WO1996026280A1 - NOVEL CYSTEINE PROTEASE RELATED TO INTERLEUKIN-1β CONVERTING ENZYME - Google Patents

Abstract

A novel human cysteine protease (referred to as Ich-2 or Bih-3) related to interleukin-1β converting enzyme (ICE) but having an amino acid sequence that differs by 47 % from that of ICE is disclosed. The Ich-2 protein of the invention exhibits proteolytic activity and can induce apoptosis in cells. The invention provides isolated nucleic acid molecules encoding Ich-2 (including proteolytic cleavage products, subunits, fusion proteins and non-naturally occurring homologs thereof), as well as recombinant expression vectors containing these nucleic acid molecules, host cells into which the expression vectors have been introduced and non-human transgenic animals carrying an Ich-2-encoding nucleic acid. The invention further provides isolated Ich-2 proteins (including proteolytic cleavage products, subunits, fusion proteins and non-naturally occurring homologs thereof), as well as anti-Ich-2 antibodies. The invention still further provides methods for identifying modulators of Ich-2 protease activity (e.g., inhibitors and activators) and methods for modulating apoptisis in cells.

Description

NOVEL CYSTEINE PROTEASE RELATED TO INTERLEUKIN-lβ CONVERTING ENZYME

Background of the Invention

Interleukin-l β converting enzyme (ICE) is a cytoplasmic cysteine protease required for generating the bioactive form of the interleukin-l β cytokine from its inactive precursor (Black, R.A. et al. (1988) J. Biol. Chem. 261:9437-9442; Kostura, M.J. et al. (1989) Proc. Natl. Acad. Sci. USA ££-5227-5231). ICE cleaves prointerleukin-l β at Aspj jg-Alaj 17 and Asp27-Gly28 (Black, supra; Kostura, supra). The substrate specificity of ICE is dependent upon aspartic acid at the PI position (Kostura, supra; Howard, A. et al. (1991) J. Immunol. 142:2964-2969; Sleath, P.R. et al. (1990) J. Biol. Chem. 2_ά: 14526-14528).

ICE itself undergoes maturational processing, possibly performed by ICE itself (Thornberry, N. A. et al. (1992) Nature 3_5_6_: 768-774). Mature ICE is generated from a 404 amino acid precursor protein by proteolytic removal of two fragments, the N-terminal 1 19 amino acid "pro-domain" and the internal residues 298-316 (Thornberry, supra). Active ICE is therefore composed of two subunits, a 20 kDa subunit (p20) encompassing residues 120 to 297 and a 10 kDa subunit (plO) encompassing residues 317 to 404. The crystal structure of ICE indicates that ICE forms a tetrameric structure consisting of two p20 and two plO subunits (Walker, N.P.C. et al. (1994), Cell 2&:343-352; Wilson, K.P. et al. (1994) Nature 370:270-275V The catalytic amino acid residues of ICE are Cys-285 and His-237. The side chains of four amino acid residues (Arg-179, Gln-283, Arg-341 and Ser-347) form the PI carboxylate binding pocket (Walker, supra; Wilson, supra).

Cysteine proteases related to ICE have been described. For example, a mouse gene, Nedd2, encodes a protein that exhibits 29 % amino acid identity to ICE (Kumar, S. et al.

(1992) Biochem. Biophys. Res. Commun. ___.:\ 155-1161 ; Kumar, S. et al. (1994) Genes Dev _: 1613-1626). Nedd2 was identified based upon its developmental ly down-regulated expression in the brain. The human Nedd2 gene has also been identified and termed Ich-1 (Wang, L. et al. (1994) Cell 7_£:739-750). Ich-1 displays 27 % amino acid identity to ICE. Another human gene has been isolated that encodes a protein related to ICE. This protein. termed CPP32, exhibits 30 % amino acid identity to ICE (Femandes-Alnemri, T. et al. (1994) J. Biol. Chem. 269:30761-30764). A Caenorhabditis elegans gene, ced-3. also encodes a protein related to ICE. The ced-3 protein exhibits 29 % amino acid identity to ICE (Yuan. J et al. (1993) Cell 7_5_:641-652). The ced-3 gene was identified by a genetic screen for mutations in the pathway of programmed cell death in C. elegans, thereby implicating ced-3 in apoptosis. Overexpression of ced-3, ICE, Nedd-2, or Ich-1 in mammalian cells and CPP32 in an insect cell line has been shown to result in the induction of apoptosis (Miura, M. et al.

(1993) Cell 75:653-660; Kumar, S. et al. (1994) , supra; Wang, L. et al. (1994). supra; Fernandes-Alnemri, T. et al. (1994), supra). Summary of the Invention

This invention pertains to a novel cysteine protease termed Ich-2 (also referred to as Bih-3). Although homologous to ICE, the amino acid sequence of Ich-2 differs by 47% from the amino acid sequence of ICE (i.e., there is 53% amino acid identity between the amino acid sequences of Ich-2 and ICE over the entire length of the proteins). Similar to ICE, the Ich-2 protein is processed to a mature form consisting of subunits of approximately 20 kDa (p20) and 10 kDa (plO). The mature Ich-2 protein exhibits proteolytic activity that shares some properties with that of ICE but also has distinct features, including some differences in substrate specificity. In particular, Ich-2 displays proteolytic activity against poly(ADP- ribose) polymerase (PARP), a protein involved in apoptosis. Thus, modulators of Ich-2 activity may be useful for modulating apoptosis in cells.

The invention provides isolated nucleic acid molecules (e.g., DNA or RNA) encoding Ich-2 proteins (including proteolytic cleavage products, subunits, homologs and fusion proteins thereof). In preferred embodiments, the nucleic acid molecule has a nucleotide sequence shown in SEQ ID NO: 1 (or a coding region thereof) or encodes a protein having an amino acid sequence shown in SEQ ID NO: 2. In other embodiments, the nucleic acid molecule encodes a p20 or plO subunit of Ich-2, or encodes an Ich-2 fragment encompassing the p20 and plO subunits that can be proteolytically processed to individual p20 and plO subunits. For example, a nucleic acid encoding the p20 subunit of Ich-2 can comprise a nucleotide sequence of about positions 378 to 875 of the nucleotide sequence shown in SEQ ID NO: 1 or can encode about positions 105 to 270 of the amino acid sequence shown in SEQ ID NO: 2. A nucleic acid molecule encoding the plO subunit of Ich-2 can comprise a nucleotide sequence of about positions 933 to 1196 of the nucleotide sequence shown in SEQ ID NO: 1 or can encode about positions 290 to 377 of the amino acid sequence shown in SEQ ID NO: 2. Alternatively, a nucleic acid molecule encompassing the p20- and plO-coding regions can comprise a nucleotide sequence of about positions 378 to 1196 of the nucleotide sequence shown in SEQ ID NO: 1 or can encode about positions 105 to 377 of the amino acid sequence of SEQ ID NO: 2. Another aspect of the invention pertains to nucleic acid molecules encoding non- naturally occurring homologs of the Ich-2. These homologs are at least 70 %, more preferably at least 80 % and even more preferably at least 90 % identical to the amino acid sequence shown in SEQ ID NO: 2, include conserved amino acid residues necessary for the proteolytic activity of the protein (e.g., the histidine at position 210, the cysteine at position 258, the arginine at position 152, the glutamine at position 256, the arginine at position 314 and the serine at position 320 of SEQ ID NO: 2), and retain proteolytic activity.

The invention further provides recombinant expression vectors containing the nucleic acid molecules of the invention and host cells into which such recombinant expression vectors have been introduced. These host cells can be used to express Ich-2 proteins. In one embodiment, the host cell is an oocyte or embryonic cell that can be used to create non- human transgenic animals having cells containing an Ich-2 -encoding nucleic acid. In one embodiment, the non-human transgenic animal has cells in which a gene corresponding to the non-human homolog of the Ich-2 gene has been functionally disrupted by homologous recombination.

Yet another aspect of the invention pertains to isolated Ich-2 proteins (including proteolytic fragments, subunits, fusion proteins and homologs thereof). In a preferred embodiment, the protein has an amino acid sequence shown in SEQ ID NO: 2. Alternatively, the protein can be a p20 subunit of Ich-2 (e.g., having an amino acid sequence of about positions 105 and 270 of SEQ ID NO: 2) or a pi 0 subunit of Ich-2 (e.g., having an amino acid sequence of about positions 290 to 377 of SEQ ID NO: 2). Moreover, the protein can be a fragment of Ich-2 that contains both the p20 and plO subunits which can be processed into the mature p20 and plO subunits (e.g., the fragment can have an amino acid sequence of about positions 105 to 377 of SEQ ID NO: 2). Furthermore, the invention also provides a mature, proteolytically active Ich-2 protein composition comprising at least one p20 subunit (e.g., about amino acid residues 105-270) and at least one plO subunit (e.g., about amino acid residues 290-377).

Fusion proteins of Ich-2 are also provided by the invention. A preferred Ich-2 fusion protein comprises a polyhistidine sequence. Moreover, non-naturally occurring homolog of the Ich-2 protein are encompassed by the invention. These homologs have an amino acid sequence that is at least 70 %, more preferably at least 80 % and even more preferably at least 90 % identical to the amino acid sequence shown in SEQ ID NO: 2, include amino acid residues necessary for the proteolytic activity of the protein and have proteolytic activity. Antibodies that bind the Ich-2 proteins of the invention (e.g., monoclonal antibodies) are also within the scope of the invention. Yet another aspect of the invention pertains to methods for identifying modulators (e.g., inhibitors or activators) of Ich-2 protease activity. In a preferred embodiment, the method involves contacting a mature form of the Ich-2 protein (i.e., a form of the Ich-2 protein that exhibits proteolytic activity) with a substrate for the protein in the presence of a test agent under proteolytic conditions and determining the amount of proteolytic activity of the protein in the presence of the test agent. A decrease in the amount of proteolytic activity in the presence of the test agent (relative to the amount of proteolytic activity in the absence of the test agent) indicates that the test agent is an Ich-2 inhibitor. In contrast, an increase in the amount of proteolytic activity in the presence of the test agent (relative to the amount of proteolytic activity in the absence of the test agent) indicates that the test agent is an activator of Ich-2 protease activity.

Ich-2 modulators (e.g., activators or inhibitors) are useful for modulating apoptosis in cells. The invention further provides a method for modulating apoptosis in cells by contacting the cell with an agent that modulate Ich-2 activity in the cells. The agent can either stimulate or inhibit lch-2 activity to thereby stimulate or inhibit apoptosis, respectively. For example, to stimulate Ich-2 activity, an Ich-2-encoding nucleic acid may be introduced into cells or an Ich-2 activator can be contacted with the cells to stimulate the activity of endogenous Ich-2. Alternatively, to inhibit Ich-2 activity, an Ich-2 inhibitor can be contacted with the cells to inhibit the activity of endogenous Ich-2.

Brief Description of the Drawings

Figure 7 is a comparison of the amino acid sequences of murine ICE (murice)(SEQ ID NO: 5), rat ICE (SEQ ID NO: 6), and human ICE (hICE) (SEQ ID NO: 4), Ich-2 (Bih-3) (SEQ ID NO: 2), Ich-1 (SEQ ID NO: 7) and CPP32 (SEQ ID NO: 8). The catalytic cysteine and histidine residues are indicated by an asterisk. The four amino acid residues whose side chains form the PI pocket are indicated by a black dot.

Figure 2 is a photograph of a Northern hybridization filter probed with an Ich-2 specific probe, depicting the tissue expression pattern of Ich-2 in adult human tissues. Figure 3 is a bar graph depicting the proteolytic hydrolysis of the chromogenic peptide substrate Ac-YVAD-pNA by N-His Ich-2 protein.

Figure 4 is a bar graph depicting the inhibition of the proteolytic activity of N-His Ich-2 or N-His ICE by Ac-YVAD-CHO at 10 μM (1), 1 μM (2), 100 nM (3), 10 nM (4) or 1 nM (5), iodoacetamide at 10 mM (6), 1 mM (7) or 100 μM (8) or E64 at 100 μM (9). Figure 5 is a graph depicting the substrate cleavage curves of N-His Ich-2 and N-His

ICE fit to the Michaelis-Menten equation.

Figure 6 is a scanning image printout of an SDS-PAGE gel of the poly(ADP-ribose) polymerase (PARP) cleavage products generated upon incubation of PARP with Ich-2 (Bih-3) or ICE for increasing lengths of time.

Detailed Description of the Invention

This invention pertains to a novel human cysteine protease related to interleukin-1 β converting enzyme (ICE). The protease of the invention is referred to herein as Ich-2 or Bih-3. A cDNA encoding Ich-2 was originally isolated from a thymus cDNA library using a human ICE cDNA as a probe under non-standard, very low stringency hybridizations conditions (see Example 1). The nucleotide sequence of the Ich-2 cDNA, and the predicted amino acid sequence of the Ich-2 protein, are shown in SEQ ID NOs: 1 and 2, respectively. Ich-2 shares certain structural features with ICE but its amino acid sequence differs by 47 % from that of ICE. Like ICE, Ich-2 is processed to two subunits of about 20 kDa (p20) and 10 kDa (plO). Based on homology with the proteolytic cleavage sites that generate the p20 and plO subunits of ICE, the p20 and plO subunits of Ich-2 are predicted to be generated by cleavage after Aspl04, Asp 270 and Asp289 of SEQ ID NO: 2, thereby producing a p20 subunit encompassing residues 105-270 of SEQ ID NO: 2 and a plO subunit encompassing residues 290 to 377 of SEQ ID NO: 2. While the Ich-2 shares some enzymatic properties with ICE (e.g., both are cysteine proteases), Ich-2 exhibits differences in substrate specificity compared to ICE. In particular, Ich-2 can cleave poly(ADP-ribose) polymerase (PARP), a substrate involved in apoptosis, whereas ICE cannot. Moreover, overexpression of Ich-2 in cells induces apoptosis. Thus, apoptosis in cells may be modulated by modulating Ich-2 activity in the cells.

Various aspects of the invention are described in further detail in the following subsections:

I. Isolated Nucleic Acid Molecules One aspect of the invention pertains to isolated nucleic acid molecules that encode

Ich-2. The nucleic acid molecule can be a DNA molecule (e.g., cDNA or genomic DNA) or an RNA molecule. An "isolated" nucleic acid molecule is free of sequences which naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, the isolated Ich-2 nucleic acid molecule may contain less than about 5 kb, 4kb, 3kb, 2kb, 1 kb, 0.5 kb or 0.1 kb of nucleotide sequences which naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived (e.g., a human cell). Moreover, an "isolated" nucleic acid molecule, such as a cDNA molecule, may be free of other cellular material. In a preferred embodiment, an isolated nucleic acid molecule of the invention comprises a nucleotide sequence shown in SEQ ID NO: 1. Alternatively, the nucleic acid molecule may comprise only the coding region of SEQ ID NO: 1 (e.g., nucleotides 66-1 196). Moreover, the nucleic acid molecule of the invention can comprise a portion of the nucleotide sequence of SEQ ID NO: 1 , for example a portion encoding a proteolytic fragment of Ich-2. Preferred portions of Ich-2 are the p20 or plO subunits or Ich-2. or a portion encoding a polypeptide fragment that can be processed into individual Ich-2 subunits (i.e., a portion encoding a polypeptide fragment encompassing p20 and pi 0 that can be processed into separate p20 and plO subunits). Preferably, a p20-encoding portion comprises about nucleotides 378 to 875 of SEQ ID NO: 1 and a plO-encoding portion comprises about nucleotides 933 to 1 196 of SEQ ID NO: 1. Alternatively, a preferred portion encoding both p20 and pi 0 comprises about nucleotides 378 to 1 196 of SEQ ID NO: 1.

The invention further encompasses nucleic acid molecules that differ from SEQ ID NO: l (and portions thereof) due to degeneracy of the genetic code and thus encode the same Ich-2 protein as that encoded by SEQ ID NO: 1. Accordingly, in another embodiment, an isolated nucleic acid molecule of the invention has a nucleotide sequence encoding a protein having an amino acid sequence shown in SEQ ID NO: 2. Alternatively, the isolated nucleic acid molecule may encode a portion of the amino acid sequence shown in SEQ ID NO: 2, such as a proteolytic fragment of the protein of SEQ ID NO: 2. Preferred proteolytic fragments are the p20 and plO subunit of Ich-2. For example, the nucleic acid molecule may encode about amino acid positions 105 to 270 of SEQ ID NO: 2 (p20) or about amino acid positions 290 to 377 of SEQ ID NO: 2 (plO). In yet another embodiment, the nucleic acid molecule encodes a polypeptide fragment encompassing both the p20 and plO subunits that can be processed to individual p20 and plO subunits. For example, the nucleic acid molecule can encode about amino acid positions 105 to 377 of SEQ ID NO: 2.

Alternatively, the nucleic acids of the invention can encode other proteolytic fragments of Ich-2 that are generated by cleavage of Ich-2 after other aspartic acid residue (i.e., cleavage at a site with aspartic acid at the PI position). Preferred cleavage sites are after those aspartic acid residues that are conserved between Ich-2 and ICE, which are the aspartic acid residues at positions 147, 158, 174, 184, 202, 227, 248, 270, 289 and 299 of SEQ ID NO: 2. Additional possible cleavage sites are after the aspartic acid residues at positions 20, 27, 47, 59, 80, 104, 156, 170, 222, 232 and 315 of SEQ ID NO: 2. Preferably, the proteolytic cleavage product of Ich-2 is at least 10 amino acids in length, and more preferably is at least 20, 30, 40, 50, 60, 70, 80 or 90 amino acids in length. Additionally, it will be appreciated by those skilled in the art that DNA sequence polymorphisms that lead to changes in the amino acid sequences of Ich-2 may exist within a population (e.g., the human population). Such genetic polymorphism in the Ich-2 gene may exist among individuals within a population due to natural allelic variation. Such natural allelic variations can typically result in 1-5 % variance in the nucleotide sequence of the a gene. Any and all such nucleotide variations and resulting amino acid polymorphisms in Ich- 2 that are the result of natural allelic variation and that do not alter the functional activity of Ich-2 are intended to be within the scope of the invention. Moreover, nucleic acid molecules encoding Ich-2 proteins may be isolated from other species, based on their homology to the Ich-2 nucleic acid disclosed herein. Accordingly, in another embodiment, the Ich-2-encoding nucleic acid molecule of the invention comprises a nucleotide sequence at least 70% identical to that of SEQ ID NO: 1, more preferably at least 80%, 90% or 95% identical to the nucleotide sequence of SEQ ID NO: 1. Additionally, in yet another embodiment, an Ich-2 nucleic acid molecule hybridizes under high stringency hybridization conditions to the nucleic acid molecule of SEQ ID NO: 1. As used herein, the term "high stringency hybridization conditions" is intended to describe conditions under which nucleotide sequences at least 70% and more preferably, at least 80 %, 90% or 95%, typically hybridize to each other. Such high stringency conditions are known to those skilled in the art and can be found in Current Protocols in Molecular Biology, John Wiley & Sons. N.Y. (1989), 6.3.1 - 6.3.6. A preferred, non-limiting example of high stringency hybridization conditions are hybridization in 6X sodium chloride/sodium citrate (SSC) at about 45°C, followed by a washes in 0.2X SSC at 50-65°C.

An Ich-2-encoding nucleic acid of the invention can be isolated from a cDNA library using a human ICE cDNA as a probe and the low-stringency hybridization conditions described in Example 1. More preferably, in view of the disclosure herein of the nucleotide sequence encoding Ich-2 (SEQ ID NO: 1), a nucleic acid of the invention can be isolated using standard molecular biology techniques, such as the polymerase chain reaction (PCR). For example, mRNA can be isolated from cells (e.g., by the guanidinium-thiocyanate extraction procedure of Chirgwin et al. (1979) Biochemistry 18: 5294-5299) and cDNA can be prepared using reverse transcriptase (e.g., Moloney MLV reverse transcriptase, available from Gibco/BRL, Bethesda, MD; or AMV reverse transcriptase, available from Seikagaku America, Inc., St. Petersburg, FL). Synthetic oligonucleotide primers can be designed based upon the nucleotide sequence shown in SEQ ID NO: 1 for use in PCR to thereby amplify Ich- 2 cDNA, or a portion thereof (e.g., see Example 3). A nucleic acid of the invention can be amplified from cDNA (or, alternatively, genomic DNA) using such oligonucleotide primers and standard PCR amplification techniques. The nucleic acid so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis. Alternatively, a probe comprising the nucleotide sequence of SEQ ID NO: 1, or a portion thereof, can be used to screen a cDNA or genomic DNA library to thereby isolate Ich-2-encoding clones using standard library screening techniques. Furthermore, oligonucleotides of the Ich-2 sequence can be prepared by standard synthetic techniques, e.g., using an automated DNA synthesizer. Yet another aspect of the invention pertains to an isolated nucleic acid molecule that encodes a non-naturally occurring homolog of Ich-2. The amino acid sequence of such a homolog differs from that shown in SEQ ID NO: 2 at one or more amino acid residues but includes those amino acid residues that are essential for proteolytic activity of Ich-2. Thus, the homolog retains proteolytic activity. Essential amino acid residues that are conserved in the homolog include the catalytic histidine and cysteine residues (His-210 and Cys-258 of SEQ ID NO: 2) and the four amino acid residues whose side chains form the PI carboxylate binding pocket (Arg-152, Glu-256, Arg-314 and Ser-320 of SEQ ID NO: 2). Along the rest of the homolog, in one embodiment the amino acid sequence is at least about 70 % identical to that of SEQ ID NO: 2. More preferably, the amino acid sequence is at least about 80 % identical to that of SEQ ID NO: 2. Even more preferably, the amino acid sequence is at least about 90 % identical to that of SEQ ID NO: 2. To determine the percent identity of a homolog's amino acid sequence to that of SEQ ID NO: 2, the sequences are aligned for optimal comparison purposes (e.g., gaps may be introduced in the sequence of one protein for optimal alignment with the other protein). The amino acid residues at corresponding amino acid positions are then compared. When a position in one sequence (e.g.. the homolog) is occupied by the same amino acid residue as the corresponding position in the other sequence (e.g., Ich-2), then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity = # of identical positions/total # of positions x 100).

A nucleic acid molecule encoding an Ich-2 homolog of the invention can be made by mutating an Ich-2-encoding nucleic acid molecule (i.e., preferably having the nucleotide sequence of SEQ ID NO: 1) at one or more nucleotide bases comprising a codon(s) of a non- essential amino acid residue(s) of the Ich-2 protein. A "non-essential" amino acid residue is a residue that can be altered from the wild-type sequence of Ich-2 (i.e., the sequence of SEQ ID NO: 2) without altering the proteolytic activity of Ich-2, whereas an "essential" amino acid residue is required for proteolytic activity (e.g., the catalytic His and Cys and the four amino acids of the PI pocket are considered "essential" amino acid residues). Certain amino acid residues of Ich-2 are predicted to be essential based upon comparison of the Ich-2 sequence to other members of the ICE family of cysteine proteases (see Figure 1 for an alignment of the amino acid sequences of ICE family members). Thus, amino acid residues that are conserved (i.e., identical) between Ich-2 and other ICE family members are predicted to be essential and thus may not be amenable to alteration. Other amino acid residues (e.g., those that are not conserved or only semi-conserved among members of the ICE family of proteases) may not be essential for proteolytic activity and thus may be amenable to alteration to thereby create an Ich-2 homolog of the invention.

Accordingly, in one embodiment, an Ich-2 homolog of the invention is created by introducing one or more mutations into an Ich-2-encoding nucleic acid within a codon(s) encoding a predicted non-essential amino acid residue(s), expressing the mutated Ich-2 protein recombinantly as described below in Section II and testing the mutated Ich-2 protein for proteolytic activity. Mutations can be introduced into an Ich-2-encoding nucleic acid by standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis. Preferably, conservative amino acid substitutions are made at one or more predicted non- essential amino acid residues. A "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, a predicted nonessential amino acid residue in Ich-2 is preferably replaced with another amino acid residue from the same side chain family. Alternatively, in another embodiment, mutations can be introduced randomly along all or part of an Ich-2 coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for proteolytic activity to identify mutants that retain proteolytic activity (discussed further below). In yet another embodiment, an Ich-2 homolog of the invention comprises at least one plO or p20 subunit from another ICE cysteine protease family member (e.g., from ICE, Nedd- 2, ced-3, Ich-1 or CPP32). That is, Ich-2 hetero-oligomers can be prepared in which at least one plO or p20 subunit is substituted with a pi 0 or p20 subunit from another ICE cysteine protease family member. Such Ich-2 hetero-oligomers may be prepared by recombinantly expressing an Ich-2 plO subunit with a p20 subunit from a different ICE family member, or an Ich-2 p20 subunit with a plO subunit from a different ICE family member, in the same host cell or by mixing different plO and p20 subunits together in vitro. The proteolytic activity of these Ich-2 hetero-oligomers can be tested in in vitro protease assays as described further below, both to map regions of the pi 0 and/or p20 subunits involved in substrate specificity and to identify Ich-2 hetero-oligomers that retain the proteolytic activity of Ich-2.

Suitable assays for testing the proteolytic activity of mutated Ich-2 proteins (i.e., Ich-2 homologs) are described in detail in Example 4. Briefly, a mutated Ich-2 protein is incubated with a suitable peptide substrate for the wild-type Ich-2 protein, such as the chromogenic peptide substrate Acetyl-Tyr-Val-Ala- Asp-p-nitroanilide, under proteolytic conditions (as described in Example 4) and the hydrolysis of the peptide substrate is measured, e.g., by the change in absorbence at 405 nm of the samples. The proteolytic activity of a mutated Ich-2 protein is compared to that of a wild-type Ich-2 protein to determine whether mutation of the protein alters the proteolytic activity of the protein.

II. Recombinant Expression Vectors and Host Cells

Another aspect of the invention pertains to vectors, preferably expression vectors, containing a nucleic acid encoding Ich-2 (or a portion, subunit or homolog thereof). As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of preferred vector is an episome, i.e., a nucleic acid capable of extra-chromosomal replication. Preferred vectors are those capable of autonomous replication and/or expression of nucleic acids to which they are linked. Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as "expression vectors". In general, expression vectors of utility in recombinant DNA techniques are often in the form of "plasmids" which refer to circular double stranded DNA loops which, in their vector form are not bound to the chromosome. In the present specification, "plasmid" and "vector" are used interchangeably as the plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses), which serve equivalent functions.

The recombinant expression vectors of the invention comprise a nucleic acid of the invention in a form "suitable for expression of the nucleic acid in a host cell", which means that the recombinant expression vectors includes one or more regulatory sequences, selected on the basis of the host cells to be used for expression, which is operatively linked to the nucleic acid. "Operably linked" is intended to mean that the nucleotide sequence is linked to the regulatory sequence(s) in a manner which allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell). The term "regulatory sequence" is intended to includes promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). Regulatory sequences include those which direct constitutive expression of a nucleotide sequence in many types of host cell and those which direct expression of the nucleotide sequence only in certain host cells (e.g., tissue -specific regulatory sequences). It will be appreciated by those skilled in the art that the design of the expression vector may depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, etc. The expression vectors of the invention can be introduced into host cells to thereby produce proteins or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein (e.g., Ich-2 proteins, fusion proteins, Ich-2 subunits etc.).

The recombinant expression vectors of the invention can be designed for expression of Ich-2 in prokaryotic or eukaryotic cells. For example, Ich-2 can be expressed in bacterial cells such as E. coli, insect cells (using baculovirus expression vectors) yeast cells or mammalian cells. Suitable host cells are discussed further in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). Alternatively, the recombinant expression vector may be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase (e.g., see Example 3)- Expression of proteins in prokaryotes is most often carried out in E. coli with vectors containing constitutive or inducible promotors directing the expression of either fusion or non-fusion proteins. Fusion vectors add a number of amino acids to a protein encoded therein, usually to the amino terminus of the recombinant protein. Such fusion vectors typically serve three purposes: 1) to increase expression of recombinant protein; 2) to increase the solubility of the recombinant protein; and 3) to aid in the purification of the recombinant protein by acting as a ligand in affinity purification. Often, in fusion expression vectors, a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protein to enable separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein. Such enzymes, and their cognate recognition sequences, include Factor Xa, thrombin and enterokinase. Typical fusion expression vectors include pGEX (Amrad Corp., Melbourne, Australia), pMAL (New England Biolabs, Beverly, MA) and pRIT5 (Pharmacia, Piscataway, NJ) which fuse glutathione S-transferase, maltose E binding protein, or protein A, respectively, to the target recombinant protein. Preferably, an Ich-2-coding sequence (e.g., encoding amino acid residues 105-337) is cloned into an expression vector (e.g., an E. coli expression vector) that fuses a polyhistidine sequence (e.g., six histidine residues) to the N-terminus of the Ich-2 coding sequence (see Example 3). The polyhistidine fusion moiety allows for purification of the Ich-2 protein on a nickel chelating column. Polyhistidine fusion expression vectors are commercially available (e.g., from Novagen). Examples of suitable inducible non-fusion E coli expression vectors include pTrc (A ann el aL- (1988) Gene 6^:301-315) and pET 1 Id (Studier ej aL Gene Expression Technology: Methods in Enzymology 185. Academic Press, San Diego, California (1990) 60- 89). Target gene expression from the pTrc vector relies on host RNA polymerase transcription from a hybrid trp-lac fusion promoter. Target gene expression from the pET 1 Id vector relies on transcription from a T7 gnlO-lac fusion promoter mediated by a coexpressed viral RNA polymerase (T7 gnl). This viral polymerase is supplied by host strains BL21(DE3) or HMS174(DE3) from a resident λ prophage harboring a T7 gnl gene under the transcriptional control of the lacUV 5 promoter. One strategy to maximize recombinant protein expression in E. coli is to express the protein in a host bacteria with an impaired capacity to proteolytically cleave the recombinant protein (Gottesman, S., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California (1990) 119-128). Another strategy is to alter the nucleic acid sequence of the nucleic acid to be inserted into an expression vector so that the individual codons for each amino acid are those preferentially utilized in E. coli (Wada et al., (1992) Nuc. Acids Res. 20:2111-21 18). Such alteration of nucleic acid sequences of the invention can be carried out by standard DNA synthesis techniques.

In another embodiment, the Ich-2 expression vector is a yeast expression vector. Examples of vectors for expression in yeast S. cerivisae include pYepSecl (Baldari. et al., (1987) Embo J. 6:229-234), pMFa (Kurjan and Herskowitz, (1982) Cell 30:933-943), pJRY88 (Schultz et al., (1987) Gene 54:113-123), and pYES2 (Invitrogen Corporation, San Diego, CA). In a preferred embodiment, Ich-2 is expressed in the methylotrophic yeast Hansenula polymorpha using an expression vector such as pMPT121, pFPMT121 or pRB (see e.g., Gellissen, G. et al. (1991) Bio/Technology 2:291-295; and European Patent 0 173 378 B 1 ). In these vectors, expression of a nucleic acid introduced into the vector is under the control of the MOX alcohol oxidase promoter (pMPT121) or the formate dehydrogenase promoter (pFPMTl 21 and pRB).

Alternatively, Ich-2 can be expressed in insect cells using baculovirus expression vectors. Baculovirus vectors available for expression of proteins in cultured insect cells (e.g., Sf 9 cells) include the pAc series (Smith et al., (1983) Mol. Cell Biol. 3:2156-2165) and the pVL series (Lucklow, V.A., and Summers, M.D., (1989) Virology 170:31-39).

In yet another embodiment, a nucleic acid of the invention is expressed in mammalian cells using a mammalian expression vector. Examples of mammalian expression vectors include pCDM8 (Seed, B., (1987) Nature 329:840) and pMT2PC (Kaufman et al. (1987), EMBO J. 6: 187-195). When used in mammalian cells, the expression vector's control functions are often provided by viral regulatory elements. For example, commonly used promoters are derived from polyoma, Adenovirus 2, cytomegalovirus and Simian Virus 40. In another embodiment, the recombinant mammalian expression vector is capable of directing expression of the nucleic acid preferentially in a particular cell type (e.g., tissue- specific regulatory elements are used to express the nucleic acid). Tissue-specific regulatory elements are known in the art. Non-limiting examples of suitable tissue-specific promoters include the albumin promoter (liver-specific; Pinkert et al. (1987) Genes Dev. 1:268-277), lymphoid-specific promoters (Calame and Eaton (1988) Adv. Immunol. 41:235-275), in particular promoters of T cell receptors (Winoto and Baltimore (1989) EMBO J. _: 729-733) and immunoglobulins (Banerji et al. (1983) Cell 11:729-740; Queen and Baltimore (1983) Cell 11:741-748), neuron-specific promoters (e.g., the neurofilament promoter; Byrne and Ruddle (1989) Proc. Natl. Acad. Sci. USA S&5473-5477), pancreas-specific promoters (Edlund et al. (1985) Science 21^:912-916), and mammary gland-specific promoters (e.g., milk whey promoter; U.S. Patent No. 4,873,316 and European Application Publication No. 264,166). Developmentally-regulated promoters are also encompassed, for example the murine hox promoters (Kessel and Gruss (1990) Science 249:374-379) and the α-fetoprotein promoter (Campes and Tilghman (1989) Genes Dev. 1:537-546).

The invention further provides a recombinant expression vector comprising a DNA molecule of the invention cloned into the expression vector in an antisense orientation. That is, the DNA molecule is operatively linked to a regulatory sequence in a manner which allows for expression (by transcription of the DNA molecule) of an RNA molecule which is antisense to the coding region of the nucleotide sequence shown in SEQ ID NO: 1. An "antisense" nucleic acid comprises a nucleotide sequence which is complementary to a "sense" nucleic acid, e.g., complementary to an mRNA sequence encoding a protein, constructed according to the rules of Watson and Crick base pairing. Accordingly, an antisense nucleic acid can hydrogen bond to a sense nucleic acid. For example, the antisense sequence complementary to a sequence of an mRNA can be complementary to a sequence found in the coding region of the mRNA or can be complementary to a 5 ' or 3' untranslated region of the mRNA. The binding of an antisense nucleic acid molecule to an mRNA molecule results in inhibition of translation of the mRNA molecule, thereby inhibiting production of the protein encoded by the mRNA molecule. Regulatory sequences operatively linked to a nucleic acid cloned in the antisense orientation can be chosen which direct the continuous expression of the antisense RNA molecule in a variety of cell types, for instance a viral promoter and/or enhancer, or regulatory sequences can be chosen which direct tissue or cell type specific expression of antisense RNA.

An antisense nucleic acid of the invention can be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art. The antisense nucleic acid (e.g., an antisense oligonucleotide) can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of th molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used. Alternatively, the antisense nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest), as described above. The antisense expression vector, for example, can be in the form of a recombinant plasmid, phagemid or attenuated virus in which antisense nucleic acids are produced under the control of a high efficiency regulatory region, the activity of which can be determined by the cell type into which the vector is introduced. For a discussion of the regulation of gene expression using antisense genes see Weintraub, H. et al., Antisense RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986.

In another embodiment, an antisense nucleic acid of the invention is a ribozyme. Ribozymes are catalytic RNA molecules with ribonuclease activity which are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region. A ribozyme having specificity for an Ich-2 nucleic acid can be designed based upon the nucleotide sequence of an Ich-2 cDNA disclosed herein (i.e., SEQ ID NO: 1). For example, a derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the base sequence of the active site is complementary to the base sequence to be cleaved in an Ich-2-encoding mRNA. See for example Cech et al. U.S. Patent No. 4,987,071 ; and Cech et al. U.S. Patent No. 5,116,742. Alternatively, an Ich-2 nucleic acid of the invention could be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules. See for example Bartel, D. and Szostak, J.W. (1993) Science 261 : 1411-1418.

Another aspect of the invention pertains to recombinant host cells into which a recombinant expression vector of the invention has been introduced. The terms "host cell" and "recombinant host cell" are used interchangeably herein. It is understood that such terms refer not only to the particular subject cell but to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.

A host cell may be any prokaryotic or eukaryotic cell. For example, an Ich-2 protein may be expressed in bacterial cells such as E. coli, insect cells, yeast or mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells). Other suitable host cells are known to those skilled in the art.

Vector DNA is introduced into prokaryotic or eucaryotic cells via conventional transformation or transfection techniques. As used herein, the terms "transformation" and "transfection" are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e.g., DNA) into a host cell, including calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, lipofection, or electroporation. Suitable methods for transforming or transfecting host cells can be found in Sambrook el aL {Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press (1989)), and other laboratory textbooks. For stable transfection of mammalian cells, it is known that, depending upon the expression vector and transfection technique used, only a small fraction of cells may integrate the foreign DNA into their genome. In order to identify and select these integrants, a gene that encodes a selectable marker (e.g., resistance to antibiotics) is generally introduced into the host cells along with the gene of interest. Preferred selectable markers include those which confer resistance to drugs, such as G418, hygromycin and methotrexate. Nucleic acid encoding a selectable marker may be introduced into a host cell on the same vector (e.g., plasmid) as that encoding Ich-2 or may be introduced on a separate vector (e.g., plasmid). Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells that have incorporated the selectable marker gene will survive, while the other cells die).

In one embodiment, a host cell of the invention is a fertilized oocyte or an embryonic stem cell into which Ich-2-coding sequences have been introduced. Such host cells can then be used to create non-human transgenic animals carrying Ich-2-coding nucleic acid in their genome. As used herein, a "transgenic animal" is a non-human animal, preferably a mammal, more preferably a mouse, in which one or more of the cells of the animal includes a transgene. A transgene is exogenous DNA which is integrated into the genome of a cell from which a transgenic animal develops and which remains in the genome of the mature animal, thereby directing the expression of an encoded gene product in one or more cell types or tissues of the transgenic animal.

In one embodiment, a transgenic animal is created by introducing Ich-2 nucleic acid into the male pronuclei of a fertilized oocyte, e.g., by microinjection, and allowing the oocyte to develop in a pseudopregnant female foster animal. Intronic sequences and polyadenylation signals can also be included in the transgene to increase the efficiency of expression of the transgene. A tissue-specific regulatory sequence(s) can be operably linked to the Ich-2 transgene to direct expression of Ich-2 to particular cells. Methods for generating transgenic animals via embryo manipulation and microinjection, particularly animals such as mice, have become conventional in the art and are described, for example, in U.S. Patent Nos. 4,736,866 and 4,870,009 and Hogan, B., Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986). Similar methods are used for production of other transgenic animals. A transgenic founder animal can be identified based upon the presence of the Ich-2 transgene in its genome and/or expression of Ich-2 mRNA in tissues or cells of the animals. A transgenic founder animal can be used to breed additional animals carrying the transgene. Moreover, transgenic animals carrying a transgene encoding Ich-2 can further be bred to other transgenic animals carrying other transgenes.

In another embodiment, the transgenic animal has cells in which a gene corresponding to the non-human homolog of the Ich-2 gene has been functionally disrupted by homologous recombination. The term "homologous recombinant animal" as used herein is intended to describe an animal containing an endogenous gene which has been modified by homologous recombination between the endogenous gene and an exogenous DNA molecule introduced into a cell of the animal, e.g., an embryonic cell of the animal, prior to development of the animal. Preferably, the non-human homologous recombinant animal is a mouse.

To create such a homologous recombinant animal, a vector is prepared which contains at least a portion of an Ich-2 gene into which a deletion, addition or substitution has been introduced to thereby functionally disrupted the Ich-2 gene. The Ich-2 gene may be a human gene (e.g., from a human genomic clone isolated from a human genomic library screened with the cDNA of SEQ ID NO: 1) or, more preferably, is a non-human homolog of a human Ich-2 gene. For example, a mouse Ich-2 gene can be isolated from a mouse genomic DNA library using the Ich-2 cDNA of SEQ ID NO: 1 as a probe. In the homologous recombination vector, the functionally disrupted portion of the Ich-2 gene is flanked at its 5' and 3' ends by additional nucleic acid of the Ich-2 gene to allow for homologous recombination to occur between the exogenous Ich-2 gene carried by the vector and an endogenous Ich-2 gene in an embryonic stem cell. The additional flanking Ich-2 nucleic acid is of sufficient length for successful homologous recombination with the endogenous gene. Typically, several kilobases of flanking DNA (both at the 5' and 3' ends) are included in the vector (see e.g., Thomas, K.R. and Capecchi, M. R. (1987) Cell 5J.:503 for a description of homologous recombination vectors). The vector is introduced into an embryonic stem cell line (e.g., by electroporation) and cells in which the introduced Ich-2 gene has homologously recombined with the endogenous Ich-2 gene are selected (see e.g., Li, E. et al. (1992) Cell 62:915). The selected cells are then injected into a blastocyst of an animal (e.g., a mouse) to form aggregation chimeras (see e.g., Bradley, A. in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E.J. Robertson, ed. (IRL, Oxford, 1987) pp. 1 13-152). A chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term. Progeny harboring the homologously recombined DNA in their germ cells can be used to breed animals in which all cells of the animal contain the homologously recombined DNA by germline transmission of the transgene.

III. Isolated Ich-2 Proteins

Another aspect of the invention pertains to isolated Ich-2 proteins (including proteolytic fragments, subunits, fusions proteins and non-naturally occurring homologs thereof). An "isolated" protein is substantially free of cellular material or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized. In a preferred embodiment, an Ich-2 protein has an amino acid sequence shown in SEQ ID NO: 2. Additionally, the invention provides proteolytic fragments of Ich-2, such as Ich-2 p20 and plO subunits. Preferably, the p20 subunit comprises about positions 105 to 270 of the amino acid sequence of SEQ ID NO: 2. Preferably, the plO subunit comprises about positions 290 to 377 of SEQ ID NO: 2. In yet another embodiment, the invention provides an Ich-2 polypeptide fragment encompassing the p20 and plO fragments that can be processed to individual p20 and plO subunits. For example, the Ich-2 polypeptide can comprise about positions 105-377 of SEQ ID NO: 2. This polypeptide fragment lacks the N-terminal "prodomain" (approximately a.a. positions 1- 104) that is absent from the mature Ich-2 protein but includes an internal region

(approximately a.a. positions 271-289) that is removed upon further maturational processing of the polypeptide fragment. In yet another embodiment, the invention provides a mature (i.e., processed), proteolytically active form of Ich-2 comprising at least one p20 subunit and at least one plO subunit. It will be appreciated by those skilled in the art that there is likely to be some flexibility in the N-terminal and C-terminal amino acid boundaries of the p20 and plO subunits (i.e., a few more or a few less amino acid residues at the N-terminal or C-terminal end). The term "about positions to " is intended to indicate this flexibility. The specific amino acid boundaries disclosed herein are identified based upon the predicted natural proteolytic cleavage sites of the full-length Ich-2 protein (e.g., by analogy to the proteolytic cleavage sites that generate the p20 and plO subunits of ICE).

In addition to the p20 and plO subunits of Ich-2, other proteolytic fragments that can be produced by cleavage after other aspartic residues within the full-length Ich-2 protein are provided. Preferred cleavage sites are after those aspartic acid residues that are conserved between Ich-2 and ICE, which are the aspartic acid residues at positions 147, 158, 174, 184, 202, 227, 248, 270, 289 and 299 of SEQ ID NO: 2. Additional possible cleavage sites are after the aspartic acid residues at positions 20, 27, 47, 59, 80, 104, 156, 170, 222, 232 and 315 of SEQ ID NO: 2. Preferably, the proteolytic cleavage product of Ich-2 is at least 10 amino acids in length, and more preferably is at least 20, 30, 40, 50, 60, 70, 80 or 90 amino acids in length.

The Ich-2 proteins, or subunits thereof, are preferably produced by recombinant DNA techniques. For example, a nucleic acid molecule encoding the protein is cloned into an expression vector (as described above), the expression vector is introduced into a host cell (as described above) and the Ich-2 protein is expressed in the host cell. The Ich-2 protein can then be isolated from the cells by an appropriate purification scheme using standard protein purification techniques. A mature, proteolytically processed form of Ich-2 can also be obtained by recombinant expression of Ich-2-encoding nucleic acid in a host cell. For example, an Ich-2 fragment encompassing amino acid residues 105-377, when expressed in E. coli, is processed (either intracellulariy or during protein purification) to a p20/pl0- containing mature, proteolytically active, Ich-2 protein (described further in Examples 3 and 4). Accordingly, the invention provides a protein composition of mature, proteolytically active Ich-2 comprising at least one p20 subunit and at least one plO subunit.

Alternative to recombinant expression, an Ich-2 polypeptide can be synthesized chemically using standard peptide synthesis techniques. Alternatively, a native Ich-2 protein can be isolated from cells (e.g., human cells), for example using an anti-Ich-2 antibody (discussed further below).

Non-naturally occurring Ich-2 homologs are also provided by the invention. These homologs comprise an amino acid sequence that is at least about 70 % identical to that of SEQ ID NO: 2, including the conserved essential amino acid residues His-210, Cys-258, Arg-152, Glu-256, Arg-314 and Ser-320. More preferably, the homolog has an amino acid sequence at least about 80 % identical to that of SEQ ID NO: 2. Even more preferably, the homolog has an amino acid sequence that is at least about 90 % identical to SEQ ID NO: 2. Moreover, the homologs of the invention retain proteolytic activity, preferably proteolytic activity that is indistinguishable from that of the mature Ich-2 protein. A non-naturally occurring Ich-2 homolog can be prepared by mutagenesis of the nucleic acid encoding the homolog (as described above in Section I), produced by recombinant expression of the nucleic acid molecule encoding the homolog in a host cell (as described above in Section II) and the tested for proteolytic activity (as described above in Section I). Other Ich-2 homologs provided by the invention include Ich-2 hetero-oligomers, comprising at least one subunit (plO or p20) from another ICE cysteine protease family member (e.g., ICE, Nedd-2, ced-3, Ich-1 or CPP32). Such Ich-2 hetero-oligomers can be prepared and tested for proteolytic activity as described above in Section I.

The invention still further provides Ich-2 fusion proteins. As used herein, an Ich-2 "fusion protein" comprises an Ich-2 polypeptide fused to a heterologous (i.e., non-Ich-2) polypeptide. The heterologous polypeptide may be fused to the N-terminus or C-terminus of the Ich-2 protein (or subunit thereof). Purification of an Ich-2 protein can be facilitated by the expression of the Ich-2 protein as a fusion protein, wherein the heterologous polypeptide of the fusion protein facilitates purification of the fusion protein. For example, as described in above in Section II, a nucleic acid encoding an Ich-2 protein (or portion or subunit thereof) can be cloned into a prokaryotic expression vector encoding a fusion moiety (i.e., heterologous polypeptide), such that the resultant expression vector encodes a fusion protein comprising the Ich-2 protein and the fusion moiety. Examples of suitable fusion moieties that facilitate protein purification include glutathione S-transferase, maltose E binding protein, protein A and, most preferably, polyhistidine. The polyhistidine sequence of the fusion protein facilitates purification of the fusion protein by affinity chromatography using a Ni2⁺ metal resin. The fusion protein may additionally contain a cleavage site, e.g., for Factor Xa, thrombin or enterokinase, between the fusion moiety (e.g., polyhistidine sequence) and the Ich-2 sequence to allow for removal of the fusion moiety after purification of the fusion protein, if desired. In a preferred embodiment, the Ich-2 fusion protein comprises six histidine residues fused to the N-terminus of an Ich-2 fragment encompassing amino acid residues 105-377 of SEQ ID NO: 2 (N-His Ich-2)(described further in Example 3 and 4).

Preferably, a fusion protein is produced by recombinant expression of a fusion gene encoding the fusion protein. Techniques for making fusion genes are known to those skilled in the art. Essentially, the joining of various DNA fragments coding for different polypeptide sequences is performed in accordance with conventional techniques, for example employing blunt-ended or stagger-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation. In another embodiment, the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and reamplified to generate a chimeric gene sequence (see, for example, Current Protocols in Molecular Biology, eds. Ausubel et al. John Wiley & Sons: 1992). Moreover, many expression vectors are commercially available that already encode a fusion moiety (e.g., polyhistidine sequence, GST sequence, etc.). An Ich-2-encoding nucleic acid can be cloned into such an expression vector such that the fusion moiety is linked in- frame to the Ich-2 protein. An isolated Ich-2 protein, or subunit or fragment thereof, can be used as an immunogen to generate antibodies that bind an Ich-2 protein using standard techniques for polyclonal and monoclonal antibody preparation. Accordingly, anti-Ich-2 antibodies are also encompassed by the invention. The term "antibody" as used herein refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen binding site which specifically binds (immunoreacts with) an antigen, such as Ich-2 The invention provides polyclonal and, more preferably, monoclonal antibodies that bind Ich-2. The term "monoclonal antibody" or "monoclonal antibody composition", as used herein, refers to a population of antibody molecules that contain only one species of an antigen binding site capable of immunoreacting with a particular epitope of Ich-2. A monoclonal antibody composition thus typically displays a single binding affinity for a particular Ich-2 protein with which it immunoreacts. Additionally, recombinant anti-Ich-2 antibodies, such as chimeric and humanized monoclonal antibodies, comprising both human and non-human portions, which can be made using standard recombinant DNA techniques, are within the scope of the invention. An antibody of the invention is typically prepared by immunizing a suitable subject with an appropriate immunogenic preparation of an Ich-2 protein and isolating an antibody that binds the Ich-2 protein. An appropriate immunogenic preparation can contain, for examples, recombinantly expressed Ich-2 protein or a chemically synthesized Ich-2 peptide. The preparation can further include an adjuvant, such as Freund's complete or incomplete adjuvant, or similar immunostimulatory agent. Immunization of a suitable subject (e.g., rabbit, goat, mouse or other mammal, etc.) with an immunogenic Ich-2 preparation induces a polyclonal anti-Ich-2 antibody response. The anti-Ich-2 antibody titer in the immunized subject can be monitored over time by standard techniques, such as with an enzyme linked immunosorbent assay (ELISA) using immobilized Ich-2. If desired, the antibody molecules directed against Ich-2 can be isolated from the mammal (e.g., from the blood) and further purified by well known techniques, such as protein A chromatography to obtain the IgG fraction. At an appropriate time after immunization, e.g., when the anti-Ich-2 antibody titers are highest, antibody-producing cells can be obtained from the subject and used to prepare monoclonal antibodies.

A monoclonal anti-Ich-2 antibody can be prepared and isolated using a technique which provides for the production of antibody molecules by continuous cell lines in culture. These include, but are not limited to, the hybridoma technique originally described by Kohler and Milstein (1975, Nature 256:495-497) (see also, Brown et al. (1981) J. Immunol 127:539- 46; Brown et al. (1980) J Biol Chem 255:4980-83; Yeh et al. (1976) PNAS 76:2927-31; and Yeh et al. (1982) Int. J. Cancer 29:269-75), and the more recent human B cell hybridoma technique (Kozbor et al. (1983) Immunol Today 4:72), EBV-hybridoma technique (Cole et al. (1985), Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96), and trioma techniques. The technology for producing monoclonal antibody hybridomas is well known (see generally R. H. Kenneth, in Monoclonal Antibodies: A New Dimension In

Biological Analyses, Plenum Publishing Corp., New York, New York (1980); E. A. Lerner (1981) Yale J. Biol. Med, 54:387-402; M. L. Gefter et al. (1977) Somatic Cell Genet., 3:231-36). Briefly, an immortal cell line (typically myeloma cells) is fused to lymphocytes (typically splenocytes) from a mammal immunized with an immunogenic preparation of the present invention, as described above, and the culture supematants of the resulting hybridoma cells are screened to identify a hybridoma producing a monoclonal antibody that binds Ich-2. Any of the many well known protocols used for fusing lymphocytes and immortalized cell lines can be applied for the purpose of generating an anti-Ich-2 monoclonal antibody (see, e.g., G. Galfre et al. (1977) Nature 266:55052; Gefter et al. Somatic Cell Genet., cited supra; Lerner, Yale J. Biol. Med., cited supra; Kenneth, Monoclonal Antibodies, cited supra). Moreover, the ordinary skilled worker will appreciate that there are many variations of such methods which also would be useful. Typically, the immortal cell line (e.g., a myeloma cell line) is derived from the same mammalian species as the lymphocytes. For example, murine hybridomas can be made by fusing lymphocytes from a mouse immunized with an immunogenic preparation of the present invention with an immortalized mouse cell line. Preferred immortal cell lines are mouse myeloma cell lines that are sensitive to culture medium containing hypoxanthine, aminopterin and thymidine ("HAT medium"). Any of a number of myeloma cell lines may be used as a fusion partner according to standard techniques, e.g., the P3-NSl/l-Ag4-l, P3-x63-Ag8.653 or Sp2/O-Agl4 myeloma lines. These myeloma lines are available from the American Type Culture Collection (ATCC), Rockville, Md. Typically, HAT-sensitive mouse myeloma cells are fused to mouse splenocytes using polyethylene glycol ("PEG"). Hybridoma cells resulting from the fusion are then selected using HAT medium, which kills unfused and unproductively fused myeloma cells (unfused splenocytes die after several days because they are not transformed). Hybridoma cells producing a monoclonal antibody of the invention are detected by screening the hybridoma culture supematants for antibodies that bind Ich-2, e.g., using a standard ELISA assay.

Alternative to preparing monoclonal antibody-secreting hybridomas, a monoclonal anti-Ich-2 antibody can be identified and isolated by screening a recombinant combinatorial immunoglobulin library (e.g., an antibody phage display library) with an Ich-2 to thereby isolate immunoglobulin library members that bind Ich-2. Kits for generating and screening phage display libraries are commercially available (e.g., the Pharmacia Recombinant Phage Antibody System, Catalog No. 27-9400-01; and the Stratagene SurjZAP™ Phage Display Kit, Catalog No. 240612). Additionally, examples of methods and reagents particularly amenable for use in generating and screening antibody display library can be found in, for example, Ladner et al. U.S. Patent No. 5,223,409; Kang et al. International Publication No. WO 92/18619; Dower et al. International Publication No. WO 91/17271; Winter et al. International Publication WO 92/20791 ; Markland et al. International Publication No. WO 92/15679; Breitling et al. International Publication WO 93/01288; McCafferty et al.

International Publication No. WO 92/01047; Garrard et al. International Publication No. WO 92/09690; Ladner et al. International Publication No. WO 90/02809; Fuchs et al. (1991) Bio/Technology 9:1370-1372; Hay et al. (1992) Hum Antibod Hybridomas 3:81-85; Huse et al. (1989) Science 246:1275-1281; Griffiths et al. (1993) EMBO J 12:725-734; Hawkins et al. (1992) J Mol Biol 226:889-896; Clackson et al. (1991) Nature 352:624-628; Gram et al.

(1992) PNAS 89:3576-3580; Garrad et al. (1991) Bio/Technology 9:1373-1377; Hoogenboom et al. (1991) Nuc Acid Res 19:4133-4137; Barbas et al. (1991) PNAS 88:7978-7982; and McCafferty et al. Nature (1990) 348:552-554.

Chimeric and humanized versions of an anti-Ich-2 monoclonal antibody are also within the scope of the invention. Such chimeric and humanized monoclonal antibodies can be produced by recombinant DNA techniques known in the art, for example using methods described in Robinson et al. International Patent Publication PCT/US86/02269; Akira, et al. European Patent Application 184,187; Taniguchi, M., European Patent Application 171,496; Morrison et al. European Patent Application 173,494; Neuberger et al. PCT Application WO 86/01533; Cabilly et al. U.S. Patent No. 4,816,567; Cabilly et al. European Patent

Application 125,023; Better et al. (1988) Science 24Q: 1041-1043; Liu et al. (1987) PNAS 84:3439-3443; Liu et al. (1987) J. Immunol. 139:3521-3526; Sun et al. (1987) PN4S £4:214- 218; Nishimura et al. (1987) Cane. Res. 42:999-1005; Wood et al. (1985) Nature 314:446- 449; and Shaw et al. (1988) J. Natl Cancer Inst. 80:1553-1559); Morrison, S. L. (1985) Science 222:1202-1207; Oi et al. (1986) BioTechnigues 4:214; Winter U.S. Patent 5,225,539; Jones et al. (1986) Nature 121:552-525; Verhoeyan et al. (1988) Science 212:1534; and Beidler et al. (1988) J. Immunol. 141:4053-4060.

An anti-Ich-2 antibody (e.g., monoclonal antibody) can be used to isolate an Ich-2 protein by standard techniques, such as affinity chromatography or immunoprecipitation. An anti-Ich-2 antibody can facilitate the purification of natural Ich-2 from cells and of recombinantly produced Ich-2 expressed in host cells.

IV. Proteolytic Activity of Ich-2 As described in more detail in Example 4, Ich-2 exhibits proteolytic activity. The proteolytic activity of Ich-2 shares certain properties with that of ICE. For example, both can cleave the chromogenic peptide substrate acetyl-Tyr-Val-Ala-Asp-p-nitroanilide (Ac-YVAD- pNA) and are inhibited by iodoacetamide, a general thiol-reactive compound. Inhibition of Ich-2 by iodoacetamide indicates that Ich-2 is a cysteine protease. Moreover, like ICE, Ich-2 is not inhibited by E64, a protease inhibitor that inhibits many cysteine proteases but not ICE. However, the proteolytic activity of Ich-2 also differs from that of ICE. For example, the peptide inhibitor Acetyl-Tyr-Val-Ala-Asp-CHO (Ac-YVAD-CHO) (Thornberry, N.A. et al. (1992) Nature 3_5 £:768-774) inhibits ICE with an IC50 of ~1 nm, whereas this same peptide inhibitor inhibits Ich-2 with an ICE50 of -1 μM. Thus, Ich-2 is much less sensitive to inhibition by Ac-YVAD-CHO than ICE, suggesting differences in the substrate specificity of the two proteases. In further demonstration of this, Ich-2 can cleave poly(APD-ribose) polymerase (PARP) in vitro, a protein that is cleaved intracellulariy during the early stages of apoptosis. In contrast, ICE has been reported to be unable to cleave PARP (see Lazebnik, Y.A. et al. (1994) Nature 121:346-347)(see also Example 4). Accordingly, Ich-2 is useful as a cysteine protease. For example, Ich-2 can be used to cleave substrate proteins in vitro (e.g., as described in Example 4). Examples of substrate proteins for Ich-2 include PARP and prointerleukin-lβ.

V. Methods of the Invention As described above, Ich-2 can cleave PARP, a protein that is cleaved intracellulariy during the early stages of apoptosis. Moreover, overexpression of Ich-2 in cells can induce apoptosis in the cells (see Example 5). Thus, modulators of Ich-2 activity can be used to modulate apoptosis in cells.

Accordingly, another aspect of the invention pertains to a method for modulating apoptosis in a cell comprising contacting the cell with an agent that modulates activity of Ich- 2 in the cell. In one embodiment, the agent stimulates Ich-2 activity. This agent may be, for example, an Ich-2-encoding nucleic acid. Nucleic acid encoding Ich-2 can be introduced into cells (e.g., by transfection of an Ich-2 cDNA) to stimulate apoptosis in the cells. Thus, a nucleic acid molecule encoding Ich-2 (e.g., cDNA) can be transfected into target cells as a "suicide" gene in situations where it is desirable to stimulate death of the target cells. Ich-2 may be used to stimulate apoptosis in cells for research purposes (e.g., cell ablation studies) and for therapeutic purposes. For example, an Ich-2 nucleic acid can be introduced into diseased cells, such as cancer cells to reduce tumor growth, smooth muscle cells to inhibit restenosis, fibroblasts to inhibit fibrosis and rheumatoid arthritis, synovial cells to inhibit rheumatoid arthritis and T and/or B lymphocytes to inhibit autoimmune diseases such as rheumatoid arthritis, multiple sclerosis and systemic lupus erythematosus. A recombinant expression of the invention can be used to express Ich-2 in cells. Tissue-specific and/or regulated expression of Ich-2 can be accomplished through the use of appropriate tissue- specific and/or inducible transcriptional regulatory elements within the expression vector. Moreover, alternative to introducing an Ich-2-encoding nucleic acid molecule into cells as a means to stimulate apoptosis in the cells, the cells can be treated with an agent that stimulates endogenous Ich-2 activity in the cells (referred to herein as an "Ich-2 activator"). An Ich-2 activator may stimulate endogenous Ich-2 activity, for example, by increasing the transcription of the Ich-2 gene, the translation of the Ich-2 mRNA, the processing of immature Ich-2 protein into a mature form or the enzymatic activity of the mature Ich-2 protein. Such Ich-2 activators can be identified using screening assays provided by the invention, described in greater detail below.

In another embodiment of the method of modulating apoptosis, the cell can be contacted with an agent that inhibits Ich-2 activity to thereby inhibit apoptosis in the cells. Agents that prevent the intracellular cleavage of PARP during the early stages of apoptosis have been shown to also inhibit the internucleosomal fragmentation of DNA that occurs during apoptosis (see Kaufmann, S.H. et al. (1993) Cancer Res. 53:3976-3985). Thus, inhibition of the proteolytic activity of Ich-2 may prevent cleavage of PARP in cells, thereby inhibiting apoptosis in the cells. Accordingly, inhibitors of Ich-2 activity may be useful in the treatment of disease conditions involving cell death by acting to inhibit or slow down this process. Examples of such disease conditions that may be amenable to treatment with an inhibitor of Ich-2 activity include neural and muscular degenerative diseases, myocardial infarction, stroke, virally-induced cell death, aging, inflammation, autoimmune diseases and AIDS. An inhibitor of Ich-2 may act on the mature Ich-2 protein or may inhibit the production of the mature Ich-2 protein (e.g., transcription of the Ich-2 gene, translation of the Ich-2 mRNA or processing of the immature Ich-2 protein). For example, one type of Ich-2 inhibitor provided by the invention is an antisense nucleic acid that binds to Ich-2 mRNA to thereby inhibit the production of Ich-2 protein in cells. Such an antisense nucleic acid can be introduced into target cells (e.g., transfected into cells) to inhibit Ich-2 activity in the cells. Alternatively, agents that inhibit Ich-2 activity can be identified using screening assays provided by the invention, described in greater detail below.

In view of the foregoing, yet another aspect of the invention pertains to methods for identifying agents that modulate (e.g., inhibit or stimulate) Ich-2 protease activity. Accordingly, the invention provides a method for identifying a modulator of Ich-2 protease activity comprising: a) contacting a mature form of an Ich-2 protein with a potential substrate for the protein in the presence of a test agent under proteolytic conditions; b) measuring Ich-2 protease activity against the substrate in the presence of the test agent; and c) identifying a modulator of Ich-2 protease activity.

A "mature form of an Ich-2 protein" refers to a proteolytically processed and active form of the Ich-2 protein (e.g., comprised of plO and p20 subunits).

In one embodiment of the method, an inhibitor of Ich-2 protease activity is identified. For example, a mature form of an Ich-2 protein is contacted with a potential substrate for the Ich-2 protein in the presence of a test agent under proteolytic conditions (i.e., in the absence of the test agent, the mature form of Ich-2 exhibits proteolytic activity against the known Ich- 2 substrate under these conditions). The proteolytic activity of the Ich-2 protein against the substrate in the presence of the test agent is then determined. A decrease in the amount of Ich-2 proteolytic activity in the presence of the test agent relative to the amount of Ich-2 proteolytic activity in the absence of the test agent indicates that the test agent is an Ich-2 protease inhibitor. In another embodiment of the method, an activator of Ich-2 protease activity is identified. This method is similar to that described above for identifying Ich-2 inhibitors (i.e., an Ich-2 protein is incubated with a substrate in the presence of a test agent and the proteolytic activity of the Ich-2 protein against the substrate is determined). However, in this embodiment, an increase in the amount of Ich-2 proteolytic activity in the presence of the test agent relative to the amount of Ich-2 proteolytic activity in the absence of the test agent indicates that the test agent is an Ich-2 protease activator.

Mature forms of Ich-2 proteins for use in the screening assays of the invention can be prepared as described above in Sections II and III. For example, in one embodiment, the mature form of the protein is derived from a recombinantly expressed Ich-2 fragment encompassing about amino acid positions 105 to 377 of SEQ ID NO: 2. When recombinantly expressed in host cells, this fragment is processed to p20 and plO subunits. In a preferred embodiment, the mature form of the protein is derived from a polyhistidine fusion protein expressed in E. coli, such as that described in Example 3.

Suitable Ich-2 substrates for use in the screening assays are described further in Example 4 and include peptide substrates and derivatives thereof. A preferred peptide substrate is derived from the tetrapeptide Tyr-Val-Ala-Asp (YVAD) (SEQ ID NO: 17), such as acetyl-Tyr-Val-Ala-Asp- -nitroanilide (a chromogenic substrate), acetyl-Tyr-Val-Ala-Asp- amino-4-methylcoumarin (a fluorogenic substrate) and Ac-Tyr-Val-Ala-Asp-Gly-Trp-amide (an unlabelled substrate). Cleavage of the former two peptide substrates can be detected spectrophotometrically, whereas cleavage of the latter peptide substrate can be detected chromatographically (e.g., by HPLC). Additionally, whole proteins can be used as substrates for Ich-2. For example, a preferred protein substrate is poly(ADP-ribose) polymerase. Alternatively, prointerleukin-lβ can be used as a substrate for Ich-2. Whole proteins can be labelled (e.g., with 35s-methionine) and their cleavage products can be directly detected (e.g., by SDS-PAGE and autoradiography). Alternatively, cleavage of whole proteins can be detected indirectly (e.g., using an antibody that binds a specific cleavage product).

This invention is further illustrated by the following examples which should not be construed as limiting. The contents of all references, patents and published patent applications cited throughout this application are hereby incorporated by reference.

EXAMPLE 1: Isolation of Ich-2 cDNA Molecule and Characterization Thereof

An Ich-2 cDNA molecule was isolated from a human thymus cDNA library. The library was screened with a 1241 base pair probe comprising the entire coding region of a human ICE cDNA (the nucleotide sequence of which is shown in SEQ ID NO: 3). The human ICE cDNA coding sequence was inserted into the polylinker of the plasmid pGEM (obtained commercially from Promega). The probe was generated from this plasmid by cleavage with Xhol and BamHI. The probe was hybridized to 4 x 10^ plaque forming units (pf s) of a human thymus cDNA library (Clontech) under non-standard, very low stringency conditions as follows. The probe was hybridized overnight at 55°C in 10% dextran sulfate, 0.1% sodium dodecyl sulfate (SDS), 1.25 X Denhardt's solution, 5 X SSC, 500 ng/ml poly(A) and 50 μg/ml sheared salmon sperm DNA. The filters were then washed in 2 X SSC, 0.1% SDS at 50°C. Although standard protocols for plaque hybridization assays recommend avoidance of dextran sulfate in the hybridization solution (see e.g., Sambrook, J. et al. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press), we believe that the non-standard dextran-sulfate-containing hybridization solution and hybridization conditions used were critical for success in isolating the Ich-2 cDNA. The initial library screening resulted in 43 "positive" plaques, which ranged in hybridization intensity from very dark to very light after a 6 day autoradiograph exposure. Sequence analysis of these 43 "positive" plaque isolates revealed that only 5 of these plaques contained Ich-2 sequences (i.e., 12%). These 5 Ich-2 clones had hybridization intensities of "light" or "light/medium" on the primary library screen, suggesting that the library screen was near the lower limit of detection of Ich-2 sequences when hybridizing with a human ICE cDNA probe. Sequence analysis of the 5 plaque isolates containing Ich-2 sequences revealed that only one clone (Thl 8-3) contained the full-length Ich-2 coding sequence (i.e., 2%). The hybridization intensity of this clone was very light on the primary library screen. Clone Thl 8-3 contained an approximately 1.7 kb insert having a 1 131 base pair open reading frame. The nucleotide sequence of the coding region of the Ich-2 cDNA is shown in SEQ ID NO: 1 (nucleotide positions 66 to 1196). The coding sequence of the Ich-2 cDNA was compared to the coding sequence of the human ICE cDNA and found to be 63% identical to the hICE coding sequence. The predicted amino acid sequence of the protein encoded by the Ich-2 cDNA is shown in SEQ ID NO: 2. The amino acid sequence of the Ich-2 protein was compared to the amino acid sequence of human, rat and mouse ICE and other ICE-related proteins (shown in Figure l)(the amino acid sequences of human ICE, murine ICE, rat ICE, Ich-1 and CPP32 are also shown in SEQ ID NOs: 4, 5, 6, 7 and 8, respectively). The Ich-2 protein exhibits 53% amino acid identity to ICE over the entire length of the proteins. The region encoding the p20/pl0 subunits exhibits 60% amino acid identity to the equivalent region of ICE. In contrast, the Ich-2 protein exhibits only 27% amino acid identity to Ich-1 (Nedd-2) and only 32% amino acid identity to CPP32. The catalytic histidine and cysteine residues are conserved in Ich-2 (amino acid positions 210 and 258 of SEQ ID NO: 2, respectively), as are all four amino acids whose side chains form the PI pocket (amino acid positions Arg-152, Gln-256, Arg-314 and Ser-320 of SEQ ID NO: 2).

Analysis of genomic Ich-2 clones isolated from a hman genomic library similarly screened as described above for Ich-2 cDNA allowed for the determination of the intron exon structure of Ich-2. This analysis indicated that all of the intron positions are conserved betweeen Ich-2 and ICE (Cerretti, D.P. et al. (1994) Genomics 2Q:468-73) with the exception of the second intron of ICE. This intron is absent in Ich-2 and the low level of sequence conservation between the second exon of Ich-2 and the corresponding region of the ICE gene suggestst hat the amino terminal portions of the two genes may have different evolutionary ancestry. To demonstrate that the cloned Ich-2 gene is an expressed human gene, reverse transcriptase-polymerase chain reaction (RT-PCR) was performed on human thymus mRNA with Ich-2 specific primers. An approximately 1.1 kb product was generated and its identity as Ich-2 mRNA was confirmed by sequencing.

EXAMPLE 2: Human Tissue Expression of Ich-2 mRNA

To analyze the expression pattern of Ich-2 mRNA, a human adult multi-tissue Northern blot was probed with an Ich-2 specific probe. The human adult Northern blot membrane (Clontech) contains 2 μg of pure polyA⁺ RNA per lane. This filter was hybridized with a 73 base pair Ich-2 cDNA fragment encompassing nucleotides 635-708 in the coding region. This probe hybridizes to the Ich-2 mRNA of about 1.7 kb. Hybridization was performed overnight at 60°C in 5 X SSPE, 10 X Denhardt's solution, 100 μg/ml sheared salmon sperm DNA, 50% formamide, 2% SDS, followed by two washes at 50°C in 2 X SSC, 0.1% SDS. The results are shown in Figure 2 (which also shows the tissue expression pattern ofhICE mRNA). Ich-2 mRNA was expressed in all tissues examined except for brain. This tissue distribution is similar to that of ICE mRNA. although the level of expression of Ich-2 mRNA is lower than that of ICE mRNA. Moreover, although an Ich-2 cDNA was isolated from a thymus cDNA library, Ich-2 mRNA is not expressed at high levels in thymus. In a second experiment, a human adult multi-tissue Northern blot was probed as described above but with a 264 base pair probe consisting of bases 1-250 of the Ich-2 coding sequence plus a 14 base pair tail introduced by the PCR reaction and the two washes were performed at 60 C in 2 X SSC, 0.1% SDS. The PCR primers used to generate the probe fragment were as follows: CCCACTAGTTCCCTATGGCAGAAGGCAACCA (5')(SEQ ID NO: 21) and GGGATATTTGGTCTATGTT (3') (SEQ ID NO: 22). Similar results were observed as described above, with Ich-2 mRNA being detected in all tissues probed except brain. Additionally, two exceptions to the conserved expression patterns of Ich-2 and ICE were observed, in ovary and placenta. Ich-2 mRNA was detected at appreciable levels in these tissues whereas ICE mRNA was barely expressed in these tissues.

EXAMPLE 3: Expression of Recombinant Ich-2 Proteins

The Ich-2 protein encoded by the Ich-2 cDNA was expressed recombinantly in several ways. The protein was expressed in vitro by using a rabbit reticulocyte lysate system. Additionally, the protein was also expressed in E. coli, in mammalian cells and in insect cells (using a baculovirus vector).

A. In Vitro Transcription and Translation Plasmids for in vitro transcription/translation of Ich-2 cDNA were prepared by first amplifying a fragment encompassing the coding region of Ich-2 (nucleotides 66-1203 of SEQ ID NO: 1) using the polymerase chain reaction (PCR) and pure T 8-3 phage eluate (containing the Ich-2 cDNA insert) as the template DNA. The PCR primers used for amplification had the following nucleotide sequences: 5'-CCCACTAGTT CCCTATGGCAGAAGGCAACCA-3'(SEQIDNO:9)and5'-CCCGGATCCATTTT

CAATTGCCAGGAAAGAG-3' (SEQ ID NO: 10). These primers incorporate an Spel site and a BamHI site at the 5' and 3' ends, respectively, of the resultant PCR amplification product. The PCR product was cut with restriction enzymes Spel and BamHI and inserted into the multi-cloning site of the eukaryotic expression vector pKV (derived from pSVβ, obtained commercially from Clontech). Genes inserted into the multi-cloning site of pKV are placed under the control of the T7 promoter for in vitro transcription and under the SV40 promoter for expression in eukaryotic cells. The Ich-2 coding region was transcribed in vitro using T7 polymerase and the resulting RNA was translated using rabbit reticulocyte lysate. The translation product was a protein of 42 kD. This is the predicted size for the translation product of the unprocessed product of the Ich-2 cDNA.

B. Expression in E. coli

A DNA fragment encoding amino acids 105-378 of Ich-2 was cloned into the unique EcoRI restriction site of the E. coli expression vector pMCH-1, which placed the Ich-2 fragment under the regulatory control of the pL promoter. This Ich-2 DNA fragment was amplified by the polymerase chain reaction using a primer having the nucleotide sequence: GGGGAATTCATGGGTCATCATCATCATCATCATGGTAGCGGTCATATCGACGACG ACGACAAGGCTCTGAAACTGTGTCCGCATGAAGAGTTCCTGAGACTATG (SEQ ID NO: 11) as the 5' primer and a primer having the nucleotide sequence: GGGGGATCCTCTA TTAATTGCCAGGAAAGAGGTAG (SEQ ID NO: 12) as the 3' primer. Using these primers, the nucleotide sequence of the amplified Ich-2 fragment was modified in the region encoding the N-terminal portion of the protein to include codons used preferentially in E. coli. Specifically, the following nucleotide changes were made (nucleotide base positions are as in SEQ ID NO: 1): C380T, C383G, G386A, T389G and T395G. Additionally, the nucleotide sequence of the Ich-2 fragment was modified in the region encoding the N- terminal portion of the protein to eliminate an EcoRI site (by changing the alanine at position 404 to a guanine) to facilitate cloning of the fragment into pMCH-1. Finally, the 5' primer encodes six histidine residues linked in-frame to the N-terminus of the Ich-2 fragment. Accordingly, the resultant expression vector (pMCH-1 His Ich-2 32kDa) encodes the Ich-2 fragment fused at its N-terminus to a six histidine residues. This poly-histidine tag allows for purification of the (His)6-Ich-2 fusion protein on a nickel chelating column (Porath, J. (1992) Protein Expression and Purification 2:263-281). An enterokinase site is included in the fusion protein between the poly-histidine tag and the Ich-2 sequences, allowing for cleavage of the poly-histidine tag from the fusion protein (e.g., after column purification) using enterokinase.

The pMCH-1 His Ich-2 32kDa vector was transformed into E. coli strain NM294 (F-endAI hsdRU (r/_c-m/_c+) supE44 Thi-1) which also contained a plasmid encoding the cI-857 temperature sensitive pL promoter repressor. Growth of the resultant strain at 40°C following the protocol described below caused induction of the pL promoter and expression of the 32kDan Ich-2 protein.

An uninduced overnight culture of the transformed bacterial strain described above (grown at 28°C) was used to inoculate 4 x 1 liter culture (1 :50 dilution). These cultures were grown at 28°C until the ODgQO reached 0.585 at which time the cultures were shifted to 40°C. Cells were harvested one hour after the shift to 40°C and the cell pellet was frozen. The time point for harvest was determined in preliminary small-scale induction experiments which indicated that the most soluble cysteine protease activity was detectable at one hour after induction (see e.g., Walker , N.P.C. et al. (1994) Ce// 2£:343-352).

Cell pellets were resuspended in 100 mis of ice cold lysis buffer (50 mM HEPES, 100 mM NaCl, 10% glycerol, 0.1 M CHAPS, 200 mM GSSG, 1 mM PMSF, 50 μM leupeptin. 1 μM pepstatin A, pH 7.5). The suspension was passed through a microfluidizer 6-7 times until the lysate color changed to a deep brown (indicating lysis). Lysates were spun at 12,000 rpm for 30 minutes at 4°C to remove debris. To purify the N-His Ich-2 protein from the cell lysate, a 1 ml Hi-Trap Chelating Sepharose column (Pharmacia) was charged with 1 ml of 100 mM NiCl2, followed by a 20 ml wash with water. The column was equilibrated with 10 mis of Buffer B (50 mM HEPES, 0.1 M NaCl, 10% glycerol, pH 7.5, 0.5 M imidazole) and 20 mis of Buffer A (same as Buffer B except that the imidazole is omitted). Lysate diluted 1 : 1 with Buffer A was run through the charged nickel column to bind N-His Ich-2 to the column. The N-His Ich-2 was then eluted from the column with imidazole-containing buffer. Eluate fractions were tested for ICE-like activity (Walker, N.P.C. et al. (1994), supra) and the active fractions were pooled, diluted 5X with Buffer A and rechomatographed as described above. Samples of purified N-His Ich-2 were analyzed by polyacrylamide gel electrophoresis on a 10-20 % gradient SDS polyacrylamide gel. N-His ICE was also electrophoresed on the gel for comparison. The gel was stained with Coomassie Brilliant Blue to detect the proteins. The analysis showed that both E. coli expressed N-His Ich-2 and E. coli expressed N-His ICE are proteolytically processed to approximately 10 and 20 kDa subunits during the expression and/or purification procedures. It also indicated that a high degree of purity was achieved for N-His Ich-2 after nickel column purification. N-terminal sequencing of the 10 kDa band was identical to the Ich-2 sequence downstream of Asp 289, showing that this residue can serve as an autocleavage site (analagous to the autocleavage site of ICE at Asp316).

C. Expression in Mammalian Cells

The Ich-2 protein is expressed in mammalian cells using the pKV expression vector described above in Part A. In this vector, expression of the Ich-2 coding region is under the control of the SV40 promoter. This expression vector can be introduced into mammalian cells, such as COS cells or CHO cells, using standard transfection techniques to thereby express the lch-2 proteins in the cells.

D. Expression in Insect Cells using a Baculovirus Vector

A recombinant baculovirus transfer vector was constructed by subcloning a PCR- generated Ich-2 cDNA into a BamHI and NotI cleaved baculovirus transfer vector, pVLl 393 (Invitrogen). Two insert fragments containing the Ich-2 cDNA (one encoding full-length p44 and one encoding p30, which lacks the N-terminal prodomain) were generated by PCR using the Ich-2 phage clone Thl8-3 (described in Example 1) as the template and the following primers: CGGGATCCTATAAATATGCACCACCATCATCACCACGGATCTGGTCAT ATTGATGATGATGATAAGGCAGAAGGCAACCACAGAAAAAAG (5' primer for p44) (SEQ ID NO: 18); CGGGATCCTATAAATATGCACCACCATCATCACCACGGATCT GGTCATATTGATGATGATGATAAGGCCCTCAAGCTTTGTCCTCAT (5' primer for p30)(SEQ ID NO: 19); ATAGTTTAGCGGCCGCAATTTCAATTGCCAGGAAAGAG GTAG (3' primer for both p44 and p30) (SEQ ID NO: 20). These primers introduced restriction sites for subcloning as well as an N-terminal polyhistidine sequence tag to both forms of Ich-2 (p44 and p30). Following subcloning, the correct clones were confirmed by restriction enzyme digestion and DNA sequencing.

To generate the recombinant baculovirus, the transfer vectors described above were used to cotransfect Spodoptera frugiperda (Sf9) cells with modified and linearized Autographa calif ornica nuclear polyhedrosis virus (AcMNPV) DNA using the

BaculoGold™ transfection system (PharMingen). The cell culture supematants containing the baculovirus were harvested four days posttransfection and were plated for single plaques. Recombinant viral plaques were visually identified after neutral red staining (0.375 mg neutral red/ml of plating top agar). PCR was performed on 10 μl of 100 μl single plaque suspensions in serum-free Grace's medium (GibcoBRL) to confirm insert size. After two rounds of replating, the purified recombinant viruses were used to generate high titer stocks. Sf9 cell infections were conducted at a mutiplicity of infection of 5 in 60 mm dishes containing 3 x 10^ cells. DNA was analyzed at 48 hours postinfection.

EXAMPLE 4: Proteolytic Activity of Ich-2 Protein

The proteolytic activity of the Ich-2 protein was analyzed using in vitro protease assays. Assays using two different substrates, a synthetic peptide substrate and poly(ADP- ribose) polymerase, were performed as described below:

A. Synthetic Peptide Substrate

The proteolytic activity of the Ich-2 protein was analyzed using an in vitro protease assay with a chromogenic peptide substrate, Acetyl-Tyr-Val-Ala-Asp- -nitroanilide (Ac- YVAD-pNA; described further in Reiter, L.A. (1994) Int. J. Peptide Protein Res. 43:87-96; commercially available from Quality Controlled Biochemicals, Inc., Hopkinton, MA), was used. This substrate is an analog of the fluorogenic peptides substrate Acetyl-YVAD-amino- 4-methylcoumarin (Ac-YVAD-AMC), designed as a substrate for ICE to mimic the S 1 -S4 position residues of an ICE cleavage site in pro-IL-1-β (see Thornberry, N.A. et al. (1992) Nature 3_5_6_:768-774). Thus, Ac-YVAD-pNA is also a substrate for ICE. To determine whether Ich-2 could hydrolyze Ac-YVAD-pNA, N-His Ich-2 (1 μl containing approximately 700 ng N-His Ich-2 protein) was preincubated for 60 minutes at 30°C in 80 μl of a reaction buffer containing 100 mM HEPES, 20% (v/v) glycerol, 5 mM DTT, 0.5 mM EDTA, at pH values ranging from 6.5 to 8.0. The peptide substrate Ac- YVAD-pNA was added in 20 μl of reaction buffer containing 2.5 mM substrate and 5% DMSO solvent, giving final concentrations in the assay mixtures of 500 μM substrate and 1 % DMSO. The incubation of N-His Ich-2 with the peptide substrate at 30°C was continued, and the catalytic hydrolysis of Ac- YVAD-pNA was monitored by the change in absorbance of the samples at 405 nm due to release of -nitroanilide as a function of time. Assays were performed in duplicate. Samples were read using a microtiter plate reader (Molecular Devices). The results are shown graphically in Figure 3, wherein changes in absorbance at 405 nm are expressed in units of mOD min'-*. The results demonstrate that N-His Ich-2 can cleave the peptide substrate Ac-YVAD-pNA, with the proteolytic activity being greatest at pH 7.0. Background hydrolysis was estimated in samples containing no enzyme and was approximately 2% of that of the enzyme-containing samples, indicating that hydrolysis was highly accelerated by N-His Ich-2. The efficient catalytic cleavage by Ich-2 of Ac-YVAD- pNA, also a substrate for ICE, demonstrates that the Ich-2 enzyme shares some substrate binding and catalytic properties with ICE.

In a second series of experiments, the ability of protease inhibitors to inhibit the proteolytic activity of Ich-2 was examined. A peptide inhibitor that inhibits ICE activity, Acetyl-Tyr-Val-Ala-Asp-CHO (Ac-YVAD-CHO; described in Thornberry, et al. (1992), supra.; commerically available from Bachem Bioscience Inc., King of Prussia, PA) was used in these studies, as well as a nonspecific thiol reactive compound, iodoacetamide, and a general cysteine protease inhibitor, E64 (described in Hanada, et al. (1978) Agric. Biol. Chem. 42:523). E64 inhibits many cysteine proteases but notably does not inhibit ICE activity (see Black et al. (1989) FEBS Lett. 247:386). Proteolytic assays were performed as described in the preceding paragraph except that the preincubations contained samples of 1 μl of inhibitor at 100X the desired final concentration in DMSO. Various concentrations of inhibitors were tested as follows: Ac-YVAD-CHO at 10 μM (sample 1), 1 μM (sample 2), 100 nM (sample 3), 10 nM (sample 4) or 1 nM (sample 5), iodoacetamide at 10 mM (sample 6), 1 mM (sample 7) or 100 μM (sample 8), and E64 at 100 μM (sample 9). The results are shown graphically in Figure 4, wherein protease activity in the presence of the inhibitor is expressed as a percentage of the control activity in the absence of the inhibitor. The results demonstrate that, similar to ICE, Ich-2 is inhibited by the non-specific thiol reactive compound iodoacetamide, indicating that Ich-2 is a cysteine protease. Moreover, similar to ICE, Ich-2 is not inhibited by the general cysteine protease inhibitor E64, suggesting similarity in the catalytic mechanisms of the two enzymes. However, Ich-2 was relatively resistant to the peptide inhibitor Ac-YVAD-CHO, with an IC50 value of about 1 μM, whereas ICE was inhibited by this peptide inhibitor with an IC50 value of about 1 nM. This difference in the inhibitory ability of Ac-YVAD-CHO indicates that the P1-P4 specificity of N-His Ich-2 and N-His ICE may be substantially different.

Differences in the binding specificities of N-His Ich-2 and N-His ICE were also indicated in a third series of experiments, in which the kinetics of cleavage of Ac-YVAD- pNA by either N-His Ich-2 or N-His ICE was examined. In these experiments, enzyme activity was assayed as described in the preceding paragraphs, except that the concentration of the peptide substrate Ac-YVAD-pNA was varied between 0 and 1000 μM. Assays were performed in triplicate and background was estimated from samples lacking enzyme at each substrate concentration. The data were fit to an equation of the form Y=V_max(X/X + K_m), where Y = activity in mOD/min and X = substrate concentration. The results are shown graphically in Figure 5. A K_m value for N-His ICE of 51 ± 3.3 μM was obtained. A K_m value for N-His Ich-2 of 962 ± 154 μM was obtained. The observed difference in the K_m values for N-His Ich-2 and N-His ICE indicates that the two enzymes have differences in substrate binding specificity. Furthermore, these data suggest that N-His Ich-2 and N-His ICE differ in their preferences for natural substrates.

B. Polvf ADP-ribose'l polymerase Substrate

The proteolytic activity of the Ich-2 protein was also analyzed using an in vitro protease assay with the substrate poly(ADP-ribose) polymerase (PARP). PARP is a protein that undergoes proteolytic cleavage during the early stages of programmed cell death or apoptosis (see e.g., Kaufmann, S.H. et al. (1993) Cancer Res. 5^:3976-3985). During apoptosis, the ~116 kDa PARP protein is cleaved to a ~25 kDa fragment containing the amino-terminal DNA binding domain and a -85 kDa fragment containing the automodification and catalytic domains. PARP protein was obtained by in vitro translation of in vitro transcribed PARP cDNA, using a standard reticulocyte lysate system. The PARP protein was radioactively labeled by inclusion of -^^S-methionine in the translation system. PARP cDNA was obtained by PCR amplification from cDNA prepared from mRNA of the human T cell line Jurkat. The PARP cDNA (whose nucleotide sequence is described in Uchida, K. et al. (1987) Biochem. Biophys. Res. Comm. 148:617-622 and is available from Genbank) was amplified in two segments. The first segment was amplified using primer (1) CCCACTAGTAGG ATG GCGGAGTCTTCGGATAAGCTC (SEQ ID NO: 13) and primer (2) AAGAGTTAATTTCATTCTCT (SEQ ID NO: 14). The second segment was amplified using primer (3) GTCTGAGGACTTCCTCCAGGA (SEQ ID NO: 15) and primer (4) CCCAGATCTTTACCACAGGGAGGTCTTAAAATTGAA (SEQ ID NO: 16). The PCR products of each reaction were mixed and reamplified with primers (1) and (4) to generate a full-length PARP cDNA with Spel and Bglll restriction sites at the ends to allow for cloning into the pSVβ-derived vector pKV (described in Example 3, Part A).

To determine whether Ich-2 could cleave PARP, N-His Ich-2 from E. coli crude lysate was incubated with 3^S-labeled, in vitro transcribed PARP overnight under reactions as described above in Part A. In a first set of experiments, three other cysteine proteases were also tested for comparison purposes: N-His ICE (expressed in baculovirus and purified by nickel chromatography), Ced-3 and a mutant Ced-3 (the latter two were obtained by in vitro transcription and translation). After incubation, the samples were subjected to standard SDS- polyacrylamide gel electrophoresis. Cleavage of PARP was indicated by the presence of an 85 kDa cleavage product. Of the four enzymes examined, only N-His Ich-2 generated the 85 kDa cleavage product of PARP, thereby demonstrating that PARP is a substrate for Ich-2.

Similar results were observed in a second set of experiments in which the proteolytic activity of N-His Ich-2 (E. coli expressed) for PARP was again compared to the proteolytic activity of N-His ICE (baculovirus expressed) for PARP, as described above. The degree of PARP cleavage was measured at 15 minute intervals over the course of one hour. The results are shown in Figure 6, which demonstrates that significant accumulation of the 85 kDa PARP cleavage product had occurred in the presence of Ich-2 after only 15 minutes incubation, whereas little PARP cleavage product was detected in the presence of ICE, even after one hour of incubation.

EXAMPLE 5: Ich-2 Induces Apoptosis

To determine whether Ich-2 could induce apoptosis in cells when overexpressed in the cells, Sf9 insect cells were infected with a recombinant baculovirus expressing either the full length protein or a truncated version of Ich-2 which lacks the N-terminal prodomain (prepared as described above in Example 3, section D). Analysis of insect cells infected with these baculovirus constructs showed that expression of either the full-length or truncated Ich- 2 construct in the cells caused the cells to exhibit the condensed morphology, cellular fragmentation and internucleosomal DNA cleavage characteristic of cells undergoing apoptotic cell death. Full-length or truncated ICE proteins similarly expressed in Sf9 cells also induced apoptosis in the cells.

EXAMPLE 6: Substrate Specificity of Ich-2

To identify peptide substrates for Ich-2, candidate peptides were used in in vitro proteolysis assays with recombinant Ich-2 protein. Human Ich-2 enzyme was expressed recombinantly with an N-terminal polyhistidine tag in E. coli as described above in Example 3, subsection B. The recombinant N-His Ich-2 protein was purified by metal chelating column chromatography as described in Porath, J. (1992) Protein Expression and Purification 1:263-281.

Candidate peptide substrates were synthesized by standard solid phase methods and were purified to >95% by reverse-phase chromatography. Peptide identities were confirmed by mass spectrometry. Each peptide was acetylated at the amino-terminus and amidated at the carboxy-terminus. The amino acid sequence of each peptide included at least one Trp or Tyr residue. Stock solutions of each peptide were prepared in dimethylsulfoxide (DMSO) at approximately 10 mM. The precise concentration of each stock solution was determined in duplicate as described in Edelhoch, H. (1967) Biochemistry 6:1948-1954. Dilutions of each stock solution to 500 μM were prepared and stored at -20 °C prior to use in enzyme assays. To determine the substrate specificity of Ich-2, V_max/K_m values for various candidate peptide substrates were compared using experimental procedures modeled after that of Howard, A., et al. (1991) J. Immunol. 142:2964-2969. Enzyme reaction mixtures (810 μL) were prepared containing: 100 mM sodium acetate (pH 6.2), 20% (v/v) glycerol, 5 mM dithiothreitol, 0.5 mM EDTA and approximately 1 1 μg N-His Ich-2. These mixtures were capped and preincubated for 30 minutes at 30 °C. Candidate peptide substrates were added from 500 μM DMSO stocks to give final concentrations of 10 μM peptide and 2% (v/v) DMSO. The reaction mixtures were then capped and incubation was continued at 30 °C. At 10 minute intervals for 60 minutes beginning at t=0, aliquots of 110 μL were removed from each reaction mixture and added to vials containing 1 1 μL of a solution of 3 M HC1 in water to stop the enzyme reaction. Samples were stored at room temperature prior to analysis.

Samples were analyzed by reverse phase HPLC using a 250 x 4.6 mm C_\% reverse phase column (Vydak, Hesperia, CA) and a linear gradient of MeCN-^O with 0.1% (v/v) TFA. The area under the substrate peaks (arbitrary units) was plotted vs. time of reaction for each substrate and fit into an equation of the form:

So

wherein S_Q is substrate peak area at time=0, S_t is substrate peak area at time=t, e is a constant approximately equal to 2.718, k is the first order rate constant formally equal to V_max/K_m and t is time. To obtain relative V_max/K_m values, the results were normalized to a value of 1.00 for one peptide, typically that which displayed the highest V_max/K_m value. Alternatively, results can be expressed as percent substrate cleavage after a fixed time of reaction.

In a series of experiments, candidate peptides differing at either the P4, P3, P2, PI or PI' position were tested as Ich-2 substrates in the assay described above. The results are summarized below in Table 1 (wherein the aspartic acid residues at the PI position in each peptide are aligned and indicated in bold). Cleavage by Ich-2 of the known ICE substrate peptide, YVADGW, was set as 1.00 and cleavage of other peptide substrates are shown relative to this. The standard one-letter amino acid code is used.

Table 1 : Cleavage by N-His Ich-2 of Candidate Peptide Substrates

Peptide Sequence Relative (V_max/K_m)

P4 position variants

1 acetyl - VADGW- amide 3.18

2 acetyl -VVADGW-amide 1.09

3 acetyl -YVADGW- amide [1.00]

4 acetyl -FVADGW-amide 0.84

5 acetyl -DVADGW- amide 0.79

6 acetyl -EVADGW-amide 0.50

7 acetyl -AVADGW- amide 0.24 P3 position variants

8 acetyl- YEADGW- •amide 4.29

3 acetyl- YVADGW*^■amide [1.00]

9 acetyl- YQADGW*^■amide 0.77

10 acetyl- YFADGW*•amide 0.43

11 acetyl- YIADGW ^■amide 0.38

12 acetyl- YTADGW ^■amide 0.35

13 acetyl- YAADGW -amide 0.35

14 acetyl- YLADGW -amide 0.27

15 acetyl* YSADGW -amide 0.27

16 acetyl* YRADGW -amide 0.17

17 acetyl* YNADGW -amide 0.13

P2 position variants

3 acetyl- YVADGW •amide [1.00]

18 acetyl- YVSDGW -amide 0.82

19 acetyl- YWDGW -amide 0.78

20 acetyl- YVEDGW -amide 0.61 21 acetyl- YVQDGW ^■amide 0.33 22 acetyl- YVDDGW ^■amide 0.29 23 acetyl- YVKDGW -amide 0.20 24 acetyl- YVFDGW -amide 0.20 25 acetyl- YVLDGW -amide 0.09

P 1 position variants

26 acetyl-LEVDGW-amide [1.00]

27 acetyl- EVEGW-amide 0.00

PI' position variants

3 acetyl- -YVADGPW- -amide [1.00]

28 acetyl- -YVADCPW- -amide 0.66

29 acetyl- -YVADSPW- -amide 0.64

30 acetyl- -YVADYPW- -amide 0.64

31 acetyl- -YVADTPW- -amide 0.35

32 acetyl- -YVADFPW- -amide 0.33

33 acetyl- -YVADAPW- -amide 0.33

34 acetyl- -YVADWPW- -amide 0.30

35 acetyl- -YVADHPW- -amide 0.21

36 acetyl- -YVADNPW- -amide 0.21

37 acetyl -YVADPPW- -amide 0.15

38 acetyl -YVADMPW- -amide 0.13 39 acetyl -YVADLPW- amide 0.08

40 acetyl -YVADEPW- amide 0.07

41 acetyl -YVADIPW-amide 0.05

42 acetyl -YVADQPW- amide 0.04

43 acetyl -YVADRPW- amide 0.04

44 acetyl -YVADVPW- amide 0.03

45 acetyl -YVADKPW- amide 0.00

Predicted Optimum Variant

26 acetyl -LEVDGW- amide 3.32

3 acetyl -YVADGW- amide [1.00]

These results demonstrate that although Ich-2 can cleave a peptide substrate comprisingthe amino acid sequence YVAD, an optimal peptide substrate for ICE, Ich-2 more preferably cleaves peptide substrates having a leucine at the P4 position, a glutamic acid at the P3 position, either an alanine, a serine or a valine at the P2 position and an aspartic acid at the PI position. Accordingly, a consensus sequence for an Ich-2 peptide substrate can comprise the amino acid sequence: Leu-Glu-(Ala Ser/Val)-Asp (SEQ ID NO: 23).

EQUIVALENTS

Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

SEQUENCE LISTING (1) GENERAL INFORMATION: (i) APPLICANT:

(A) NAME: BASF A tiengesellschaft

(B) STREET: Carl-Bosch Str. 38

(C) CITY: 67056 Ludwigshafen

(D) STATE: Rheinland-Pfalz (E) COUNTRY: Federal Republic of Germany

(ii) TITLE OF INVENTION: Novel Cysteine Protease Related to

Interleukin-lβ Converting Enzyme (iii) NUMBER OF SEQUENCES: 23

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: LAHIVE & COCKFIELD

(B) STREET: 60 State Street, suite 510 (C) CITY: Boston

(D) STATE: Massachusetts

(E) COUNTRY: USA

(F) ZIP: 02109-1875 (v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: ASCII text

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER:

(B) FILING DATE:

(C) CLASSIFICATION:

(vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: US 08/391,674

(B) FILING DATE: 21-FEB-1995

(C) CLASSIFICATION:

(vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: US 08/463,080

(B) FILING DATE: 05-JUN-1995

(C) CLASSIFICATION:

(viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: DECONTI, Giulio A. , Jr.

(B) REGISTRATION NUMBER: 31,503

(C) REFERENCE/DOCKET NUMBER: BBI-021CPPC

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: (617)227-7400

(B) TELEFAX: (617)227-5941

(2) INFORMATION FOR SEQ ID NO: 1 :

(i) SEQUENCE CHARACTERISTICS; (A) LENGTH: 1280 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS : double

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA

(ix) FEATURE:

(A) NAME/KEY: CDS (B) LOCATION: 66..1196

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l: _{ττττττττττ} TTTTTGACTC TGAGGCTCTT TCCAACGCTG TAAAAAAGGA CAGAGGCTGT 60

TCCCT ATG GCA GAA GGC AAC CAC AGA AAA AAG CCA CTT AAG GTG TTG 107

Met Ala Glu Gly Asn His Arg Lys Lys Pro Leu Lys Val Leu 1 5 10

GAA TCC CTG GGC AAA GAT TTC CTC ACT GGT GTT TTG GAT AAC TTG GTG 155 Glu Ser Leu Gly Lys Asp Phe Leu Thr Gly Val Leu Asp Asn Leu Val 15 20 25 30 GAA CAA AAT GTA CTG AAC TGG AAG GAA GAG GAA AAA AAG AAA TAT TAC 203 Glu Gin Asn Val Leu Asn Trp Lys Glu Glu Glu Lys Lys Lys Tyr Tyr 35 40 45

GAT GCT AAA ACT GAA GAC AAA GTT CGG GTC ATG GCA GAC TCT ATG CAA 251 Asp Ala Lys Thr Glu Asp Lys Val Arg Val Met Ala Asp Ser Met Gin

50 55 60

GAG AAG CAA CGT ATG GCA GGA CAA ATG CTT CTT CAA ACC TTT TTT AAC 299 Glu Lys Gin Arg Met Ala Gly Gin Met Leu Leu Gin Thr Phe Phe Asn 65 70 75

ATA GAC CAA ATA TCC CCC AAT AAA AAA GCT CAT CCG AAT ATG GAG GCT 347 lie Asp Gin lie Ser Pro Asn Lys Lys Ala His Pro Asn Met Glu Ala 80 85 90

GGA CCA CCT GAG TCA GGA GAA TCT ACA GAT GCC CTC AAG CTT TGT CCT 395 Gly Pro Pro Glu Ser Gly Glu Ser Thr Asp Ala Leu Lys Leu Cys Pro 95 100 105 110 CAT GAA GAA TTC CTG AGA CTA TGT AAA GAA AGA GCT GAA GAG ATC TAT 443 His Glu Glu Phe Leu Arg Leu Cys Lys Glu Arg Ala Glu Glu lie Tyr 115 120 125

CCA ATA AAG GAG AGA AAC AAC CGC ACA CGC CTG GCT CTC ATC ATA TGC 491 Pro lie Lys Glu Arg Asn Asn Arg Thr Arg Leu Ala Leu lie lie Cys 130 135 140

AAT ACA GAG TTT GAC CAT CTG CCT CCG AGG AAT GGA GCT GAC TTT GAC 539 Asn Thr Glu Phe Asp His Leu Pro Pro Arg Asn Gly Ala Asp Phe Asp 145 150 155

ATC ACA GGG ATG AAG GAG CTA CTT GAG GGT CTG GAC TAT AGT GTA GAT 587 lie Thr Gly Met Lys Glu Leu Leu Glu Gly Leu Asp Tyr Ser Val Asp 160 165 170 GTA GAA GAG AAT CTG ACA GCC AGG GAT ATG GAG TCA GCG CTG AGG GCA 635 Val Glu Glu Asn Leu Thr Ala Arg Asp Met Glu Ser Ala Leu Arg Ala 175 180 185 190

TTT GCT ACC AGA CCA GAG CAC AAG TCC TCT GAC AGC ACA TTC TTG GTA 683 Phe Ala Thr Arg Pro Glu His Lys Ser Ser Asp Ser Thr Phe Leu Val 195 200 205 CTC ATG TCT CAT GGC ATC CTG GAG GGA ATC TGC GGA ACT GTG CAT GAT 731 Leu Met Ser His Gly lie Leu Glu Gly He Cys Gly Thr Val His Asp 210 215 220

GAG AAA AAA CCA GAT GTG CTG CTT TAT GAC ACC ATC TTC CAG ATA TTC 779 Glu Lys Lys Pro Asp Val Leu Leu Tyr Asp Thr He Phe Gin He Phe 225 230 235

AAC AAC CGC AAC TGC CTC AGT CTG AAG GAC AAA CCC AAG GTC ATC ATT 827 Asn Asn Arg Asn Cys Leu Ser Leu Lys Asp Lys Pro Lys Val He He 240 245 250

GTC CAG GCC TGC AGA GGT GCA AAC CGT GGG GAA CTG TGG GTC AGA GAC 875 Val Gin Ala Cys Arg Gly Ala Asn Arg Gly Glu Leu Trp Val Arg Asp 255 260 265 270

TCT CCA GCA TCC TTG GAA GTG GCC TCT TCA CAG TCA TCT GAG AAC CTG 923 Ser Pro Ala Ser Leu Glu Val Ala Ser Ser Gin Ser Ser Glu Asn Leu 275 280 285 GAG GAA GAT GCT GTT TAC AAG ACC CAC GTG GAG AAG GAC TTC ATT GCT 971 Glu Glu Asp Ala Val Tyr Lys Thr His Val Glu Lys Asp Phe He Ala 290 295 300

TTC TGC TCT TCA ACG CCA CAC AAC GTG TCC TGG AGA GAC AGC ACA ATG 1019 Phe Cys Ser Ser Thr Pro His Asn Val Ser Trp Arg Asp Ser Thr Met 305 310 315

GGC TCT ATC TTC ATC ACA CAA CTC ATC ACA TGC TTC CAG AAA TAT TCT 1067 Gly Ser He Phe He Thr Gin Leu He Thr Cys Phe Gin Lys Tyr Ser 320 325 330

TGG TGC TGC CAC CTA GAG GAA GTA TTT CGG AAG GTA CAG CAA TCA TTT 1115

Trp Cys Cys His Leu Glu Glu Val Phe Arg Lys Val Gin Gin Ser Phe

335 340 345 350

GAA ACT CCA AGG GCC AAA GCT CAA ATG CCC ACC ATA GAA CGA CTG TCC 1163

Glu Thr Pro Arg Ala Lys Ala Gin Met Pro Thr He Glu Arg Leu Ser

355 360 365 ATG ACA AGA TAT TTC TAC CTC TTT CCT GGC AAT TGAAAATGGAA 1207

Met Thr Arg Tyr Phe Tyr Leu Phe Pro Gly Asn 370 375

GCCACAAGCA GCCCAGCCCT CCTTAATCAA CTTCAAGGAG CACCTTCATT AGTACAGCTT 1267 GCATATTTAA CAT 1280

(2) INFORMATION FOR SEQ ID NO:2 : (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 377 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

Met Ala Glu Gly Asn His Arg Lys Lys Pro Leu Lys Val Leu Glu Ser 1 5 10 15

Leu Gly Lys Asp Phe Leu Thr Gly Val Leu Asp Asn Leu Val Glu Gin 20 25 30

Asn Val Leu Asn Trp Lys Glu Glu Glu Lys Lys Lys Tyr Tyr Asp Ala

35 40 45 Lys Thr Glu Asp Lys Val Arg Val Met Ala Asp Ser Met Gin Glu Lys

50 55 60

Gin Arg Met Ala Gly Gin Met Leu Leu Gin Thr Phe Phe Asn He Asp 65 70 75 80

Gin He Ser Pro Asn Lys Lys Ala His Pro Asn Met Glu Ala Gly Pro 85 90 95

Pro Glu Ser Gly Glu Ser Thr Asp Ala Leu Lys Leu Cys Pro His Glu 100 105 110

Glu Phe Leu Arg Leu Cys Lys Glu Arg Ala Glu Glu He Tyr Pro He 115 120 125 Lys Glu Arg Asn Asn Arg Thr Arg Leu Ala Leu He He Cys Asn Thr

130 135 140

Glu Phe Asp His Leu Pro Pro Arg Asn Gly Ala Asp Phe Asp He Thr 145 150 155 160

Gly Met Lys Glu Leu Leu Glu Gly Leu Asp Tyr Ser Val Asp Val Glu 165 170 175

Glu Asn Leu Thr Ala Arg Asp Met Glu Ser Ala Leu Arg Ala Phe Ala 180 185 190

Thr Arg Pro Glu His Lys Ser Ser Asp Ser Thr Phe Leu Val Leu Met 195 200 205 Ser His Gly He Leu Glu Gly He Cys Gly Thr Val His Asp Glu Lys 210 215 220

Lys Pro Asp Val Leu Leu Tyr Asp Thr He Phe Gin He Phe Asn Asn 225 230 235 240

Arg Asn Cys Leu Ser Leu Lys Asp Lys Pro Lys Val He He Val Gin 245 250 255 Ala Cys Arg Gly Ala Asn Arg Gly Glu Leu Trp Val Arg Asp Ser Pro 260 265 270

Ala Ser Leu Glu Val Ala Ser Ser Gin Ser Ser Glu Asn Leu Glu Glu 275 280 285

Asp Ala Val Tyr Lys Thr His Val Glu Lys Asp Phe He Ala Phe Cys 290 295 300 Ser Ser Thr Pro His Asn Val Ser Trp Arg Asp Ser Thr Met Gly Ser 305 310 315 320

He Phe He Thr Gin Leu He Thr Cys Phe Gin Lys Tyr Ser Trp Cys 325 330 335

Cys His Leu Glu Glu Val Phe Arg Lys Val Gin Gin Ser Phe Glu Thr 340 345 350

Pro Arg Ala Lys Ala Gin Met Pro Thr He Glu Arg Leu Ser Met Thr 355 360 365

Arg Tyr Phe Tyr Leu Phe Pro Gly Asn 370 375 (2) INFORMATION FOR SEQ ID NO:3 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1216 base pairs

(B) TYPE: nucleic acid (C) STRANDEDNESS: double

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA (ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 1..1212

(Xl) SEQUENCE DESCRIPTION: SEQ ID NO:3 :

ATG GCC GAC AAG GTC CTG AAG GAG AAG AGA AAG CTG TTT ATC CGT TCC 48 Met Ala Asp Lys Val Leu Lys Glu Lys Arg Lys Leu Phe He Arg Ser 1 5 10 15 ATG GGC GAA GGT ACA ATA AAT GGC TTA CTG GAT GAA TTA TTA CAG ACA 96 Met Gly Glu Gly Thr He Asn Gly Leu Leu Asp Glu Leu Leu Gin Thr 20 25 30

AGG GTG CTG AAC AAG GAA GAG ATG GAG AAA GTA AAA CGT GAA AAT GCT 144 Arg Val Leu Asn Lys Glu Glu Met Glu Lys Val Lys Arg Glu Asn Ala 35 40 45

ACA GTT ATG GAT AAG ACC CGA GCT TTG ATT GAC TCC GTT ATT CCG AAA 192 Thr Val Met Asp Lys Thr Arg Ala Leu He Asp Ser Val He Pro Lys 50 55 60

GGG GCA CAG GCA TGC CAA ATT TGC ATC ACA TAC ATT TGT GAA GAA GAC 240 Gly Ala Gin Ala Cys Gin He Cys He Thr Tyr He Cys Glu Glu Asp 65 70 75 80 AGT TAC CTG GCA GGG ACG CTG GGA CTC TCA GCA GAT CAA ACA TCT GGA 288 Ser Tyr Leu Ala Gly Thr Leu Gly Leu Ser Ala Asp Gin Thr Ser Gly 85 90 95

AAT TAC CTT AAT ATG CAA GAC TCT CAA GGA GTA CTT TCT TCC TTT CCA 336 Asn Tyr Leu Asn Met Gin Asp Ser Gin Gly Val Leu Ser Ser Phe Pro 100 105 110 GCT CCT CAG GCA GTG CAG GAC AAC CCA GCT ATG CCC ACA TCC TCA GGC 384 Ala Pro Gin Ala Val Gin Asp Asn Pro Ala Met Pro Thr Ser Ser Gly 115 120 125

TCA GAA GGG AAT GTC AAG CTT TGC TCC CTA GAA GAA GCT CAA AGG ATA 432 Ser Glu Gly Asn Val Lys Leu Cys Ser Leu Glu Glu Ala Gin Arg He 130 135 140

TGG AAA CAA AAG TCG GCA GAG ATT TAT CCA ATA ATG GAC AAG TCA AGC 480 Trp Lys Gin Lys Ser Ala Glu He Tyr Pro He Met Asp Lys Ser Ser 145 150 155 160

CGC ACA CGT CTT GCT CTC ATT ATC TGC AAT GAA GAA TTT GAC AGT ATT 528 Arg Thr Arg Leu Ala Leu He He Cys Asn Glu Glu Phe Asp Ser He 165 170 175

CCT AGA AGA ACT GGA GCT GAG GTT GAC ATC ACA GGC ATG ACA ATG CTG 576 Pro Arg Arg Thr Gly Ala Glu Val Asp He Thr Gly Met Thr Met Leu 180 185 190 CTA CAA AAT CTG GGG TAC AGC GTA GAT GTG AAA AAA AAT CTC ACT GCT 624 Leu Gin Asn Leu Gly Tyr Ser Val Asp Val Lys Lys Asn Leu Thr Ala 195 200 205

TCG GAC ATG ACT ACA GAG CTG GAG GCA TTT GCA CAC CGC CCA GAG CAC 672 Ser Asp Met Thr Thr Glu Leu Glu Ala Phe Ala His Arg Pro Glu His 210 215 220

AAG ACC TCT GAC AGC ACG TTC CTG GTG TTC ATG TCT CAT GGT ATT CGG 720 Lys Thr Ser Asp Ser Thr Phe Leu Val Phe Met Ser His Gly He Arg 225 230 235 240

GAA GGC ATT TGT GGG AAG AAA CAC TCT GAG CAA GTC CCA GAT ATA CTA 768

Glu Gly He Cys Gly Lys Lys His Ser Glu Gin Val Pro Asp He Leu 245 250 255

CAA CTC AAT GCA ATC TTT AAC ATG TTG AAT ACC AAG AAC TGC CCA AGT 816

Gin Leu Asn Ala He Phe Asn Met Leu Asn Thr Lys Asn Cys Pro Ser 260 265 270 TTG AAG GAC AAA CCG AAG GTG ATC ATC ATC CAG GCC TGC CGT GGT GAC 864 Leu Lys Asp Lys Pro Lys Val He He He Gin Ala Cys Arg Gly Asp 275 280 285

AGC CCT GGT GTG GTG TGG TTT AAA GAT TCA GTA GGA GTT TCT GGA AAC 912 Ser Pro Gly Val Val Trp Phe Lys Asp Ser Val Gly Val Ser Gly Asn 290 295 300 CTA TCT TTA CCA ACT ACA GAA GAG TTT GAG GAT GAT GCT ATT AAG AAA 960 Leu Ser Leu Pro Thr Thr Glu Glu Phe Glu Asp Asp Ala He Lys Lys 305 310 315 320 GCC CAC ATA GAG AAG GAT TTT ATC GCT TTC TGC TCT TCC ACA CCA GAT 1008 Ala His He Glu Lys Asp Phe He Ala Phe Cys Ser Ser Thr Pro Asp 325 330 335

AAT GTT TCT TGG AGA CAT CCC ACA ATG GGC TCT GTT TTT ATT GGA AGA 1056 Asn Val Ser Trp Arg His Pro Thr Met Gly Ser Val Phe He Gly Arg 340 345 350

CTC ATT GAA CAT ATG CAA GAA TAT GCC TGT TCC TGT GAT GTG GAG GAA 1104 Leu He Glu His Met Gin Glu Tyr Ala Cys Ser Cys Asp Val Glu Glu 355 360 365

ATT TTC CGC AAG GTT CGA TTT TCA TTT GAG CAG CCA GAT GGT AGA GCG 1152

He Phe Arg Lys Val Arg Phe Ser Phe Glu Gin Pro Asp Gly Arg Ala

370 375 380

CAG ATG CCC ACC ACT GAA AGA GTG ACT TTG ACA AGA TGT TTC TAC CTC 1200

Gin Met Pro Thr Thr Glu Arg Val Thr Leu Thr Arg Cys Phe Tyr Leu 385 390 395 400 TTC CCA GGA CAT TAAA 1216

Phe Pro Gly His

(2) INFORMATION FOR SEQ ID NO:4 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 404 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:

Met Ala Asp Lys Val Leu Lys Glu Lys Arg Lys Leu Phe He Arg Ser 1 5 10 15

Met Gly Glu Gly Thr He Asn Gly Leu Leu Asp Glu Leu Leu Gin Thr 20 25 30

Arg Val Leu Asn Lys Glu Glu Met Glu Lys Val Lys Arg Glu Asn Ala 35 40 45 Thr Val Met Asp Lys Thr Arg Ala Leu He Asp Ser Val He Pro Lys 50 55 60

Gly Ala Gin Ala Cys Gin He Cys He Thr Tyr He Cys Glu Glu Asp 65 70 75 80

Ser Tyr Leu Ala Gly Thr Leu Gly Leu Ser Ala Asp Gin Thr Ser Gly 85 90 95 Asn Tyr Leu Asn Met Gin Asp Ser Gin Gly Val Leu Ser Ser Phe Pro 100 105 110

Ala Pro Gin Ala Val Gin Asp Asn Pro Ala Met Pro Thr Ser Ser Gly 115 120 125

Ser Glu Gly Asn Val Lys Leu Cys Ser Leu Glu Glu Ala Gin Arg He 130 135 140 Trp Lys Gin Lys Ser Ala Glu He Tyr Pro He Met Asp Lys Ser Ser 145 150 155 160

Arg Thr Arg Leu Ala Leu He He Cys Asn Glu Glu Phe Asp Ser He 165 170 175

Pro Arg Arg Thr Gly Ala Glu Val Asp He Thr Gly Met Thr Met Leu 180 185 190

Leu Gin Asn Leu Gly Tyr Ser Val Asp Val Lys Lys Asn Leu Thr Ala 195 200 205

Ser Asp Met Thr Thr Glu Leu Glu Ala Phe Ala His Arg Pro Glu His 210 215 220 Lys Thr Ser Asp Ser Thr Phe Leu Val Phe Met Ser His Gly He Arg 225 230 235 240

Glu Gly He Cys Gly Lys Lys His Ser Glu Gin Val Pro Asp He Leu 245 250 255

Gin Leu Asn Ala He Phe Asn Met Leu Asn Thr Lys Asn Cys Pro Ser 260 265 270

Leu Lys Asp Lys Pro Lys Val He He He Gin Ala Cys Arg Gly Asp 275 280 285

Ser Pro Gly Val Val Trp Phe Lys Asp Ser Val Gly Val Ser Gly Asn 290 295 300 Leu Ser Leu Pro Thr Thr Glu Glu Phe Glu Asp Asp Ala He Lys Lys 305 310 315 320

Ala His He Glu Lys Asp Phe He Ala Phe Cys Ser Ser Thr Pro Asp 325 330 335

Asn Val Ser Trp Arg His Pro Thr Met Gly Ser Val Phe He Gly Arg 340 345 350

Leu He Glu His Met Gin Glu Tyr Ala Cys Ser Cys Asp Val Glu Glu 355 360 365

He Phe Arg Lys Val Arg Phe Ser Phe Glu Gin Pro Asp Gly Arg Ala 370 375 380 Gin Met Pro Thr Thr Glu Arg Val Thr Leu Thr Arg Cys Phe Tyr Leu 385 390 395 400

Phe Pro Gly His (2) INFORMATION FOR SEQ ID NO: 5 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 402 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5 :

Met Ala Asp Lys He Leu Arg Ala Lys Arg Lys Gin Phe He Asn Ser 1 5 10 15

Val Ser He Gly Thr He Asn Gly Leu Leu Asp Glu Leu Leu Glu Lys

20 25 30

Arg Val Leu Asn Gin Glu Glu Met Asp Lys He Lys Leu Ala Asn He 35 40 45

Thr Ala Met Asp Lys Ala Arg Asp Leu Cys Asp His Val Ser Lys Lys 50 55 60

Gly Pro Gin Ala Ser Gin He Phe He Thr Tyr He Cys Asn Glu Asp 65 70 75 80

Cys Tyr Leu Ala Gly He Leu Glu Leu Gin Ser Ala Pro Ser Ala Glu 85 90 95

Thr Phe Val Ala Thr Glu Asp Ser Lys Gly Gly His Pro Ser Ser Ser 100 105 110

Glu Thr Lys Glu Glu Gin Asn Lys Glu Asp Gly Thr Phe Pro Gly Leu 115 120 125

Thr Gly Thr Leu Lys Phe Cys Pro Leu Glu Lys Ala Gin Lys Leu Trp 130 135 140

Lys Glu Asn Pro Ser Glu He Tyr Pro He Met Asn Thr Thr Thr Arg 145 150 155 160

Thr Arg Leu Ala Leu He He Cys Asn Thr Glu Phe Gin His Leu Ser 165 170 175

Pro Arg Val Gly Ala Gin Val Asp Leu Arg Glu Met Lys Leu Leu Leu 180 185 190 Glu Asp Leu Gly Tyr Thr Val Lys Val Lys Glu Asn Leu Thr Ala Leu

195 200 205

Glu Met Val Lys Glu Val Lys Glu Phe Ala Ala Cys Pro Glu His Lys 210 215 220

Thr Ser Asp Ser Thr Phe Leu Val Phe Met Ser His Gly He Gin Glu 225 230 235 240 Gly He Cys Gly Thr Thr Tyr Ser Asn Glu Val Ser Asp He Leu Lys 245 250 255

Val Asp Thr He Phe Gin Met Met Asn Thr Leu Lys Cys Pro Ser Leu 260 265 270

Lys Asp Lys Pro Lys Val He He He Gin Ala Cys Arg Gly Glu Lys 275 280 285 Gin Gly Val Val Leu Leu Lys Asp Ser Val Arg Asp Ser Glu Glu Asp 290 295 300

Phe Leu Thr Asp Ala He Phe Glu Asp Asp Gly He Lys Lys Ala His 305 310 315 320

He Glu Lys Asp Phe He Ala Phe Cys Ser Ser Thr Pro Asp Asn Val 325 330 335

Ser Trp Arg His Pro Val Arg Gly Ser Leu Phe He Glu Ser Leu He 340 345 350

Lys His Met Lys Glu Tyr Ala Trp Ser Cys Asp Leu Glu Asp He Phe 355 360 365

Arg Lys Val Arg Phe Ser Phe Glu Gin Pro Glu Phe Arg Leu Gin Met 370 375 380

Pro Thr Ala Asp Arg Val Thr Leu Thr Lys Arg Phe Tyr Leu Phe Pro 385 390 395 400

Gly His

(2) INFORMATION FOR SEQ ID NO:6 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 403 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6 :

Met Ala Asp Lys Val Leu Arg Ala Lys Arg Lys Gin Phe He Asn Ser 1 5 10 15

Val Ser Val Gly Thr He Asn Gly Leu Leu Asp Glu Leu Leu Glu Lys 20 25 30

Arg Val Leu Asn Gin Glu Glu Met Asp Thr He Lys Leu Ala Asn He 35 40 45 Thr Val Met Glu Lys Ala Arg Asp Leu Cys Asp His Val Thr Lys Lys 50 55 60

Gly Pro Arg Ala Ser Gin Met Phe He Thr Tyr He Cys Asn Glu Asp 65 70 75 80 Cys Tyr Leu Ala Glu He Leu Glu Leu Gin Ser Gly Pro Ser Ala Glu 85 90 95

Thr Val Glu Val Thr Glu Asp Ser Lys Gly Gly His Pro Phe Ser Ser 100 105 110

Glu Thr Lys Glu Lys Leu Asn Lys Glu Gly Gly Ala Phe Pro Gly Pro

115 120 125

Pro Ser Gly Ser Leu Lys Phe Cys Pro Leu Glu He Ala Gin Lys Leu 130 135 140

Trp Lys Glu Asn His Ser Glu He Tyr Pro He Met Lys Thr Pro Thr 145 150 155 160

Arg Thr Arg Leu Ala Leu He He Cys Asn Thr Asp Phe Gin His Leu 165 170 175 Ser Arg Arg Val Gly Ala Asp Val Asp Leu Arg Glu Met Lys Leu Leu

180 185 190

Leu Gin Asp Leu Gly Tyr Thr Val Lys Val Lys Glu Asn Leu Thr Ala 195 200 205

Leu Glu Met Thr Lys Glu Leu Lys Glu Phe Ala Ala Cys Pro Glu His 210 215 220

Lys Thr Ser Asp Ser Thr Phe Leu Val Phe Met Ser His Gly Leu Gin 225 230 235 240

Glu Gly He Cys Gly He Thr Tyr Ser Asn Glu Val Ala Asp He Leu 245 250 255

Lys Val Asp Thr He Phe Gin Met Met Asn Thr Leu Lys Cys Pro Ser 260 265 270

Leu Lys Asp Lys Pro Lys Val He He He Gin Ala Cys Arg Gly Glu 275 280 285

Lys Gin Gly Val Val Leu Leu Lys Asp Ser Val Gly Asn Ser Glu Glu 290 295 300

Gly Phe Leu Thr Asp Ala He Phe Glu Asp Asp Gly He Lys Lys Ala 305 310 315 320

His He Glu Lys Asp Phe He Ala Phe Cys Ser Ser Thr Pro Asp Asn 325 330 335 Val Ser Trp Arg His Pro Val Arg Gly Ser Leu Phe He Glu Ser Leu

340 345 350

He Lys His Met Lys Glu Tyr Ala Trp Ser Cys Asp Leu Glu Asp He 355 360 365

Phe Arg Lys Val Arg Phe Ser Phe Glu Gin Pro Asp Ser Arg Leu Gin 370 375 380 Met Pro Thr Thr Glu Arg Val Thr Leu Thr Lys Arg Phe Tyr Leu Phe 385 390 395 400

Pro Gly His

(2) INFORMATION FOR SEQ ID NO:7 :

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 452 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7

Met Ala Ala Pro Ser Ala Gly Ser Trp Ser Thr Phe Gin His Lys Glu 1 5 10 15

Leu Met Ala Ala Asp Arg Gly Arg Arg He Leu Gly Val Cys Gly Met 20 25 30

His Pro His His Gin Glu Thr Leu Lys Lys Asn Arg Val Val Leu Ala 35 40 45

Lys Gin Leu Leu Leu Ser Glu Leu Leu Glu His Leu Leu Glu Lys Asp 50 55 60

He He Thr Leu Glu Met Arg Glu Leu He Gin Ala Lys Val Gly Ser 65 70 75 80

Phe Ser Gin Asn Val Glu Leu Leu Asn Leu Leu Pro Lys Arg Gly Pro 85 90 95

Gin Ala Phe Asp Ala Phe Cys Glu Ala Leu Arg Glu Thr Lys Gin Gly 100 105 110 His Leu Glu Asp Met Leu Leu Thr Thr Leu Ser Gly Leu Gin His Val

115 120 125

Leu Pro Pro Leu Ser Cys Asp Tyr Asp Leu Ser Leu Pro Phe Pro Val

130 135 140

Cys Glu Ser Cys Pro Leu Tyr Lys Lys Leu Arg Leu Ser Thr Asp Thr

145 150 155 160

Val Glu His Ser Leu Asp Asn Lys Asp Gly Pro Val Cys Leu Gin Val 165 170 175

Lys Pro Cys Thr Pro Glu Phe Tyr Gin Thr His Phe Gin Leu Ala Tyr 180 185 190 Arg Leu Gin Ser Arg Pro Arg Gly Leu Ala Leu Val Leu Ser Asn Val

195 200 205

His Phe Thr Gly Glu Lys Glu Leu Glu Phe Arg Ser Gly Gly Asp Val 210 215 220 Asp His Ser Thr Leu Val Thr Leu Phe Lys Leu Leu Gly Tyr Asp Val 225 230 235 240

His Val Leu Cys Asp Gin Thr Ala Gin Glu Met Gin Glu Lys Leu Gin 245 250 255

Asn Phe Ala Gin Leu Pro Ala His Arg Val Thr Asp Ser Cys He Val 260 265 270

Ala Leu Leu Ser His Gly Val Glu Gly Ala He Tyr Gly Val Asp Gly 275 280 285

Lys Leu Leu Gin Leu Gin Glu Val Phe Gin Leu Phe Asp Asn Ala Asn 290 295 300

Cys Pro Ser Leu Gin Asn Lys Pro Lys Met Phe Phe He Gin Ala Cys 305 310 315 320 Arg Gly Asp Glu Thr Asp Arg Gly Val Asp Gin Gin Asp Gly Lys Asn

325 330 335

His Ala Gly Ser Pro Gly Cys Glu Glu Ser Asp Ala Gly Lys Glu Lys 340 345 350

Leu Pro Lys Met Arg Leu Pro Thr Arg Ser Asp Met He Cys Gly Tyr 355 360 365

Ala Cys Leu Lys Gly Thr Ala Ala Met Arg Asn Thr Lys Arg Gly Ser 370 375 380

Trp Tyr He Glu Ala Leu Ala Gin Val Phe Ser Glu Arg Ala Cys Asp 385 390 395 400 Met His Val Ala Asp Met Leu Val Lys Val Asn Ala Leu He Lys Asp

405 410 415

Arg Glu Gly Tyr Ala Pro Gly Thr Glu Phe His Arg Cys Lys Glu Met 420 425 430

Ser Glu Tyr Cys Ser Thr Leu Cys Arg His Leu Tyr Leu Phe Pro Gly 435 440 445

His Pro Pro Thr 450

(2) INFORMATION FOR SEQ ID NO:8 :

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 277 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8 : Met Glu Asn Thr Glu Asn Ser Val Asp Ser Lys Ser He Lys Asn Leu 1 5 10 15

Glu Pro Lys He He His Gly Ser Glu Ser Met Asp Ser Gly He Ser 20 25 30

Leu Asp Asn Ser Tyr Lys Met Asp Tyr Pro Glu Met Gly Leu Cys He 35 40 45 He He Asn Asn Lys Asn Phe His Lys Ser Thr Gly Met Thr Ser Arg 50 55 60

Ser Gly Thr Asp Val Asp Ala Ala Asn Leu Arg Glu Thr Phe Arg Asn 65 70 75 80

Leu Lys Tyr Glu Val Arg Asn Lys Asn Asp Leu Thr Arg Glu Glu He 85 90 95

Val Glu Leu Met Arg Asp Val Ser Lys Glu Asp His Ser Lys Arg Ser 100 105 110

Ser Phe Val Cys Val Leu Leu Ser His Gly Glu Glu Gly He He Phe 115 120 125 Gly Thr Asn Gly Pro Val Asp Leu Lys Lys He Thr Asn Phe Phe Arg 130 135 140

Gly Asp Arg Cys Arg Ser Leu Thr Gly Lys Pro Lys Leu Phe He He 145 150 155 160

Gin Ala Cys Arg Gly Thr Glu Leu Asp Cys Gly He Glu Thr Asp Ser 165 170 175

Gly Val Asp Asp Asp Met Ala Cys His Lys He Pro Val Asp Ala Asp 180 185 190

Phe Leu Tyr Ala Tyr Ser Thr Ala Pro Gly Tyr Tyr Ser Trp Arg Asn 195 200 205 Ser Lys Asp Gly Ser Trp Phe He Gin Ser Leu Cys Ala Met Leu Lys 210 215 220

Gin Tyr Ala Asp Lys Leu Glu Phe Met His He Leu Thr Arg Val Asn 225 230 235 240

Arg Lys Val Ala Thr Glu Phe Glu Ser Phe Ser Phe Asp Ala Thr Phe 245 250 255

His Ala Lys Lys Gin He Pro Cys He Val Ser Met Leu Thr Lys Glu 260 265 270

Leu Tyr Phe Tyr His 275 (2) INFORMATION FOR SEQ ID NO: 9 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 31 base pairs

(B) TYPE: nucleic acid (C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:

CCCACTAGTT CCCTATGGCA GAAGGCAACC A 31

(2) INFORMATION FOR SEQ ID NO:10:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 31 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS : single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:

CCCGGATCCA TTTTCAATTG CCAGGAAAGA G 31

(2) INFORMATION FOR SEQ ID NO:11:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 104 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:ll:

GGGGAATTCA TGGGTCATCA TCATCATCAT CATGGTAGCG GTCATATCGA CGACGACGAC 60 AAGGCTCTGA AACTGTGTCC GCATGAAGAG TTCCTGAGAC TATG 104

(2) INFORMATION FOR SEQ ID NO:12:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:

GGGGGATCCT CTATTAATTG CCAGGAAAGA GGTAG 35 (2) INFORMATION FOR SEQ ID NO:13:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 36 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:

CCCACTAGTA GGATGGCGGA GTCTTCGGAT AAGCTC 36

(2) INFORMATION FOR SEQ ID NO: 14 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid (C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:

AAGAGTTAAT TTCATTCTCT 20

(2) INFORMATION FOR SEQ ID NO:15:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

( i) SEQUENCE DESCRIPTION: SEQ ID NO: 15

GTCTGAGGAC TTCCTCCAGG A 21 (2) INFORMATION FOR SEQ ID NO:16:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 36 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:

CCCAGATCTT TACCACAGGG AGGTCTTAAA ATTGAA 36

(2) INFORMATION FOR SEQ ID NO:17:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 4 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:

Tyr Val Ala Asp l

(2) INFORMATION FOR SEQ ID NO:18:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 90 base pairs (B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:

CGGGATCCTA TAAATATGCA CCACCATCAT CACCACGGAT CTGGTCATAT TGATGATGAT 60

GATAAGGCAG AAGGCAACCA CAGAAAAAAG 90 (2) INFORMATION FOR SEQ ID NO:19:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 87 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single (D) TOPOLOGY: linear

(ii) MOLECULE TYPE*. DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19: CGGGATCCTA TAAATATGCA CCACCATCAT CACCACGGAT CTGGTCATAT TGATGATGAT 60 GATAAGGCCC TCAAGCTTTG TCCTCAT 87

(2) INFORMATION FOR SEQ ID NO: 0: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 42 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:

ATAGTTTAGC GGCCGCAATT TCAATTGCCA GGAAAGAGGT AG 42

(2) INFORMATION FOR SEQ ID NO:21:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 31 base pairs

(B) TYPE: nucleic acid (C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:

CCCACTAGTT CCCTATGGCA GAAGGCAACC A 31

(2) INFORMATION FOR SEQ ID NO:22:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:

GGGATATTTG GTCTATGTT 19

(2) INFORMATION FOR SEQ ID NO:23:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 4 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide

(ix) FEATURE: (A) NAME/KEY: Modified-site

(B) LOCATION: 3 (D) OTHER INFORMATION: /note= "Xaa is Ala or Ser or Val" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:

Leu Glu Xaa Asp

1

Claims

I . An isolated Ich-2 protein, or a proteolytic cleavage product thereof.

2. The protein of claim 1 , wherein the proteolytic cleavage product is a 10 kilodalton subunit of a mature Ich-2 protein.

3. The protein of claim 1, wherein the proteolytic cleavage product is a 20 kilodalton subunit of a mature Ich-2 protein.

4. The protein of claim 1 , which comprises an amino acid sequence shown in SEQ ID NO: 2.

5. The protein of claim 4, which comprises an amino acid sequence between about positions 105 and 377 of SEQ ID NO: 2.

6. The protein of claim 4, which comprises an amino acid sequence between about positions 105 and 270 of SEQ ID NO: 2.

7. The protein of claim 4, which comprises an amino acid sequence between about positions 290 and 377 of SEQ ID NO: 2.

8. The protein of claim 4, comprising at least one subunit having an amino acid sequence between about positions 105 and 270 of SEQ ID NO: 2 and at least one subunit having an amino acid sequence between about positions 290 and 377 of SEQ ID NO: 2.

9. The protein of claim 1, which is a fusion protein comprising an Ich-2 polypeptide operatively linked to a non-Ich-2 polypeptide.

10. The protein of claim 9, wherein the non-Ich-2 polypeptide comprises a polyhistidine sequence.

I I . A non-naturally occurring homolog of the protein of claim 4, wherein the homolog comprises an amino acid sequence that is at least 70 % identical to the amino acid sequence shown in SEQ ID NO: 2, includes amino acid residues corresponding to the histidine at position 210, the cysteine at position 258, the arginine at position 152, the glutamine at position 256, the arginine at position 314 and the serine at position 320 of SEQ ID NO: 2, and has proteolytic activity.

12. The homolog of claim 1 1 , which has an amino acid sequence that is at least 80 % identical to the amino acid sequence shown in SEQ ID NO: 2.

13. The homolog of claim 11 , which has an amino acid sequence that is at least 90 % identical to the amino acid sequence shown in SEQ ID NO: 2.

14. An antibody that binds to the protein of claim 1.

15. The antibody of claim 14, which is a monoclonal antibody.

16. A method for modulating apoptosis in a cell comprising contacting the cell with an agent that modulates activity of Ich-2 in the cell.

17. The method of claim 16, wherein apoptosis is stimulated in the cell.

18. The method of claim 16, wherein the agent is a nucleic acid encoding Ich-2 that has been introduced into the cell.

19. The method of claim 16, wherein the agent stimulates activity of endogenous Ich-2 in the cell.

20. The method of claim 17, wherein the cell is diseased.

21. The method of claim 16, wherein apoptosis is inhibited in the cell.

22. The method of claim 21 , wherein the agent inhibits activity of endogenous Ich-2 in the cell.

23. The method of claim 22, wherein the agent is an antisense Ich-2 nucleic acid molecule.

24. The method of claim 21 , wherein apoptosis in the cell is inhibited to ameliorate a degenerative disease condition.

25. A method for identifying a modulator of Ich-2 protease activity, comprising a) contacting a mature form of an Ich-2 protein with a potential substrate for the protein in the presence of a test agent under proteolytic conditions; b) measuring Ich-2 protease activity against the substrate in the presence of the test agent; and c) identifying a modulator of Ich-2 protease activity.

26. The method of claim 25, wherein the Ich-2 protein comprises an amino acid sequence shown in SEQ ID NO: 2.

27. The method of claim 26, wherein the mature form of the Ich-2 protein comprises at least one subunit comprising an amino acid sequence between about positions 105 and 270 of SEQ ID NO: 2 and at least one subunit comprising an amino acid sequence between about positions 290 and 377 of SEQ ID NO: 2.

28. The method of claim 25, wherein the mature form of the protein is derived from a polyhistidine fusion protein expressed in E. coli.

29. The method of claim 25, wherein the potential substrate for the mature form of the Ich-2 protein is a peptide having an aspartic acid residue at the PI position, or a fluorogenic or chromogenic derivative thereof.

30. The method of claim 29, wherein the peptide comprises an amino acid sequence Tyr- Val-Ala-Asp (SEQ ID NO: 17).

31. The method of claim 30, wherein the peptide is selected from the group consisting of acetyl-Tyr-Val-Ala-Asp-/>-nitroanilide, acetyl-Tyr-Val-Ala-Asp-amino-4-methylcoumarin and Ac-Tyr-Val-Ala-Asp-Gly-Trp-amide.

32. The method of claim 25, wherein the potential substrate for the mature form of the Ich-2 protein is poly(ADP-ribose) polymerase.

33. The method of claim 25, wherein the potential substrate for the mature form of the Ich-2 protein is prointerleukin-l β.

34. The method of claim 25, wherein the modulator inhibits Ich-2 protease activity.

35. The method of claim 25, wherein the modulator stimulates Ich-2 protease activity.

36. Use of an agent that modulates activity of Ich-2 in a cell in the manufacture of a medicament for modulating cysteine protease activity in a subject.

37. The use of claim 36, wherein the agent is a nucleic acid molecule encoding Ich-2.

38. The use of claim 36, wherein the agent is an antisense nucleic acid that binds to lch-2 mRNA.

39. The use of claim 36, wherein the agent is an Ich-2 protein, or a proteolytic cleavage product thereof.

40. The use of claim 36, wherein the agent is an antibody that binds an Ich-2 protein.

41. The use of claim 36, wherein the agent stimulates activity of endogenous Ich-2 in cells of the subject.

42. The use of claim 36, wherein the agent inhibits activity of endogenous Ich-2 in cells of the subject.

43. Use of an agent that modulates activity of Ich-2 in a cell in the manufacture of a medicament for modulating apoptosis in a subject.

44. The use of claim 43, wherein the agent is a nucleic acid molecule encoding Ich-2.

45. The use of claim 43, wherein the agent is an antisense nucleic acid that binds to Ich-2 mRNA.

46. The use of claim 43, wherein the agent is an Ich-2 protein, or a proteolytic cleavage product thereof.

47. The use of claim 43, wherein the agent is an antibody that binds an Ich-2 protein.

48. The use of claim 43, wherein the agent stimulates activity of endogenous Ich-2 in cells of the subject.

49. The use of claim 43, wherein the agent inhibits activity of endogenous Ich-2 in cells of the subject.