposomes are injected into the organism undergoing genetic manipulation, such as an animal requiring gene therapy or anti- viral therapeutics.
  • the preferred route of injection in mammals is intravenous. It will be understood by those skilled in the art that oligonucleotides are taken up by cells and tissues in animals such as mice without special delivery methods, vehicles or solutions.
  • a solution containing the mutagenic oligonucleotides is added directly to a solution containing the DNA molecules of interest in accordance with methods well known to those skilled in the art and described in more detail in the examples below.
  • In vivo research studies are conducted by transfecting cells with plasmid DNA and incubating the mutagenic oligonucleotides in a solution such as growth medium with the transfected cells for a sufficient amount of time for entry of the oligomers into the cells and for triplex formation.
  • the transfected cells may be in suspension or a monolayer attached to a solid phase, or may be cells within a tissue wherein the oligonucleotide is in the extracellular fluid.
  • the cells are then irradiated to activate the psoralen to form photoadducts and consequently mutations at the targeted site.
  • the mutagenic oligonucleotide is useful for mutagenic repair that may restore the DNA sequence of the target gene to normal.
  • the mutagenic oligonucleotide may be useful for mutagenic repair of a defective gene such as the human ⁇ -hemoglobin gene in sickle cell anemia, thalassemia and other hemoglobinopathies.
  • the target gene is an oncogene causing unregulated proliferation, such as in a cancer cell, then the mutagenic oligonucleotide is useful for causing a mutation that inactivates the gene and terminates or reduces the uncontrolled proliferation of the cell.
  • the mutagenic oligonucleotide is also a useful anti-cancer agent for activating a repressor gene that has lost its ability to repress proliferation. Furthermore, the mutagenic oligonucleotide is useful as an antiviral agent when the oligonucleotide is specific for a portion of a viral genome necessary for proper proliferation or function of the virus.
  • the mutagenic triplex-forming oligonucleotide can also be used as a molecular biology research tool to cause site-directed mutagenesis in any gene for the study of mechanisms such as, for example, DNA repair.
  • the oligonucleotide may also be used to study DNA repair by delivering an adduct to the DNA and studying how the adduct is processed into a mutation under various experimental conditions.
  • the mutagenic triplex-forming oligonucleotides will be further understood in view of the following non-limiting examples.
  • Example 1 Site-specific. Targeted Mutagenesis of the supV gene of the Lambda Phage Genome
  • a triplex-forming oligonucleotide linked to psoralen at its 5' end was used to achieve site-specific, targeted mutagenesis in a specific gene in an intact, double-stranded lambda phage genome.
  • Psoralen-linked oligonucleotides were obtained from either Oligos Etc. (Wilsonville, OR) or M. Talmor (Yale University, New Haven, CT) with materials from Glen Research (Sterling, VA).
  • the psoralen was incorporated in the oligonucleotide synthesis as a psoralen phosphoramidite in accordance with the instructions provided by supplier.
  • site-specific triplex formation was designed to deliver the psoralen to the targeted site in the lambda DNA, and UVA irradiation was used to activate the psoralen to form adducts and thereby induce mutations at that site.
  • Sequence analysis of mutations in the target gene showed that almost all were in the targeted region, and 56% were found to be the same T:A to A:T transversion at the targeted base pair.
  • the ratio of targeted to non-targeted mutagenesis was estimated by simultaneous analysis of mutagenesis in a non-targeted gene within the lambda genome, along with analysis of mutagenesis induced by a non-triplex forming (but psoralen linked) oligonucleotide.
  • the target gene chosen was supF, an E. coli amber suppressor tyrosine tRNA gene, contained within the genome of a lambda phage vector, lambda supF as shown in Fig. 1.
  • a 10 base homopurine oligonucleotide AGIO (5' AGGAAGGGGG 3') capable of forming a triple strand at positions 167-176 in the supF gene was identified.
  • the ability of AGIO to bind to the supF gene was demonstrated using 32 P-labeled AGIO in an in vitro binding reaction with a 250 bp fragment containing the entire supF gene.
  • binding assays were carried out for 2 hours at 37 degrees in 10% sucrose, 20 mM MgCl 2 , 10 mM Tris (pH 8.0), and 1 mM spermidine in a 10 ⁇ l volume.
  • the 250 bp supF target was generated from lambda supF using the polymerase chain reaction.
  • Each oligo (200 ng) was labelled with 50 ⁇ Ci of gamma- 32 P-ATP (Amersham, Arlington Heights, IL) and separated from unreacted gamma 32 P-ATP by passage through a G-25 spin column (Boehringer Mannheim, Indianapolis, IN).
  • the concentration of oligomer in the reaction mixture was 6 x 10 "8 M and the oligomer: supF ratio was approximately 1: 1 on a molar basis. When present, competitors were used at 200-fold molar excess.
  • reaction mixtures were run on a 4% acrylamide gel in 90 mM Tris base, 90 mM boric acid, 20 mM MgCl 2 with a 20% acrylamide plug.
  • a 100 bp ladder (BRL, Bethesda, MD) was end-labelled as described for oligomers and ran on gels as a size reference. Following a 4 hour run at constant voltage (150 V), the gel was visualized by autoradiography for 1 hour using Kodak X-AR film.
  • the electrophoretic gel showed binding of the triplex forming oligonucleotide "AGIO" to the supF gene target.
  • AGIO 5' AGGAAGGGGG 3' , Sequence ID No. 1
  • GA10 reverse sequence oligomer
  • the reverse sequence oligomer, GAIO failed to bind to supF or to compete with AGIO for binding.
  • AGIO linked to 4'hydroxymethyl- 4,5',8-trimethylpsoralen via a 2 carbon linker arm (pso- AGIO) formed a covalent bond to labeled duplex supF DNA following UVA irradiation, whereas the reverse oligomer (pso-GAlO) did not.
  • Targeted mutagenesis was achieved by incubating pso- AGIO with lambda supF DNA in vitro to form triplex at positions 167 to 176 of the supF gene and bring the tethered psoralen into proximity with the targeted base pair at position 167 as shown in Table 1.
  • the numbers in the table represent the frequency of mutations seen in either the supF gene or the cl gene in the lambda supF genome following the indicated treatment.
  • the lambda DNA at 3 nM was incubated with or without a 1000-fold molar excess of the indicated oligonucleotides (3 ⁇ M).
  • UVA (365 nm) irradiation of selected samples was performed at a dose of 1.8 J/cm 2 .
  • a radiometer was used to measure lamp output (typical UVA irradiance of 5-7 mW/cm 2 at 320-400 nm).
  • the DNA was packaged in vitro into phage particles, using the method of Hohn, Methods in Enzymology 68:299-309 (1979), and the phage particles were adsorbed to E. coli and grown as individual plaques to allow genetic analyses of the supF and cl genes. AGIO bound specifically to the supF gene, whereas the reverse sequence GA10 did not bind.
  • CT8 (row 3), complementary to the 3' eight nucleotides of AGIO, was preincubated with psoralen- AGIO for 30 min at a 1:1 ratio to form duplex DNA and partially inhibit the ability to psoralen-AGlO to fo ⁇ n triplex at the targeted site in the supF gene.
  • Photoactivation of the psoralen generated a DNA adduct, and in vitro packaging of the psoralen-AGlO-lambda supF DNA complex allowed growth of the phage in bacteria to fix the adduct into a mutation.
  • the phage particles were grown as individual plaques on a bacterial lawn to detect targeted mutagenesis in the supF gene and to measure the extent of non-targeted mutagenesis by screening for the function of an unrelated gene, the lambda repressor (cl) gene. Mutations in these genes yield colorless plaques among blue ones and clear plaques among turbid ones, respectively. Pso-AGlO plus UVA treatment of the lambda DNA resulted in a mutation frequency of 0.233% in supF but approximately 100-fold less, 0.0024%, in cl.
  • the specificity of the targeted mutagenesis is most likely even greater than this 100-fold difference, perhaps as much as 500-fold, considering that cl (765 bp) is a bigger target for mutagenesis than supF (184 bp) and the percentage of base pairs in the two genes at which mutations are detectable was similar.
  • This difference in target size was demonstrated by the 5 -fold difference in supF versus cl mutants induced by the reverse oligomer, pso-GAlO.
  • the reverse oligomer gave a 582-fold lower frequency of supF mutations (0.0004%) than did pso-AGlO, but yielded a similar frequency of cl mutations.
  • mutagenesis by the reverse oligomer was barely above background (untreated lambda DNA).
  • an 8 base oligomer (CT8) complementary to 8 of the 10 bases of AGIO (5' CCCCCTTC 3') was preincubated at a 1:1 ratio with pso- AGIO to form a double-stranded complex.
  • CT8 8 base oligomer complementary to 8 of the 10 bases of AGIO
  • Table 1 Targeted mutagenesis of the supF gene in lambda supF DNA produced by a psoralen-linked triplex-forming oligonucleotide (pso-AGlO) plus UVA irradiation.
  • pso-AGlO psoralen-linked triplex-forming oligonucleotide
  • the A:T base pair at 167 forms a triplet with the 5' adenine to which the psoralen is tethered in AGIO, and so it is the closest base pair to the psoralen.
  • the overwhelming predominance of the T: A to A: T transversion at this site is consistent with the mutagenic action of psoralen, which tends to form adducts at pyrimidines, and especially at thymidines. It should be noted that these mutations are independent and none of the mutations represent siblings because each packaged lambda particle gives rise to a single, separate lambda plaque on the bacterial lawn.
  • the psoralen moiety may occasionally reach beyond the T:A base pair at 167 to form adducts at nearby pyrimidines, giving rise to mutations. It is also possible that even if an adduct is formed at position 167, the bacterial polymerase and repair enzymes that fix the adduct into a mutation may generate mutations at nearby sites during repair and replication while at the same time repairing or bypassing the adduct at 167.
  • the occurrence of several mutations that involve base changes at two adjacent base pairs (166 and 167 in all 3 instances) supports the notion that an adduct at position 167 can cause a change at a nearby position.
  • the rare non-specific mutagenesis by pso- AG10 (and the very small amount of mutagenesis by pso-GAlO that is above background) may result from the potential ability of the psoralen molecule, in spite of being tethered to the oligonucleotide, to intercalate into and form adducts at random sites in the DNA.
  • a reduction of this non-specific activity may be achieved by reducing the reach and the degrees of freedom of the psoralen by attaching it to the triplex-forming oligonucleotide by a shorter tether, such as a one carbon linker arm, or by direct linkage of the psoralen to the nucleotide in the triplex-forming oligonucleotide by direct photoactivation of free psoralen to bind to the oligonucleotide, and the purification of the desired product.
  • a shorter tether such as a one carbon linker arm
  • This experiment achieved a targeted mutation frequency of 0.233%.
  • Example 3 Covalent Linkage of Psoralen to an Oligonucleotide.
  • 5-aminomethyl-8-methoxypsoralen was covalently linked to an oligonucleotide.
  • 5-aminomethyl-8-methoxypsoralen (5am8mop, HRI Associates, Emeryville, CA) was mixed with the linker, sulfo-m-maleimidobenzoyl- N-hydroxysuccinimide ester (sulfo-MBS, Pierce Chemical Co., Rockville, IL) in 0.05 M phosphate buffer, pH 8, with a 5am8mop to sulfo-MBS molar ratio of 1 :40.
  • the mixture was stirred at room temperature for 30 minutes while protected from light in accordance with the methods of Liu et al., Biochem.
  • the modified 5am8mop was purified by HPLC using a modification of standard conditions used in the analysis of 8- methoxypsoralen as described by Gasparro et al., J. Invest. Derm. 90:234-236 (1988).
  • the initial conditions were: a Regis RexchromTM phenyl 15 cm HPLC column ranning a gradient between acetonitrile and either water or 0.05 M, pH 4.5 ammonium acetate buffer. A linear gradient was run from 10% acetonitrile to 60% acetonitrile over 50 minutes.
  • buffer was needed in the initial purification run, the sample was collected off the HPLC, evaporated, and desalted by passing it through the HPLC again with an acetonitrile: water gradient mixture.
  • the detector was a SpectraFocusTM scarining UV detector with wavelengths from 220 to 360 sampled.
  • the detector was connected to a Pharmacia Frac-100TM fraction collector.
  • the purified, modified 5am8mop was then reacted with an oligonucleotide containing an -SH tether by mixing equimolar amounts of modified 5am8mop with the oligonucleotide in 0.05 M phosphate buffer, pH 7-7.5 at room temperature for three hours while protected from light.
  • the oligonucleotide tethered to 5am8mop was then purified by HPLC using a modification of the method of Gasparro et al. , Antisense Res. Dev. 1:117-140 (1991).
  • Example 4 Targeted Mutagenesis of SV40 DNA Using Triple Helix- Forming Oligonucleotides.
  • Oligonucleotides and vectors Psoralen-linked oligonucleotides were obtained from either Oligos Etc. (Wilsonville, OR) or M. Talmor (Yale University, New Haven, CT) with materials from Glen Research (Sterling, VA).
  • the psoralen is incorporated in the oligonucleotide synthesis as a psoralen phosphoramidite, resulting in an oligonucleotide linked at its 5' end via a two carbon linker arm to 4'-hydroxymethyl- 4,5',8-trimethylpsoralen, as illustrated in Fig. 3.
  • sequences of oligonucleotides used in this study include AGIO (5 ⁇ GGAAGGGGG3', Sequence ID No. 1) and GA10 (5'GGGGGAAGGA3 ⁇ Sequence ID No. 2).
  • SV40 shuttle vector pSP189 was constracted by and obtained from Dr. Michael Seidman (Otsuka Pharmaceuticals, Bethesda, MD). Triplex binding assays. Binding assays were carried out for 2 hours at 37°C in 10% sucrose, 20 mM MgCl 2 , 10 mM Tris (pH 8.0), and 1 mM spermidine in a 10 ⁇ l volume.
  • the 250 bp supF target was generated from lambda supF using the polymerase chain reaction.
  • Loading buffer was added and samples were heated 10 minutes at 55 °C, and run for 1 hour on a 4.5% Nusieve gel in TAE buffer at 80 v (10 v/cm). An analysis by agarose gel electrophoresis of Hin ⁇ I digestions of the 250 bp supF gene PCR fragment under various conditions was performed.
  • a faint band corresponding to a size of 150 kDa was present in Lane 1, which contained no psoralen-AGlO and no UVA; a band corresponding to a size of 150 kDa was present in lane 2, containing UVA alone (no psoralen- AGIO); a band corresponding to a size of 150 kDa was present in lane 3, psoralen- AGIO and UVA; a band corresponding to a size of 150 kDa was present in lane 4, psoralen-AGlO alone (no UVA); a band corresponding to a size of approximately 300 kDa was present in lane 5, undigested supF PCR fragment; lane 6 contained the size markers (100 bp ladder) and bands were present at 100, 200 and 300 kDa.
  • the DNA was fixed to the filters by UV crosslinking, and the filters were incubated in 6X SSC, 5X Denhardt's solution, 0.5% SDS, and 5 x 10 5 cpm ml of 32 P-labeled oligonucleotides at 42°C for 18 hours.
  • the filters were washed in IX SSC and 0.1 % SDS for 30 minutes at 25 °C and then in IX SSC and 0.1% SDS at 42 °C for 2 hours. These conditions were empirically determined to allow discrimination between binding of the wild type probe (5' GGT TCG AAT CCT TCC CCC 3', Sequence ID No. 3) and the 167 mutant probe (5' GGT TCG AAA CCT TCC CCC 3', Sequence ID No. 4). Binding of the oligonucleotide probes was determined by autoradiography.
  • SV40 mutagenesis The SV40 vector DNA (pSP189) at 80 nM was incubated with psoralen- AGIO or psoralen-GAlO (ranging from 2 to 1000- fold molar excess) and irradiated as described above.
  • the oligonucleotide-plasmid complex was then transfected into monkey COS-7 cells (ATCC #1651-CRL) using cationic liposomes (DOTAP, Boehringer Mannheim, Indianapolis, IN) at a final concentration of 5 ⁇ g/ml in the culture dish.
  • DOTAP cationic liposomes
  • Boehringer Mannheim Indianapolis, IN
  • SV40 vector DNA was harvested from the COS cells by the Hirt lysate procedure. Genetic analysis of the supF genes in the SV40 vector was carried out by transformation of EL coli SY204 [/ ⁇ cZ125(Am)] to ampicillin resistance by electroporation using 12-150 ng o ⁇ Dpn I digested Hirt lysate DNA and a Bio-Rad Gene Pulser apparatus equipped with a Pulse Controller (Bio-Rad, Richmond, CA). Mutants were identified by growth in the presence of 65 ⁇ g/ml IPTG and 80 ⁇ g/ml X-Gal, as described by (Glazer et al., Mol. Cell Biol. 7:218-224 (1987)). These transformants were counted and the mutants (white colonies) were streaked for single colonies.
  • DNA sequencing was prepared for sequencing by isolating DNA from a 3 ml bacterial culture using a Promega Magic Miniprep kit (Promega, Madison, WI). DNA sequence data was obtained by direct chain termination sequencing of the plasmid DNA using automated methods. RESULTS
  • An SV40-based shuttle vector (pS189) was used to assay for targeted mutagenesis.
  • This vector contains both the SV40 and the pBR328 origins of replication, plus the jS-lactamase gene for ampicillin resistance, to allow episomal replication in both mammalian cells and bacteria (Fig. 3). It also carries the supF gene, an amber suppressor tyrosine tRNA gene of E. coli. as a marker gene for mutagenesis studies.
  • the SV40 DNA after appropriate treatment, is introduced into monkey COS cells where repair and replication can occur, producing mutations indicative of mammalian processing of DNA damage.
  • the small, circular vector DNA is recovered from the cells by biochemical separation from the chromosomal DNA (Hirt lysate, Hirt et al., J. Mol. Biol. 26:365-369 (1967)), and it is used to transform E. coli carrying the lacZ (amber) mutation to allow analysis of supF gene function by scoring colonies for -galactosidase activity (produced via suppression of the amber mutation in lacZ) in the presence of the chromogenic substrate, X-gal.
  • Vectors with wild type supF genes yield blue colonies; those with mutations in supF produce white ones.
  • the viral DNA is digested before bacterial transformation with the enzyme Dpn I which will restrict DNA that has not been methylated by the mammalian pattern at its recognition site.
  • SV40 DNA is illustrated in Fig. 3.
  • a 10 base pair region of the supF gene (bp 167-176) was identified as a site amenable to triplex formation because of the homopurine/homopyrimidine ran there. Since this ran was G-rich, the purine motif for triplex formation was selected (Beal and Dervan, Science 251:1360-1363 (1991)), and an oligonucleotide,
  • Sequence ID No. 1 (AGIO) was synthesized based on this motif.
  • a psoralen derivative 4'-hydroxymethyl-4,5',8- trimethylpsoralen, was attached to the oligonucleotide by a phosphodiester linkage at the 5' adenine via a two carbon linker arm, with the goal of directing mutations to base pair 167. This is the base pair with which that 5' adenine binds in the predicted triple helix.
  • the psoralen- AGIO oligonucleotide is oriented anti-parallel to the purine-rich strand in the duplex DNA.
  • the pSP189 DNA is incubated with the psoralen-linked oligonucleotide (psoralen- AGIO), treated with long wave ultraviolet light (UVA) to activate the psoralen to form a pre-mutagenic adduct on the thymidine in base pair 167, and then transfected into COS-7 cells.
  • UVA long wave ultraviolet light
  • the viral DNA is isolated from the monkey cells, subjected to digestion with Dpn I, and used to transform E. coli. The frequency of supF mutations is determined, and representative samples of supF mutant clones are collected for further analysis. Site-specific formation of triplex DNA.
  • the SV40 vector containing the supF target gene (50 nM) was incubated with psoralen- AGIO at ratios of oligomer to vector of from 1:1 to 1000:1, irradiated with 1.8 J/cm 2 of UVA, digested with Hin ⁇ I, and run on a 4.5% Nusieve gel.
  • Lane 1 undigested plasmid DNA; lane 2, no psoralen- AGIO prior to digestion; lanes 3-7, increasing ratios of psoralen- AG10/SV40 DNA as indicated above each lane; lane 8, 100 bp size markers (BRL-Gibco).
  • Targeted mutagenesis of SV40 vector DNA passaged in COS cells Experiments to induce targeted mutagenesis in SV40-vector DNA using triplex-forming oligonucleotides were carried out as shown in Fig. 3. Psoralen-linked oligonucleotides were incubated with SV40 vector DNA, exposed to 1.8 J/m 2 UVA light, and transfected into COS cells. After two days to allow repair and replication to occur, the vector DNA was rescued from the cells and used to transform bacteria to facilitate genetic analysis of the supF gene.
  • psoralen-GAlO produced a small amount of mutagenesis above background (0.5% versus 0.07%).
  • the reverse oligomer yielded no significant mutagenesis above the background frequency in the assay, whereas, at these lower ratios, psoralen-AGlO still generated a high frequency of mutations in supF (as high as 6.4% for the 10:1 ratio versus 0.06% for psoralen-GAlO at 10:1 and 0.07% for untreated vector DNA).
  • This demonstrates mutagenesis specifically targeted to the supF gene in the SV40 vector by psoralen- AG10 but not by psoralen-GAlO.
  • the psoralen molecule tethered to the oligonucleotide by a 2-carbon linker arm, has sufficient reach and degrees of freedom to form adducts at nearby base pairs. Improved mutational specificity may be achieved by reducing the length of the linker arm.
  • Fig. 5B the published sequences of supF mutations produced in this same vector system using free 8-methoxypsoralen are presented for comparison. Not only are these mutations more scattered, but also none were found to occur at base pair 167. In the analysis of mutagenesis in SV40 vectors, it is often difficult to determine if identical mutations arose independently or if they were the result of a single mutational event amplified by subsequent vector replication.
  • the lack of binding to the wild type probe suggests that they either have different mutations at bp 167 (not T:A to A:T) or have mutations near bp 167, within the 18 bp region covered by the probes, causing mismatches with both the wild type and mutant oligonucleotides.
  • a total of 42 mutants generated by psoralen- AGIO were analyzed by this method (including the 20 subject to sequence analysis), and 22 (52%) were found to carry the T:A to A:T mutation at bp 167. All of the rest were judged to have different mutations at or near the targeted base pair, because neither the mutant nor wild type probe hybridized to them.
  • UVA alone n.a. 0.06 5 / 8,427
  • the results also provide a preliminary analysis of both the time dependence and the concentration dependence of the oligonucleotide-directed targeting within mammalian cells.
  • Materials and Methods Oligonucleotides and vectors. Psoralen-linked oligonucleotides were obtained from Oligos Etc. (WilsonviUe, OR). The psoralen was incorporated into the oligonucleotide synthesis as a psoralen phosphoramidite, resulting in an oligonucleotide linked at its 5' end via a two-carbon linker arm to 4'-hydroxymethyl-4',5'.8-trimethylpsoralen, as illustrated in Fig. 6. The sequences of psoralen-conjugated oligonucleotides used in this experiment include: AGIO 5' AGGAAGGGGG 3', Sequence ID No. 1
  • AGT43 5' AGGAAGGGGGGGGTGGTGGGGGAGGGGG
  • AGGGGGAGGGGGAGG 3', Sequence ID No. 7 SV40 shuttle vectors, pSupFGla and pSupFG2 were derivatives of pSP189 (described above) and carried new triplex-binding sites which were engineered into the supF gene.
  • the modified supF genes were constracted by inserting synthetic oligonucleotides into the Xhol to Eagl sites in the original supF gene using standard techniques as described by Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, second edition, Cold Spring Harbor Laboratory Press, New York (1990) (which is incorporated by reference herein).
  • Two complementary 57-mers which contain the sequence corresponding to bp 157 to 213 of supFGla were Triplex binding assays.
  • Two complementary 57-mers which contain the sequence corresponding to bp 157 to 213 of supFGla were synthesized. Both oligomers were labeled with y-[ 32 P]-ATP.
  • the duplex DNA was prepared by mixing both 57-mers at a ratio of 1 : 1 in TE buffer and incubating at 37°C for two hours.
  • duplex DNA (1 x 10- 10 M) was incubated with increasing concentrations of the psoralen-linked oligomers in 10 ⁇ l of 10 mM Tris (pH 7.4), 1 mM spermidine, and 20 mM MgCl 2 at 37°C for two hours.
  • UVA irradiation (1.8 J/cm 2 of broad band UV light centered at 365 nm, irradiance of 5 mW/cm 2 ) was used to generate photoadducts and thereby covalently link the oligomers to their targets.
  • the samples were mixed with 90 ⁇ l of formamide, and 20 ⁇ l of each sample was analyzed on an 8% polyacrylamide denaturing gel containing SDS and 7 M urea.
  • a phosphor-imager (Molecular Dynamics, Sunnyvale, CA) was used for quantitation of the reaction products.
  • the COS cells at 70% confluence were washed with PBS-EDTA, treated with trypsin and incubated at 37 °C for five minutes.
  • the cells were resuspended in DMEM/10%FCS and were washed three times by centrifugation at 900 rpm for five minutes (4°C) using a Sorvall RT6000D centrifuge.
  • the cells were resuspended at 1 x 10 7 cells/ml.
  • the plasmid DNAs were added at 3 ⁇ g DNA/10 6 cells and the cell/DNA mixtures were left on ice for 10 minutes.
  • Transfection of the cells was performed by electroporation using a Bio-Rad gene pulser at a setting of 25 ⁇ F/250 W/250 V in the 0.4 cm cuvette. Following electroporation, the cells were kept on ice for 10 minutes. The cells were diluted with growth medium, washed, and transferred to 37 °C for 30 minutes. At this point, the cells were either further diluted and exposed to the oligonucleotides in growth medium or washed, diluted further, and allowed to attach to dishes for twelve hours, washed again with PBS/EDTA, trypsinized, washed three times with growth medium, and finally exposed to the oligonucleotides in suspension.
  • the psoralen-conjugated oligonucleotides were added to cells in suspension, which were then incubated at 37 °C with gentle agitation every fifteen minutes. UVA irradiation was given at a dose of 1.8 J/cm 2 at the indicated times. The cells were further diluted in growth medium and allowed to attach to plastic dishes at a density of 1 x 10 6 cells per 15 cm 2 dish.
  • the cells were harvested for vector DNA isolation using a modified alkaline lysis procedure.
  • the cells were resuspended in 100 ⁇ l of cell resuspension solution (50 mM Tris/HCl, 10 mM EDTA, pH 8.0; 100 ⁇ g/ml RNase A) and 100 ⁇ l of cell lysis solution (0.2 M NaOH, 1 % SDS) was added.
  • 100 ⁇ l of neutralization solution (3 M potassium acetate, pH 5.5) was added.
  • a fifteen minute room temperature incubation was followed by centrifugation in a microcentrifuge for ten minutes.
  • the clear supernatant was extracted with an equal volume of phenol/chloroform (1:1) once, and the DNA was precipitated with 2.5 volumes of ethanol at -70°C for ten minutes.
  • the DNA was collected by centrifugation for ten minutes, washed with 70% ethanol once, and allowed to air dry for five minutes at room temperature.
  • the DNA was digested with Dpn I and RNase A at 37 °C for two hours, extracted with phenol/chloroform, and precipitated with ethanol.
  • the DNA pellet was dissolved in 10 ⁇ l of TE buffer (10 mM Tris, 1 mM EDTA, pH 8.0) and 1 ⁇ l of vector DNA was used to transform E. coli SY204 or MBM7070 by electroporation. The transformed E.
  • coli cells were plated onto LB plates containing 50 ⁇ g/ml of ampicillin, 100 ⁇ g/ml of X-gal, and 1 M of IPTG and were incubated at 37 °C overmght. The mutant colonies and the total colonies were counted. The mutant colonies were purified and the plasmids were isolated for DNA sequence analysis. DNA sequencing. The single colonies of purified mutants were picked into 5 ml of L broth containing ampicillin (50 ⁇ g/ml) and were incubated at 37 °C for 16-20 hours by shaking at 250 rpm. Cells from 3 milliliters of culture were collected by centrifugation.
  • Plasmid DNA Isolation of plasmid DNA was accomplished using the Wizard plasmid miniprep DNA purification system (Promega, Madison, WI). 1.5 ⁇ g of plasmid DNA was used for DNA sequencing using an ABI cycle-sequencing kit in accordance with the manufacturer's instructions (Applied Biosystems Inc., Foster City, CA) using standard methods. The sequencing primer was chosen to bind to the ⁇ -lactamase gene just upstream of the supF gene in the vector. Results.
  • Mutagenesis assay The design of the assay system used to study targeted mutagenesis of an SV40 vector in vivo in Monkey COS cells is shown in Fig. 6.
  • the SV40 shuttle vector contains the supF gene, a suppressor tRNA gene of E. coli, as the target gene for mutagenesis. It also contains a portion of the pBR327 replication origin and ⁇ -lactamase gene for growth and selection in bacteria.
  • the cells were incubated in the presence of the psoralen-linked oligonucleotides, which are designed to bind to supF gene sequences such that the psoralen is delivered to the intended intercalation site at bp 166-167.
  • the cells were irradiated with UVA to activate the psoralen to form photoadducts and consequently mutations at the targeted site in the supF gene. Another 48 hours were allowed for repair and/or replication.
  • the vector DNA was harvested from the cells by an alkaline lysis procedure and used to transform lacZ (amber) E.
  • novel supF genes Based on this result and based on the reported binding constants for oligonucleotides of various lengths, a modified supF gene containing a 30 base pair polypurine/polypyrimidine segment amenable to triplex formation was constracted because it was believed that the binding affinity for triple helix formation by the 10-mer (pso-AGlO) might be insufficient to achieve significant interactions in vivo. Novel gene sequences were incorporated into the supF gene to test a series of potential triplex forming oligonucleotides using bp 166-167 as the targeted psoralen intercalation site. Assay systems were developed to allow the characterization of factors affecting in vivo triplex formation and to examine the possibility of intracellular mutation targeting.
  • the pSP189 vector contains a 93 bp segment encompassing the sequences coding for the mature tRNA between unique Xhol and EagI sites. Using synthetic oligonucleotides, this 93 bp stretch was replaced with novel sequences.
  • the design of a new supF gene, supFGla, is illustrated in Fig. 7. To eliminate one interruption at bp 167 in the polypurine/polypyrimidine run, an A:T to C:G transversion was incorporated into the synthetic fragment, along with a compensatory T:A to G:C change at bp 101 to maintain base pairing in the amino acid acceptor stem of the mature tRNA.
  • a 12 bp polypurine/polypyrimidine sequence was inserted between bp 183 and 184 to extend the length of the polypurine/polypyrimidine ran in the gene to 30 bp. Since the 5' CCA sequence at positions 181-183 comprises the 3' terminal amino acid acceptor site of the tRNA, the new sequences 3' to position 183 do not affect the mature tRNA molecule and so do not alter the phenotype of the gene. Following annealing and legation of the synthetic oligonucleotides into the vector, constructs containing functional suppressor genes were identified by transformation of lacZ (amber) bacteria. The sequence of the new supFGla gene was confirmed by direct DNA sequencing of the vector DNA. The new construct contained a 30 bp polypurine site with just two interruptions. By a similar method, supFGl was also constructed, containing a 43 bp polypurine site, also with just two interruptions, as shown in Fig. 8.
  • Corresponding oligonucleotides pso-AGlO, pso-AGT30, and pso-AGT43 were designed to bind in the anti-parallel motif to the 10, 30, and 43 bp sites in these genes.
  • Pso-AGT20 designed to bind to bp 167-186 in supFGla, was also tested. Fixed concentrations of radioactively labelled duplex target DNA were incubated with increasing concentrations of the psoralen-linked oligomers to assay for triplex formation over a range of concentrations.
  • UVA irradiation (1.8 J/cm2) was used to generate photoadducts and thereby covalently link the mutagenic oligonucleotides to their targets, ensuring that subsequent manipulation of the samples would not alter the apparent binding.
  • the samples were then analyzed by denaturing gel electrophoresis and autoradiography.
  • the percentage of the sample constituting the sum of the XL and MA bands is proportionate to the extent of triple helix formation.
  • no XL or MA bands are visualized (not shown), and so adducts can be taken as indicative of triplex formation.
  • concentration of the triplex-forming oligonucleotide is increased, the proportion of the target duplex bound as either MA or XL, as opposed to unbound, increases.
  • concentration dependence of triplex formation by pso-AGlO and by pso-AGT30 are quite different.
  • a useful measure of triple helix formation is the equilibrium dissociation constant, K,., which can be estimated as the concentration of mutagenic oligonucleotide at which triplex formation is half-maximal.
  • K the equilibrium dissociation constant
  • the Kj is 8 x 10- 7 M
  • the K, is 3 x 10- 9 M, a 270-fold difference.
  • the greater affinity for triplex-formation by pso-AGT30 is consistent with the results of other studies correlating oligonucleotide length and binding affinity, and it places the affinity of pso-AGT30 for binding to supFGla in the range of physiologic interactions. Similar analyses revealed a K,j of 1 x 10 ° M for pso-AGT43 binding to supFG2 and 8 x 10-9 M for pso-AGT20 binding to supFGla.
  • oligomers differed in length and binding affinity for triplex formation as shown in Table 3 below.
  • the oligomers were added to the cells approximately one hour following electroporation with the vector DNA. The cells were then irradiated with UVA either two hours or eight hours after oligonucleotide addition.
  • the psoralen-linked oligonucleotides can enter cells, form a site-specific triple helix, and mediate targeted mutagenesis of an SV40 vector at frequencies in the range of 5%.
  • the oligonucleotide concentration used was 2 ⁇ M for all time points.
  • Concentration dependence The concentration dependence for targeted mutagenesis was also investigated. The results are shown in Table 5 below. Following electroporation of the COS cells with the SV40 vector DNA, the cells were incubated in the presence of pso-AGT30 at concentrations from 0.1 nM to 2 ⁇ M. UVA irradiation was given eight hours later. As can be seen, a low but detectable frequency of mutagenesis was observed with the extracellular oligonucleotide concentration in the nanomolar range. This is consistent with the K,j for triplex formation for pso-AGT30 and supFGla being 3 x 10- 9 M.
  • the values represent the frequency of mutations induced at the oligonucleotide concentrations listed with UVA irradiation given eight hours after oligonucleotide addition to the cells.
  • the specificity of the mutagenic oligonucleotide-mediated targeted mutagenesis may be influenced by several factors, one of which is the existence of alternate sites in the DNA having partial homology for triplex formation by the psoralen-conjugated mutagenic oligonucleotide. This issue was examined by comparing targeted mutagenesis of the supFGla and supFGl genes by pso-AGT43. Pso-AGT43 is designed to form a triple helix at base pairs 167-209 of supFGl.
  • pso-AGT43 In the anti-parallel motif, it matches exactly the 43 bp site in supFGl except for the two T interruptions at base pairs 180 and 183 (95% homology). In contrast, pso-AGT43 has only 65% homology for triplex formation with supFGla. The first 30 nucleotides in pso-AGT43 match exactly those in pso- AGT30, and so pso-AGT43 has 28 out of 43 nucleotide homology for triplex formation with supFGla (taking into account the unavoidable mismatches at 180 and 183).
  • the tethered psoralen in pso-AGT43 is targeted to intercalate at base pairs 166-167.
  • pso-AGT30 in targeting both the supFGla gene (to which it is designed to form triplex) and the original supF gene (to which it has only 10 out of 30 nucleotide homology for triplex formation) was made.
  • the electroporated COS cells were incubated in 2 ⁇ M concentrations of the mutagenic oligonucleotide for two hours before UVA irradiation was given.
  • Pso-AGT43 effectively targeted mutations to supFGla as shown below in Table 6.
  • pso-AGT43 failed to induce mutations in the supFGla gene above the background frequency, suggesting that the partial homology for triplex formation with supFGla is insufficient to mediate significant in vivo interactions.
  • pso-AGT30 can target mutations to supFGla, but it is not effective in inducing mutations in the unmodified supF.
  • the frequency of targeted mutations induced by pso-AGT43 in supFGl was not higher than that seen with pso-AGT30 and supFGla, in contrast to the increase observed in going from pso-AGlO to pso-AGT20 to pso-AGT-30 (Table 3). It is possible that the 43 nucleotide long G-rich oligonucleotide (pso-AGT43) may be subject to K + -driven self-association to form G-quartets, limiting its effectiveness within the cells.
  • the values represent the fraction of base matches in the anti-parallel triple helix motif (G for G:C bp and either A or T for A:T bp) between the listed oligonucleotide and the designated target gene.
  • the values represent the frequency of induced mutations observed using oligonucleotide concentrations of 2 ⁇ M and with UVA irradiation given two hours after oligonucleotide addition to the cells.
  • Sequence analysis of the mutations targeted by pso-AGT30 revealed a high specificity for T:A to A:T transversions at the predicted psoralen intercalation site (bp 166).
  • the results of the time course experiment indicate that the processes of oligonucleotide entry into cells and of intracellular formation of triple helices occur over several hours.
  • the increased frequency of mutations seen at the later time points may, in part, reflect the time needed for these processes as well as the interplay of repair and replication in forming the targeted DNA lesions into mutations.
  • NAME Pabst, Patrea L.
  • GTAAAAGCAT TACCTGTGGT GGGGTTCCCG AGCGGCCAAAGGGAGCAGAC TCTAAATCTG 60

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Saccharide Compounds (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne un oligonucléotide mutagène formant un triplex et ses procédés d'utilisation. L'oligonucléotide est chimiquement modifié afin de contenir un mutagène incorporé et forme une molécule d'acide nucléique à trois brins avec un segment spécifique d'ADN d'une molécule cible d'ADN. Lorsque le triplex est formé, le mutagène est rapproché de la molécule cible et provoque une mutation sur un site spécifique de celle-ci. La mutation active, désactive ou modifie l'activité et la fonction de la molécule cible.
PCT/US1996/008883 1995-06-06 1996-06-04 Oligonucleotide chimiquement modifie pour mutagenese dirigee sur site WO1996039195A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU60432/96A AU6043296A (en) 1995-06-06 1996-06-04 Chemically modified oligonucleotide for site-directed mutage nesis

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US46351995A 1995-06-06 1995-06-06
US463,519 1995-06-06

Publications (2)

Publication Number Publication Date
WO1996039195A2 true WO1996039195A2 (fr) 1996-12-12
WO1996039195A3 WO1996039195A3 (fr) 1997-01-30

Family

ID=23840376

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1996/008883 WO1996039195A2 (fr) 1995-06-06 1996-06-04 Oligonucleotide chimiquement modifie pour mutagenese dirigee sur site

Country Status (2)

Country Link
AU (1) AU6043296A (fr)
WO (1) WO1996039195A2 (fr)

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6136601A (en) * 1991-08-21 2000-10-24 Epoch Pharmaceuticals, Inc. Targeted mutagenesis in living cells using modified oligonucleotides
WO2017143061A1 (fr) 2016-02-16 2017-08-24 Yale University Compositions et procédés pour le traitement de la mucoviscidose
WO2017143042A2 (fr) 2016-02-16 2017-08-24 Yale University Compositions permettant d'améliorer l'édition ciblée de gènes et leurs procédés d'utilisation
WO2018187493A1 (fr) 2017-04-04 2018-10-11 Yale University Compositions et procédés d'administration in utero
WO2020033951A1 (fr) 2018-08-10 2020-02-13 Yale University Compositions et procédés d'édition de gène embryonnaire in vitro
WO2020047353A1 (fr) 2018-08-31 2020-03-05 Yale University Compositions et procédés pour améliorer l'édition de gènes à base de triplex et de nucléase
WO2020112195A1 (fr) 2018-11-30 2020-06-04 Yale University Compositions, technologies et procédés d'utilisation de plérixafor pour améliorer l'édition de gènes
WO2020257776A1 (fr) 2019-06-21 2020-12-24 Yale University Compositions d'acides nucléiques peptidiques ayant des segments de liaison de type hoogsteen modifiés et leurs procédés d'utilisation
WO2020257779A1 (fr) 2019-06-21 2020-12-24 Yale University Compositions pna à gamma-hydroxyméthyle modifiée et leurs procédés d'utilisation
WO2021050568A1 (fr) 2019-09-09 2021-03-18 Yale University Nanoparticules pour absorption sélective de tissu ou cellulaire
US11896686B2 (en) 2014-05-09 2024-02-13 Yale University Hyperbranched polyglycerol-coated particles and methods of making and using thereof
US11918695B2 (en) 2014-05-09 2024-03-05 Yale University Topical formulation of hyperbranched polymer-coated particles

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0253193A2 (fr) * 1986-07-08 1988-01-20 Abbott Laboratories Méthode de mutagénèse par réparation dirigée à l'aide d'oligonucléotides d'une rupture de brin
US5354670A (en) * 1991-12-24 1994-10-11 The President And Fellows Of Harvard College Site-directed mutagenesis of DNA
WO1995001364A1 (fr) * 1993-06-25 1995-01-12 Yale University Oligonucleotide modifie chimiquement en vue d'une mutagenese dirigee vers le site

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0253193A2 (fr) * 1986-07-08 1988-01-20 Abbott Laboratories Méthode de mutagénèse par réparation dirigée à l'aide d'oligonucléotides d'une rupture de brin
US5354670A (en) * 1991-12-24 1994-10-11 The President And Fellows Of Harvard College Site-directed mutagenesis of DNA
WO1995001364A1 (fr) * 1993-06-25 1995-01-12 Yale University Oligonucleotide modifie chimiquement en vue d'une mutagenese dirigee vers le site

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
JOURNAL OF VIROLOGY 67 (12). 1993. 7324-7331. ISSN: 0022-538X, XP002018570 HAVRE P A ET AL: "Targeted mutagenesis of simian virus 40 DNA mediated by a triple helix-forming oligonucleotide." *
MOLECULAR AND CELLULAR BIOLOGY 15 (3). 1995. 1759-1768. ISSN: 0270-7306, XP002018567 WANG G ET AL: "Targeted mutagenesis in mammalian cells mediated by intracellular triple helix formation." *
NUCLEIC ACIDS RESEARCH 22 (14). 1994. 2845-2852. ISSN: 0305-1048, XP002018568 GASPARRO F P ET AL: "Site-specific targeting of psoralen photoadducts with a triple helix-forming oligonucleotide: Characterization of psoralen monoadduct and crosslink formation." *
PROC NATL ACAD SCI U S A, APR 2 1996, 93 (7) P2941-6, UNITED STATES, XP002018566 RAHA M ET AL: "Mutagenesis by third-strand-directed psoralen adducts in repair-deficient human cells: high frequency and altered spectrum in a xeroderma pigmentosum variant." *
PROC NATL ACAD SCI U S A, AUG 15 1993, 90 (16) P7879-83, UNITED STATES, XP002018569 HAVRE PA ET AL: "Targeted mutagenesis of DNA using triple helix-forming oligonucleotides linked to psoralen." *

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6136601A (en) * 1991-08-21 2000-10-24 Epoch Pharmaceuticals, Inc. Targeted mutagenesis in living cells using modified oligonucleotides
US11918695B2 (en) 2014-05-09 2024-03-05 Yale University Topical formulation of hyperbranched polymer-coated particles
US11896686B2 (en) 2014-05-09 2024-02-13 Yale University Hyperbranched polyglycerol-coated particles and methods of making and using thereof
US11136597B2 (en) 2016-02-16 2021-10-05 Yale University Compositions for enhancing targeted gene editing and methods of use thereof
WO2017143061A1 (fr) 2016-02-16 2017-08-24 Yale University Compositions et procédés pour le traitement de la mucoviscidose
WO2017143042A2 (fr) 2016-02-16 2017-08-24 Yale University Compositions permettant d'améliorer l'édition ciblée de gènes et leurs procédés d'utilisation
WO2018187493A1 (fr) 2017-04-04 2018-10-11 Yale University Compositions et procédés d'administration in utero
WO2020033951A1 (fr) 2018-08-10 2020-02-13 Yale University Compositions et procédés d'édition de gène embryonnaire in vitro
WO2020047353A1 (fr) 2018-08-31 2020-03-05 Yale University Compositions et procédés pour améliorer l'édition de gènes à base de triplex et de nucléase
WO2020112195A1 (fr) 2018-11-30 2020-06-04 Yale University Compositions, technologies et procédés d'utilisation de plérixafor pour améliorer l'édition de gènes
WO2020257779A1 (fr) 2019-06-21 2020-12-24 Yale University Compositions pna à gamma-hydroxyméthyle modifiée et leurs procédés d'utilisation
WO2020257776A1 (fr) 2019-06-21 2020-12-24 Yale University Compositions d'acides nucléiques peptidiques ayant des segments de liaison de type hoogsteen modifiés et leurs procédés d'utilisation
WO2021050568A1 (fr) 2019-09-09 2021-03-18 Yale University Nanoparticules pour absorption sélective de tissu ou cellulaire

Also Published As

Publication number Publication date
WO1996039195A3 (fr) 1997-01-30
AU6043296A (en) 1996-12-24

Similar Documents

Publication Publication Date Title
EP0705270B1 (fr) Oligonucleotide modifie chimiquement en vue d'une mutagenese dirigee vers le site
US5776744A (en) Methods and compositions for effecting homologous recombination
US5962426A (en) Triple-helix forming oligonucleotides for targeted mutagenesis
Faruqi et al. Recombination induced by triple-helix-targeted DNA damage in mammalian cells
Wang et al. Targeted mutagenesis in mammalian cells mediated by intracellular triple helix formation
JP4063326B2 (ja) 非天然ヌクレオチドを有するキメラ突然変異性ベクター
Yoon et al. Targeted gene correction of episomal DNA in mammalian cells mediated by a chimeric RNA. DNA oligonucleotide.
WO1996039195A2 (fr) Oligonucleotide chimiquement modifie pour mutagenese dirigee sur site
US20020156261A1 (en) Oligonucleotides containing an antisense sequence stabilized by a secondary structure, pharmaceutical compositions containing them and method of blocking gene expression using them
US7279463B2 (en) Triple-helix forming oligonucleotides for targeted mutagenesis
US20030148352A1 (en) Intracellular generation of single-stranded DNA
US7112405B2 (en) Compositions and methods for enhancing oligonucleotide-mediated gene alteration
US6936418B2 (en) Methods and compositions for effecting homologous recombination
Gunther et al. Triplex‐mediated, in vitro targeting of psoralen photoadducts within the genome of a transgenic mouse
Song et al. Activation of gene expression by triplex-directed psoralen crosslinks
Collier Antigene Nucleic Acids—Inhibition of Gene Expression via Triple Helix Formation

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AL AM AU BB BG BR CA CN CZ EE FI GE HU IL IS JP KG KP KR LK LR LT LV MD MG MK MN MX NO NZ PL RO SG SI SK TR TT UA UZ VN AM AZ BY KG KZ MD RU TJ TM

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): KE LS MW SD SZ UG AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

AK Designated states

Kind code of ref document: A3

Designated state(s): AL AM AU BB BG BR CA CN CZ EE FI GE HU IL IS JP KG KP KR LK LR LT LV MD MG MK MN MX NO NZ PL RO SG SI SK TR TT UA UZ VN AM AZ BY KG KZ MD RU TJ TM

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): KE LS MW SD SZ UG AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: CA