MXPA00011566A - Alg-2lp, alg-2 like molecules and uses therefor - Google Patents

Abstract

The invention provides isolated nucleic acids molecules, designated hALG-2LP, sALG-2LP, and mALG-2LP nucleic acid molecules, which encode proteins involved in the modulation of programmed cell death. The invention also provides antisense nucleic acid molecules, recombinant expression vectors containing hALG-2LP, sALG-2LP, and mALG-2LP nucleic acid molecules, host cells into which the expression vectors have been introduced, and nonhuman transgenic animals in which a hALG-2LP, sALG-2LP, and mALG-2LP gene has been introduced or disrupted. The invention still further provides isolated hALG-2LP, sALG-2LP, and mALG-2LP proteins, fusion proteins, antigenic peptides and anti-hALG-2LP, sALG-2LP, and mALG-2LP antibodies. Diagnostic methods utilizing compositions of the invention are also provided.

Description

ALG-2LP, MOLECULES OF TYPE ALG-2 AND USES OF THE SAME BACKGROUND OF THE INVENTION During the embryonic and normal adult development of multicellular organisms, the cells that are not necessary or are harmful are eliminated by a process known as cell death programmed or apoptosis (Ellis R.E. et al (1991) Annual Rev. Cell Biol. 7: 663-698).

The programmed death of cells occurs in both vertebrates and invertebrates and is characterized by unique morphological alterations such as cytoplasmic contraction and chromatin condensation, as well as by specific dissociation of DNA in oligonucleosomal fragments. Unlike necrosis, the programmed death of cells or apoptosis is an irreversible process that, in most systems, seems to depend on the expression of a specific set of novel "death genes". The deregulation of this process contributes to the pathogenesis of several diseases including neurodegenerative disorders, cancers, immunodeficiencies, and autoimmune diseases (Thompson C.B. et al. (1995) Science 267: 1456). It is believed that calcium plays an important regulatory role in programmed cell death or apoptosis (Trump B.F. et al. (1992) Curr. Opin. Cell Biol. 4: 227-232). The initial evidence came from studies that demonstrated that a sustained elevation of cytosolic calcium could induce apoptosis in thymocytes (Durant S. et al (1980) Biochem. Biophys. Res. Commun. 93: 385-391). A sustained increase in calcium concentration can activate numerous potentially harmful processes in the cell. Some of these processes include the activation of hydrolytic enzymes such as phospholipase A2, calcium activated proteases, and calcium-activated endonucleases; the destabilization of the cytoskeleton; the disorder of the cellular unions which leads to the decrease or absence of cell-cell communication; and the activation of the expression of immediate-early genes, such as c-fos, c-jun, and c-myc (Zhong LT et al. (1993) Proc. Nati. Acad. Sci. USA 90: 4533-4573) . Several mechanisms can interact to deregulate the intracellular calcium concentration. Initially, this interaction can be specific for organelles, for example anoxia that inhibits mitochondrial respiration, tapsigargin that inhibits ER Ca2 + -ATPase (Thasturp, O. Et al (1990) Proc. Nati. Acad. Sci. USA 87 2466- 2470), or active complement that permeabilizes the plasma membrane.

An increased cytosolic concentration of ionized sodium can also affect the cytosolic calcium concentration due to the importance of NaVCa2 + exchange in many cells (Snowdo ne, K.W. et al. (1985) J. Biol. Chem. 260, 14998-15007). The increased cytosolic concentration of sodium can also result in the increase of pHx through activation of the Na + / H + exchange. The decrease in pHx significantly retards the rate of progression of cell death after injury in several cells, probably by antagonizing Ca2 + mediated effects on phospholipases, proteases, and endonucleases, while a pHj. Increased frequently accelerates the progress towards the death of the cell. In addition, the activation of membrane receptors by binding and interaction of ligand with G proteins frequently results in the activation of PLC-β and PLC- ?. This in turn mediates, inter alia, the formation of 1, 4, 5-inositol triphosphate (IP3) and 1,2-diacylglycerol. IP3 in turn mediates the release of Ca2 + from ER that, through the formation of a calcium influx factor, can result in an increased influx of Ca -2+ into the cell. COMPENDIUM OF THE INVENTION This invention offers, at least in part, novel nucleic acid molecules that encode proteins that modulate the programmed death of cells, for example, the programmed death of cells expressing these proteins. Examples of nucleic acid molecules encoding such proteins include ALG-2LP, Monkey ALG-2LP, and mouse ALG-2LP, which are also referred to herein as gene-2 type proteins related to apoptosis (ALG-2LP). In a preferred embodiment, the hALG-2LP, SALG-2LP and mALG-2LP proteins interact with a protein (e.g., bind with it), or a portion or subunit thereof, that is a member of a death transduction pathway. programmed of the cells. ALG-2 was identified for the first time in a screening to detect genes involved in apoptosis and has subsequently been shown, in antisense experiments, to be required for cell death induced by the fas ligand (Vito P. et al., 1996). ) Science 271: 521-525). ALG-2 consists of 191 amino acids and contains two EF hand structures of canonical calcium binding. The proteins presented here have sequence homology with ALG-2 and therefore are likely to participate in similar biological processes, for example, they are likely to modulate the programmed death of the cells. Accordingly, the type 2 protein molecules of apoptosis related gene, eg, hALG-2LP, SALG-2LP, and mALG-2LP, can be employed to modulate the activity of the transduction pathway of programmed cell death related to molecules and can be used to offer new therapeutic approaches for the treatment of disorders characterized by the deregulation of programmed cell death. Examples of disorders characterized by the deregulation of programmed cell death include neurodegenerative disorders such as Alzheimer's disease, dementias related to Alzheimer's disease (eg Pick's disease), Parkinson's disease, and other diffuse Lewy body diseases. , multiple sclerosis, amyotrophic lateral sclerosis, progressive supranuclear palsy, epilepsy, Jacob-Creutzfieldt's disease, or AIDS-related dementia; or proliferative disorders, for example, cancer, such as chronic lymphocytic leukemia or colorectal cancer. In addition, since they are involved in programmed cell death, genes hALG-2LP, SALG-2LP, or mALG-2LP that contain genetic lesions can be detected in order to diagnose a disorder characterized by an aberrant or abnormal expression of nucleic acid of hALG-2LP, SALG-2LP or mALG-2LP or aberrant or abnormal protein activity hALG-2LP, SALG-2LP, or mALG-2LP, for example, a neurodegenerative disorder. In addition, another aspect of the present invention relates to isolated nucleic acid molecules (e.g., cDNA) which consist of a nucleotide sequence encoding a protein "hALG-2LP, sALG-2LP, either mALG-2LP or a biologically active portion thereof, as well as nucleic acid fragments suitable for use as primers or as hybridization probes for the detection of nucleic acid encoding IALG-2LP, SALG-2LP, or mALG-2LP (e.g. MRNA) In preferred embodiments, the isolated nucleic acid molecules comprise the nucleotide sequences of SEQ ID Nos: 1, 4 or 7, the nucleotide sequence of the plasmid DNA insert deposited with ATCC® with the Accession Number: , or else the coding region (shown in SEQ ID NOs: 3, 6, or 9), or a complement of these nucleotide sequences. In other particularly preferred embodiments, the isolated nucleic acid molecules of the present invention comprise a nucleotide sequence that hybridizes or is at least 32%, 35%, 40%, 45%, 50%, 55%, 60% , 65%, 70% 75%, 80%, 85%, 90%, 95%, 98% or more homologous with the total length of the nucleotide sequences shown in SEQ ID NOs: 1, 4, or 7, the total length of the nucleotide sequence of the plasmid DNA insert deposited with ATCC®, with Access Number, or a part of this nucleotide sequence. In other preferred embodiments, the isolated nucleic acid molecules encode the amino acid sequences of SEQ ID NOs: 2, 5, or 8, or an amino acid sequence encoded by the nucleotide sequence of the plasmid DNA insert deposited with ATCC® with Access Number:.

Preferred hALG-2LP, SALG-2LP, or mALG-2LP proteins of the present invention also possess at least one of the activities described herein.

In another embodiment, the isolated nucleic acid molecules encode proteins or portions thereof where the proteins or portions thereof include an amino acid sequence that is sufficiently homologous with an amino acid sequence of SEQ ID NOs: 2, 5, or well 8, for example, sufficiently homologous with an amino acid sequence of SEQ ID NOs: 2, 5, or 8 in such a way that the proteins or portions thereof maintain at least one of the activities described herein. Preferably, the proteins or portions thereof encoded by the nucleic acid molecules maintain the ability to modulate a programmed death pathway activity of the cells. In one embodiment, the proteins encoded by the nucleic acid molecules are at least 38%, 42%, 44%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more homologues with the amino acid sequences of SEQ ID NOs: 2, 5, or 8 (for example, the entire amino acid sequences of SEQ ID NOs: 2, 5, or either 8) or the amino acid sequence encoded by the nucleotide sequence of the .ADN insert of the plasmid deposited with ATCC® with Accession Number:.

In another preferred embodiment, the proteins are full-length human proteins substantially homologous to the entire amino acid sequences of SEQ ID NOs: 2, 5, or 8 (encoded by the open reading frames shown in SEQ ID NOs: 3, 6 , or 9, respectively).

In another preferred embodiment, the nucleic acid molecule of hALG-2LP, SALG-2LP, or mALG-2LP is derived from a mammal, eg, a human, a monkey, or a mouse, and encodes a protein (eg, example, fusion protein of hALG-2LP, sALG-2LP, or mALG-2LP) including a calcium binding domain that is at least 42% or more homologous with SEQ ID NO: 10, 11, 12, 13 , 14, or 15 and has one or more of the following activities: 1) it can interact with the programmed cell death pathway associated with molecule, for example, an ALG-2 interaction protein; and 2) it can modulate the death of the cells, for example, programmed death of the cells, in a cell, for example, a brain cell and other cells expressing .ALG-2LP. In another embodiment, the isolated nucleic acid molecule is at least 15 nucleotides in length and hybridizes under stringent conditions to a nucleic acid molecule containing the nucleotide sequence of SEQ ID NOs: 1, 4, or 7, or well with the nucleotide sequence of the .ADN insert of the plasmid deposited with ATCC ® with Accession Number:. Preferably, the isolated nucleic acid molecule corresponds to a naturally occurring nucleic acid molecule. More preferably, the isolated nucleic acid encodes a human hALG-2LP, SALG-2LP, or mALG-2LP that occurs naturally or a biologically active portion thereof. further, given the presentation here of a cDNA sequence encoding hALG-2LP, SALG-2LP, or mALG-2LP (eg, SEQ ID NOs: 1, 4, or 7), are also provided by the invention antisense nucleic acid molecules (ie, molecules that are complementary to a hALG-2LP sequence coding sequence, sALG-2LP, or mALG-2LP) are also offered by the invention. Another aspect of the present invention relates to vectors, for example, recombinant expression vectors, which contain the nucleic acid molecules of the invention and host cells in which such vectors have been introduced. In one embodiment, such a host cell is used to produce a protein hALG-2LP, SALG-2LP, or mALG-2LP by culturing the host cell in a suitable medium. If desired, the protein hALG-2LP, sALG-2LP, or mALG-2LP can then be isolated from the medium or the host cell. In another aspect, the invention relates to transgenic non-human animals wherein a hALG-2LP, SALG-2LP, or mALG-2LP gene has been introduced or altered. In one embodiment, the genome of the non-human animal has been altered by introducing a nucleic acid molecule of the invention encoding hALG-2LP, SALG-2LP, or mALG-2LP as a transgene. In another embodiment, an endogenous .ALG-2LP gene within the genome of the non-human animal has been altered, for example functionally disrupted, by homologous recombination. Another aspect of the present invention relates to a protein hALG-2LP, SALG-2LP, or mALG-2LP isolated or a portion thereof can modulate programmed cell death in a cell, for example, brain cell, or other cells that express ALG-2LP. In another preferred embodiment, the protein hALG-2LP, SALG-2LP, or mALG-2LP isolated or portion thereof is sufficiently homologous with an amino acid sequence of SEQ ID NOs: 2, 5, or 8 in such a way that the protein or portion thereof maintains the ability to modulate programmed cell death in a cell, for example, a brain cell and other cells that express ALG-2LP. In one embodiment, the biologically active portion of the protein 'hALG-2LP, SALG-2LP, or mALG-2LP includes a domain or motif, preferably a domain or motif having an activity described herein. The domain can be a calcium binding domain, for example, an EF hand. If the active portion of the protein comprising the calcium binding domain is isolated or derived from a mammal, e.g., a human, it is preferred that the calcium binding domain be at least 38%, 42%, 44 %, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more homologous with SEQ ID NOs: 10, 11, 12, 13, 14, or 15. Preferably, the biologically active portion of the protein hALG-2LP, SALG-2LP, or mALG-2LP that includes a calcium binding domain also has the following activities: 1) it can interact with a pathway of programmed cell death associated with molecule, for example, an ALG-2 and 2 interaction protein) can modulate cell death, for example, programmed cell death, in a cell, for example, a brain cell and other cells expressing ALG- 2LP. The invention also offers an isolated preparation of a protein hALG-2LP, SALG-2LP, or mALG-2LP. The protein hALG-2LP, S.ALG-2LP, or mALG-2LP consists of the amino acid sequence of SEQ ID NO: 2, 5, or 8 to an amino acid sequence encoded by the nucleotide sequence of the DNA insert of the Plasmid deposited with ATCC® as Access Number:. In another preferred embodiment, the invention relates to a protein hALG-2LP, SALG-2LP, or full-length mALG-2LP isolated substantially homologous with the amino acid sequence of SEQ ID NO: 2, 5, or 8 (encoded by the open reading frame shown in SEQ ID NO: 3, 6, or 9, respectively). In another embodiment, the protein hALG-2LP, SALG-2LP, or mALG-2LP is at least 38%, 42%, 44%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more homologous with the amino acid sequence of SEQ ID NO: 2, 5 or 8, respectively. In other embodiments, the protein hALG-2LP, SALG-2LP, or mALG-2LP consists of an amino acid sequence that is at least 42% or more homologous with the amino acid sequence of SEQ ID NO: 2, 5 or 8 , respectively, and has one or more of the following activities: 1) it can interact with a programmed cell death path associated with molecules, for example, a protein that interacts with ALG-2; and 2) can modulate cell death, for example, programmed cell death in a cell, for example, a brain cell or other cells that express ALG2-LP. Alternatively, the protein hALG-2LP, SALG-2LP, or mALG-2LP can consist of an amino acid sequence encoded by a nucleotide sequence that hybridizes, for example, that hybridizes under stringent conditions, or is at least 32%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more homologous with the length of the nucleotide sequence of SEQ ID NO: 1, 4 or 7, respectively, or the entire length of the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC® with Accession Number:, respectively. In addition, it is preferred that the hALG-2LP, sALG-2LP, or mALG-2LP forms also have one or more of the activities described herein. The protein hALG-2LP, SALG-2LP, or either mALG-2LP (or polypeptide) or a biologically active portion thereof can be operably linked to a polypeptide not-hALG-2LP, SALG-2LP, or mALG-2LP to form a fusion protein. In addition, the protein hALG-2LP, SALG-2LP, or either mALG-2LP or a biologically active portion thereof can be incorporated into a pharmaceutical composition comprising the protein and a pharmaceutically acceptable carrier. The protein hALG-2LP, SALG-2LP, or mALG-2LP of the present invention or portions or fragments thereof can be used to prepare anti-hALG-2LP, anti-sALG-2LP, or anti-mALG-2LP antibodies . Accordingly, the invention also provides an antigenic peptide of hALG-2LP, sALG-2LP, or mALG-2LP consisting of at least 8 amino acid residues of the amino acid sequence shown in SEQ ID NO: 2, 5, or well 8, respectively, and encompasses an epitope of hALG-2LP, SALG-2LP, or mALG-2LP such that an antibody prepared against the hALG-2LP peptide, SALG-2LP, or mALG-2LP forms an immune complex specific with hALG-2LP, SALG-2LP, or mALG-2LP, respectively. Preferably, the antigenic peptide comprises at least 10 amino acid residues, more preferably at least 15 amino acid residues, and even more preferably at least 20 amino acid residues, and especially at least 30 amino acid residues. The invention also provides an antibody that binds specifically with hALG-2LP, sALG-2LP, or mALG-2LP. In one embodiment, the antibody is monoclonal. In another embodiment, the antibody is coupled to a detectable substance. In another embodiment, the antibody is incorporated into a pharmaceutical composition comprising the antibody and a pharmaceutically acceptable carrier. The invention also relates to methods for detecting genetic lesions in hALG-2LP gene, SALG-2LP, or mALG-2LP, thus determining whether a subject with an injured gene presents a risk (or a predisposition) for a disorder characterized by aberrant or abnormal nucleic acid expression hALG-2LP, SALG-2LP, or mALG-2LP, or aberrant or abnormal protein activity hALG-2LP, SALG-2LP, or mALG-2LP, for example, a disorder characterized by the deregulation of the programmed death of the cells. In preferred embodiments, the methods include detecting, in a sample of cells from the subject, the presence or absence of a genetic lesion characterized by an alteration affecting the integrity of a gene encoding a hALG-2LP protein, SALG- 2LP, either mALG-2LP, or the erroneous expression of hALG-2LP gene, SALG-2LP, or mALG-2LP. Another aspect of the invention relates to methods for detecting the presence of hALG-2LP, SALG-2LP, or mALG-2LP in a biological sample. In a preferred embodiment, the methods include contacting a biological sample with a compound or agent capable of detecting protein hALG-2LP, SALG-2LP, or mALG-2LP, or mRNA of hALG-2LP, sALG-2LP , or mALG-2LP, in such a way that the presence of hALG-2LP is detected, SALG-2LP, or mALG-2LP in the biological sample. The compound or agent can be, for example, a labeled or labeled nucleic acid probe capable of hybridizing to hALG-2LP mRNA, S.ALG-2LP, or mALG-2LP or a labeled antibody or which can be labeled capable of binding with protein hALG-2LP, SALG-2LP, or mALG-2LP. The invention also relates to methods for diagnosing a subject, for example, with a disorder characterized by the deregulation of programmed cell death, based on the detection of hALG-2LP protein or mRNA, SALG-2LP, or mALG- 2LP. In one embodiment, the method includes contacting a cell or tissue sample (e.g., a brain cell sample) of the subject with an agent capable of detecting hALG-2LP protein or mRNA, SALG-2LP, or either mALG-2LP, determining the amount of protein or mRNA of hALG-2LP, SALG-2LP, or mALG-2LP that is expressed in the cell or tissue sample, compared to the amount of protein or .RNA of hALG- 2LP, SALG-2LP, or mALG-2LP expressed in the cell or tissue sample with a control sample and by forming a diagnosis based on the amount of protein or .RNA of hALG-2LP, SALG-2LP , or mALG-2LP which is expressed in the cell or tissue sample compared to the control sample. Preferably, the cell sample is a sample of brain cells. Kits for detecting hALG-2LP, SALG-2LP, or mALG-2LP in a biological sample are also within the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 depicts the nucleotide (SEQ ID N0: 1) and amino acid sequence (SEQ ID NO: 2) of human ALG-2LP (hALG-2LP). The coding region without the 5 'and 3' untranslated regions of the human ALG-2LP gene is shown in SEQ ID NO: 3. Figure 2 shows the nucleotide sequences (SEQ ID NO.

NO: 4) and amino acids (SEQ ID NO: 5) of monkey ALG-2LP (sALG-2LP). The coding region without the 5 'regions and 3 'untranslated monkey ALG-2LP gene appears in SEQ ID NO: 6. Figure 3 depicts the sequence of nucleotides (SEQ ID NO: 7) and amino acid sequence (SEQ ID NO: 8) of ALG-2LP from partial murine (mALG-2LP). The coding region without the 5 'and 3' untranslated regions of the murine ALG-2LP gene appears in SEQ ID NO: 9. DETAILED DESCRIPTION OF THE INVENTION The present invention is based, at least in part, on the discovery of novel molecules that are known here as nucleic acid molecules and proteins of hALG-2LP, sALG-2LP, and mALG-2LP that are related to proteins that regulate programmed cell death. As used herein, "programmed cell death" refers to a genetically regulated process involved in the normal development of multicellular organisms. This process occurs in cells destined for removal in several normal situations, including larval development of the nematode c. elegans, insect metamorphosis, development in mammalian embryos including the nephrogenic zone in the developing kidney, and regression or atrophy (for example, in the prostate after castration). Scheduled cell death can occur after withdrawal of growth factors or trophic in many cells, lack of food, hormonal treatment, ultraviolet radiation, and exposure to toxic and infectious agents including species that react with oxygen and phosphatase inhibitors , for example, okadaic acid, calcium ionones, and numerous chemotherapeutic agents for the treatment of cancer. For a detailed description of programmed cell death, see, Trump B.F. et al. (1995) FASEB J. 9: 219-228 and Lee S. (1993) Curr. Opin. Cell Biol. 5; 286-291, whose contents are incorporated herein by reference. Thus, proteins hALG-2LP, SALG-2LP, and mALG-2LP through their participation in a programmed cell death pathway, can modulate a programmed cell death pathway activity and provide novel diagnostic targets as well as novel therapeutic agents for disorders characterized by the deregulation of programmed cell death, especially in cells that express ALG2-LP. As used herein, a "disorder characterized by the deregulation of programmed cell death" refers to a disorder, disease or condition that is characterized by deregulation, eg, up-regulation or down-regulation, of programmed cell death . The deregulation of programmed cell death can cause deregulation of cell proliferation and / or cell cycle regression. Examples of disorders characterized by the deregulation of programmed cell death include neurodegenerative disorders, for example, Alzheimer's disease, dementias related to Alzheimer's disease (such as for example Pick's disease), Parkinson's disease and other diffuse body diseases of Le. and, multiple sclerosis, amyotrophic lateral sclerosis, progressive supranuclear palsy, epilepsy, Jacob-Creutzfieldt's disease, or dementias related to AIDS; or proliferative disorders, for example, cancer such as chronic lymphocytic leukemia or colorectal cancer. An abnormality in the function of the protein hALG-2LP, sALG-2LP, or mALG-2LP can cause a disorder characterized by a deregulation of programmed cell death. Thus, one aspect of the invention relates to methods for detecting genetic lesions in a hALG-2LP gene, SALG-2LP, or mALG-2LP, to determine in this way whether a subject with the injured gene is at risk (or well predisposed) for a disease characterized by aberrant or abnormal nucleic acid expression of hALG-2LP, sALG-2LP, or mALG-2LP or aberrant or abnormal protein activity hALG-2LP, SALG-2LP, or mALG-2LP, as for example, a disorder characterized by the deregulation of programmed cell death. The type 2 protein nucleic acid molecules of apoptosis-related gene described herein, for example, hALG-2LP, SALG-2LP, and mALG-2LP, were identified from human, monkey, brain cDNA libraries. and mouse, respectively, using the Blast algorithm. A cDNA library was prepared from sectioned mouse brain stria isolated mRNA. A homology search of sequences obtained from the cDNA library revealed a cDNA sequence having 42% homology (62 of 144 amino acids) with the rat ALG-2 protein. In addition, clones from the cDNA library were placed continuously to obtain a full-length monkey cDNA sequence, SEQ ID NO: 4. The monkey clone was used to screen a human heart cDNA library and a library of the whole brain of murine. Sequencing of the positive clones yielded the human sequence, SEQ ID NO: 1 and the partial murine sequence, SEQ ID NO: 7. The cDNA nucleotide sequence of hALG-2LP and the predicted protein amino acid sequence of hALG-2LP they appear in figure 1 and in SEQ ID NOS: 1 and 2, respectively. A plasmid containing the full-length nucleotide sequence encoding human ALG-2LP (with the name of .DNA insert of -) was deposited with ATCC® and received the Access Number. This deposit will be maintained in accordance with the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. This deposit was made simply as a convenience to those skilled in the art and not as an admission that a deposit is required according to 35 U.S.C. § 112. The hALG-2LP gene having a length of about 1667 nucleotides, encodes a protein having a molecular weight of about 32.7 kD and having a length of about 284 amino acid residues. The hALG-2LP protein is expressed in all tissues examined (brain, heart, kidney, liver, lung, skeletal muscle, testicle, placenta, pancreas, colon, prostate, ovaries, small intestine and spleen). No expression was observed in the hypothalamus. Amino acid residues 127 to 139 and 194 to 206 of the hALG-2LP protein comprise a region that shows homology with a calcium binding domain. As used herein, the term "calcium binding domain" refers to an amino acid domain, eg, an EF hand (described, for example, in Baimbridge KG et al. (1992) TINS 15 (8): 303-308, whose contents are incorporated herein by reference), which participates in the calcium link. These EF hands usually have a sequence that is similar to the consensus sequence: EO- -OO-ODKDGDG-O- • -EF- -00. (SEQ ID NO: 16). Or it can be I, L, V or M, and "•" indicates a position without strongly preferred residue. Each listed residue is present in more than 25% of the sequences, and the underlined residues are present in more than 80% of the sequences. The nucleotide sequence of the SALG-2LP cDNA and the predicted amino acid sequence of the SALG-2LP protein are shown in Figure 2 and in SEQ ID NOs: 4 and 5. The SJALG-2LP gene, which has a length of about 1525 nucleotides encode a peptide having a molecular weight of about 31.8 kD and having a length of about 277 amino acid residues. The nucleotide sequence of the partial mALG-2LP cDNA and the predicted amino acid sequence of the partial mALG-2LP protein appear in Figure 3 and in SEQ ID NOs: 7 and 8, respectively. The partial mALG-2LP gene, which has a length of about 1362 nucleotides, encodes a protein having a molecular weight of about 31.5 kD and having a length of about 274 amino acids. Various aspects of the present invention are described in greater detail in the following subsections: I. Isolated Nucleic Acid Molecules One aspect of the present invention relates to isolated nucleic acid molecules encoding hALG-2LP, sALG-2LP, or mALG -2LP, or biologically active portions thereof, as well as nucleic acid fragments sufficient for use as hybridization probes to identify nucleic acid encoding hALG-2LP, SALG-2LP, or mALG-2LP (e.g., mRNA) of hALG-2LP, SALG-2LP, or mALG-2LP). As used herein, the term "nucleic acid molecule" includes DNA molecules (e.g., cDNA or genomic DNA) and RNA molecules (e.g., mRNA) and DNA analogues and RNA generated using nucleotide analogues. The nucleic acid molecule can be single chain or double chain, but preferably it is double stranded DNA. An "isolated" nucleic acid molecule is a molecule separated from other nucleic acid molecules present in the natural source of the nucleic acid. Preferably, an "isolated" nucleic acid is free of sequences that naturally flank the nucleic acid (i.e., sequences located at the 5 'and 3' ends of the nucleic acid) in the genetic DNA of the organism from which the nucleic acid is derived. nucleic acid. For example, in various embodiments, the nucleic acid molecules of hALG-2LP, SALG-2LP, or isolated mALG-2LP may contain less than about 5kb., 4kb, 3kb, 2kb, Ikb, 0.5kb or 0.1kb of nucleotide sequence that naturally flank the nucleic acid molecule in the genomic DNA of the cell from which the nucleic acid is derived (eg, a cell from brain or another cell that expresses ALG2-LP). In addition, an "isolated" nucleic acid molecule, such as for example the cDNA molecule, may be substantially free of other cellular material, or culture medium when produced by recombinant techniques, either chemical precursors or other chemical precursors when synthesizes chemically. A nucleic acid molecule of the present invention, for example, a nucleic acid molecule having the nucleotide sequence of SEQ ID NOs: 1, 4, and 7, or a portion thereof, can be isolated using molecular biology techniques standards and the sequence information provided here. For example, an ALG-2LP cDNA of human, monkey or mouse can be isolated from a human, monkey or mouse brain library, respectively, using all or a portion of SEQ ID NO: 1, 4, or 7 as a hybridization probe and standard hybridization techniques (see, for example, as described in Sambrook, J. Fritish, EF and Maniatis, T. Molecular Cloning: A Labora tory Manual, 2nd edition, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989). In addition, a nucleic acid molecule encompassing all or a portion of SEQ ID NO: 1, 4 or 7 can be isolated by the polymerase chain reaction using oligonucleotide primers designed based on the sequence of SEQ ID NO: 1 , 4 or 7. For example, mRNA can be isolated from normal brain cells (for example, by the guanidinium-thiocyanate extraction procedure of Chirgwin et al (1979) Biochemistry 18: 529 4-5299) and the cDNA can be prepared by reverse transcriptase (for example Moloney MLV reverse transcriptase available from Gibco / BRL, Bethesda, MD; or reverse AMV transcriptase, available from Seikagaku .America, Inc., St. Petersburg, FL). Synthetic oligonucleotide primers for polymerase chain reaction amplification can be designed based on the nucleotide sequence illustrated in SEQ ID N0: 1, 4 or 7. A nucleic acid of the invention can be amplified using cDNA, or, alternatively, Genomic DNA, as annealed and appropriate oligonucleotide primers according to standard polymerase chain reaction amplification techniques. "The nucleic acid amplified in this way can be cloned into an appropriate vector and characterized by sequence analysis of .ADN In addition, oligonucleotides corresponding to a nucleotide sequence of hALG-2LP, SALG-2LP, or mALG-2LP can be prepared by standard synthetic techniques, for example, using an automated DNA synthesizer In a preferred embodiment, an isolated nucleic acid molecule of the present invention comprises the nucleotide sequence illustrated in SEQ ID NO: 1, 4, and 7 or the nucleotide sequence of the insert of the plasmid DNA deposited with ATCC® with Access Number The sequence of SEQ ID NO: 1 corresponds to cDNA of human ALG-2LP (hALG-2LP) This cDNA comprises sequences encoding the protein hALG-2LP (ie, the "coding region", from nucleotides 30 to 881 of SEQ ID NO: 1), as well as 5 'untranslated sequences (nucleotides 1-29 of SEQ ID NO: 1) and the non-trasl sequences 3 'alkates (nucleotides 882 to 1667 of SEQ ID NO: 1). Alternatively, the nucleic acid molecule may comprise only the coding region of SEQ ID NO: 1 (eg, nucleotides 30 to 881, shown separately as SEQ ID NO: 3). The sequence of SEQ ID NO: 4 corresponds to the monkey ALG-2LP cDNA (sALG-2LP). This cDNA comprises sequences encoding the SALG-2LP protein (ie, the "coding region", nucleotides 10 to 840 of SEQ ID N0: 4), as well as 5 'non-translated sequences (nucleotides 1-9 in SEQ ID NO: 4) and 3 'untranslated sequences (nucleotides 841 to 1525 of SEQ ID N0: 4).

Alternatively, the nucleic acid molecule may comprise only the coding region of SEQ ID NO: 4 (for example, nucleotides 10 to 840, shown separately as SEQ ID NO: 6). The sequence of SEQ ID NO: 7 corresponds to the CDNA of partial mouse ALG-2LP (mALG-2LP). This cDNA comprised sequences encoding the partial mALG-2LP protein (i.e., "the coding region", nucleotides 177 to 998 of SEQ ID NO: 7), as well as 5 'untranslated sequences (nucleotides 1 to 176 of SEQ. ID NO: 7) and 3 'untranslated sequences (nucleotides 999 to 1362 of SEQ ID NO: 7). Alternatively, the nucleic acid molecule may comprise only the coding region of SEQ ID NO: 7 (eg, nucleotides 177 to 998, shown separately, SEQ ID NO: 9). Another preferred embodiment, an isolated nucleic acid molecule of the present invention comprises a nucleic acid molecule that is a complement to the nucleotide sequence shown in SEQ ID NO: 1, 4, or 7, the nucleotide sequence of the .ADN of the plasmid deposited with ATCC® with Accession Number:, or a portion of these nucleotide sequences. A nucleic acid molecule that is complementary to the nucleotide sequence shown in SEQ ID NO: 1, 4, or 7 is a nucleic acid molecule that is sufficiently complementary to the nucleotide sequence shown in SEQ ID NO: 1, 4 , or 7 in such a way that it can hybridize with the nucleotide sequence illustrated in SEQ ID NO: 1, 4, or 7, respectively, thus forming a stable duplex. In another preferred embodiment, an isolated nucleic acid molecule of the present invention comprises a nucleotide sequence that is at least 32%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% 75%, 80%, 85%, 90%, 95%, 98% or more homologous to the nucleotide sequence shown in SEQ ID NO: 1, 4, or 7, the nucleotide sequence of the .ADN insert of the plasmid deposited with ATCC® with Accession Number, or a portion of these nucleotide sequences. In a preferred embodiment, an isolated nucleic acid molecule of the present invention comprises a sequence of hybridizing nucleotides, for example, that hybridize under stringent conditions to the nucleotide sequence shown in SEQ ID NO: 1, 4, or 7, the nucleotide sequence of the plasmid DNA insert deposited before ATCC® with an Accession Number:, or a portion of these nucleotide sequences. In addition, the nucleic acid molecule of the invention can comprise only a portion of the coding region of SEQ ID NO: 1, 4, or 7, for example a fragment that can be used as a probe or primer or a fragment that encodes a biologically active portion of hALG-2LP, sALG-2LP, or mALG-2LP. The nucleotide sequence determined from the cloning of the hALG-2LP gene, SALG-2LP, or mALG-2LP from a mammal allows the generation of probes and primers designed for use to identify and / or clone homologs of hALG-2LP, sALG-2LP, or mALG-2LP in other cell types, for example, from other tissues, as well as homologues hALG-2LP, sALG-2LP, or mALG-2LP from other mammals, for example , rats. The probe / primer typically comprises substantially purified oligonucleotide. The oligonucleotide typically comprises a region of a nucleotide sequence that hybridizes under stringent conditions to at least about 12, preferably about 25, more preferably about 40, 50, 75, 100, 150, 200, 300, 400, 500 , 520, 540, 550 or 600 consecutive nucleotides of SEQ ID NO: 1, 4 or 7 of sense, or anti-sense sequence of SEQ ID NO: 1, 4, or 7, or mutants thereof that occur naturally. Initiators based on the nucleotide sequence of SEQ ID NO: 1, 4, or 7 can be used in polymerase chain reactions to clone hALG-2LP homologs, SALG-2LP, or mALG-2LP. Probes based on the nucleotide sequences hALG-2LP, SALG-2LP, or mALG-2LP can be used to detect transcripts or genomic sequences that code for the same proteins or homologous proteins. In preferred embodiments, the probe further comprises a marker set therein, e.g., the label group can be a radioisotope, a fluorescent compound, an enzyme, or an enzyme cofactor. Such probes can be used as part of a diagnostic test kit to identify cells or tissues that erroneously express a protein hALG-2LP, SALG-2LP, or mALG-2LP, for example by measuring a level of nucleic acid encoding hALG-2LP, sALG-2LP, or mALG-2LP in a sample of cells from a subject, for example, by detecting mRNA levels of hALG-2LP, SALG-2LP, or mALG-2LP or determining whether a gen hALG-2LP, SALG-2LP, or genomic mALG-2LP has been mutated or removed. In one embodiment, the nucleic acid molecule of the present invention encodes a protein or portion thereof that includes an amino acid sequence that is sufficiently homologous as the amino acid sequence SEQ ID NO: 2, 5, or 8 or a sequence of amino acids encoded by the nucleotide sequence of the DNA insert of the plasmid deposited in ATCC® with number of Access: in such a way that the protein or portion thereof retains the ability to modulate an activity related to programmed cell death. As used herein, the term "sufficiently homologous" refers to proteins or portions thereof that have amino acid sequences that include a minimum number of identical or equivalent amino acid residues (e.g., amino acid residues having a similar side chain) to an amino acid residue in SEQ ID NO: 2, 5, or 8) to an amino acid sequence of SEQ ID NO: 2, 5, or 8 or an amino acid sequence encoded by the nucleotide sequences of the DNA insert of the plasmid deposited with ATCC with Access Number: in such a way that the protein or portion thereof can modulate an activity related to programmed cell death. In another embodiment, the protein is at least 38%, 42%, 44%, 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98 % or more homologous with the amino acid sequence of SEQ ID NO: 2, 5, or 8. Portions of proteins encoded by the nucleic acid molecules hALG-2LP, SALG-2LP, or mALG-2LP of the present invention are preference biologically active portions of several proteins hALG-2LP, sALG-2LP, or mALG-2LP. As used herein the term "biologically active portion of hALG-2LP, SALG-2LP, or mALG-2LP" encompasses a portion, eg, a domain / motif, of hALG-2LP, SALG-2LP, or mALG- 2LP having one or more of the following activities: 1) can interact with a molecule associated with programmed cell death guidance, for example, a protein that interacts with ALG-2; and 2) cell death can be modulated, for example, cell death program, in the cell, for example brain cell, and other cells that express ALG-2LP. Standard binding assays, eg, immunoprecipitations and yeast two-hybrid assays, as described herein, can be performed to determine the capacity of a hALG-2LP protein, SALG-2LP, or mALG-2LP or a biologically activates it by interacting (for example, joining) with another protein associated with the programmed cell death path, for example, ALG-2, or portion of it. To determine whether a hALG-2LP protein, SALG-2LP, or mALG-2LP or a biologically active portion thereof can modulate programmed cell death in a cell, e.g. T cell, T cells, e.g. cell hybridomas T (3DO) that have been crosslinked with a T cell receptor to induce programmed cell death (as described in Ashwell JD et al (1990) J. Immunol. 144: 3326) can be transfected with a nucleic acid encoding the protein hALG-2LP, SALG-2LP, or mALG-2LP or biologically active portions thereof, or cloned for example in a pLTP vector (as described in Vito P. et al. (1996) Science 271: 521 -525). The ability of the transfected nucleic acid molecules to protect the recipient cells against cell death can then be monitored. Additional fragments of nucleic acid encoding biologically active portions of hALG-2LP, SALG-2LP, or mALG-2LP can be prepared by isolating a portion of SEQ ID NO: 2, 5 or 8, respectively, which express the encoded protein or peptide of hALG-2LP, SALG-2LP, or mALG-2LP (for example, by expressing recombinant in vitro) and by evaluating the activity of the encoded portion of protein peptide hALG-2LP, SALG-2LP , or mALG-2LP. The invention further encompasses nucleic acid molecules that differ from the nucleotide sequence shown in SEQ ID NO: 1, 4, or 7 (and portions thereof) due to the degeneracy of the genetic code and consequently encode the same hALG protein -2LP, SALG-2LP, or mALG-2LP encoded by the nucleotide sequence shown in SEQ ID NO: 1, 4 or 7, respectively. In another modality, an isolated nucleic acid molecule of the present invention has a nucleotide sequence encoding the protein having an amino acid sequence shown in SEQ ID NO: 2, 5 or 8 or a protein having an encoded amino acid sequence or nucleotide sequence of DNA insert of the plasmid deposited with ATCC® with Access Number:. In a further embodiment, the nucleic acid molecule of the present invention encodes a full-length human protein which is substantially homologous to the amino acid sequence SEQ ID NO: 2, 5, or 8 (encoded by the open reading frame) shown in SEQ ID NO: 3, 6, or 9) or an amino acid sequence encoded by the nucleotide sequence of the plasmid DNA insert deposited with ATCC® with Accession Number:.

In addition to the nucleotide sequences hALG-2LP, SALG-2LP, and mALG-2LP shown in SEQ ID NOs: 1, 4, and 7, it will be observed by those skilled in the art that polymorphisms of DNA sequences that cause changes in the amino acid sequences of hALG-2LP, SALG-2LP, and mALG-2LP may exist within a population (eg, the human population). Such genetic polymorphism in the genes hALG-2LP, SALG-2LP, and mALG-2LP may exist between individuals within a population due to natural allelic variation. As used herein, the terms "gene" and "recombinant gene" refer to nucleic acid molecules comprising an open reading frame encoding a hALG-2LP protein, SALG-2LP, or mALG-2LP, preferably a hALG-2LP protein, SALG-2LP, or mammalian mALG-2LP. Said natural allelic variations can typically result in a variation of 1-5% in the nucleotide sequence of the hALG-2LP gene, SALG-2LP, or mALG-2LP. Each and every one of these variations of nucleotides and amino acid polymorphisms resulting in hALG-2LP, SALG-2LP, or mALG-2LP that are the result of natural allelic variation and that do not alter the functional activity of hALG-2LP, SALG- 2LP, or mALG-2LP are within the scope of the present invention. In addition, nucleic acid molecules encoding hALG-2LP, sALG-2LP, or mALG-2LP proteins from other species, and therefore having a nucleotide sequence that differs from the sequence of SEQ ID NO: 1, 4 or 7, are within the scope of the present invention. Nucleic acid molecules corresponding to natural allelic variants and non-human, non-simian, or non-murine cDNAs of hALG-2LP, sALG-2LP, or mALG-2LP of the invention can be isolated on the basis of their homology to the nucleic acid of hALG-2LP, sALG-2LP, or mALG-2LP disclosed herein using the human cDNA, a portion thereof, as hybridization probes in accordance with standard hybridization techniques under stringent hybridization conditions. Accordingly, in another embodiment, in another embodiment, an isolated nucleic acid molecule of the present invention is at least 15 nucleotides in length and hybridizes under stringent conditions to the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOS. NO: 1, 4, or 7, or the nucleotide sequence of the plasmid DNA insert deposited before ATCC with Accession Number: In other embodiments, the nucleic acid has at least 30, 50, 100, 250, 300, 350, 400, 450, 500, 520, 540, 550, or 600 nucleotides in length. As used herein, the term "hybridizes under stringent conditions" is intended to describe hybridization and washing conditions in which nucleotide sequences at least 60% homologous to each other typically remain hybridized to each other. Preferably, the conditions are such that sequences with at least about 65%, preferably at least about 70%, and even more preferably at least about 75% or more homology between them typically remain hybridized to each other. Such stringent conditions are known to those skilled in the art and are found in Current Protocols in Molecular Biology (Natural Protocols in Molecular Biology) John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. A preferred, non-limiting example of stringent hybridization conditions is hybridization in 6X sodium chloride / sodium citrate (SSC) at a temperature of about 45 ° C, followed by one or more washes in 0.2X SSC, 0.1% SDS at a temperature of 50-60 ° C. Preferably, an isolated nucleic acid molecule of the present invention that hybridizes under stringent conditions with the sequence of SEQ ID NO: 1, 4, or 7 corresponds to a nucleic acid molecule what happens naturally As used herein, a "naturally occurring" nucleic acid molecule refers to a DNA or RNA molecule having a nucleotide sequence that occurs in nature (e.g., which encodes a natural protein). In one embodiment, the nucleic acid encodes hALG-2LP, SALG-2LP, or native mALG-2LP. In addition to the naturally occurring allelic variants of the hALG-2LP sequence, sALG-2LP, or mALG-2LP that may exist in populations, the skilled person will further observe that changes can be introduced by mutation in the nucleotide sequence of SEQ ID NO: 1, 4, or 7, thus causing changes in the amino acid sequence of the protein hALG-2LP, SALG-2LP, or mALG-2LP encoded, without altering the functional capacity of protein hALG-2LP, sALG -2LP, or mALG-2LP. For example, substitutions of nucleotides that cause amino acid substitutions in "non-essential" amino acid residues can be made in the sequence of SEQ ID N0: 1, 4, or 7. A "non-essential" amino acid residue is a residue that can be be altered from the wild-type sequence of hALG-2LP, sALG-2LP, or mALG-2LP (eg, the sequence of SEQ ID NO: 2, 5, or 8) without altering the activity of hALG-2LP, SALG-2LP, or mALG-2LP, while an "essential" amino acid residue is required for the hALG-2LP, SALG-2LP, or mALG-2LP activity. For example, amino acid residues that are conserved among the ALG-2LP proteins of the present invention are predicted to be particularly easy to be altered (eg, the conserved aspartate, lysine, and glutamate residues present in the EF hand). Other amino acid residues, however (for example those that have not been conserved or only semi-conserved in the EF hand) may not be essential for the activity and therefore are likely to undergo alterations without altering the hALG-2LP activity, SALG-2LP, or mALG-2LP. Accordingly, another aspect of the present invention relates to nucleic acid molecules that encode hALG-2LP, SALG-2LP, or mALG-2LP proteins that contain changes in amino acid residues that are not essential for hALG-2LP activity, SALG-2LP, or mALG-2LP. Such proteins hALG-2LP, sALG-2LP, or mALG-2LP differ in amino acid sequences of SEQ ID NO: 2, 5, or 8, respectively, and yet retain at least one of the hALG-2LP activities, SALG-2LP, or mALG-2LP described here. In one embodiment, the isolated nucleic acid molecule comprises a nucleotide sequence encoding a protein, wherein the protein comprises an amino acid sequence of at least 38%, 42%, 44%, 45%, 50%, 55%, 60 %, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more homologous with the amino acid sequence of SEQ ID NO: 2, 5, or 8 and can modulate death programmed cell To determine the percentage homology of two amino acid sequences (eg, SEQ ID NO: 2, 5, or 8 and a mutant form thereof) or of two nucleic residues, the sequences are aligned for optimal comparison purposes (eg, example, gaps can be introduced in the sequence of a protein or nucleic acid for optimal alignment with the other protein or nucleic acid). The amino acid or nucleotide residues are then compared at corresponding amino acid positions or nucleotide positions. When a position in a sequence (for example SEQ ID NO: 2, 5, or 8) is occupied or the same amino acid or nucleotide residue as the corresponding position in the other sequence (for example, a mutant form of hALG-2LP , SALG-2LP, or alternatively? AALG-2LP, respectively), then the molecules are homologous in this position (ie, as used here "the homology" of amino acid or nucleic acid is equivalent to "identity" of amino acid or acid nucleic). The percentage homology between the two sequences depends on the number of identical positions shared by the sequences (ie percentage of homology = # of identical positions / # total of positions x 100). The comparison of sequences and determination of the percentage homology between two sequences can be achieved using a mathematical algorithm. A preferred non-limiting example of a mathematical algorithm used for the comparison of sequences is the algorithm of Karlin and Altschul (1990) Proc. Na ti. Acad. Sci. USA 87: 2264-68, modified in Karlin and Altschul (1993) Proc. Nati Acad. Sci. USA 90: 5873-77. This algorithm is incorporated into the NBLAST and XBLAST (version 2.0) programs of Altschul, et al. (1990) < J. Mol. Biol. 215: 403-10. searches for nucleotides with BLAST can be carried out with the NBLAST program, result = 100, word length = 12 to obtain nucleotide sequences homologous to the nucleic acid molecules of hALG-2LP, S.ALG-2LP, or mALG-2LP of the invention. You can also search for protein with BLAST with the XBLAST program, result = 50, word length = 3 to obtain amino acid sequences homologous to the protein molecules of hALG-2LP, SALG-2LP, or mALG-2LP of the invention. To obtain alignments with gaps for comparison purposes, Gapped BLAST can be employed in accordance with that described in Altschul et al., (1997) Nucleic Acids Res. 25 (17): 3389-3402. When the BLAST and Gapped BLAST programs are used, the broadcast parameters of the respective programs (for example, XBLAST and NBLAST) can be used. See http: //www.ncbi. nlm.nih. gov. Another preferred non-limiting example of a mathematical algorithm used for the comparison of sequences is the algorithm Myers and Miller, CABIOS (1989). This algorithm is incorporated into the ALIGN program (version 2.0) that is part of the GCG sequence alignment programmatic package. When the ALIGN program is used for the comparison of amino acid sequences, a residual weight table PAM120, a gap length penalty of 12, and a gap penalty of 4 can be used. An isolated nucleic acid molecule that encodes a protein hALG-2LP, SALG-2LP, or mALG-2LP homologous to the protein of SEQ ID NO: 2, 5, or 8, respectively, can be created by the introduction of one or more substitutions, additions or deletions of nucleotides in the nucleotide sequence of SEQ ID NO: 1, 4, or 7, such that one or more of the substitutions, additions or removals of amino acids are introduced into the encoded protein. Mutations can be introduced in SEQ ID NO: 1, 4, or 7 by standard techniques, such as site-directed mutagenesis, and mutagenesis mediated by polymerase chain reaction. Preferably, conservative amino acid substitutions are made in one or more predicted nonessential amino acid residues. A "conservative amino acid substitution" is a substitution in which the amino acid residue is replaced by an amino acid residue having a similar side chain. Families of amino acid residues that have similar side chains have been defined in the art. These families include amino acids with basic side chains (for example, lysine, arginine, histidine), acid side chains (eg, aspartic acid, glutamic acid), uncharged polar side chains (eg, glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), non-polar side chains (eg, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), side chains with beta branching (eg, threonine, valine, isoleucine) and aromatic side chains (eg, tyrosine, phenylalanine, tryptophan, histidine). Thus, a non-essential amino acid residue predicted in hALG-2LP, SALG-2LP, or mALG-2LP is preferably replaced by another amino acid residue of the same side chain family. Alternatively, in another embodiment, mutations can be randomly introduced throughout all or part of the coding sequence of hALG-2LP, SALG-2LP, or mALG-2LP, as for example by saturation mutagenesis and the resulting mutants can be screened for a hALG-2LP, sALG-2LP, or mALG-2LP activity described herein to identify mutants that retain the hALG-2LP, SALG-2LP, or mALG-2LP activity. After mutagenesis of SEQ ID NO: 1, 4 or 7, the encoded protein can be expressed recombinantly (for example, according to that described in examples 3 and 4) and the activity of the protein can be determined using, for example, tests described here. In addition to the nucleic acid molecules encoding hALG-2LP, SALG-2LP, or mALG-2LP proteins described above, another aspect of the invention relates to isolated nucleic acid molecules that are antisense. An "antisense" nucleic acid comprises a sequence of nucleotides that is complementary to a "sense" nucleic acid encoding a protein, for example, complementary to the coding strand of a double stranded or complementary cDNA molecule. of a mRNA sequence. Accordingly, an antisense nucleic acid can be linked by hydrogen to a sense nucleic acid. The antisense nucleic acid may be complementary to a coding strand of hALG-2LP, SALG-2LP, or whole mALG-2LP, or only a portion thereof. In one embodiment, an antisense nucleic acid molecule is antisense relative to a "coding region" of the coding strand of a nucleotide sequence encoding hALG-2LP, SALG-2LP, or mALG-2LP. The term "coding region" refers to the region of the nucleotide sequence comprising codons that are translated into amino acid residues, for example the entire coding region of SEQ ID NO: 1 comprises nucleotides 30 to 881 (shown separately as SEQ ID NO: 3), the entire coding region of SEQ ID NO: 4 comprises nucleotides 10 to 840 (shown separately as SEQ ID NO: 6), and the entire coding region of SEQ ID NO: 7 comprises nucleotides 177 to 998 (shown separately as SEQ ID NO: 9). In another embodiment, the antisense nucleic acid molecule is antisense relative to a "non-coding region" of the coding strand of a nucleotide sequence encoding hALG-2LP, SALG-2LP, or mALG-2LP. The term "non-coding region" refers to the 5 'and 3' sequences that flank the coding region that are not translated into amino acids (i.e., they are also known as 5 'and 3' regions not translated). An example of the antisense molecule that is complementary to a fragment of the 5 'untranslated region of SEQ ID NO: 1 and also including the start codon is a nucleic acid molecule that includes nucleotides that are complementary to nucleotides 20 to 38 of SEQ ID NO: 1. This antisense molecule has the following nucleotide sequence: 5 'CAGAATCACCATGGCCAGC 3' (SEQ ID NO: 17). An example of an antisense molecule that is complemry to a portion of the 3 'untranslated region of SEQ ID NO: 1 is a nucleic acid molecule that includes nucleotides that are complemry to nucleotides 885 to 905 of SEQ ID NO: 1 This antisense molecule has the following sequence: 5 'CCCAACCATCTGTGGAGAGTG 3' (SEQ ID NO: 18). An example of an antisense molecule that is complemry to a portion of the 5 'untranslated region of SEQ ID NO: 4 and that also includes the start codon is a nucleic acid molecule that includes nucleotides that are complemry to nucleotides 1 to 15 of SEQ ID NO: 4. This antisense molecule has the following nucleotide sequence: 5 '' CGCGTGGGCATGGCC 3 '(SEQ ID NO: 19). An example of an antisense molecule that is complemry to a portion of the 3 'untranslated region of SEQ ID NO: 4 is a nucleic acid molecule that includes nucleotides that are complemry to nucleotides 844 to 862 of SEQ ID NO: 4 This antisense molecule has the following sequence: 5 'CCCAACCCATCTGTGGAGA 3' (SEQ ID NO: 20). An example of an antisense molecule that is complemry to a portion of the 5 'untranslated region of SEQ ID NO: 7 and that also includes the start codon is a nucleic acid molecule that includes nucleotides that are complemry to nucleotides 170 to 182 of SEQ ID NO: 7. This antisense molecule has the following nucleotide sequence: 5 'CGGCACGAGCAGC 3' (SEQ ID NO: 21). An example of an antisense molecule that is complemry to a portion of the untranslated region 3f of SEQ ID NO: 7 is a nucleic acid molecule that includes nucleotides that are complemry to nucleotides 992 to 1008 of SEQ ID NO: 7. This antisense molecule has the following sequence: 5 'GATGCTATGACCCAGCC3' (SEQ ID NO: 22). Given the coding strand sequences encoding hALG-2LP, SALG-2LP, or mALG-2LP disclosed herein (SEQ ID NO: 1, 4 and 7, respectively), antisense nucleic acids of the presinvon can be designed in accordance with the base pairing rules of Watson and Crick. The antisense nucleic acid molecule can be complemry to the re .RNA region of hALG-2LP, SALG-2LP, or mALG-2LP, but more preferably is an oligonucleotide that is antisense only to a part of the coding or non-coding region of .ARNm of hALG-2LP, SALG-2LP, or mALG-2LP. For example, the antisense oligonucleotide can be complemry to the region surrounding the mRNA translation initiation site of hALG-2LP, sALG-2LP, or mALG-2LP. An antisense oligonucleotide can have, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length. An antisense nucleic acid of the invon can be constructed employing chemical and enzymatic synthesis ligation reactions by using procedures known in the art. For example, an antisense nucleic acid (e.g., an antisense oligonucleotide) can be chemically synthesized using either naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, for example, phosphorothioate derivatives and nucleotides substituted by acridine can be used. Examples of modified nucleotides that can be used to generate the antisense nucleic acid include: 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyhydroxymethyl) uracil, 5-carboxymethylaminomethyl -2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopnyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5- methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wibutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3- (3-amino-3-N-2-carboxypropyl) uracil, (acp3) w, and 2-6-diaminopurine. Alternatively, the antisense nucleic acid can be produced biologically by employing an expression vector in which a nucleic acid has been subcloned in an antisense orientation (ie, RNA transcribed from the inserted nucleic acid will be of an antisense orientation relative to to a target nucleic acid of interest described later in the following subsection). The antisense nucleic acid molecules of the present invention are typically administered to a subject, or are generated in situ in such a way that they hybridize or bind with cellular jRNA and / or genomic DNA encoding a hALG-2LP protein, sALG -2LP, or mALG-2LP to inhibit in this way the expression of the protein, for example, by inhibiting transcription and / or translation. Hybridization can be effected by conventional nucleotide supplementation to form a stable duplex or, for example, in the case of an antisense nucleic acid molecule that binds with .DNA duplexes, through specific interactions in the larger cleavage of the double helix. An example of a route of administration of an antisense nucleic acid molecule of the invention includes direct injection into a tissue site. Alternatively, an antisense nucleic acid molecule can be modified to target selected cells and then administered systemically. For example, for systemic administration, an antisense molecule can be modified such that it specifically binds to a receptor or an antigen that is expressed on a selected cell surface, for example, by linking the nucleic acid molecule of antisense with a peptide or an antibody that binds to a cell surface antigen receptor. The antisense nucleic acid molecule can also be administered to cells using the vectors described herein. To achieve sufficient intracellular concentrations of the antisense molecules, constructs of vectors are preferred in which the antisense nucleic acid molecule is placed under the control of a strong pol II or poly III promoter. In another embodiment, the antisense nucleic acid molecule of the present invention is an a-anomeric nucleic acid molecule. The a-anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA where, unlike the usual β-units, the chains are formed in a parallel manner between them (Gaultier et al (1987) Nucleic Acids. 15: 6625-6641). The antisense nucleic acid molecule can also comprise a 2'-o-methylribonucleotide (Inoue et al (1987) Nucleic Acids Res. 15: 6131-6148) or a chimeric .RNA-DNA analogue (Inoue et al. 1987) FEBS Lett 215: 327- 330). In another embodiment, an antisense nucleic acid of the present invention is a ribozyme. Ribozymes are catalytic RNA molecules with ribonuclease activity capable of dissociating a single-stranded nucleic acid, such as mRNA, with which they have a complementary region. Thus, ribozymes (e.g., hammerhead ribozymes (described in Haselhoff and Gerlach (1988) Nature 334: 585-591)) can be used to catalytically dissociate mRNA transcripts from hALG-2LP, SALG-2LP, or mALG -2LP to inhibit the translation of hALG-2LP mRNA in this way, SALG-2LP, or mALG-2LP. A ribozyme having a specificity for a nucleic acid encoding hALG-2LP, SALG-2LP, or mALG-2LP can be designed based on the nucleotide sequence of a hALG-2LP cDNA, SALG-2LP, or mALG -2LP disclosed herein (SEQ ID NO: 1, 4, or 7, respectively). For example, an RNA derivative of Tetrahymena L-19 IVS can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be dissociated in an mRNA encoding hALG-2LP, SALG-2LP, or mALG- 2LP. See, for example Cech et al. U.S. Patent No. 4,987,071 and Cech et al. U.S. Patent No. 5,116,742. Alternatively, hALG-2LP, sALG-2LP, or mALG-2LP mRNA can be used to select a catalytic AREN that has a specific ribonuclease activity from a set of RNA molecules. See, for example, Bartel, D. and Szostak, J.W. (1993) Science 261: 1411-1418. Alternatively, expression of the hALG-2LP, SALG-2LP, or mALG-2LP gene can be inhibited by the nucleotide sequence approach complementary to the regulatory region of hALG-2LP, sALG-2LP, or mALG-2LP (by example, the promoter and / or enhancer of hALG-2LP, SALG-2LP, or mALG-2LP) to form triple helical structures that prevent transcription of the hALG-2LP gene, SALG-2LP, or mALG-2LP in white cells. See, generally, Helene, C. (1991) Anticancer Drug Des. 6 (6): 569-84; Helene, C. et al. (1992) Ann. N.Y. Acad. Sci. 660: 27-36, and Maher, L.J. (1992) Bioassays 14 (12): 807-15. II. Recombinant expression vectors and host cells In another aspect of the invention, said invention relates to vectors, preferably expression vectors, which contain a nucleic acid encoding hALG-2LP, SALG-2LP, or mALG-2LP (or a portion thereof). As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid" which refers to a circular two-chain .ADN loop where additional segments of .ADN can be linked. Another type of vector is a viral vector, where additional segments of DNA can be ligated into the viral genome. Some vectors are capable of autonomous replication in a host cell into which they are introduced (eg, bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors for example, non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and therefore are replicated together with the host genome. In addition, certain vectors can direct the expression of genes to which they are operatively linked. Such vectors are known as "expression vectors". In general, expression vectors useful in recombinant DNA techniques are frequently in the form of plasmids. In the present specification, the terms "plasmids" and "vector" can be used interchangeably since the plasmid is the most frequently used vector form. However, the invention includes other forms of expression vectors, such as for example viral vectors (e.g., retroviruses, adenoviruses and adeno-associated viruses with replication defects), which serve equivalent functions. The recombinant expression vectors of the invention comprise a nucleic acid of the invention in a form suitable for the expression of the nucleic acid in a host cell, which means that the recombinant expression vectors include one or more regulatory sequences selected based on the guest cells to be employed for expression, operably linked to the nucleic acid sequence to be expressed. Within a recombinant expression vector, the expression "operatively linked" is intended to mean that the nucleotide sequence of interest is found to be unit to the regulatory sequence (s) in a manner that allows the expression of the nucleotide sequence (for example, in an in vitro transcription / translation system or in a host cell when the vector is introduced into the host cell). The term "regulatory sequence" is intended to encompass promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). Regulatory sequences include those sequences that direct the constitutive expression of a nucleotide sequence in many types of host cells and those that direct the expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). Those skilled in the art will note that the design of the expression vector may depend on factors such as the choice of the host cell to be transformed, the level of expression of the desired protein, etc. The expression vectors of the invention can be introduced into host cells to thereby produce proteins or peptides, including fusion proteins or fusion peptides, encoded by nucleic acid such as those described herein (eg, hALG-2LP proteins, S. ALG-2LP, or mALG-2LP, mutant forms of hALG-2LP, SALG-2LP, or mALG-2LP, fusion proteins, and the like). The recombinant expression vectors of the present invention can be designed for the expression of hALG-2LP, sALG-2LP, or mALG-2LP in prokaryotic or eukaryotic cells. For example hALG-2LP, SALG-2LP, or mALG-2LP can be expressed in bacterial cells such as E. coli, insect cells (using baculovirus expression vectors), yeast cells or mammalian cells. Suitable host cells are further discussed in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990) . Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example, using regulatory sequences of T7 promoter and T7 polymerase. The expression of proteins in prokaryotes are frequently carried out in E. coli with vectors containing constitutive or inducible promoters that direct the expression of either fusion proteins or non-fusion proteins. The fusion vectors add several amino acids to a coded protein, usually at the amino terminus of the recombinant protein. Such fusion vectors typically serve three purposes: 1) increase the expression of recombinant protein; 2) increases the solity of the recombinant protein; 3) help purify the recombinant protein by action as a ligand in affinity purification. Frequently, in fusion expression vectors, a proteolytic cleavage site is introduced at the junction of the fusion portion and the recombinant protein to allow separation of the recombinant protein from the fusion portion after purification of the fusion protein. . Such enzymes, and their homologous recognition sequences, include factor Xa, thrombin and enterokinase. Typical fusion expression vectors include pGEX (Pharmacia Biotech Inc. Smith, D.B. and Johnson, K.S. (1998) Gene 67: 31-40), pMAL (New England Biolabs, Beverly, MA) and pRIT5 (Pharmacia, Piscataway, NJ) fusing glutathione-S-transferase (GST), maltose binding protein E, protein A, respectively, on the white recombinant protein. In one embodiment, the coding sequence of hALG-2LP, SALG-2LP, or mALG-2LP is cloned into a pGEX expression vector to create a vector encoding a fusion protein comprising from the N-terminal to the C-terminus , GST-thrombin dissociation site-hALG-2LP, S.ALG-2LP, or mALG-2LP. The fusion protein can be purified by affinity chromatography using glutathione-agarose resin. HALG-2LP, SALG-2LP, or recombinant mALG-2LP not fused to GST can be recovered by cleavage of the fusion protein with thrombin. Examples of suitable inducible non-fusion E. coli expression vectors include pTrc (Amann et al (1988) Gene 69: 301-315) and pET lid (Studier et al., Gene Expression Technology: Methods in Enzymology 185, Academic Press , San Diego, California (1990) 60-89). The expression of the target gene from the pTrc vector is based on the transcription of host RNA polymerase from a hybrid trp-lac fusion promoter. White gene expression from the pET lid vector is based on transcription from a T7 gnlO-lac fusion promoter mediated by a co-expressed viral RNA polymerase (T7 gnl). This viral polymerase is supplied by BL21 (DE3) or HMS174 (DE3) host strains from a profago? resident having a T7 gnl gene under the control of transcription of the lacUv promoter 5. One strategy to optimize the expression of recombinant protein in E. coli is the expression of the protein in a host bacterium with an impaired capacity of proteolytic dissociation of the protein Recombinant (Gottesman, S., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California (1990) 119-128). Another strategy is to alter the nucleic acid sequence of the nucleic acid to be inserted into an expression vector such that the individual codons for each amino acid are the codons most preferably used in E. coli (Wada et al. (1992) Nucleic Acids Res. 2011-2118). Such alteration of the nucleic acid sequences of the invention can be effected by standard .DNA synthesis techniques. In another embodiment, the expression vector of hALG-2LP, sALG-2LP, or mALG-2LP is a yeast expression vector. Examples of vectors for expression in yeast S. cerevisae include pYepSecl (Baldari, et al. (1987) Embo J. 6: 229-234), pMFA (Kurjan and Herskowitz, (1982) Cell 30: 933-943), pJRY88 (Schultz et al. (19879 Gene 54: 113-123), and pYES2 (Invitrogen Corporation, San Diego, CA) Alternatively, hALG-2LP, SALG-2LP, or mALG-2LP can be expressed in insect cells using baculovirus expression vectors Baculovirus vectors available for expression of proteins in cultured insect (for example Sf9 cells) include the pAc series (Smith et al (1983) Mol Cell Biol. 3: 2156-2165) and the pVL series (Lucklow and Summers (1989) Virology 170: 31-39). In another embodiment, the nucleic acid of the present invention is expressed in mammalian cells using a mammalian expression vector Examples of mammalian expression vectors include pCDM8 (Seed, B. (1987) Na ture 329: 840) and pMT2PC (Kaufman et al (1987) EMBO J. 6: 187-195) When used in mammalian cells, the expression vector control functions are provided n frequently by viral regulatory elements. For example, commonly used promoters are derived from polyoma, adenovirus 2, cytomegalovirus and simian virus 40. For other expression systems suitable for both prokaryotic cells and eukaryotic cells, see chapters 16 and 17 of Sambrook, J., Fritsh, EF , and Maniatis, T. Molecular Cloning: A Laboratory Manual 2a. edition, ed. , Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989). In another embodiment, the recombinant mammalian expression vector can direct expression of the nucleic acid preferably in a particular cell type (for example, tissue-specific regulatory elements are used to express the nucleic acid). Specific regulatory elements for tissues are known in the art. Non-limiting examples of suitable tissue-specific promoters include the albumin promoter (specific for liver; Pinkert et al. 81987) Genes Dev. 1: 268-277), lymphoid-specific promoters (Caiame and Eaton (1988) Adv. Immunol. 43: 235-275), particularly promoters of T cell receptors (Winoto and Baltimore (1989) EMBO J 8: 729-733); and immunoglobulins (Banerji et al (1983) Cell 33: 729-740; Queen and Baltimore (1983) Cell 33: 741-748), specific promoters for neurons (eg, the neurofilament promoter; Byrne and Ruddle (1989) ) PNAS 86: 5473-5477), pancreas-specific promoters (Edlund et al (1985) Science 230: 912-916), and mammary gland-specific promoters (eg, whey promoter, US Patent No. 4,873,316). and European application publication No. 264,166). Regulated promoters for development are also encompassed, for example, the murine Hox promoters (Kessel and Gruss (1990) Science 249: 374-379) and the α-fetoprotein promoter (Campes and Tilghman (1989) Genes Dev. 3: 537-546). The invention further provides a recombinant expression vector comprising a DNA molecule of the invention cloned into the expression vector in an antisense orientation. That is, the DNA molecule is operably linked to a regulatory sequence in such a way that expression (by transcription of the DNA molecule) of an RNA molecule that is antisense to hALG-2LP mRNA, SALG- is allowed. 2LP, or mALG-2LP. Regulatory sequences operably linked to a cloned nucleic acid in the antisense orientation can be selected which direct the continuous expression of antisense RNA molecule in various cell types, eg, viral promoters and / or viral enhancers, or regulatory sequences can selected which direct tissue-specific constitutive expression or specific for antisense RNA cell type. The antisense expression vector can be in the form of a recombinant plasmid, phagemid or attenuated virus wherein the antisense nucleic acids are produced under the control of a high efficiency regulatory region whose activity can be determined by the cell type in which the vector is introduced. For comments on the regulation of gene expression using antisense genes, see Weintraub, H. et al., Antisense RNA as a molecular tool for genetic analysis (antisense RNA as a molecular tool for genetic analysis), Reviews -Trends in Genetics , Vol. 1 (1) 1986. Another aspect of the invention relates to host cells into which a recombinant expression vector of the invention has been introduced. The terms "host cell" and "recombinant host cell" are used interchangeably herein. It is understood that these terms refer not only to the particular cell but to the progeny or potential progeny of said cell. Since certain modifications may occur in successive generations due to mutation or influences of the environment, in fact said progeny may not be identical to the cell of origin, but it is still included within the scope of the term used here. A host cell can be any prokaryotic or eukaryotic cell. For example, the protein hALG-2LP, SALG-2LP, or mALG-2LP can be expressed in bacterial cells such as E. coli, insect cells, yeast or mammalian cells (such as Chinese hamster ovary cells (CHO) ) or COS cells). Other suitable host cells are known to those skilled in the art. The vector DNA can be introduced into prokaryotic or eukaryotic cells through conventional transformation or transfection techniques. As used herein the terms "transformation" and "transfection" are intended to encompass several known techniques for the introduction of foreign nucleic acid (eg, DNA) into a host cell, such techniques include co-precipitation of calcium phosphate or chloride of calcium, transfection mediated by DEAE-dextran, lipofection or electroporation. Suitable methods for transforming or transfecting host cells can be found in Sambrook et al. (Molecular Cloning: A Laboratory Manual 2nd edition, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989), and other laboratory manuals. For a stable transfection of mammalian cells, it is known that, depending on the expression vector and the transfection technique employed, only a small fraction of cells can integrate the foreign DNA into their genome. In order to identify and select these integrants, a gene encoding a selectable marker (e.g., resistance to antibiotics) is generally introduced into the host cells together with the gene of interest. Preferred selectable markers include those that provide resistance to drugs, such as G418, hygromycin, and methotrexate. Nucleic acid encoding a selectable marker can be introduced into a host cell in the same vector as that encoding hALG-2LP, SALG-2LP, or mALG-2LP or it can be introduced into a separate vector. Stably transfected cells with the introduced nucleic acid can be identified by means of pharmacological selection (for example, the cells having the incorporated selectable marker gene will survive while the other cells will die). A host cell of the invention, such as for example a prokaryotic or eukaryotic host cell in culture, can be used to produce (ie, express) hALG-2LP, SALG-2LP, or mALG-2LP protein. Accordingly, the invention further provides methods for producing hALG-2LP protein, SALG-2LP, or mALG-2LP using the host cells of the invention. In one embodiment, the method comprises culturing the host cell of the invention (wherein a recombinant expression vector encoding hALG-2LP, SALG-2LP, or mALG-2LP has been introduced into a suitable medium until the production of hALG-2LP, SALG-2LP, or mALG-2LP In another embodiment, the method further comprises the isolation of hALG-2LP, SALG-2LP, or mALG-2LP from the host or host cell. The present invention can also be used to produce non-human transgenic animals Non-human transgenic animals can be employed in screening assays designed to identify agents or compounds, eg, drugs, pharmaceutical agents, etc., capable of ameliorating detrimental symptoms of selected disorders. such as disorders characterized by a degenerate cell death.For example, in one embodiment, a host cell of the present invention is a neuronal cell in which an encoding sequences of hALG-2LP, sALG-2LP, or mALG-2LP have been introduced. In addition, methods of the present invention can be employed to create non-human transgenic animals in which exogenous hALG-2LP, SALG-2LP, or mALG-2LP sequences have been introduced into the mouse genome, or homologous recombinant animals where HALG-2LP, SALG-2LP, or endogenous mALG-2LP sequences were altered. Such animals are useful for studying the function / activity of hALG-2LP, SALG-2LP, or mALG-2LP and for identifying and / or evaluating modulators of the activity of hALG-2LP, SALG-2LP, or mALG-2LP. As used herein, a "transgenic animal" is a non-human animal, preferably a mammal, more preferably a rodent such as a rat or mouse, wherein one or more of the cells of the animal includes a transgene. Other examples of transgenic animals include non-human primates, sheep, dogs, cows, goats, chickens, amphibians, etc. A transgene is an exogenous DNA integrated into the genome of a cell from which a transgenic animal develops and which remains in the genome of the mature animal, thus directing the expression of the gene product encoded in one or more cell types or tissues of the transgenic animal. As used herein, a "recombinant homologous animal" is a non-human animal, preferably a mammal, more preferably a mouse, wherein a gene SALG-2LP, or endogenous mALG-2LP has been altered by "homologous recombination between the endogenous gene and the exogenous DNA molecule introduced into an animal cell as for example, an embryonic cell of the animal, prior to the development of the animal A transgenic animal of the invention can be created by introducing nucleic acid encoding hALG-2LP, sALG-2LP, or mALG-2LP into the pro-nuclei oocyte males fertilized, for example, by microinjection, retroviral infection, and allowing the oocyte to develop in a pseudoprecious female recipient animal The cDNA sequence of hALG-2LP, SALG-2LP, or mALG-2LP of SEQ ID NO: 1 , 4 or 7, can be introduced as a transgene in the genome of a non-human animal.Alternatively, a non-human, non-monkey, non-murine homolog of the hALG-2LP gene, sALG-2LP, or mALG-2LP as by example hALG-2LP gene, sALG-2LP, or mA Human LG-2LP can be isolated based on hybridization with the .ADNc of hALG-2LP, sALG-2LP, or mALG-2LP (described further in section I above) and used as a transgene. Synchronous sequences and polyadenylation signals can also be included in the transgene to increase the efficiency of expression of the transgene. A specific regulatory sequence (s) for tissue can be operatively linked to the transgene of hALG-2LP, S.ALG-2LP, or mALG-2LP to direct protein expression hALG-2LP, SALG-2LP, or mALG-2LP to a particular cell. Methods for generating transgenic animals through embryo manipulation and microinjection, especially animals such as mice, have become conventional in the art and are described, for example in U.S. Patent Nos. 4,736,866 and 4,870,009, both by Leder et al., U.S. Patent No. 4,873,191 to Wagner et al. and in Hogan, B., Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1986). Similar methods are used for the production of other transgenic animals. A transgenic founder animal can be identified based on the presence of transgene hALG-2LP, SALG-2LP, or mALG-2LP in its genome and / or by mRNA expression of hALG-2LP, sALG-2LP, or mALG -2LP in tissues or cells of animals. A transgenic founder animal can then be employed to rear additional animals that carry the transgene. Further, . Transgenic animals that carry a transgene encoding hALG-2LP,? ALG-2LP, or mALG-2LP can be crossed with other transgenic animals that carry other transgenes. To create a homologous recombinant animal, a vector is prepared that contains at least a portion of hALG-2LP gene, S.ALG-2LP, or mALG-2LP where a removal, addition, or substitution has been introduced to alter this way, for example, functionally upsetting the hALG-2LP gene, SALG-2LP, or mALG-2LP. The gene hALG-2LP, SALG-2LP, or mALG-2LP can be a human gene (for example, from a human genomic clone isolated from a human genomic library screened with the cDNA of SEQ ID NO: 1.4 or 7). ), but more preferably it is a non-human homologue of a hALG-2LP gene, sALG-2LP, or human mALG-2LP. For example, a rat ALG-2LP gene can be isolated from a frog genomic DNA library using the ALG-2LP system, monkey ALG-2LP, or a partial murine ALG-2LP cDNA of SEQ ID. NO: 1,4 or 7 as a probe. The rat ALG-2LP gene can then be employed to construct a suitable homologous recombination vector to alter an endogenous ALG-2LP gene in the rat genome. In a preferred embodiment, the vector is designed such that, upon homologous recombination, the endogenous ALG-2LP gene is functionally disrupted (i.e., it no longer encodes a functional protein).; it is also known as a "knocked out" vector). Alternatively, the vector can be designed such that, upon homologous recombination, the endogenous ALG-2LP gene is mutated or otherwise altered but still encodes a functional protein (eg, the upstream regulatory region can be altered to alter in this way the expression of the endogenous ALG-2LP protein). In the homologous recombination vector, the altered portion of the ALG-2LP gene is flanked at its 5 'and 3' ends by additional nucleic acid of the ALG-2LP gene to allow homologous recombination to occur between the hALG-2LP gene, SALG- 2LP, either exogenous mALG-2LP carried by the vector and an endogenous ALG-2LP gene in an embryonic precursor cell. The nucleic acid hALG-2LP, SALG-2LP, or additional flank mALG-2LP is of sufficient length for successful homologous recombination with the endogenous gene. Typically, several kilobases of flank DNA (both at the 5 'and 3' ends) are included in the vector (see, for example, Thomas, KR and Capecchi, MR (1987) Cell 51: 503 for a description of vectors of homologous recombination). The vector is introduced into a line of embryonic precursor cells for example, by electroporation), and the cells in which the introduced hALG-2LP, SALG-2LP, or mALG-2LP gene has been recombined in an homologous manner with the ALG gene. Endogenous-2LP are selected (see, for example, Li, E. et al. (1992) Cell 69: 915). The selected cells are then injected into a blastocyst of an animal (e.g., a mouse) to form aggregation chimeras (see, e.g., Bradley, A. in Teratocarconomas and Embryonic Stem Cells: A Practical Approach, EJRoberston, ed. (IRL, Oxford, 1987) pages 113-152). A chimeric embryo can then be implanted into a suitable pseudopregnant female carrier animal and the embryo brought to term. Progeny presenting the homologously recombined DNA in their germ cells can be used to breed animals in which all cells of the animal contain the homologously recombined DNA by transducing the germ line of the transgene. Methods for constructing homologous recombination vectors as well as homologous recombinant animals are described in Bradley, A. (1991) Current Opinion in Biotechnology 2: 823-829 and in Publications International PCT Numbers: WO 90/11354 by Le Mouellec et al .; WO 91/01140 by S ithies et al .; WO 92/0968 by Zijlstra et al .; and WO 93/04169 by Berns et al.

In another embodiment, transgenic non-human animals containing selected systems that allow regulated expression of the transgene can be produced. An example of such a system is the cre / loxP recombinase of bacteriophage Pl system. For a description of the cre / loxP recombinase system, see, for example, Lakso et al. (1992) PNAS 89: 6232-6236. Another example of a recombinase system is the FLP recombinase system of Saccharomyces cerevisiae (0 'Gorman et al. (1991) Science 251: 1351-1355) If a cre / loxP recombinase system is used to regulate the expression of the transgene, animals containing Transgenes encoding both Cre recombinase with a selected protein are required Such animals can be provided through the construction of "double" transgenic animals, for example, by crossing two transgenic animals, one containing a transgene that encodes a protein selected and the other containing a transgene encoding a recombinase Clones of non-human transgenic animals described herein may also be produced in accordance with the methods described in Wilmut, I. et al. (1997) Nature 385: 810-813 and Publications PCT International Nos: WO 97/07668 and WO 97/07669 In summary, a cell, for example a somatic cell, of the transgenic animal can be isolated and n induced to leave the growth site and enter the G0 phase. The quiescent cell can then be fused, for example, through the use of electrical impulses, onto an enucleated oocyte from an animal of the same species from which the quiescent cell was isolated. The reconstructed oocyte is then cultured in such a way that it develops into a morula or blastocyst and then transferred to a pseudopregnant female recipient animal. The offspring born of this female receptor animal will be a clone of the animal from which the cell was isolated, for example the somatic cell. III. Proteins hALG-2LP, sALG-2LP, and mALG-2LP isolated as well as antibodies anti-hALG-2LP, anti-sALG-2LP, and anti-mALG-2LP Another aspect of the present invention relates to proteins hALG-2LP, SALG -2LP, and mALG-2LP isolated, and for being biologically active thereof, as well as peptide fragments suitable for use as immunogens to prepare anti-hALG-2LP, anti-sALG-2LP, and anti-mALG-2LP antibodies . An "isolated" or "purified" protein or a biologically active portion thereof is substantially free of cellular material when produced by recombinant DNA techniques, either chemical precursors or other chemicals when chemically synthesized. The expression "substantially free of cellular material" includes preparations of protein hALG-2LP, SALG-2LP, or mALG-2LP wherein the protein is separated from cellular components of cells where it is produced naturally or recombinantly. In one embodiment, the expression "substantially" free of cellular material "includes protein preparations hALG-2LP, SALG-2LP, or mALG-2LP having less than about 30% (dry weight) of non-hALG-2LP protein, SALG-2LP, or mALG-2LP (also referred to herein as a "contaminating protein"), preferably less than about 20% non-hALG-2LP protein, SALG-2LP, or mALG-2LP, preferably even more less than the approximately 10% non-hALG-2LP protein, SALG-2LP, or mALG-2LP and more preferably less than about 5% non-hALG-2LP protein, S.ALG-2LP, or mALG-2LP. When the protein hALG-2LP, SALG-2LP, or mALG-2LP or biologically active portion thereof is produced recombinantly, it is also preferred that it be substantially free of culture medium, ie, that the culture medium represents less about 20%, more preferably less than about 10%, and especially less than about 5% d the volume of the protein preparation. The expression "substantially free of chemical precursors or other chemicals" includes hALG-2LP protein preparations, SALG-2LP, or mALG-2LP, where the protein is separated from chemical precursors or other chemical substances involved in the synthesis of the protein. In one embodiment, the phrase "substantially free of chemical precursors or other chemicals" includes protein preparations hALG-2LP, SALG-2LP, or mALG-2LP having less than about 30% (by dry weight) of chemical precursors or either non-hALG-2LP, sALG-2LP, or mALG-2LP chemicals, more preferably less than about 20% chemical precursors or non-hALG-2LP, SALG-2LP, or mALG-2LP chemicals, preferably even greater than less than about 10% chemical precursors or non-hALG-2LP, SALG-2LP, or mALG-2LP chemicals and especially less than about 5% non-hALG-2LP chemical precursors, SALG-2LP, or mALG-2LP. In preferred embodiments, the isolated proteins or biologically active portions thereof do not have contaminating proteins from the same animal from which the protein hALG-2LP, sALG-2LP, or mALG-2LP is derived. Typically, such proteins are produced by the recombinant expression, for example, of a human ALG-2LP protein in a non-human cell. A protein hALG-2LP, SALG-2LP, or mALG-2LP isolated by a portion thereof of the present invention can modulate programmed cell death. In preferred embodiments the protein or portion thereof comprises an amino acid sequence that is sufficiently homologous with an amino acid sequence of SEQ ID NO: 2, 5, or 8 in such a manner that the protein or portion thereof maintains the capacity to modulate programmed cell death. The portion of the protein is preferably a biologically active portion in accordance with what is described herein. In another preferred embodiment, the hALG-2LP protein (i.e., amino acid residues 1-284 of SEQ ID NO: 2), the sALG-2LP protein, (i.e., amino acid residues 1-277 of SEQ ID NO: 5 ), or else mALG-2LP protein (i.e., amino acid residues 1-274 of SEQ ID NO: 8) has an amino acid sequence shown in SEQ ID NO: 2, 5, or 8, respectively, or a sequence of amino acid that is encoded by the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC® with Accession Number:.

In another preferred embodiment, the protein hALG-2LP, sALG-2LP, or mALG-2LP has an amino acid sequence that is encoded by a nucleotide sequence that hybridizes, for example, that hybridizes under stringent conditions, to the sequence of nucleotides of the DNA insert of the plasmid deposited with ATCC ® with Accession Number:. In another preferred embodiment, the hALG-2LP, SALG-2LP, or mALG-2LP protein has two amino acid sequences which is encoded by a nucleotide sequence that is at least 32%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more homologous with the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC® with Accedo Number:. Preferred hALG-2LP, sALG-2LP, or mALG-2LP proteins of the present invention also possess at least one of the hALG-2LP, SALG-2LP, or mALG-2LP activities described herein. For example, a preferred hALG-2LP, SALG-2LP, or mALG-2LP protein of the present invention includes an amino acid sequence encoded by a nucleotide sequence that hybridizes, for example, that hybridizes under stringent conditions, to the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC® with Accession Number: and that can modulate the programmed cell death. In other embodiments, the protein hALG-2LP, sALG-2LP, or mALG-2LP is substantially homologous to the amino acid sequence of SEQ ID NO: 2, 5, or 8 and retains the functional activity of the protein of SEQ ID NO. : 2, 5, or 8 and yet differs in amino acid sequence due to natural allelic variation or mutagenesis, as described in detail in subsection I above. Accordingly, in another embodiment, the protein hALG-2LP, SALG-2LP, or mALG-2LP is a protein comprising an amino acid sequence that is at least about 38%, 42%, 44%, 45%, 50 %, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%. 98% or more homologous with the entire amino acid sequence of SEQ ID NO: 2, 5 or 8 and having at least one of the hALG-2LP, sALG-2LP, or mALG-2LP activities described herein. In another embodiment, the invention pertains to a human protein of full length substantially homologous to the amino acid sequence of SEQ ID NO: 2, 5, or 8. Biologically active portions of the hALG-2LP protein, SALG-2LP, or mALG-2LP include peptides comprising amino acid sequences derived from the amino acid sequences of the protein hALG-2LP, SALG-2LP, or mALG-2LP, for example, the amino acid sequences illustrated is SEQ ID NO: 2, 5, or 8, respectively, or the amino acid sequences of a protein analogous to the hALG-2LP protein, SALG-2LP, or mALG-2LP, which contains fewer amino acids than the protein hALG-2LP, SALG-2LP, or full-length mALG-2LP or the full-length protein that homologates the protein hALG-2LP, SALG-2LP, or mALG-2LP and has at least one activity of the protein hALG-2LP, SALG-2LP, or well mALG-2LP. Typically, biologically active portions (peptides, for example, peptides having for example 5, 10, 15, 20, 30, 35, 36, 37, 38, 39, 40, 50, 100 or more biological amino acids) comprise a domain or reason, for example, a domain showing homology with a calcium binding domain, for example an EF hand, which is derived from a human being and has a homology of at least about 38%, 42%, 44%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more with SEQ ID NO: 10, 11, 12, 13, or 15. In addition, other biologically active portions in which other regions of the proteins are removed can be prepared by recombinant techniques and evaluated for one or more of the activities described herein. Preferably, the biologically active portions of the protein hALG-2LP, SALG-2LP, or mALG-2LP include one or more selected domains / motifs or portions thereof having a biological activity. The hALG-2LP proteins, SALG-2LP, or mALG-2LP are preferably produced by recombinant DNA techniques. For example, a nucleic acid molecule encoding the protein is cloned into an expression vector (in accordance with that described above), the expression vector is introduced into a host cell (in accordance with that described above), and the protein hALG-2LP, SALG-2LP, or mALG-2LP is expressed in the host cell. The protein hALG-2LP, SALG-2LP, or mALG-2LP can then be isolated from the cells by an appropriate purification scheme using standard protein purification techniques. Alternatively to the recombinant expression, protein, polypeptide, or peptide of hALG-2LP, SALG-2LP, or mALG-2LP can be synthesized chemically using standard synthesis techniques. In addition, hALG-2LP protein, sALG-2LP, or native mALG-2LP can be isolated from cells (eg, brain cells or other cells expressing ALG2-LP) for example, using an anti-hALG-2LP antibody, SALG-2LP, or mALG-2LP (described in more detail below). The invention also offers chimeric or fusion proteins hALG-2LP, sALG-2LP, or mALG-2LP. As used herein a chimeric 2protein "hALG-2LP, SALG-2LP, or mALG-2LP or a" fusion protein "hALG-2LP, SALG-2LP, or mALG-2LP comprises a hALG-2LP polypeptide, SALG-2LP or either mALG-2LP operably linked to a non-hALG-2LP peptide, S. ALG-2LP, or mALG-2LP A "hALG-2LP polypeptide, sALG-2LP, or mALG-2LP" refers to a polypeptide having an amino acid sequence corresponding to hALG-2LP, SALG-2LP, or mALG-2LP, while a "non-hALG-2LP polypeptide, SALG-2LP, or mALG-2LP" refers to a polypeptide having an amino acid sequence that corresponds to a protein that is not substantially homologous with the hALG-2LP protein, SALG-2LP, or mALG-2LP, for example, a protein that is different from the hALG-2LP protein, SALG-2LP , or mALG-2LP, and which is derived from the same organism or from a different organism Within the fusion protein the term "operatively linked" is intended to indicate that the polypeptide gone hALG-2LP, SALG-2LP, or either mALG-2LP and the non-hALG-2LP polypeptide, SALG-2LP, or • either mALG-2LP are fused together in frame. The non-hALG-2LP polypeptide, SALG-2LP, or mALG-2LP may be fused to the N or C terminus of the hALG-2LP polypeptide, SALG-2LP, or mALG-2LP. For example, in one embodiment, the fusion protein is fusion protein GST-hALG-2LP, GST-sALG-2LP or GST-mALG-2LP where the sequences hALG-2LP, sALG-2LP, or mALG-2LP are merge onto terminal C of the GST sequences. Such fusion proteins can facilitate the purification of hALG-2LP, SALG-2LP, or recombinant mALG-2LP. In another embodiment, the fusion protein is a hALG-2LP, SALG-2LP, or mALG-2LP protein that contains a heterologous signal sequence at its N-terminus. In certain host cells (e.g., mammalian host cells), the expression and / or secretion of hALG-2LP, S. ALG-2LP, or mALG-2LP can be increased by the use of a heterologous signal sequence. Preferably, a chimeric or fusion protein hALG-2LP, SALG-2LP, or mALG-2LP of the invention is produced by standard recombinant DNA techniques. For example, fragments of .DNA encoding the different polypeptide sequences are joined together in a frame in accordance with conventional techniques, for example, by the use of flat-ended or stepped end terminals for ligation, restriction enzyme digestion for provide the appropriate terminals, filling the cohesive ends as appropriate, treatment with alkaline phosphatase to avoid undesirable bonds, and enzymatic ligation. In another modality, gene 71 Fusion can be synthesized by conventional techniques that include automatic DNA synthesizers. Alternatively, an amplification by polymerase chain reaction of gene fragments can be effected by employing anchor primers that cause the formation of complementary ridges between two consecutive gene fragments that can be subsequently fused and reamplified to generate a chimeric gene sequence (see, for example, Example, Current Protocols in Molecular Biology, eds, Ausubel et al., John Wiley, Sons: 1992). In addition, many expression vectors are commercially available which already encode a fusion portion (eg, a GST polypeptide). A nucleic acid encoding GST can be cloned into an expression vector of this type such that the fusion portion is bound in frame to the hALG-2LP protein, sALG-2LP, or mALG-2LP. The present invention also relates to homologs of the proteins hALG-2LP, SALG-2LP, or mALG-2LP which function either as agonists of hALG-2LP, sALG-2LP, or mALG-2LP (mimetics) or a antagonist hALG-2LP, SALG-2LP, or mALG-2LP. In a preferred embodiment, the agonists and antagonists hALG-2LP, SALG-2LP, or mALG-2LP stimulate or inhibit, respectively, a subset of the biological activities of the naturally occurring form of the protein hALG-2LP, SALG-2LP , or mALG-2LP. Thus, the specific biological effects may be caused by treatment with a homolog of limited function. In one embodiment, treating a subject with a homolog having a subset of the biological activities of the naturally occurring form of the protein has fewer side effects in a subject compared to treatment with the naturally occurring form of the protein. hALG-2LP, SALG-2LP, or mALG-2LP. Homologues of the protein hALG-2LP, SALG-2LP, or mALG-2LP can be generated by mutagenesis, for example, discrete or truncated point mutation of the protein hALG-2LP, sALG-2LP, or mALG-2LP. As used herein the term "homologous" refers to a variant form of the protein hALG-2LP, SALG-2LP, or mALG-2LP which acts as an agonist or antagonist of the activity of the protein hALG-2LP, sALG-2LP , or mALG-2LP. An agonist of the protein hALG-2LP, SALG-2LP, or mALG-2LP may retain substantially the same biological activities as the protein hALG-2LP, sALG-2LP, or mALG-2LP, or a subset of such biological activities . An antagonist of the hALG-2LP protein, SALG-2LP, or mALG-2LP can inhibit one or more of the activities of the naturally occurring form of the hALG-2LP protein, SALG-2LP, or mALG-2LP, by example by competitive binding to a downstream or upstream member of the cascade of hALG-2LP, SALG-2LP, or mALG-2LP including the protein hALG-2LP, SALG-2LP, or mALG-2LP. Thus, the mammalian hALG-2LP, SALG-2LP, or mALG-2LP protein and homologs thereof of the present invention can be positive or negative regulators of a programmed cell death transduction pathway activity. In an alternative embodiment, homologs of the hALG-2LP protein, S.ALG-2LP, or mALG-2LP can be identified by screening combinatorial libraries of mutants, eg, truncation mutants, of the hALG-2LP protein, SALG -2LP, or mALG-2LP for agonist or antagonist activity of the protein hALG-2LP, SALG-2LP, or mALG-2LP. In one embodiment, a varied library of variants of hALG-2LP, SALG-2LP, or mALG-2LP is generated by combination mutagenesis at the nucleic acid level and is encoded by a varied gene library. A varied library of variants hALG-2LP, S.ALG-2LP, or mALG-2LP can be produced for example by enzymatically linking a mixture of synthetic oligonucleotides to gene sequences in such a way that a degenerate set of sequences can be expressed hALG-2LP, sALG-2LP, either mALG-2LP potentials as individual polypeptides, or alternatively, as a larger set of fusion proteins (e.g., to visualize phages) containing the set of hALG-2LP sequences, sALG-2LP , or ALG-2LP. There are several methods that can be used to produce libraries of potential hALG-2LP, SALG-2LP, or mALG-2LP homologs from a degenerate oligonucleotide sequence. The chemical synthesis of a degenerate gene sequence can be carried out in an automatic DNA synthesizer and the synthetic gene is then ligated into an appropriate expression vector. The use of a set of gene generators allows the delivery, in a mixture of all the coding sequences of the desired set of potential hALG-2LP, SALG-2LP, or mALG-2LP sequences. Methods for synthesizing degenerate oligonucleotides are known in the art (see, for example, Narang, S.A. (1983) Tetrahedron 39: 3; Itakura et al. (1984) Annu. .Rev. Biochem. 53: 323; Itakura et al. (1984) Science 198: 1056; Ike et al. (1983) Nucleic Acid Res. 11: 477). In addition, fragment libraries of the protein encoding hALG-2LP, SALG-2LP, or mALG-2LP can be used to generate a varied population of hALG-2LP, SJALG-2LP, or mALG-2LP fragments for screening and subsequent selection of homologues of a protein hALG-2LP, S.ALG-2LP, or mALG-2LP. In one embodiment, a library of coding sequence fragments can be generated by treating a double-stranded polymerase chain reaction fragment of a hALG-2LP coding sequence, SALG-2LP, or mALG-2LP with a nuclease lowers conditions in which a cut occurs only approximately once per molecule, denaturing the double-stranded DNA, renaturing the DNA to form a double-stranded DNA that can include sense / antisense pairs of different cut products, remove portions of single chain of the duplexes reformed by treatment with SI nuclease, and ligate the resulting fragment library into an expression vector. Through this method, an expression library can be derived that encodes N-terminal, C-terminal, and internal fragments of various sizes of the hALG-2LP protein, SALG-2LP, or mALG-2LP. Various techniques are known for screening gene products from combination libraries made by dot or truncation mutations, and for screening cDNA libraries for gene products having a selected property. Such techniques are adaptable for rapid screening of gene libraries generated by the homologous combination mutagenesis of hALG-2LP, SALG-2LP, or mALG-2LP. The most widely used techniques that can be employed in the case of high throughput analysis, for screening large gene libraries typically include cloning the gene library into replicable expression vectors, transforming appropriate cells with the resulting library of vectors, and the expression of the combination genes under conditions in which the detection of a desired activity facilitates the isolation of the vector encoding the gene whose product was detected. Reconstructive mutagenesis (REM), a new technique that increases the frequency of functional mutants in libraries, can be used with screening assays to identify homologs of hALG-2LP, SALG-2LP, or mALG-2LP (Arkin and Yourvan (1992) PNAS 89: 7811-7815; Degrave et al. (1993) Protein Engineering 6 (3): 327-331). In one embodiment, cell-based assays can be exploited to analyze a library of hALG-2LP, sALG-2LP, or miscellaneous mALG-2LP, for example, a library of expression vectors can be transfected into a cell line, for example , a T-cell hybridoma (3D0) that has been cross-linked with a T cell receptor to induce programmed cell death (in accordance with that described in Ashwell JD et al (1990) J. Immunol., 144: 3326). The effect of the hALG-2LP mutant, SALG-2LP, or mALG-2LP on programmed cell death can be detected, for example, by monitoring nuclear chromatin changes. The plasmid DNA can then be recovered from the reconsidered cells for inhibition or alternatively stimulation of programmed cell death, and the individual clones can usually be characterized. A protein hALG-2LP, SALG-2LP, or mALG-2LP isolated, or a portion or fragment thereof can be used as an immunogen to generate antibodies that bind with hALG-2LP, SALG-2LP, or mALG-2LP using standard techniques for the preparation of polyclonal and monoclonal antibodies. The hALG-2LP protein, SALG-2LP, or full-length mALG-2LP can be used or, alternatively, the invention provides antigenic peptide fragments of hALG-2LP, sALG-2LP, or mALG-2LP for use as immunogens. The antigenic peptide of hALG-2LP, sALG-2LP, or mALG-2LP comprises at least 8 amino acid residues of the amino acid sequence shown in SEQ ID NO: 2, 5, or 8 and encompasses an epitope of hALG- 2LP, SALG-2LP, or mALG-2LP in such a way that an antibody prepared against a peptide forms a specific immune complex with hALG-2LP, SALG-2LP, or mALG-2LP. Preferably, the antigenic peptide comprises at least 10 amino acid residues, more preferably 15 amino acid residues, still more preferably 20 amino acid residues and especially at least 30 amino acid residues. Preferred epitopes encompassed by the antigenic peptide are regions of hALG-2LP, SALG-2LP, or mALG-2LP that are found on the surface of the protein, e.g., hydrophilic regions. An hALG-2LP immunogen, SALG-2LP, or mALG-2LP is typically used to prepare antibodies by immunizing a suitable subject (e.g., rabbit, goat, mouse, or other mammal) with the immunogen. An appropriate immunogenic preparation may contain, for example, hALG-2LP protein, SALG-2LP, or mALG-2LP expressed recombinantly either a hALG-2LP peptide, SALG-2LP, or chemically synthesized mALG-2LP. The preparation may further include an assistant, such as a complete or incomplete Freud's assistant, or a similar immunostimulation agent. Immunization of a suitable subject with a preparation of hALG-2LP, SALG-2LP, or immunogenic mALG-2LP induces an anti-hALG-2LP antibody response, anti-sALG-2LP, or polyclonal anti-mALG-2LP. Accordingly, another aspect of the invention relates to anti-hALG-2LP, anti-sALG-2LP, or anti-mALG-2LP antibodies. The term "antibody" as used herein refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, ie, molecules that contain an antigen binding site that specifically binds (reacts immunologically with) an antigen, such as example, in hALG-2LP, S.ALG-2LP, or mALG-2LP. Examples of immunologically active portions of immunoglobulin molecules include F (ab) and F (ab) 2 fragments which can be generated by treatment of the antibody with an enzyme such as for example pepsin. The invention offers polyclonal and monoclonal antibodies that bind hALG-2LP, SALG-2LP, or mALG-2LP. The term "monoclonal antibody" or "monoclonal antibody composition", as used herein, refers to a population of antibody molecules that contain only one species of an antigen binding site capable of reacting immunologically with a particular epitope of hALG-2LP, SALG-2LP, or mALG-2LP. A monoclonal antibody composition therefore typically exhibits a unique binding affinity for a protein hALG-2LP, sALG-2LP, or mALG-2LP with which it immunoreacts. Anti-hALG-2LP polyclonal antibodies, SALG-2LP, or mALG-2LP can be prepared according to the above described by immunizing a suitable subject with a hALG-2LP immunogen, SALG-2LP, or mALG-2LP. The titer of anti-hALG-2LP antibody, sALG-2LP, or mALG-2LP in the immunized subject can be monitored over time by standard techniques, for example by an enzyme-linked immunosorbent assay (ELISA) using hALG- 2LP, SALG-2LP, or immobilized mALG-2LP. If desired, antibody molecules directed against hALG-2LP, SALG-2LP, or mALG-2LP can be isolated from mammalian (eg, from blood, and further purified by well-known techniques such as protein A chromatography to obtain The IgG fraction At an appropriate time after immunization, for example, when anti-hALG-2LP, SALG-2LP, or mALG-2LP antibody titers with the highest are obtained, cells that produce cells can be obtained of the subject and can be used to prepare monoclonal antibodies by standard techniques, as for example the hybridoma technique originally described by Kohler and Milstein (1975) Nature 256: 495-497) (see also, Brown et al. (1981) J. Immunol. 127: 539-46; Brown et al. (1980) J. Biol. Chem. 255: 4980-83; Yeh (1976) PNAS 76: 2927-31; and Yeh et al. (1982) Jnt. J. Cancer 29: 269-75), the most recent human cell hybridoma technique (Kozbor et al. (1983) Immunol Today 4:72), the EBV-hybridoma technique (Colé et al. (1985), Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pages 77-96) or trioma techniques. The technology for the production of well-known monoclonal antibody hybridomas (see generally RH Kenneth, in Monoclonal Antibodies: A New Dimension in Biological Analyzes, Plenum Publishing Corp., New York, New York (1980); EA Lerner (1981) Yale J Biol. Med., 54: 387-402; ML Gefter et al. (1977) Soma tic Cell Genet., 3: 231-36). Briefly, a line of immortal cells (typically a myeloma) is fused on lymphocytes (typically splenocytes) of a mammal immunized with a hALG-2LP immunogen, SALG-2LP, or mALG-2LP in accordance with that described above, and the culture supernatants of the resulting hybridoma cells are screened to identify a hybridoma that produces a monoclonal antibody that binds with hALG-2LP, sALG-2LP, or mALG-2LP. Any of many well-known protocols used to fuse lymphocytes and immortalized cell lines can be applied for the purpose of generating an anti-hALG-2LP monoclonal antibody, sALG-2LP, or mALG-2LP (eg, G. Galfre et al. 1977) Nature 266: 55052; Gefter et al., Somatic Cell Genet, cited above, Lerner, Yale J. Biol Med., Cited above, Kenneth, Monoclonal Antibodies, cited above). In addition, the person with ordinary knowledge in the field will note that numerous variations of these methods would be useful. Typically, the deadly cell line (e.g., a myeloma cell line) is derived from the same mammalian species as the lymphocytes. For example, murine hybridomas can be made by melting lymphocytes from a mouse immunized with the immunogenic preparation of the present invention with an immortalized mouse cell line. Preferred immortal cell lines are lines of mouse myeloma cells sensitive to the culture medium containing hypoxanthine, aminopterin, and thymidine ("HAT medium"). Any of many lines of myeloma cells can be used as a fusion partner in accordance with standard techniques, for example, the myeloma lines of P3-NS1 / 1-Ag4-1, P3-x63-Ag8.653 or Sp2 / 0 -Agl4. These myeloma lines are available in ATCC®. Typically, HAT-sensitive mouse myeloma cells are fused onto mouse splenocytes using polyethylene glycol ("PEG"). Hybridoma cells resulting from the fusion are then selected using a HAT medium that labels the unfused myeloma cells and the myeloma cells fused unproductively (the unfused splenocytes die after several because they are not transformed). Hybridoma cells producing a monoclonal antibody of the present invention are detected by screening the hybridoma culture supernatants for the presence of antibodies that bind with hALG-2LP, SALG-2LP, or mALG-2LP, for example, using a standard ELISA assay. Alternatively, to prepare hybridomas secreting monoclonal antibodies, an anti-hALG-2LP monoclonal antibody, SALG-2LP, or mALG-2LP, can be identified and isolated by screening a recombinant combination immunoglobulin library (e.g. antibody phage display library) with hALG-2LP, SALG-2LP, or mALG-2LP, to thereby isolate immunoglobulin library members that bind with hALG-2LP, SALG-2LP, or mALG-2LP. Kits for generating and screening commercial phage display libraries (for example, Pharmacia Recombinant Phage Antibody System, catalog number 27-9400-01, and Stratagene's SurfZAP ™ Phage Display iC? T, catalog number 240612). In addition, examples of methods and reagents particularly suitable for use in generating and screening an antibody visualization library can be found, for example, in US Patent No. 5,223,409 to Ladner et al.; in PCT International Publication No. WO 92/18619 to Kang et al .; in PCT International Publication No. WO 91/17271 to Dower et al .; in PCT International Publication No. WO 92/20791 of Winter et al .; in PCT International Publication No. WO 92/15679 to Markland et al .; in PCT International Publication No. WO 93/01288 to Breitling et al .; in PCT International Publication No. WO 92/01047 by McCafferty et al .; in PCT International Publication No. WO 92/09690 to Garrard et al .; in PCT International Publication No. WO 90/02809 to Ladner et al .; Fuchs et al. (1991) Bio / Technology 9: 1370-1372; Hay et al. (1992) Hum. Antibod. Hybridomas 3: 81-85; Huse et al. (1989) Science 246: 1275-1281; Griffiths et al. (1993) EMBO J 12: 725-734; Hawkins et al. (1992) J. Mol. Biol. 226: 889-896; Clarkson et al. (1991) Na ture 352: 624-628; Gram et al. (1992) PNAS 89: 3576-3580; Garrad et al. (1991) Bio / Technology 9: 1373-1377; Hoogenboom et al. (1991) Nuc. Acid Res. 19: 4133-4137; Barbas et al. (1991) PNAS 88: 7978-7982; and McCafferty et al. Nature (1990) 348: 552-554. In addition, recombinant anti-hALG-2LP, SALG-2LP, or mALG-2LP antibodies, such as, for example, chimeric and humanized monoclonal antibodies, comprising both human and non-human portions, which can be made using standard recombinant DNA techniques, are found within the scope of the present invention. Such chimeric and humanized monoclonal antibodies can be produced by known recombinant DNA techniques, for example, using methods described in Robinson et al. International Application No. PCT / US86 / 02269; Akira, et al., European Patent Application 184,187; Taniguchi, M., European Patent Application 171,496; Morrison et al., European Patent Application 173,494; Neuberger et al., PCT International Publication No. WO 86/01533; Cabilly et al., US Patent No. 4,816,567; Cabilly et al., European Patent Application 125,023; Better et al. (1988) Science 240: 1041-1043; Liu et al. (1987) PNAS 84: 3439-3443; Liu et al. (1987) J. Immunol 139: 3521-3526; Sun et al. (1987) PNAS 84: 214-218; Nishimura ET al. (1987) Ca c. Res. 47: 999-1005; Wood et al. (1985) Nature 314: 446-449; and Shaw et al (1988) J. Na ti. Cancer Inst. 80: 1553-1559); Morrison, S.L. (1985) Science 229: 1202-1207; Oi et al. (1986) Bio Techniques 4: 214; Winter, Patent. North American No. 5,225,539; Jones et al. (1986) Nature 321: 552-525; Verhoeyan et al. (1988) Science 239: 1534; and Beidler et al. (1988) J. Immunol. 141: 4053-4060. An anti-hALG-2LP antibody, sALG-2LP, or mALG-2LP (eg, monoclonal antibody) can be used to isolate hALG-2LP, SALG-2LP, or mALG-2LP by standard techniques, for example affinity chromatography or immunoprecipitation. An anti-hALG-2LP antibody, SALG-2LP, or mALG-2LP can facilitate the purification of hALG-2LP, SALG-2LP, or natural mALG-2LP from cells and from hALG-2LP, sALG-2LP, or mALG -2LP produced recombinantly expressed in host cells. In addition, an anti-hALG-2LP, SALG-2LP, or mALG-2LP antibody can be used to detect a hALG-2LP protein, SALG-2LP, or mALG-2LP (e.g., in a lysate cell or cell supernatant) with the object to evaluate the abundance and expression pattern of the protein hALG-2LP, SALG-2LP, or mALG-2LP. Anti-hALG-2LP, SALG-2LP, or mALG-2LP antibodies can be used for diagnostic purposes in order to monitor protein levels in tissue as part of a clinical test procedure, for example, to terminate the efficacy of a given treatment regimen. Detection can be facilitated by the coupling (i.e., physical binding) of the antibody on a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials and radioactive materials. Examples of suitable enzymes include sour horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable complexes of prosthetic groups include streptavidin / biotin and avidin / biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinyl amine fluorescein, dansyl chloride, or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin, and examples of suitable radioactive material include 125 I, 131 I, 35 S or 3 H. IV. Pharmaceutical Compositions The nucleic acid molecules of hALG-2LP, SALG-2LP, or mALG-2LP, proteins hALG-2LP, SALG-2LP, or mALG-2LP, and anti bodies anti-hALG-2LP, SALG-2LP, or mALG -2LP (which are also referred to herein as "active compounds") of the present invention can be incorporated into pharmaceutical compositions suitable for administration to a subject, for example, to a human. Such compositions typically comprise the nucleic acid molecule, protein, or antibody and a pharmaceutically acceptable carrier. As used herein, the term "pharmaceutically acceptable carrier" is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption retardation agents, and the like, compatible with a pharmaceutical administration. The use of such media and agent for pharmaceutically active substances is well known in the art. Except insofar as a conventional medium or agent is incompatible with the active compound, such means may be employed in the compositions of the invention. Complementary active compounds can also be incorporated into the compositions. A pharmaceutical composition of the invention is formulated to be compatible with the intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, and rectal administration. Solutions or suspensions employed for parenteral, intradermal, or subcutaneous application may include the following components: a sterile diluent, for example water for injection, a saline solution, fixed oils, polyethylene glycol, glycerin, propylene glycol, and other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethyldiamintetraacetic acid; buffers such as acetates, citrates, or phosphates and tonicity adjusting agents such as sodium chloride or dextrose. The pH can be adjusted, with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be in ampoules, disposable syringes, or multiple-dose vials of glass or plastic. Pharmaceutical compositions suitable for use in injections include sterile aqueous solutions (when soluble in water) or sterile dispersions and powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL ™ (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and must be fluid to the extent that it can be easily handled in syringes. It must have stability under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The vehicle can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), as well as suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of coating, for example lecithin, by maintaining the required particle size in the case of a dispersion, and by the use of surfactants. Prevention of the action of microorganisms can be achieved through various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many, it is preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions can be carried out by including in the composition an agent that retards absorption, for example, aluminum monostearate and gelatin. Sterile injectable solutions can be prepared by incorporating the active compound (e.g., a hALG-2LP, SALG-2LP, or mALG-2LP protein, or an anti-hALG-2LP, anti-sALG-2LP, or anti-mALG antibody) -2LP) in the required amount in an appropriate solvent with one of the ingredients mentioned above or with a combination of said solvents, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle containing a basic dispersion medium, and the other required ingredients selected from those mentioned above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and lyophilization which provides a powder of the active ingredient plus any additional desired ingredients from a previously sterile filtered solution thereof.

Oral compositions generally include an inert ingredient or an edible vehicle. They can be found in gelatin capsules or they can be compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, capsules or lozenges. Oral compositions can also be prepared using a vehicle or fluid for use as a mouthwash, where the compound in the fluid vehicle is applied orally and expectorated or ingested. Pharmaceutically compatible binder agents, and / or helper materials can be included as part of the composition. The tablets, pills, capsules and the like may contain any of the following ingredients or compound of a similar nature: a binder, for example microcrystalline cellulose, gum tragacanth or gelatin; an excipient, for example starch or lactose, a disintegrating agent, for example, alginic acid, Primogel, or corn starch; a lubricant, for example magnesium stearate or Sterotes; a glidant, for example colloidal silicon dioxide; a sweetener, for example sucrose or saccharin; * or a flavoring, for example peppermint, methyl salicylate, or orange flavor. For administration by inhalation, the compounds are administered in the form of an aerosol spray from a pressurized container or dispenser containing a suitable impeller, for example a carbon dioxide gas or atomizer. Systemic administration can also be effected by transmucosal or transdermal means. For transmucosal or transdermal administration, appropriate penetration agents are used in the formulation for the barrier to be permeated. Such penetrating agents are generally known in the art to include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be achieved through the use of rubbers in salts or suppositories. For transdermal administration, the active compounds are formulated in ointments, gels or creams as is generally known in the art. The compounds may also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal administration. In one embodiment, the active compounds are prepared with carriers that protect the compound against rapid elimination from the body, such as for example a controlled release formulation that includes implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be employed, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for the preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes focused on cells infected with monoclonal antibodies to viral antigens) can also be employed as pharmaceutically acceptable carriers. They can be prepared in accordance with methods known to those skilled in the art, for example, in accordance with that described in US Pat. No. 4,522,811. It is a particular advantage to formulate oral or parenteral compositions in dosage unit form to facilitate administration and for greater dosage uniformity. The unit dosage form as used herein refers to physically discrete units suitable as unit dosages for the subject to be treated; each unit contains a predetermined amount of an active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the invention are dictated by the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and by the limitations inherent in the compositional technique of such an active compound for the treatment of individuals. and they depend directly on said unique characteristics, said particular therapeutic effect to be achieved and said inherent limitations. The nucleic acid molecules of the invention can be inserted into vectors and used as vectors for gene therapy. Genetic therapy vectors can be administered to a subject, such as, for example, by intravenous injection, local administration (see US Patent No. 5,328,470) or by stereotactic injection (see, for example, Chen et al. (1994) PNAS 91: 3054 -3057). The pharmaceutical preparation of the gene therapy vector can include the gene therapy vector in an acceptable diluent, or it can comprise a slow release matrix where the gene delivery vehicle is integrated. Alternatively, when the whole gene delivery vector can be produced intact from recombinant cells, e.g., retroviral vectors, the pharmaceutical preparation can include one or more cells that produce the gene delivery system. The pharmaceutical compositions may be included in a container, package, or dispenser together with instructions for administration. V. Uses and methods of the invention The nucleic acid molecules, proteins, protein homologs and antibodies described herein can be used, for example, in diagnostic assays. The nucleic acid molecules can be used to detect .RNA of hALG-2LP, SALG-2LP, or mALG-2LP (for example in a biological sample) or a genetic lesion in a gene hALG-2LP, SALG-2LP, or well mALG-2LP. In addition, the anti-hALG-2LP, anti-sALG-2LP, or anti-mALG-2LP antibodies of the invention can be used to detect and isolate hALG-2LP protein, SALG-2LP, or mALG-2LP and modulate activity of protein hALG-2LP, SALG-2LP, or mALG-2LP. Accordingly, the invention offers a method for detecting the presence of hALG-2LP, SALG-2LP, or mALG-2LP in a biological sample. The method includes contacting the biological sample as a compound or agent capable of detecting hALG-2LP protein or mRNA, sALG-2LP, or mALG-2LP in such a way that the presence of hALG-2LP, SALG- 2LP, or mALG-2LP is detected in the biological sample. A preferred agent for detecting mRNA from hALG-2LP, SALG-2LP, or mALG-2LP is a labeled or labeled nucleic acid probe capable of hybridizing with .RNA of hALG-2LP, SALG-2LP, or mALG-2LP. The nucleic acid probe can be, for example, cDNA of hALG-2LP, SALG-2LP, or full-length mALG-2LP of SEQ ID NO: 1.4 or 7, or a portion thereof, as for example an oligonucleotide of at least 15, 30, 50, 100, 250 or 500 nucleotides in length and sufficient to hybridize specifically under stringent conditions with mRNA of hALG-2LP, SALG-2LP, or mALG-2LP. A preferred agent for detecting a hALG-2LP protein, sALG-2LP, or mALG-2LP is a labeled or labeled antibody capable of binding to hALG-2LP protein, SALG-2LP, or mALG-2LP. The antibodies can be polyclonal, or, more preferably, monoclonal. An intact antibody, or a fragment thereof (for example, Fab or F (ab ') 2) can be used. The term "labeled or that may be labeled" in relation to the probe or an antibody, is intended to encompass direct labeling of the probe or antibody by coupling (i.e., physical binding) of a detectable substance on the probe or antibody, as well as by indirect labeling of the probe or antibody by reactivity with another reagent that is directly labeled. Examples of indirect labeling include detection of a primary antibody using a fluorescently labeled secondary antibody and final labeling of a biotin DNA probe such that it can be detected with fluorescently labeled streptavidin. The term "biological sample" is intended to include tissues, cells and biological fluids isolated from a subject, as well as tissues, cells and fluids present within a subject. That is, the detection method of the invention can be used to detect .RNA of hALG-2LP, SALG-2LP, or mALG-2LP or protein of hALG-2LP, SALG-2LP, or mALG-2LP in a biological sample in vitro as well as in vivo. For example, in vitro mRNA detection techniques of hALG-2LP, SALG-2LP, or mALG-2LP include Northern hybridizations as well as in situ hybridizations. In vitro techniques for the detection of protein hALG-2LP, SALG-2LP, or mALG-2LP include enzyme-linked immunosorbent assays (ELISAs), Western blot, immunoprecipitations and immunofluorescence. Alternatively, a protein of hALG-2LP, SALG-2LP, or mALG-2LP can be detected in vivo in a subject by introducing an anti-hALG-2LP antibody, SALG-2LP, or mALG-2LP in the subject. marked. For example, the antibody can be labeled with a radioactive label whose presence and location in a subject can be detected by standard imaging techniques. The invention also encompasses a kit for detecting the presence of hALG-2LP, sALG-2LP, or mALG-2LP in a biological sample. For example, the kit can comprise a labeled or labeled compound or agent capable of detecting hALG-2LP protein or mRNA, SALG-2LP, or mALG-2LP in a biological sample.; means for determining the amount hALG-2LP, sALG-2LP, or mALG-2LP in the sample; and means to purchase the amount of hALG-2LP, SALG-2LP, or mALG-2LP in the sample with a standard. The compound or agent can be packaged in a suitable container. The kit may further comprise instructions for using the kit to detect mRNA or hALG-2LP protein, sALG-2LP, or mALG-2LP. The methods of the invention can also be used to detect genetic lesions in a hALG-2LP, SALG-2LP, or mALG-2LP gene, thus determining whether a subject with an injured gene is at risk of suffering from a disorder, for example, a disorder characterized by programmed dysregulated cell death, which is characterized by an aberrant or abnormal expression of nucleic acid of hALG-2LP, SALG-2LP, or mALG-2LP or a hALG-2LP protein activity, SALG-2LP, or aberrant or abnormal mALG-2LP according to what is defined here. In preferred embodiments, the methods include detecting, in a sample of cells of the subject, the presence or absence of a genetic lesion characterized by at least one alteration affecting the integrity of a gene encoding a hALG-2LP protein, sALG-2LP , either mJ ^ LG-2LP or the erroneous expression of the hALG-2LP gene, SALG-2LP, or mALG-2LP. For example, such genetic lesions can be detected by determining the existence of at least one of the following: 1) the removal of one or several nucleotides of a hALG-2LP gene, SALG-2LP, or mALG-2LP; 2) the addition of one or more nucleotides to a hALG-2LP, SALG-2LP, or mALG-2LP gene; 3) the replacement of one or several nucleotides of hALG-2LP gene, SALG-2LP, or mALG-2LP; 4) a chromosomal rearrangement of hALG-2LP gene, SALG-2LP, or mALG-2LP; 5) an alteration in the level of the messenger RNA transcript of a hALG-2LP gene, SALG-2LP, or mALG-2LP; 6) the aberrant modification of a hALG-2LP gene, SALG-2LP, or mALG-2LP, such as the genomic DNA methylation pattern, 7) the presence of an unnatural splicing pattern of a transcript of Messenger RNA of a hALG-2LP gene, SALG-2LP, or mALG-2LP, 8) an unnatural level of a hALG-2LP protein, sALG-2LP, or mALG-2LP, 9) the allelic loss of a hALG-2LP gene, SALG-2LP, or mALG-2LP, and 109 the inappropriate post-translational modification of a hALG-2LP protein, SALG-2LP, or mALG-2LP. In accordance with that described herein, there are numerous known assay techniques that can be employed to detect lesions in the hALG-2LP, SALG-2LP, or mALG-2LP gene. In certain embodiments, the detection of the lesion includes the use of a probe / primer in a polymerase chain reaction (PCR) (see, for example, U.S. Patent Nos. 4,683,195 and 4,683,202), such as anchor PCR or RACE. PCR or alternatively, in a ligation chain reaction (LCR) (see, for example, Landegran et al (1988) Science 241: 1077-1080; and Nakazawa et al. (1994) PNAS 91: 360-364) , the latter being particularly useful for detecting point mutations in the hALG-2LP, SALG-2LP, or mALG-2LP gene (see Abravaya et al (1995) Nucleic Acids Res. 23: 675-682). This method may include the steps of collecting a sample of cells from a patient, isolating the nucleic acid (e.g., mRNA, genomic or both) from the cell of the sample, contacting the nucleic acid sample with one or more primers. which hybridize specifically with a hALG-2LP, SALG-2LP, or mALG-2LP gene under conditions such that hybridization and amplification of the hALG-2LP, SALG-2LP, or mALG-2LP gene (if present) occurs and the detection of the presence or absence of an amplification product, or detection of the size of the amplification product and comparison of the length with a control sample. In an alternative embodiment, mutations in a hALG-2LP, SALG-2LP, or mALG-2LP gene of a sample cell can be identified by alterations in restriction enzyme cleavage patterns. For example, sample and control DNA is isolated, amplified (optionally), deferred with one or more restriction endonucleases, and fragment length sizes are determined by gel electrophoresis and compared. Differences in fragment length sizes between sample and control DNA indicate mutation in the sample DNA. In addition, the use of sequence-specific ribozymes (see, for example, U.S. Patent No. 5,498,531) can be used to determine the presence of specific mutations by developing or losing a ribozyme cleavage site. In another embodiment, any of several sequencing reactions known in the art can be used to directly sequence the hALG-2LP, sALG-2LP, or mALG-2LP gene and detect mutations by comparing the sequences of hALG-2LP, sALG- 2LP, or mALG-2LP of the sample with the corresponding sequence of natural type (control). Examples of sequencing reactions include reactions based on techniques developed by Maxam and Gilbert ((1977) PNAS 74: 560) or Sanger ((1977) PNAS 74: 5463). Several automated sequencing procedures can be employed when carrying out diagnostic tests ((1995) Biotechniques 19: 448), including sequencing by mass spectrometry (see, for example, International publication No. WO 94/16101; Cohen et al. (1996) Adv. Chromatogr. 36: 127-162; and Griffin et al. (1993) Appl. Biochem Biotechnol. 38: 147-159). Other methods to detect mutations in the hALG-2LP, sALG-2LP, or mALG-2LP gene include methods in which protection against dissociation agents is used to detect non-corresponding bases in RNA / RNA or DNA / DNA duplexes (Myers et al (1985) Science 230: 1242); Cotton et al. (1988) PNAS 85: 4397; Saleeba et al. (1992) Meth. Enzymol. 217: 286-295), the electrophoretic mobility of the wild type and mutant nucleic acid is compared (Orita et al (1989) PNAS 86: 2766; Cotton (1993) Mutant Res. 285: 125-144; and Hayashi (1992 ) Genet Anal Tech Appl 9: 73-79), and the movement of mutant or wild type fragments in polyacrylamide gels containing a gradient of denaturing agent is assayed using gel electrophoresis with denaturing gradient (Myers et al. 1985) Nature 313: 495). Examples of other techniques for detecting point mutations include, selective oligonucleotide hybridization, selective amplification, and selective extension of primers. SAW. Use of partial sequences of hALG-2LP, sALG-2LP, or mALG-2LP Portions or fragments of the cDNA sequences identified herein (and the corresponding complete gene sequences) can be used in various ways as polynucleotide reagents. For example, these sequences can be used to (a) map their respective genes on a chromosome, and, consequently, locate gene regions associated with a genetic disease; (b) identify an individual from a tiny biological sample (tissue typing); and (c) assist forensic identification of a biological sample. These applications are described in the sub-sections that appear below. to. Chromosome mapping Once the sequence of a gene (or a part of that sequence) is isolated, that sequence can be used to map the location of the gene on a chromosome. This process is known as chromosome mapping. Portions or fragments of the sequences of hALG-2LP, SALG-2LP, or mALG-2LP, described here can be used to map the location of the hALG-2LP, S.ALG-2LP, or mALG-2LP genes, respectively, on a chromosome. The mapping of hALG-2LP, SALG-2LP, or mALG-2LP sequences into chromosomes is an important first step to correlate these sequences with genes associated with disease. In summary, the hALG-2LP, SALG-2LP, or mALG-2LP genes can be mapped onto chromosomes by preparing polymerase chain reaction primers (preferably 15 to 25 base pairs in length) from sequences of hALG-2LP, SALG-2LP, or mALG-2LP. A computerized analysis of the sequences of hALG-2LP, sALG-2LP, or mALG-2LP can be used to quickly select primers that do not embed more than one exon in the genomic DNA, thus complicating the amplification process. These primers can be used for sieving the polymerase chain reaction of somatic cell hybrids containing individual human chromosomes. Only hybrids containing the human gene corresponding to the sequences hALG-2LP, SALG-2LP, and mALG-2LP will provide an amplified fragment. Somatic cells are prepared by fusing somatic cells from different mammals (e.g., human and mouse cells). As hybrids of human and mouse cells grow and divide, they gradually lose their human chromosomes in random order, but retain the mouse chromosomes. By using media in which mouse cells can not grow, due to the lack of a particular enzyme, but where human cells can grow, the human chromosome containing the gene encoding the required enzyme will be conserved. By varying the media, panels of hybrid cell lines can be established. Each cell line in a panel contains either a single human chromosome or a small number of human chromosomes, and a complete set of mouse chromosomes, allowing easy mapping from individual genes to specific human genes (D'Eustachio P. Et al. (1983) Science 220: 919-924). Hybrids of somatic cells that contain only fragments of human chromosomes can also be produced by the use of human chromosomes with translocations and removals. Somatic cell hybrid polymerase chain reaction mapping is a rapid procedure for assigning a particular sequence to a particular chromosome. Three or more sequences can be assigned per day using a unique thermal cycler device. Using hALG-2LP sequences, SALG-2LP, and mALG-2LP to design oligonucleotide primers, sub-localization with fragment panels can be achieved from specific chromosomes. Other mapping strategies that can be used in a similar manner to map a hALG-2LP, sALG-2LP, or mALG-2LP sequence on its chromosome include in situ hybridization (described in Fan, Y. et al. (1990) PNAS, 87: 6223-27), the one pre-atomized with chromosomes classified by marked flow, the pre-selection by hybridization on cDNA libraries specific for chromosome. Fluorescence in situ hybridization (FISH) of a DNA sequence on its metaphase chromosomal expansion can be further employed to provide a precise chromosomal location in one step. Chromosome expansions can be effected using cells whose division has been blocked in the metaphase by a chemical agent of the colcemid type that disrupts the itotic spindle. Chromosomes can be treated briefly with trypsin, and then stained with Giemsa. A pattern of light and dark bands develops on each chromosome, in such a way that the chromosomes can be identified individually. The FISH technique can be used with a DNA sequence from 500 or 600 bases. However, clones greater than 1,000 bases have a higher chance of binding over a single chromosomal location with sufficient signal intensity for simple detection. Preferably 1,000 bases will be sufficient and more preferably 2,000 bases to obtain good results in an adequate period of time. For a review of this technique see Verma et al., Human Chromosomes: A Manual of Basic Techniques (Pergamon Press, New York 1988). Reagents for chromosome mapping can be used individually to mark a single chromosome or a single site on this chromosome, or panels of reagents can be used to mark multiple sites and / or multiple chromosomes. Reagents corresponding to non-coding regions of the genes are in fact preferred for mapping purposes. The coding sequences are most likely conserved within gene families, thus increasing the likelihood of cross-hybridizations during chromosome mapping. Once a sequence is mapped to a location on the chromosome, the physical position of the sequence on the chromosome can be correlated with genetic map data. (Such data are found, for example, in V. McKusick, Mendelian InHeritance in Man, available online through Johns Hopkins University Welch Medical Library). The relationship between genes and disease, mapped to the same chromosome region, can then be identified through binding analysis (co-inheritance of physically adjacent genes), as described for example, in Egeland, J. et al. (1987) Nature, 325: 783-787. In addition, differences in DNA sequences between affected and unaffected individuals with a disease associated with the hALG-2LP gene, SALG-2LP, or mALG-2LP can be determined. If a mutation is observed in some or all of the affected individuals but not in the unaffected individuals, then the mutation is likely to be the causative agent of the particular disease. The comparison between affected individuals and unaffected individuals generally includes the observation first of structural alterations in the chromosomes, such as for example removals or translocations that are visible from chromosome expansions or that can be detected using polymerase chain reactions based on said chromosome. DNA sequence. Finally, the complete sequencing of genes from several individuals can be done to confirm the presence of a mutation and to distinguish mutations of polymorphisms. b. Tissue typing The sequences of hALG-2LP, SALG-2LP, or mALG-2LP of the The present invention can also be used to identify individuals from minute biological samples. The military organization of the United States of America, for example, is considering the use of restriction fragment length polymorphism (RFLP) for the identification of its personnel. In this technique, the genomic DNA of a person is digested with one or more restriction enzymes, and probed in a Southern blot to provide unique bands for identification. This method does not suffer from the current limitations of "dog tags" that can be lost, changed or stolen, making positive identification difficult. The sequences of the present invention are useful as additional markers of .DNA for RFLP (described in US Pat. No. 5,272,057). In addition, the sequences of the present invention can be employed to provide an alternative technique that determines the actual sequence of base DNA based on selected portions of an individual's genome. Thus, the hALG-2LP, SALG-2LP, or mALG-2LP sequences described herein can be used to prepare two polymerase chain reaction primers from the 5r and 3 'ends of the sequences. These primers can then be used to amplify a person's DNA and sequencing it subsequently. Panels of corresponding DNA sequences from individuals, prepared in this way, can offer unique individual identifications, since each individual will have a unique set of such DNA sequences due to allelic differences. The sequences of the present invention can be used to obtain such identification sequences from individuals and from tissue. The hALG-2LP, SALG-2LP, or mALG-2LP sequences of the present invention uniquely represent portions of the human genome. An allelic variation occurs to some extent in the coding regions of these sequences, and to a greater extent in the non-coding regions. It is estimated that an allelic variation between individual humans occurs with a frequency of approximately one variation per 500 bases. Each of the sequences described herein can be used, to some extent, as a standard against which the DNA of an individual can be compared for identification purposes. Due to the large number of polymorphisms that occur in non-coding regions, a smaller number of sequences are required to differentiate individuals. The non-coding sequences of SEQ ID NO: 1, 4 and 7 can comfortably offer positive individual identification with a panel of perhaps 10 to 1,000 primers each providing a non-coding 100-base amplified sequence. If predicted coding sequences such as the sequences in SEQ ID NO: 3, 6 and 9 are used, a more appropriate number of primers for positive individual identification would be 500 to 2,000. If a reagent panel of the hALG-2LP, SALG-2LP, or mALG-2LP sequences described herein is used to generate a unique identification database for an individual, these same reagents can then be used to identify tissue from this guy. Using the unique identification basis, positive identification of the individual, living or dead, can be made from extremely small tissue samples. c. Use of partial sequences of hALG-2LP, SALG-2LP, or mALG-2LP in forensic biology Identification techniques based on .DNA can also be used in forensic biology. Forensic biology in a scientific field that employs the genetic typing of biological evidence found in the setting of a crime as a means to positively identify, for example, the person. who committed a crime To perform such identification, a polymerase chain reaction technology can be used to amplify DNA sequences taken from very small biological samples such as tissues, for example, hair or skin or body fluids, for example, blood, saliva, or semen found in the scene of a crime. The identified sequence can then be compared to a standard sequence thus allowing identification of the origin of the biological sample. The sequences of the present invention can be used to provide polynucleotide reagents, for example, polymerase chain reaction primers, targeted to specific loci in the human genome, which can improve the reliability of DNA-based forensic identifications for example by the provision of another "identification marker" (ie, another DNA sequence that is unique to a particular individual). As mentioned above, a real base sequence information can be used for identification as a precise alternative to patterns formed by fragments generated by restriction enzyme. The sequences focused towards the non-coding regions of SEQ ID NOs: 1, 4 and 7 are especially appropriate for this purpose since larger numbers of polymorphisms occur in the non-coding regions, which makes it easier to differentiate individuals using this technique. Examples of polynucleotide reagents include the sequences hALG-2LP, SALG-2LP, or mALG-2LP or portions thereof, for example, fragments derived from the non-coding regions of SEQ ID Nos: 1, 4 and 7, which have a length of at least 20 bases, preferably at least 30 bases. The hALG-2LP, SALG-2LP, or mALG-2LP sequences described herein may be additionally employed to provide polynucleotide reagents, for example labeled or labeled probes, which may be employed for example in an in situ hybridization technique to identify a specific tissue, for example, brain tissue. This can be very useful in cases in which a forensic pathologist obtain a tissue of unknown origin. Panels of such probes of hALG-2LP, sALG-2LP, or mALG-2LP can be used to identify tissue by species and / or ppr type of organ. Similarly, these reagents, for example initiators of hALG-2LP, SALG-2LP, and mALG-2LP or probes can be used to screen tissue culture for contamination (ie, screening for the presence of a mixture of different types of cells in a culture). This invention is further illustrated by the following examples which should not be considered as limiting. The contents of all of the references, patent applications, patents, and published patent applications cited in this application are incorporated herein by reference. EXAMPLES Example 1: Identification and characterization of cDNA OF hALG-2LP, SALG-2LP, and mALG-2LP In this example, nucleic acid molecules of hALG-2LP, SALG-2LP, or mALG-2LP were identified by screening appropriate cDNA libraries. An EST (jlkbc063c04) was first identified in a monkey brain cDNA library using the Sequence Explorer. Subsequently, a mouse EST (jlmba005e01) was identified in a mouse brain cDNA library and two human ESTs were also identified by screening of proprietary libraries. The positive clones were sequenced and the sequences were assembled. A BLASTN ™ search of the EST database revealed the following ESTs that have significant homology to the HALG-2LP cDNA: Species Findings Pairs% of? database of bases of identity coding of EST covered access No. of human being 1149-1630 100 Yes AA569956 access number human 1124-1643 100 Yes AA226400 accession number human 1208-1657 99 Yes W80352 No. of access access human being 1154-1630 96 Yes AA533187 Access number for human being 1160-1599 99 Yes AA633700 Access number for human being 1237-1630 98 Yes N95345 Access number for human being 873-1305 100 Yes AA431700 Access no. human 911-1341 100 Yes AA311285 Human access number 1202-1629 99.5 Yes AA643585 Human access number 1173-1630 96 Yes AA040058 A BLASTN ™ search of the EST database revealed the following ESTs that have significant homology to the SALG-2LP cDNA: Species Findings Pairs% of? database of bases of identity coding of EST covered Access No. of human being 845-1266 96 No AA431700 Access No. human being 870-1302 94 No AA311285 Accession number human 845-1232 94 No W26197 No. of human access 766-1224 94 No AA031577 Mouse Access No. 135-675 90 Yes AA215228 Mouse Access No. 135-675 90 Yes AA110246 A BLASTN ™ search of the EST database revealed the following ESTs that have Significant homology with the mALG-2LP cDNA: Species Findings Pairs% of? database of bases of identity encryption of covered ESTs Mouse access no. 283-608 9999 Yes AA110246 Mouse access number 296-833 99 Yes AA215228 Mouse access number 664-1000 99 Yes W77580 No. of Mouse access 888-1107 99 Yes AA119341 Example 2. Tissue expression of the hALG-2LP, sALG-2LP, and mALG-2LP genes Northern Analysis Northern Absorption of multiple tissues from human, monkey, and mouse (MTN) MTN absorptions I, II, III (Clontech, Palo. Alta, CA), containing 2 ### of poly A + RNA per lane were probed with specific primers for hALG-2LP (probes). The filters were prehybridized in 10 ml of an Express Hyb hybridization solution (Clontech, Palo Alto, CA) at a temperature of 68 ° C for 1 hour, after which 100 mg of 32 P labeled probe was added. The probe was generated using the Stratagene Prime-It kit, catalog number 300392 (Clontech, Palo, Alto, CA). Hybridization was allowed to proceed at a temperature of 68 ° C for approximately 2 hours. The filters were washed in a 0.05% SDS / 2X SSC solution for 15 minutes at room temperature and then twice with a 0.1% SDS / 0.1X SSC solution for 20 minutes at a temperature of 50 ° C and then exposed to a film. of auto-radiography during the night at a temperature of -80 ° C with a screen. The human and mouse tissues tested included: brain, heart, kidney, liver, lung, skeletal muscle, spleen, testis, placenta, pancreas, colon, prostate, ovaries, small intestine, and hypothalamus. Strong hybridization was observed with all the tissues tested, except for the hypothalamus, indicating that transcripts of the .ALG-2LP gene are expressed in these tissues. Example 3: Expression of Recombinant hALG-2LP, SALG-2LP, and mALG-2LP Proteins in Bacterial Cells In this example, hALG-2LP, SALG-2LP, and mALG-2LP are expressed as glutathione-S-transferase fusion proteins (GST) recombinants in E. coli and the fusion proteins are isolated and characterized. Specifically, hALG-2LP, SALG-2LP, and mALG-2LP are fused to GST and these fusion proteins are expressed in E. coli, for example, strain PEB199. Since hALG-2LP, SALG-2LP, and mALG-2LP have predicted sizes of 32.7 kD, 31.8 kD, and 31.5 kD, respectively, and GST is predicted to have a size of 26 kD, it is predicted that fusion proteins will have a molecular weight of 58.7 kD, 57.8 kD, and 57.5 Kd, respectively. The expression of the fusion proteins GST-hALG-2LP, SALG-2LP, and mALG-2LP in PB199 is induced with IPTG. The recombinant fusion proteins are purified from crude bacterial lysates and the PB199 strain induced by affinity chromatography on glutathione beads. Using an electrophoretic polyacrylamide gel analysis of purified proteins from bacterial lysates, the molecular weight of the resulting fusion proteins is determined. Example 4: Expression of hALG-2LP protein, sALG-2LP, and recombinant mALG-2LP in COS cells To express the hALG-2LP, SALG-2LP, and mALG-2LP gene in COS cells, the pcDNA / Amp vector from Invitrogen Corporation (San Diego, CA) is employed. This vector contains an SV40 origin of replication, an ampicillin resistance gene, an E. coli origin of replication, a CMV promoter followed by a poly linker region, and an SV40 intron and polyadenylation site. A DNA fragment encoding the protein hALG-2LP, sALG-2LP, or whole mALG-2LP and an HA tag (Wilson et al (1984) Cell 37: 767) fused in frame over its 3 'end of the fragment is cloned in the poly linker region of the vector, thus placing the expression of the recombinant protein under the control of the CMV promoter.

To construct the plasmid, the DNA sequence of hALG-2LP, sALG-2LP, or mALG-2LP is amplified by polymerase chain reaction using two primers. The 5 'primer contains the restriction site of interest followed by approximately twenty nucleotides of the coding sequence hALG-2LP, SALG-2LP, or mALG-2LP starting from the start codon: the 3' end sequence contains the complementary sequences of the other restriction site of interest, an end-of-translation codon, the HA marker and the last twenty nucleotides of the hALG-2LP coding sequence, SALG-2LP, or mALG-2LP. The fragment amplified by polymerase chain reaction and the vector pCADN / Amp are digested with the appropriate restriction enzymes and the vector is dephosphorylated using the CIAP enzyme (New England Biolabs, Beverly, MA). preferably, the two chosen restriction sites are different such that the gene hALG-2LP, sALG-2LP, and mALG-2LP is inserted in the correct orientation. The ligation mixture is transformed into E. coli cells (strains HB101, DH5a, SURE, available from Stratagene Cloning Systems, La Jolla, CA, can be used), the transformed culture is plated on plates of ampicillin medium and select resistant colonies. The plasmid DNA is harvested from transformants and examined by restriction analysis to determine the presence of the correct fragment. Cells are subsequently transfected with plasmid DNA from hALG-2LP, SALG-2LP, or mALG-2LP-pcDNA / Amp, using co-precipitation methods of calcium phosphate or calcium chloride, DEAE-dextran-mediated transfection. , lipofection, or electroporation. Other suitable methods for transfecting host cells can be found in Sambrook, J., Fritsh, E.F., and Maniatis, T. Molecular Cloning: A Labora tory Manual 2a. edition, ed. , Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989). The expression of hALG-2LP protein, sALG-2LP, or mALG-2LP is detected by radiolabelling (35S-methionine or 35S-cysteine available in NEN, Boston, MA, can be used) and immunoprecipitation (Harlow, E. and Lane, D. Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1988) employing a monoclonal antibody specific for HA. Briefly, the cells are labeled for 8 hours with 35S-methionine (or 35S-cysteine). The culture media is then collected and the cells are used using detergents (RIPA buffer, 150 mM NaCl, 1% NP-40, 0.1% SDS, 0.5% DOC, 50 mM Tris, pH 7.5). both the cell lysate and the culture media are precipitated with a monoclonal antibody specific for HA. The precipitated protein is then analyzed by SDS-PAGE. Alternatively, DNA containing the hALG-2LP, SALG-2LP, or mALG-2LP coding sequence is cloned directly into the vector linker pCADN / Amp vector using the appropriate restriction sites. The resulting plasmid is transfected into COS cells in the manner described above, and the expression of hALG-2LP protein, SALG-2LP, or mALG-2LP is detected by radiolabeling and immunoprecipitation using a monoclonal antibody specific for hALG-2LP. , sALG-2LP, or mALG-2LP. Example 5: Characterization of proteins hALG-2LP, SALG-2LP, and mALG-2LP In this example, the amino acid sequences of the protein hALG-2LP, sALG-2LP, or mALG-2LP are compared with the amino acid sequences of known proteins and several reasons were identified. The hALG-2LP protein from which the amino acid sequence is shown in Figure 1 (SEQ ID NO: 2) is a novel protein that includes 284 amino acid residues. Amino acid residues 127 to 139 and 194 to 206 of SEQ ID NO: 2 (shown separately as SEQ ID NO: 10 and SEQ ID NO: 11, respectively) comprise domains that show high homology with the calcium binding domains , for example, EF hands.

A BALST search (Alstchul et al (1990) J. Mol. Biol. 215: 403) of the protein sequences of human ALG-2LP showed that hALG-2LP is similar to the following proteins: probable mouse calcium protein ( Accession No. P12815), human sorcin (Accession No. P30626), mouse accession no. 50266, mouse calcium binding protein (accession no. S04970), and Chinese hamster sorcin (Accession No. P05044). ALG-2LP from human present a 44% identity with the mouse probable calcium binding protein (Accession No. P12815) at nucleotides 396-872; 38% identical with human sorcin (Accession No. P30626) in nucleotides 444-872; 44% identical with mouse access No. 50266 at nucleotides 396-872; 44% identical with the mouse calcium binding protein (Accession No. S04970) in nucleotides 396-872; and 37% identical to Chinese hamster sorcery (Accession No. P05044) at nucleotides 444-857, at the amino acid level. The SALG-2LP protein whose amino acid sequence is shown in Figure 2 (SEQ ID NO: 5) is a novel protein that includes 277 amino acid residues. Amino acid residues 120 to 132 and 187 to 199 of SEQ ID NO: 5 (shown separately as SEQ ID NO: 12 and SEQ ID NO: 13, respectively) comprise domains that show high homology with calcium binding domains , for example, EF hands.

A BALST search (Alstchul et al (1990) J. Mol. Biol. 215: 403) of the monkey ALG-2LP protein sequences showed that SALG-2LP is similar to the following proteins: probable calcium binding protein of mouse (Accession No. P12815), human sorcin (accession No. P30626), and Chinese hamster sorcery (Accession No. P05044). ALG-2LP from a human being has a 42% identity with the probable mouse calcium binding protein (Accession No. P12815) at nucleotides 376-831; 38% identical with human sorcin (Accession No. P30626) in nucleotides 376-831; and 37% identical to Chinese hamster sorcery (Accession No. P05044) at nucleotides 403-816, at the amino acid level. The mALG-2LP protein whose partial amino acid sequence is shown in Figure 3 (SEQ ID NO: 8) is a novel protein that includes 274 amino acid residues. Amino acid residues 117 to 129 and 184 to 196 of SEQ ID NO: 8 (are separately shown as SEQ ID NO: 14 and SEQ ID NO: , respectively) comprise domains that show homology with the calcium binding domains, e.g., EF hands. A BALST search (Alstchul et al (1990) J. Mol. Biol. 215: 403) of the partial murine ALG-2LP protein sequences showed that mALG-2LP is similar to the following proteins: calcium binding protein probable of mouse (Accession No. P12815), mouse calcium binding protein (Accession No. S04970), and human sorcin (Accession No. P30626). Partial murine ALG-2LP has a 45% identity with the mouse calcium binding protein likely (Accession No. P12815) in amino acid residues 115-121; a 43% identity with the mouse calcium binding protein (Accession No. S04970) at amino acid residues 130-221; and 39% identical with human sorcina (Accession No. P30626) in amino acid residues 131-227. Equivalents Those skilled in the art will recognize or be able to determine using only routine experiments many equivalent to the specific embodiments of the invention described herein. The following claims encompass such equivalents.

LIST OF SEQUENCES (1) GENERAL INFORMATION: (i) APPLICANT: (A) NAME: MILLENNIUM PHARMACEUTICALS, INC. (B) STREET: 75 SIDNEY STREET (C) CITY: CAMBRIDGE (D) STATE: MASSACHUSETTS (E) COUNTRY: United States of America (F) POSTAL CODE: 02139 (G) TELEPHONE: (H) TELEFAX: (ii) TITLE OF THE INVENTION: ALG-2LP, MOLECULES OF TYPE ALG-2 AND USES OF THEM (iii) NUMBER OF SEQUENCES: 22 (iv) ADDRESS FOR CORRESPONDENCE: (A) RECIPIENT: LAHIVE & amp;; COCKFIELD, LLP (B) STREET: 28 STATE STREET (C) CITY: BOSTON (D) STATE: MASSACHUSETTS (E) COUNTRY: United States of America (F) Zip Code: 02109 (v) COMPUTER LEGIBLE FORMAT: (A) TYPE OF MEDIUM: Soft disk (B) COMPUTER: IBM compatible personal computer (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) PROGRAMMING: Patentln Relay # 1.0, Version # 1.25 (vi) CURRENT REQUEST DATA : (A) APPLICATION NUMBER: PCT / US99 / (B) SUBMISSION DATE: May 13, 1999 (C) CLASSIFICATION: (vii) PREVIOUS APPLICATION DATA: (A) APPLICATION NUMBER: US 09 / 084,749 (B) ) DATE OF SUBMISSION: May 26, 1998 (viii) INFORMATION ABOUT LAWYER / AGENT: (A) NAME: MANDRAGOURAS, AMY E. (B) REGISTRATION NUMBER: 36,207 (C) REFERENCE NUMBER / CÉDULA: MNI-043PC (ix) INFORMATION FOR TELECOMMUNICATIONS: (A) TELEPHONE : (617)227-7400 (B) TELEFAX: (617)742-4214 (2) INFORMATION FOR SEQ ID NO: l: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1667 base pairs (B) TYPE: nucleic acid (C) NUMBER OF CHAINS: unique (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (ix) CHARACTERISTIC: Leu Tyr Gly Gln Gly Gly Ala Pro Pro Asn Val Asp Pro Glu Ala Tyr 105 110 115 120 TCC TGG TTC CAG TCG GTG GAC TCA GAT CAC AGT GGC TAT ATC TCC ATG 437 Ser Trp Phe Gln Ser Val Asp Ser Asp His Ser Gly Tyr lie Ser Met 125 130 135 AAG GAG CTA AAG CAG GCC CTG GTC AAC TGC AAT TGG TCT TCA TTC AAT 485 Lys Glu Leu Lys Gln Ala Leu Val Asn Cys Asn Trp Ser Ser Phe Asn 140 145 150 GAT GAG ACC TGC CTC ATG ATG ATA AAC ATG TTT GAC AAG ACC AAG TCA 533 Asp Glu Thr Cys Leu Met Met lie As Met Met Phe Asp Lys Thr Lys Ser 155 160 165 GGC CGC ATC GAT GTC TAC GGC TTC TCA GCC CTG TGG AAA TTC ATC CAG 581 Gly Arg lie Asp Val Tyr Gly Phe Ser Ala Leu Trp Lys Phe lie Gln 170 175 180 CAG TGG AAG AAC CTC TTC CAG CAG TAT GAC CGG GAC CGC TCG GGC TCC 629 Gln Trp Lys Asn Leu Phe Gln Gln Tyr Asp Arg Asp Arg Ser Gly Ser 185 190 195 200 ATT AGC TAC ACA GAG CTG CAG CAA GCT CTG TCC CAA ATG GGC TAC AAC 677 lie Ser Tyr Thr Glu Leu Gln Gln Wing Leu Ser Gln Met Gly Tyr Asn 205 210 215 CTG AGC CCC CAG TTC ACC CAG CTT CTG GTC TCC CGC TAC TGC CCA CGC 725 Leu Ser Pro Gln Phe Thr Gln Leu Leu Val Ser Arg Tyr Cys Pro Arg 220 225 230 TCT GCC AAT CCT GCC ATG CAG CTT GAC CGC TTC ATC CAG GTG TGC ACC 773 Ser Wing Asn Pro Wing Met Gln Leu Asp Arg Phe lie Gln Val Cys Thr (A) NAME / KEY: CDS (B) LOCATION: 30..881 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: l: GTCGACCCAC GCGTCCGGTC AGAATCACC ATG GCC AGC TAT CCT TAC CGG CAG 53 Met Wing Ser Tyr Pro Tyr Arg Gln 1 5 GGC T GC CCA GGA GCT GCA GGA CAA GCA CCA GGA GCC CCT CCG GGT AGC 101 Gly Cys Pro Gly Wing Wing Gly Gln Wing Pro Gly Wing Pro Pro Gly Ser 10 15 20 TAC TAC TAC CCG GGA CCC CCC AAT AGT GGA GGG CAG TAT GGT AGT GGG CTA 149 Tyr Tyr Pro Gly Pro Pro Asn Ser Gly Gly Gln Tyr Gly Ser Gly Leu 25 30 35 40 CCG CCT GGT GGT TAT GGG GGT CCT GCC CCT GGA GGG CCT TAT GGA 197 Pro Pro Gly Gly Gly Tyr Gly Pro Pro Wing Gly Gly Pro Tyr Gly 45 50 55 CCA CCA GCT GGT GGG CCC TAT GGA CAC CCC AAT CCT GGG ATG TTC 245 Pro Pro Wing Gly Gly Gly Pro Tyr Gly His Pro Asn Pro Gly Met Phe 60 65 70 CCC TCT GGA ACT CCA GGA GGA CCA TAT GGC GGT GCA GCT CCC GGG GGC 293 Pro Ser Gly Thr Pro Gly Gly Pro Tyr Gly Gly Wing Wing Pro Gly Gly 75 80 85 CCC TAT GGT CAG CCA CCT CCA AGT TCC TAC GGT GCC CAG CAG CCT GGG 341 Pro Tyr Gly Gln Pro Pro Pro Ser Ser Tyr Gly Wing Gln Gln Pro Gly 90 95 100 CTT TAT GGA CAG GGT GGC GCC CCT CCC AAT GTG GAT CCT GAG GCC TAC 389 235 240 245 CAG CTG CAG GTG CTG ACA GAG GCC TTC CGG GAG AAG GAC ACA GCT GTA 821 Gln Leu Gln Val Leu Thr Glu Wing Phe Arg Glu Lys Asp Thr Wing Val 250 255 260 CAA GGC AAC ATC CGG CTC AGC TTC GAG GAC TTC GTC ACC ATG ACA GCT 869 Gln Gly Asn He Arg Leu Ser Phe Glu Asp Phe Val Thr Met Thr Ala 265 270 275 280 TCT CGG ATG CTA TGACCCAACC ATCTGTGGAG AGTGGAGTGC ACCAGGGACC 921 Ser Arg Met Leu TTTCCTGGCT TCTTAGAGTG AGAGAAGTAT GTGGACATCT CTTCTTTTCC TGTCCCTCTA 981 GAAGAACATT CTCCCTTGCT TGATGCAACA CTGTTCCAAA AGAGGGTGGA GAGTCCTGCA 1041 TCATAGCCAC CAAATAGTGA GGACCGGGGC TGAGGCCACA CAGATAGGGG CCTGATGGAG 1101 GAGAGGATAG AAGTTGAATG TCCTGATGGC CATGAGCAGT TGAGTGGCAC AGCCTGGCAC 1161 CAGGAGCAGG TCCTTGTAAT GGAGTTAGTG TCCAGTCAGC TGAGCTCCAC CCTGATGCCA 1221 GTGGTGAGTG TTCATCGGCC TGTTACCGTT AGTACCTGTG TTCCCTCACC AGGCCATCCT 1281 GTCAAACGAG CCCATTTTCT CCAAAGTGGA ATCTGACCAA GCATGAGAGA GATCTGTCTA 1341 TGGGACCAGT GGCTTGGATT CTGCCACACC CATAAATCCT TGTGTGTTAA CTTCTAGCTG 1401 CCTGGGGCTG GCCCTGCTCA GACAAATCTG CTCCCTGGGC ATCTTTGGCC AGGCTTCTGC 1461 CCTCTGCAGC TGGGACCCCT CACTTGCCTG CCATGCTCTG CTCGGCTTCA GTCTCCAGGA 1521 GACAGTGGTC ACCTCTCCCT GCCAATACTT TTTTTAATTT GCATTTTTTT TCATTTGGGG 1581 CCAAAAGTCC AGTGAAATTG TAAGCTTCAA TAAAAGGATG AAACTCTGGA AAAAAAAAAA 1641 AAAAAAAAAA AAAAAAAAAA AAAAAA 1667 (2) INFORMATION FOR SEQ ID NO: 2: (i) CHARACTERISTICS OF THE SEQUENCE: • (A) LENGTH: 284 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: Met Wing Being Tyr Pro Tyr Arg Gln Gly Cys Pro Gly Wing Wing Gly Gln 1 5 10 15 Wing Pro Gly Wing Pro Pro Gly Ser Tyr Tyr Pro Gly Pro Pro Asn Ser 20 25 30 Gly Gly Gln Tyr Gly Pro Gly Pro Pro Gly Gly Pro Gly Gly Pro Gly Pro Gly Gly Gly Gly Pro Tyr 50 55 60 Gly His Pro Asn Pro Gly Met Phe Pro Ser Gly Thr Pro Gly Gly Pro 65 70 75 80 Tyr Gly Gly Wing Pro Pro Gly Gly Pro Tyr Gly Gln Pro Pro Pro Ser 85 90 95 Be Tyr Gly Wing Gln Gln Pro Gly Leu Tyr Gly Gln Gly Wing Pro 100 105 110 Pro Asn Val Asp Pro Glu Ala Tyr Ser Trp Phe Gln Ser Val Asp Ser 115 120 125 Asp His Ser Gly Tyr lie Met Met Lys Glu Leu Lys Gln Ala Leu Val 130 135 140 Asn Cys Asn Trp Ser Ser Phe Asn Asp Glu Thr Cys Leu Met Met lie 145 150 155 160 sn Met Phe Asp Lys Thr Lys Ser Gly Arg lie Asp Val Tyr Gly Phe 165 170 175 Be Ala Leu Trp Lys Phe lie Gln Gln Trp Lys Asn Leu Phe Gln Gln 180 185 190 Tyr Asp Arg Asp Arg Ser Gly Ser lie Ser Tyr Thr Glu Leu Gln Gln 195 200 205 Wing Leu Ser Gln Met Gly Tyr Asn Leu Ser Pro Gln Phe Thr Gln Leu 210 215 220 Leu Val Ser Arg Tyr Cys Pro Arg Ser Wing Asn Pro Wing Met Gln Leu 225 230 235 240 Asp Arg Phe lie Gln Val Cys Thr Gln Leu Gln Val Leu Thr Glu Wing 245 250 255 Phe Arg Glu Lys Asp Thr Wing Val Gln Gly Asn lie Arg Leu Ser Phe 260 265 270 Glu Asp Phe Val Thr Met Thr Ala Ser Arg Met Leu 275 280 (2) INFORMATION FOR SEQ ID NO: 3: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 852 base pairs (B) TYPE: nucleic acid (C) NUMBER OF CHAINS: unique (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (ix) CHARACTERUSTUCA: (A) NAME / KEY: CDS (B) LOCATION: 1.852 (xi) DESCRIPTION SEQUENCE: SEQ ID NO: 3: ATG GCC AGC TAT CCT TAC CGG CAG GGC TGC CCA GGA GCT GCA GGA CAA 48 Met Wing Wing Tyr Pro Tyr Arg Gln Gly Cys Pro Gly Wing Wing Gly Gln 1 5 10 15 GCA CCA GGA GCC CCT CCG GGT AGC TAC TAC TAC CCT GGA CCC CCC AAT AGT 96 Wing Pro Gly Wing Pro Pro Gly Ser Tyr Pro Gly Pro Pro Asn Ser 20 25 30 GGA GGG CAG TAT GGT AGT GGG CTA CCC CCT GGT GGT GGT TAT GGG GGT 144 Gly Gly Gln Tyr Gly Ser Gly Leu Pro Pro Gly Gly Gly Tyr Gly Gly 35 40 45 CCT GCC CCT GGA GGG CCT TAT GGA CCA CCA GCT GGT GGA GGG CCC TAT 192 Pro Wing Pro Gly Gly Pro Tyr Gly Pro Pro Wing Gly Gly Gly Pro Tyr 50 55 60 GGA CAC CCC AAT CCT GGG ATG TTC CCC TCT GGA ACT CCA GGA GGA CCA 240 Gly His Pro Asn Pro Gly Met Phe Pro Be Gly Thr Pro Gly Gly Pro 65 70 75 80 TAT GGC GGT GGT GCA GCT CCC GGG GGC CCC TAT GGT CAG CCA CCT CCA AGT 288 Tyr Gly Gly Wing Wing Pro Gly Gly Pro Tyr Gly Gln Pro Pro Pro Ser 85 90 95 TCC TAC GGT GCC CAG CAG CCT GGG CTT TAT GGA CAG GGT GGC GCC CCT 336 Ser Tyr Gly Wing Gln Gln Pro Gly Leu Tyr Gly Gln Gly Glly Wing Pro 100 105 110 CCC AAT GTG GAT CCT GAG GCC TAC TCC TGG TTC CAG TCG GTG GAC TCA 384 Pro Asn Val Asp Pro Glu Wing Tyr Ser Trp Phe Gln Ser Val Asp Ser 115 120 125 GAT CAC AGT GGC TAT ATC TCC ATG AAG GAG CTA AAG CAG GCC CTG GTC 432 Asp His Ser Gly Tyr He Ser Met Lys Glu Leu Lys Gln Ala Leu Val 130 135 140 AAC TGC AAT TGG TCT TCA TTC AAT GAT GAG ACC TGC CTC ATG ATG ATA 480 Asn Cys Asn Trp Ser Ser Phe Asn Asp Glu Thr Cys Leu Met Met He 145 150 155 160 AAC ATG TTT GAC AAG ACC AAG TCA GGC CGC ATC GAT GTC TAC GGC TTC 528 Asn Met Phe Asp Lys Thr Lys Ser Gly Arg He Asp Val Tyr Gly Phe 165 170 175 TCA GCC CTG TGG AAA TTC ATC CAG CAG TGG AAG AAC CTC TTC CAG CAG 576 Be Ala Leu Trp Lys Phe He Gln Gln Trp Lys Asn Leu Phe Gln Gln 180 185 190 TAT GAC CGG GAC CGC TCG GGC TCC ATT AGC TAC ACA GAG CTG CAG CAA 624 Tyr Asp Arg Asp Arg Ser Gly Ser He Ser Tyr Thr Glu Leu Gln Gln 195 200 205 GCT CTG TCC CAA ATG GGC TAC AAC CTG AGC CCC CAG TTC ACC CAG CTT 672 Wing Leu Ser Gln Met Gly Tyr Asn Leu Ser Pro Gln Phe Thr Gln Leu 210 215 220 CTG GTC TCC CGC TAC TGC CCA CGC TCT GCC AAT CCT GCC ATG CAG CTT 720 Leu Val Ser Arg Tyr Cys Pro Arg Ser Wing Asn Pro Wing Met Gln Leu 225 230 235 240 GAC CGC TTC ATC CAG GTG TGC ACC CAG CTG CAG GTG CTG ACA GAG GCC 768 Asp Arg Phe He Gln Val Cys Thr Gln Leu Gln Val Leu Thr Glu Wing 245 250 255 TTC CGG GAG AAG GAC ACA GCT GTA CAA GGC AAC ATC CGG CTC AGC TTC 816 Phe Arg Glu Lys Asp Thr Wing Val Gln Gly Asn He Arg Leu Ser Phe 260 265 270 GAG GAC TTC GTC ACC ATG ACA GCT TCT CGG ATG CTA 852 Glu Asp Phe Val Thr Met Thr Ala Ser Arg Met Leu 275 280 (2) INFORMATION FOR SEQ ID NO: 4: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 1525 base pairs (B) TYPE: nucleic acid ( C) NUMBER OF CHAINS: unique (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (ix) CHARACTERISTICS: (A) NAME / KEY: CDS (B) LOCATION: 10..840 (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 4: CGCGTGGGC ATG GCC AGC TAT CCG TAC CGG CAG GGC TGC CCA GGA GCT 48 Met Wing Ser Tyr Pro Tyr Arg Gln Gly Cys Pro Gly Wing 1 5 10 GCA GGA CA CA GCA CGA GGA CCCC CCG GGT AGC TAC TAC TAC CCG GGA CCC 96 Wing Gly Gln Wing Pro Gly Wing Pro Pro Gly Ser Tyr Tyr Pro Gly Pro 15 20 25 CCC AAT AGT GGA GGG CAG TAT GGC AGT GGG CTA CCC CCT GGT GGT TAT 144 Pro Asn Ser Gly Gly Gln Tyr Gly Ser Gly Leu Pro Pro Gly Gly Tyr 30 35 40 45 GGG GGT CCT GCC CCT GGA GGG CCT TAT GGA CCA CCA GCT GGT GGA GGG 192 Gly Gly Pro Ala Pro Gly Gly Pro Tyr Gly Pro Pro Ala Gly Gly Gly 50 55 60 CCT TAT GGA CAC CCC AGT CCT GGC ATG TTC CCC TCT GGA ACT CCA GGA 240 Pro Tyr Gly His Pro Ser Pro Gly Met Phe Pro Ser Gly Thr Pro Gly 65 70 75 GGA CCA TAT GGC GGT GCA GCT CCA GGG AGC CCC TAT GGT CAG CCA CCT 288 Gly Pro Tyr Gly Gly Ala Ala Pro Gly Ser Pro Tyr Gly Gln Pro Pro 80 85 90 CTA AGT TCC TAT GGT GCC CAG CAG CCT GGG CCT TAT GGA CAG GGT GGC 336 Leu Ser Ser Tyr Gly Wing Gln Gln Pro Gly Pro Tyr Gly Gln Gly Gly 95 100 105 GCC CCT CCC AGT GTG GAT CCT GAG GCC TAC TCC TGG TTC CAG TCG GGC 384 Wing Pro Pro Ser Val Asp Pro Glu Wing Tyr Ser Trp Phe Gln Ser Gly 110 115 120 125 TAT ATC TCC ATG AAG GAG CTA AAG CAG GCC CTG GTC AAC TGC AAT TGG 432 Tyr He Ser Met Lys Glu Leu Lys Gln Ala Leu Val Asn Cys Asn Trp 130 135 140 TCC TCA TTC AAT GAT GAG ACC TGC CTC ATG ATG ATA AAC ATG TTT GAC 480 Ser Ser Phe Asn Asp Glu Thr Cys Leu Met Met As As Met Met Phe Asp 145 150 155 AAG ACC AAG TCA GGC CGC ATC GAT GTC TAC GGC TTC GCC CTG TGG 528 Lys Thr Lys Ser Gly Arg He Asp Val Tyr Gly Phe Ser Ala Leu Trp 160 165 170 AAA TTC ATC CAG CAG TGG AAG AAC CTC TTC CAG CAG TAT GAC CGG GAC 576 Lys Phe He Gln Gln Trp Lys Asn Leu Phe Gln Gln Tyr Asp Arg Asp 175 180 185 CGC GCT GGC TCC ATT AGC CT ACA GAG CTG CAG CAA GCT CTG TCC CAA 624 Arg Ser Gly Ser He Ser Tyr Thr Glu Leu Gln Gln Ala Leu Ser Gln 190 195 200 205 ATG GGC TAC AAC CTG AGC CCC CAG TTC ACC CAG CTT CTG GTC TCC CGC 672 Met Gly Tyr Asn Leu Ser Pro Gln Phe Thr Gln Leu Leu Val Ser Arg 210 215 220 TAC TGC CCA CGC TCT GCC AAT CCT GCC ATG CAG CTG GAC CGC TTC ATC 720 Tyr Cys Pro Arg Ser Wing Asn Pro Wing Met Gln Leu Asp Arg Phe He 225 230 235 CAG GTG TGC ACC CAG CTG CAG GTG CTG ACA GAG GCC TTC CGG GAG AAG 768 Gln Val Cys Thr Gln Leu Gln Val Leu Thr Glu Ala Phe Arg Glu Lys 240 245 250 GAC ACA GCT GTA CAA GGC AAC ATT CGG CTC AGC TTC GAG GAC TTC GTC 816 Asp Thr Ala Val Gln Gly Asn He Arg Leu Ser Phe Glu Asp Phe Val 255 260 265 ACC ATG ACA GCT TCT CGG ATG CTA TGACCCAACC CATCTGTGGA GAGTGGAGTG 870 Thr Thr Met Met Ala Ser Arg Leu 270 275 CACCAGGGAC CTTTCCTGGC TTCTTAGAGT GAGAGAAGTA CGTGGACATC TCTTCTTTTC 930 CTGTCCCTTT AGAAGAACAT TCTCCCTTGC TTGATGCAAC ACTGTTCCAA AAGAGGGTTG 990 AGAGTCCTGC ATCATAGCCA CCAAATAGTG AGGACCGGGG CTAAGGCCAC ACAGATAGGG 1050 GCCTGATGGA GGAGAGGATG GAAGTTGAAT GTCCTGATGG CCATGAGCAG TTGAGTGGCA 1110 CAGCCCTGGC ACCGGGAGCA GGTTC TTGTA ATGGAGTTAG TGTCCAGTCA GCTGAGCTCC 1170 ACCCTGATGC CAGTGGTGAG TGTTAATTGG CCCATTATCG TTACTACCTG TGTTCCCTCA 1230 CCÁGGCCATC CTGTCACACG AGCCCATTTT CTCCAAGGTG GAATCTGACC AAGCATGAGA GAGATCTGCC 1290 CATGGGACCA GTGGCTTAGA TTCCGCCACA CCCATGGGAC CCCTCACTTG 1350 CCTGCCATGC CCTGCTCGGC TTCAGTCTCC AGGGGACAGT GGGCACCTCT CTCTGCCAAT 1410 ACTTTTTTTA ATTTGCATTT TTTTTCATTT GGGGCCAAAA GTCCAGTGAA ATTGTAAGCT 1470 TCAATAAAAG GATGAAACTC TGGGAAAAAA AAAAAAAAAA AAAAAGGGCG GCCGC 1525 (2) INFORMATION FOR SEQ ID NO: 5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 277 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 5: Met Ala Ser Tyr Pro Tyr Arg Gln Gly Cys Pro Gly Wing Ala Gly Gln 1 5 10 15 Wing Pro Gly Wing Pro Pro Gly Ser Tyr Tyr Pro Gly Pro Pro Asn Ser 20 25 30 Gly Gly Gln Tyr Gly Pro Gly Pro Pro Gly Pro Gly Pro Gly Gly Gly Gly Pro 40 Pro Wing Gly Gly Pro Tyr Gly Pro Pro Wing Gly Gly Gly Pro Tyr Gly 50 55 60 His Pro Ser Pro Gly Met Phe Pro Ser Gly Thr Pro Gly Pro Tly 65 70 75 80 Gly Gly Ala Ala Pro Gly Ser Pro Tyr Gly Gln Pro Pro Leu Ser Be 85 90 95 Tyr Gly Ala Gln Gln Pro Gly Pro Tyr Gly Gln Gly Ala Pro Pro 100 105 110 Ser Val Asp Pro Glu Wing Tyr Ser Trp Phe Gln Ser Gly Tyr lie Ser 115 120 125 Met Lys Glu Leu Lys Gln Wing Leu Val Asn Cys Asn Trp Ser Ser Phe 130 135 140 Asn Asp Glu Thr Cys Leu Met Met He Asn Met Phe Asp Lys Thr Lys 145 150 155 160 Ser Gly Arg He Asp Val Tyr Gly Phe Ser Ala Leu Trp Lys Phe He 165 170 175 Gln Gln Trp Lys Asn Leu Phe Gln Gln Tyr Asp Arg Asp Arg Ser Gly 180 185 190 Ser lie Tyr Thr Glu Leu Gln Gln Wing Leu Ser Gln Met Gly Tyr 195 200 205 Asn Leu Ser Pro Gln Phe Thr Gln Leu Leu Val Ser Arg Tyr Cys Pro 210 215 220 Arg Ser Wing Asn Pro Wing Met Gln Leu Asp Arg Phe lie Gln Val Cys 225 230 235 240 Thr Gln Leu Gln Val Leu Thr Glu Wing Phe Arg Glu Lys Asp Thr Wing 245 250 255 Val Gln Gly Asn lie Arg Leu Be Phe Glu Asp Phe Val Thr Met Thr 260 265 270 Wing Ser Arg Met Leu 275 (2) INFORMATION FOR SEQ ID NO: 6: (1) SEQUENCE CHARACTERISTICS: (A) LENGTH: 831 base pairs (B) TYPE: nucleic acid (C) NUMBER OF HEBRAS: unique (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (ix) CHARACTERISTICS: (A) NAME / KEY: CDS (B) LOCATION: 1. 831 (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 6: ATG GCC AGC TAT CCG TAC CGG CAG GGC TGC CCA GGA GCT GCA GGA CAA 48 Met Wing Being Tyr Pro Tyr Arg Gln Gly Cys Pro Gly Wing Wing Gly Gln 1 5 10 15 GCA CCA GGA GCC CCT CCG GGT AGC TAC TAC TAC CCT GGA CCC CCC AAT AGT 96 Wing Pro Gly Wing Pro Pro Gly Ser Tyr Tyr Pro Gly Pro Pro Asn Ser 20 25 30 GGA GGG CAG TAT GGC AGT GGG CTA CCC CCT GGT GGT TAT GGG GGT CCT 144 Gly Gly Gln Tyr Gly Ser Gly Leu Pro Pro Gly Gly Tyr Gly Gly Pro 35 40 45 GCC CCT GGA GGG CCT TAT GGA CCA CCA GCT GGT GGA GGG CCT TAT GGA 192 Wing Pro Gly Gly Pro Tyr Gly Pro Pro Wing Gly Gly Gly Pro Tyr Gly 50 55 60 CAC CCC AGT CCT GGC ATG TTC CCC TCT GGA ACT CCA GGA GGA CCA TAT 240 His Pro Ser Pro Gly Met Phe Pro Ser Gly Thr Pro Gly Gly Pro Tyr 65 70 75 80 GGC GGT GCA GCT CCA GGG AGC CCC TAT GGT CAG CCA CCT CTA AGT TCC 288 Gly Gly Wing Wing Pro Gly Pro Pro Tyr Gly Gln Pro Pro Leu Ser 85 90 95 TAT GGT GCC CAG CAG CCT GGG CCT TAT GGA CAG GGT GGC GCC CCT CCC 336 Tyr Gly Wing Gln Gln Gln Pro Gly Gly Gly Glly Gl Pro Pro Pro 100 100 110 AGT GTG GAT CCT GAG GCC TAC TCC TGG TTC CAG TCG GGC TAT ATC TCC 384 Ser Val Asp Pro Glu Wing Tyr Ser Trp Phe Gln Ser Gly Tyr He Ser 115 120 125 ATG AAG GAG CTA AAG CAG GCC CTG GTC AAC TGC AAT TGG TCC TCA TTC 432 Met Lys Glu Leu Lys Gln Ala Leu Val Asn Cys Asn Trp Ser Ser Phe 130 135 140 AAT GAT GAG ACC TGC CTC ATG ATG ATA AAC ATG TTT GAC AAG ACC AAG 480 Asn Asp Glu Thr Cys Leu Met Met As As Met Phe Asp Lys Thr Lys 145 150 155 160 TCA GGC CGC ATC GAT GTC TAC GGC TTC TCA GCC CTG TGG AAA TTC ATC 528 Ser Gly Arg He Asp Val Tyr Gly Phe Ser Wing Leu Trp Lys Phe He 165 170 175 CAG CAG TGG AAG AAC CTC TTC CAG CAG TAT GAC CGG GAC CGC TCG GGC 576 Gln Gln Trp Lys Asn Leu Phe Gln Gln Tyr Asp Arg Asp Arg Ser Gly 180 185 190 TCC ATT AGC TAC ACA GAG CTG CAG CAA GCT CTG TCC CAA ATG GGC TAC 624 Ser He Ser Tyr Thr Glu Leu Gln Gln Ala Leu Ser Gln Met Gly Tyr 195 200 205 AAC CTG AGC CCC CAG TTC ACC CAG CTT CTG GTC TCC CGC TAC TGC CCA 672 Asn Leu Ser Pro Gln Phe Thr Gln Leu Leu Val Ser Arg Tyr Cys Pro 210 215 220 CGC TCT GCC AAT CCT GCC ATG CAG CTG GAC CGC TTC ATC CAG GTG TGC 720 Arg Ser Wing Asn Pro Wing Met Gln Leu Asp Arg Phe He Gln Val Cys 225 230 235 240 ACC CAG CTG CAG GTG CTG ACA GAG GCC TTC CGG GAG AAG GAC ACA GCT 768 Thr Gln Leu Gln Val Leu Thr Glu Wing Phe Arg Glu Lys Asp Thr Wing 245 250 255 GTA CAA GGC AAC ATT CGG CTC AGC TTC GAG GAC TTC GTC ACC ATG ACA 816 Val Gln Gly Asn He Arg Leu Ser Phe Glu Asp Phe Val Thr Met Thr 260 265 270 GCT TCT CGG ATG CTA 831 Wing Ser Arg Met Leu 275 (2) INFORMATION FOR SEQ ID NO: 7: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 1362 base pairs (B) TYPE: nucleic acid (C) NUMBER OF CHAINS: unique (D) TOPOLOGY: l ineal (ii) TYPE OF MOLECULE: cDNA (ix) CHARACTERISTIC: (A) NAME / KEY: CDS (B) LOCATION: 177. . 998 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7:TGTCGNCACT CCATGGNTGA TGTATATAAC TATCTATTCG ATGATGAAGA 60 TACCCCACCA AACCCAAAAA AAGAGATCTC TATGGCTTAC CCATACGATG TTCCAGATTA 120 CGCTAGCTTG GGTGGTCATA TGGCCATGGA GGCCCCGGGG ATCCGAATTC GGCACG 176 AGC AGC TAT CCA AAC GGA CAG AGT TGC CCA GGA GCT GCA GGA CAG GTG 224 Ser Ser Tyr Pro Asn Gly Gln Ser Cys Pro Gly Ala Wing Gly Gln Val 1 5 10 15 CCT GGA GTA CCG GGG GGC TAT TAT CCT GGT CCT CCC CAT GGT GGG 272 Pro Gly Val Pro Pro Gly Gly Tyr Tyr Pro Gly Pro Pro His Gly Gly 20 25 30 GGC CAG TAT GGC AGT GGA CTG CCC CCA GGT GGC TAT GGA GCT CCT 320 Gly Gln Tyr Gly Gly Glu Pro Gly Gly Tly Gly Tly Gly Tly Gly Gly CC GGA TGA GCT CCG TGA GCT CCG GGA TGA GCT CCG TCG 368 Pro Gly Gly Pro Tyr Gly Tyr Pro Be Wing Gly Val Pro Ser 50 55 60 GGA ACT CCA AGT GGA CCA TAT GGC GGT ATA CCT CCA GGG GGT CCC TAT 416 Gly Thr Pro Ser Gly Pro Tyr Gly Gly Pro Pro Gly Gly Pro Tyr 65 70 75 80 GGT CAG CTA CCT CCA GGG GGT CCC TAC GGT ACC CAG CCT GGA CAT TAT 464 Gly Gln Le Pro Pro Pro Gly Gly Pro Tyr Gly Thr Gln Pro Gly His Tyr 85 90 95 GGA CAG GGT GGT GTC CCC CNG AAT GTG GAT CCT GAG GCC TAC TCC TGG 512 Gly Gln Gly Val Pro Xaa Asn Val Asp Pro Glu Ala Tyr Ser Trp 100 105 110 TTC CAG TCA GTG GAT GCC GAT CAC AGT GGC TAT ATC TCC CTC AAG GAG 560 Phe Gln Ser Val Asp Wing Asp His Ser Gly Tyr He Ser Leu Lys Glu 115 120 125 CTG AAG CAG GCC CTA GTC AAC TCC AAC TGG TCC TCA TTC AAT GAC GAG 608 Leu Lys Gln Wing Leu Val Asn Ser Asn Trp Ser Ser Phe Asn Asp Glu 130 135 140 ACA TGC CTC ATG ATG ATA AAC ATG TTT GAC AAG ACC AAG TCT GGC CGC 656 Thr Cys Leu Met Met He Asn Met Phe Asp Lys Thr Lys Ser Gly Arg 145 150 155 160 ATT GAT GTC GCC GGC TTC TCA GCC TTA TGG AAA TTC CTC CAG TGG 704 He Asp Val Ala Gly Phe Ser Ala Leu Trp Lys Phe Leu Gln Gln Trp 165 170 175 AGG AAC CTC TTT CAG CAG TAT GAC CGG GAC CGC TCG GGC TCC ATT AGC 752 Arg Asn Leu Phe Gln Gln Tyr Asp Arg Asp Arg Ser Gly Ser Be Ser 180 185 190 TCC ACA GAG CTG CAG CAA GCG CTC TCC CAG ATG GGC TAC AAC CTG AGC 800 Ser Thr Glu Leu Gln Gln Ala Leu Ser Gln Met Gly Tyr Asn Leu Ser 195 200 205 CCT CAG TTC ACG CAG CTC CTG GTT TCC CGG TAC TGC GCA CGC TCT GCT 848 Pro Gln Phe Thr Gln Leu Leu Val Ser Arg Tyr Cys Wing Arg Ser Wing 210 215 220 ATT CCC GCC ATG CAG CTT GAC TGC TTC ATC AAG GTG TGT ACC CAG CTG 896 He Pro Ala Met Gln Leu Asp Cys Phe He Lys Val Cys Thr Gln Leu 225 230 235 240 CAG GTG TTG ACT GAG GCC TTC CGG GAA AAG GAT ACC GCT GTA CAG GGC 944 Gln Val Leu Thr Glu Ala Phe Arg Glu Lys Asp Thr Ala Val Gln Gly 245 250 255 AAC ATC CGG CTC AGC TTT GAG GAC TTT GTC ACC ATG ACG GCT TCA AGG 992 Asn He Arg Leu Ser Phe Glu Asp Phe Val Thr Met Thr Wing Ser Arg 260 265 270 ATG CTA TGACCCAGCC TCCCTAAAGG GAGTGGAGCA CACCAGGGGA TGTGGGCCCC 1048 Met Leu TCCTTTCCTC CTCTCCTAGC AAAGAGTGTT TCCTAGCCTG AGCTAGGAAG GGCGGAGCTT 1108 GACTATCCTG GGCTGTGGAA GTGGGTCTTG CCTTGGAAGT AGGGGCCCTA GAGTAGCAAT 1168 GGAGTTAGTG TCTGGCCAAG CTGTCCTGGC CTCTGGCTTT CCCCCTCTAC TCCCTGATGC 1228 CAGTGCTAAA TGCTCATTGG CTGCCTACTT GGCATCCCTT AACCGAGACC ATCGGGTTAG_1288_ACGAGCCCAA GGNTCTGCAC AGTGGGAATC AGACTGAACT GAGAAGAGAA TTGCTTGGGA 1348 1362 ACCANANCCC TTGG (2) INFORMATION FOR SEQ ID NO: 8: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 274 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 8: Ser Ser Tyr Pro Asn Gly Gln Ser Cys Pro Gly Wing Ala Gly Gln Val 1 5 10 15 Pro Gly Pro Pro Gly Gly Tyr Gyr Pro Gly Gly Pro Pro Gly Gly 20 25 30 Gly Gln Tyr Gly Pro Gly Pro Gly Gly Gly Tyr Pro Gly Wing Pro 40 40 Pro Wing Gly Gly Pro Pro Tyr Gly Tyr Pro Ser Wing Gly Gly Val Pro Ser 50 55 60 Gly Thr Pro Ser Gly Pro Tyr Gly Pro Gly Gly Gly Pro Tyr 65 70 75 80 Gly Gln Pro Pro Pro Gly Gly Pro Tyr Gly Gl Pro Pro Gly His Tyr 85 90 95 Gly Gln Gly Gly Val Pro Xaa Asn Val Asp Pro Glu Ala Tyr Ser Trp 100 105 110 Phe Gln Ser Val Asp Wing Asp His Ser Gly Tyr He Ser Leu Lys Glu 115 120 125 Leu Lys Gln Ala Leu Val Asn Ser Asn Trp Ser Ser Phe Asn Asp Glu 130 135 140 Thr Cys Leu Met Met Met As Met Met Phe Asp Lys Thr Lys Ser Gly Arg 145 150 155 160 lie Asp Val Ala Gly Phe Ser Ala Leu Trp Lys Phe Leu Gln Gln Trp 165 170 175 Arg Asn Leu Phe Gln Gln Tyr Asp Arg Asp Arg Ser Gly Be He Be 180 185 190 Ser Thr Glu Leu Gln Gln Ala Leu Ser Gln Met Gly Tyr Asn Leu Ser 195 200 205 Pro Gln Phe Thr Gln Leu Leu Val Ser Arg Tyr Cys Ala Arg Ser Ala 210 215 220 He Pro Wing Met Gln Leu Asp Cys Phe He Lys Val Cys Thr Gln Leu 225 230 235 240 Gln Val Leu Thr Glu Wing Phe Arg Glu Lys Asp Thr Wing Val Gln Gly 245 250 255 Asn He Arg Leu Be Phe Glu Asp Phe Val Thr Met Thr Ala Ser Arg 260 265 270 Met Leu (2) INFORMATION FOR SEQ ID NO: 9: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 822 base pairs (B) TYPE: nucleic acid (C) NUMBER OF CHAINS: single (D) ) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (ix) CHARACTERISTIC: (A) NAME / C LAVE: CDS (B) LOCATION: 1.822 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 9: AGC AGC TAT CCA AAC GGA CAG AGT TGC CCA GGA GCT GCA GGA CAG GTG 48 Being Ser Tyr Pro Asn Gly Gln Ser Cys Pro Gly Ala Wing Gly Gln Val 1 '5 10. 15 CCT GGA GTA CCG GGG GGC TAT TAT CCT GGT CCT CCC CAT GGT GGG 96 Pro Gly Val Pro Pro Gly Gly Tyr Tyr Pro Gly Pro Pro His Gly Gly 20 25 30 GGC CAG TAT GGC AGT GGA CTG CCC CCA GGT GGT GGC TAT GGA GCT CCT 144 Gly Gln Tyr Gly Ser Gly Leu Pro Pro Gly Gly Tyr Gly Wing Pro 35 40 45 GCC CCT GGA GGA CCC TAT GGA TAC CCC AGT GCT GGA GTC GTC CCC TCG 192 Wing Pro Pro Gly Gly Pro Tyr Gly Tyr Pro Ser Wing Gly Gly Val Pro Ser 50 55 60 GGA ACT CCA AGT GGA CCA TAT GGC GGT ATA CCT CCA GGG GGT CCC TAT 240 Gly Thr Pro Ser Gly Pro Tyr Gly Pro Gly Pro Gly Gly Pro Tyr 65 70 75 80 GGT CAG CTA CCT CCA GGG GGT CCC TAC GGT ACC CAG CCT GGA CAT TAT 288 Gly Gln Leu Pro Pro Gly Gly Pro Tyr Gly Thr Gln Pro Gly His Tyr 85 90 95 GGA CAG GGT GGT GTC CCC CNG AAT GTG GAT CCT GAG GCC TAC TCC TGG 336 Gly Gln Gly Gly Val Pro Xaa Asn Val Asp Pro Glu Wing Tyr Ser Trp 100 105 HP TTC CAG TCA GTG GAT GCC GAT CAC AGT GGC TAT ATC TCC CTC AAG GAG 384 Phe Gln Ser Val Asp Ala Asp His Ser Gly Tyr He Ser Leu Lys Glu 115 120 125 CTG AAG CAG GCC CTA GTC AAC TCC AAC TGG TCC TCA TTC AAT GAC GAG 432 Leu Lys Gln Ala Leu Val Asn Ser Asn Trp Ser Ser Phe Asn Asp Glu 130 135 140 ACA TGC CTC ATG ATG ATA AAC ATG TTT GAC AAG ACC AAG TCT GGC CGC 480 Thr Cys Leu Met Met He Asn Met Phe Asp Lys Thr Lys Ser Gly Arg 145 150 155 160 ATT GAT GTC GCC GGC TTC TCA GCC TTA TGG AAA TTC CTC CAG CAG TGG 528 He Asp Val Ala Gly Phe Ser Ala Leu Trp Lys Phe Leu Gln Gln Trp 165 170 175 AGG AAC CTC TTT CAG CAG TAT GAC CGG GAC CGC TCG GGC TCC ATT AGC 576 Arg Asn Leu Phe Gln Gln Tyr Asp Arg Asp Arg Ser Gly Ser Be Ser 180 185 190 TCC ACA GAG CTG CAG CAA GCG CTC TCC CAG ATG GGC TAC AAC CTG AGC 624 Ser Thr Glu Leu Gln Gln Wing Leu Ser Gln Met Gly Tyr Asn Leu Ser 195 200 205 CCT CAG TTC ACG CAG CTC CTG GTT TCC CGG TAC TGC GCA CGC TCT GCT 672 Pro Gln Phe Thr Gln Leu Leu Val Ser Arg Tyr Cys Ala Arg Ser Wing 210 215 220 ATT CCC GCC ATG CAG CTT GAC TGC TTC ATC AAG GTG TGT ACC CAG CTG 720 He Pro Wing Met Gln Leu Asp Cys Phe He Lys Val Cys Thr Gln Leu 225 230 235 240 CAG GTG TTG ACT GAG GCC TTC CGG GAA AAG GAT ACC GCT CAG GGC 768 Gln Val Leu Thr Glu Wing Phe Arg Glu Lys Asp Thr Wing Val Gln Gly 245 250 255 AAC ATC CGG CTC AGC TTT GAG GAC TTT GTC ACC ATG ACG GCT TCA AGG 816 Asn He Arg Leu Ser Phe Glu Asp Phe Val Thr Met Thr Ala Ser Arg 260 265 270 ATG CTA 822 Met Leu (2) INFORMATION FOR SEQ ID NO: 10: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH : 13 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: peptide * (v) TYPE OF FRAGMENT: internal (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10: Asp Ser Asp His Ser Gly Tyr lie Met Met Lys Glu Leu 1 5 10 (2) INFORMATION FOR SEQ ID NO: 11: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: peptide (v) TYPE OF FRAGMENT: internal (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11: Asp Arg Asp Arg Ser Gly Ser He Ser Tyr Thr Glu Leu 1 5 10 (2) INFORMATION FOR SEQ ID NO: 12: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 13 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: peptide (v) TYPE OF FRAGMENT: internal (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12 : Ser Trp Phe Gln Ser Gly Tyr He Ser Met Lys Glu Leu 1 5 10 (2) INFORMATION FOR SEQ ID NO: 13: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 13 amino acids (B) TYPE: amino acid ( D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: peptide (v) TYPE OF FRAGMENT: internal (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 13: Asp Arg Asp Arg Ser Gly Ser He Ser Tyr Thr Glu Leu 1 5 10 (2) INFORMATION FOR SEQ ID NO: 14: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 13 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: peptide (v) TYPE OF FRAGME NTO: internal (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 14: Asp Ala Asp His Ser Gly Tyr He Ser Leu Lys Glu Leu 1 5 10 (2) INFORMATION FOR SEQ ID NO: 15: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 13 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: peptide (v) TYPE OF FRAGMENT: internal (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 15: Asp Arg Asp Arg Ser Gly Ser lie Ser Thr Glu Leu 1 5 10 (2) INFORMATION FOR SEQ ID NO: 16: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 26 amino acids (B) TYPE: amino acid (D) ) TOPOLOGY: linear (ii) TYPE OF MOLECULE: peptide (v) TYPE OF FRAGMENT: internal (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 16: Glu Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Asp Lys Asp Gly Asp Gly Xaa 1 5 10 15 Xaa Xaa Xaa Xaa Glu Phe Xaa Xaa Xaa Xaa 20 25 (2) INFORMATION FOR SEQ ID NO: 17: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 19 base pairs (B) TYPE: acid nucleic (C) NUMBER OF CHAINS: single (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 17 CAGAATCACC ATGGCCAGC 19 (2) INFORMATION FOR SEQ ID NO: 18: ( i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) NUMBER OF CHAINS: single (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 18: CCCAACCATC TGTGGAGAGT G 21 (2) INFORMATION FOR SEQ ID NO: 19: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 15 base pairs (B) TYPE: nucleic acid (C) NUMBER OF CHAINS: single (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 19: CGCGTGGGCA TGGCC 15 (2) INFORMATION FOR SEQ ID NO: 20: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) NUMBER OF CHAINS: unique (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 20: CCCAACCCAT CTGTGGAGA 19 (2) INFORMATION FOR SEQ ID NO: 21: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 13 base pairs (B) TYPE: nucleic acid (C) NUMBER OF CHAINS: unique (D) TOPOLOGY : linear (ii) TYPE OF MOLECULE: cDNA (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 21 CGGCACGAGC AGC 13 (2) INFORMATION FOR SEQ ID NO: 22: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) NUMBER OF CHAINS: unique (D) TOPOLOGY : linear (ii) TYPE OF MOLECULE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 22: GATGCTATGA CCCAGCC 17

Claims (20)

1. CLAIMS An isolated nucleic acid molecule selected from the group consisting of: a) a nucleic acid molecule encoding a protein comprising the amino acid sequence of SEQ ID NO: 2; b) a nucleic acid molecule encoding a protein comprising the amino acid sequence of SEQ ID NO: 5; c) a nucleic acid molecule encoding a protein comprising the amino acid sequence of SEQ ID NO: 8; d) a nucleic acid molecule encoding a fragment of a protein comprising the amino acid sequence of SEQ ID NO: 2, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 2; e) a nucleic acid molecule encoding a fragment of a protein comprising the amino acid sequence of SEQ ID NO: 5, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 5; f) a nucleic acid molecule encoding a fragment of a protein comprising the amino acid sequence of SEQ ID NO: 8, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 8; g) a nucleic acid molecule encoding a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 2, wherein the nucleic acid molecule is hybridized with a nucleic acid molecule comprising SEQ ID NO : l under strict conditions; h) a nucleic acid molecule encoding a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 5, wherein the nucleic acid molecule is hybridized to a nucleic acid molecule comprising SEQ ID NO : 4 under strict conditions; and i) a nucleic acid molecule encoding a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 8, wherein the nucleic acid molecule is hybridized to a nucleic acid molecule comprising SEQ ID NO : 7 under strict conditions.
2. The nucleic acid molecule according to claim 1 further comprising vector nucleic acid sequences.
3. The nucleic acid molecule according to claim 1 further comprising nucleic acid sequences encoding a heterologous protein.
4. A host cell containing the nucleic acid molecule of claim 1.
5. The host cell of claim 4 which is a mammalian host cell.
6. A non-human mammalian host cell containing the nucleic acid molecule of claim 1.
7. An isolated nucleic acid molecule according to claim 1, which is selected from the group consisting of: a) the coding region of SEQ ID NO: l; b) the coding region of SEQ ID NO: 4; and c) the coding region of SEQ ID NO: 7.
8. An isolated protein selected from the group consisting of: a) a protein comprising the amino acid sequence of SEQ ID NO: 2; b) a protein comprising the amino acid sequence of SEQ ID NO: 5; c) a protein comprising the amino acid sequence of SEQ ID NO: 8; d) a fragment of a protein comprising the amino acid sequence of SEQ ID NO: 2, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 2; e) a fragment of a protein comprising the amino acid sequence of SEQ ID NO: 5, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 5; f) a fragment of a protein comprising the amino acid sequence of SEQ ID NO: 8, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 8; g) a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 2, wherein the protein is encoded by a nucleic acid molecule that hybridizes with a nucleic acid molecule comprising SEQ ID NO: l under strict conditions; h) a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 5, wherein the protein is encoded by a nucleic acid molecule that hybridizes to a nucleic acid molecule comprising SEQ ID NO: 4 under strict conditions; and i) a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 8, wherein the protein is encoded by a nucleic acid molecule that hybridizes with a nucleic acid molecule comprising SEQ ID NO: 7 under strict conditions.
9. The protein according to claim 8 further comprising heterologous amino acid sequences.
10. An antibody that selectively binds to a protein of claim 8.
11. A method for producing a protein selected from the group consisting of: a) a protein comprising the amino acid sequence of SEQ ID NO: 2; b) a protein comprising the amino acid sequence of SEQ ID NO: 5; * c) a protein comprising the amino acid sequence of SEQ ID NO: 8; d) a fragment of a protein comprising the amino acid sequence of SEQ ID NO: 2, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 2; e) a fragment of a protein comprising the amino acid sequence of SEQ ID NO: 5, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 5; f) a fragment of a protein comprising the amino acid sequence of SEQ ID NO: 8, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 8; g) a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 2, wherein the protein is encoded by a nucleic acid molecule that hybridizes with a nucleic acid molecule comprising SEQ ID NO: l under strict conditions; h) an allelic variant that naturally occurs from a protein comprising the amino acid sequence of SEQ ID NO: 5, wherein the protein is encoded by a nucleic acid molecule that hybridizes with a nucleic acid molecule comprising SEQ ID NO: 4 under stringent conditions; and i) a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 8, wherein the protein is encoded by a nucleic acid molecule that hybridizes with a nucleic acid molecule comprising SEQ ID NO: 7 under stringent conditions; the method comprises the step of culturing the host cell of claim 4 under conditions in which the nucleic acid molecule is expressed.
12. A method for detecting the presence of a selected protein within the group consisting of: a) a protein comprising the amino acid sequence of SEQ ID NO: 2; b) a protein comprising the amino acid sequence of SEQ ID NO: 5; c) a protein comprising the amino acid sequence of SEQ ID NO: 8; d) a fragment of a protein comprising the amino acid sequence of SEQ ID NO: 2, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 2; e) a fragment of a protein comprising the amino acid sequence of SEQ ID NO: 5, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 5; f) a fragment of a protein comprising the amino acid sequence of SEQ ID NO: 8, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 8; g) a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 2, wherein the protein is encoded by a nucleic acid molecule that hybridizes with a nucleic acid molecule comprising SEQ ID NO: l under strict conditions; h) an allelic variant that naturally occurs from a protein comprising the amino acid sequence of SEQ ID NO: 5, wherein the protein is encoded by a nucleic acid molecule that hybridizes with a nucleic acid molecule comprising SEQ ID NO: 4 under strict conditions; and i) a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 8, wherein the protein is encoded by a nucleic acid molecule that hybridizes with a nucleic acid molecule comprising SEQ ID NO: 7 under strict conditions; In a sample, the method comprises the steps of: i) contacting the sample with a compound that binds. selectively to the protein; and ii) determining whether the compound binds with the protein in the sample.
13. The method according to claim 12, wherein the compound that binds to the protein is an antibody.
14. A kit comprising reagents used for the method of claim 12, wherein the reagents comprise a compound that selectively binds to a protein selected from the group consisting of: a) a protein comprising the amino acid sequence of SEQ ID NO: 2; b) a protein comprising the amino acid sequence of SEQ ID NO: 5; c) a protein comprising the amino acid sequence of SEQ ID NO: 8; d) a fragment of a protein comprising the amino acid sequence of SEQ ID NO: 2, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 2; e) a fragment of a protein comprising the amino acid sequence of SEQ ID NO: 5, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 5; f) a fragment of a protein comprising the amino acid sequence of SEQ ID NO: 8, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 8; g) a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 2, wherein the protein is encoded by a nucleic acid molecule that hybridizes with a nucleic acid molecule comprising SEQ ID NO: l under strict conditions; h) a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 5, wherein the protein is encoded by a nucleic acid molecule that hybridizes with a nucleic acid molecule comprising SEQ ID NO: 4 under strict conditions; and i) a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 8, wherein the protein is encoded by a nucleic acid molecule that hybridizes with a nucleic acid molecule comprising SEQ ID NO: 7 under strict conditions.
15. A method for detecting the presence of a selected nucleic acid molecule within the group consisting of: a) a nucleic acid molecule encoding a protein comprising the amino acid sequence of SEQ ID NO: 2; b) a nucleic acid molecule encoding a protein comprising the amino acid sequence of SEQ ID NO: 5; c) a nucleic acid molecule encoding a protein comprising the amino acid sequence of SEQ ID NO: 8; d) a nucleic acid molecule encoding a fragment of a protein comprising the amino acid sequence of SEQ ID NO: 2, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 2; e) a nucleic acid molecule encoding a fragment of a protein comprising the amino acid sequence of SEQ ID NO: 5, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 5; f) a nucleic acid molecule encoding a fragment of a protein comprising the amino acid sequence of SEQ ID NO: 8, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 8; g) a nucleic acid molecule encoding a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 2, wherein the nucleic acid molecule is hybridized on a nucleic acid molecule comprising SEQ ID NO: l under strict conditions; h) a nucleic acid molecule encoding a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 5, wherein the nucleic acid molecule hybridizes to a nucleic acid molecule comprising SEQ ID NO: 4 under stringent conditions; and i) a nucleic acid molecule encoding a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 8, wherein the nucleic acid molecule hybridizes to a nucleic acid molecule comprising SEQ ID NO: 7 under stringent conditions; In a sample, the method comprises the steps of: i) contacting the sample with a nucleic acid probe or primer that hybridizes selectively with the nucleic acid molecule; and ii) determining whether the nucleic acid probe or primer binds to a nucleic acid molecule in the sample.
16. The method according to claim 15, wherein the sample comprises molecules of 7 [mu] Nm and is in contact with a nucleic acid probe.
17. A kit comprising reagents used for the method of claim 15, wherein the reagents comprise a compound that hybridizes selectively with a nucleic acid molecule selected from the group consisting of: a) a nucleic acid molecule encoding a protein that comprises the amino acid sequence of SEQ ID NO: 2; b) a nucleic acid molecule encoding a protein comprising the amino acid sequence of SEQ ID NO: 5; c) a nucleic acid molecule encoding a protein comprising the amino acid sequence of SEQ ID NO: 8; d) a nucleic acid molecule encoding a fragment of a protein comprising the amino acid sequence of SEQ ID NO: 2, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 2; e) a nucleic acid molecule encoding a fragment of a protein comprising the amino acid sequence of SEQ ID NO: 5, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 5; f) a nucleic acid molecule encoding a fragment of a protein comprising the amino acid sequence of SEQ ID NO: 8, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 8; g) a nucleic acid molecule encoding a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 2, wherein the nucleic acid molecule is hybridized to a nucleic acid molecule comprising SEQ ID NO : l under strict conditions; h) a nucleic acid molecule encoding a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 5, wherein the nucleic acid molecule is hybridized to a nucleic acid molecule comprising SEQ ID NO : 4 under strict conditions; and i) a nucleic acid molecule encoding a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 8, wherein the nucleic acid molecule is hybridized to a nucleic acid molecule comprising SEQ ID NO : 7 under strict conditions.
18. 18. A method for identifying a compound that binds to a selected protein within the group consisting of; a) a protein comprising the amino acid sequence of SEQ ID NO: 2; b) a protein comprising the amino acid sequence of SEQ ID NO: 5; c) a protein comprising the amino acid sequence of SEQ ID NO: 8; d) a fragment of a protein comprising the amino acid sequence of SEQ ID NO: 2, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 2; e) a fragment of a protein comprising the amino acid sequence of SEQ ID NO: 5, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 5; f) a fragment of a protein comprising the amino acid sequence of SEQ ID NO: 8, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 8; g) a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 2, wherein the protein is encoded by a nucleic acid molecule that hybridizes with a nucleic acid molecule comprising SEQ ID NO: l under strict conditions; h) an allelic variant that naturally occurs from a protein comprising the amino acid sequence of SEQ ID NO: 5, wherein the protein is encoded by a nucleic acid molecule that hybridizes with a nucleic acid molecule comprising SEQ ID NO: under stringent conditions; and i) a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 8, wherein the protein is encoded by a nucleic acid molecule that hybridizes with a nucleic acid molecule comprising SEQ ID NO: 7 under stringent conditions; the method comprises the steps of: i) contacting the protein, or a cell expressing the protein with a test compound; and ii) determining whether the protein binds to the test compound.
19. The method according to claim 18, wherein the binding of the test compound to the protein is detected by a method selected from the group consisting of: a) detection of binding by direct detection of the test compound / protein binding; b) detection of the junction using a competition binding assay; c) binding detection using an assay to determine ALG-2LP activity.
20. 20. A method for modulating the activity of a selected protein within the group consisting of: a) a protein comprising the amino acid sequence of SEQ ID NO: 2; b) a protein comprising the amino acid sequence of SEQ ID NO: 5; c) a protein comprising the amino acid sequence of SEQ ID NO: 8; d) a fragment of a protein comprising the amino acid sequence of SEQ ID NO: 2, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 2; e) a fragment of a protein comprising the amino acid sequence of SEQ ID NO: 5, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 5; f) a fragment of a protein comprising the amino acid sequence of SEQ ID NO: 8, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 8; g) a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 2, wherein the protein is encoded by a nucleic acid molecule that hybridizes with a nucleic acid molecule comprising SEQ ID NO: l under strict conditions; h) an allelic variant that naturally occurs from a protein comprising the amino acid sequence of SEQ ID NO: 5, wherein the protein is encoded by a nucleic acid molecule that hybridizes with a nucleic acid molecule comprising SEQ ID NO: 4 under stringent conditions; and i) a naturally occurring allelic variant of a protein comprising the amino acid sequence of SEQ ID NO: 8, wherein the protein is encoded by a nucleic acid molecule that hybridizes with a nucleic acid molecule comprising SEQ ID NO: 7 under stringent conditions, the method comprising the steps of: i) contacting a cell that expresses the protein with a compound that binds with the protein in a sufficient concentration to modulate the activity of the protein. The method according to claim 20, wherein the activity is the modulation of programmed cell death. The method according to claim 20, wherein the method results in the inhibition of programmed cell death. The method according to claim 20, wherein the method results in the stimulation of programmed cell death.