WO1996021034A1

WO1996021034A1 - Avian recombinant live vaccine

Info

Publication number: WO1996021034A1
Application number: PCT/FR1995/001763
Authority: WO
Inventors: Jean-Christophe Francis Audonnet; Michel Joseph Marie Bublot; Raphaël Jean DARTEIL; Carole Véronique DUINAT; Eliane Louise Françoise LAPLACE; Michel Albert Emile Riviere
Original assignee: Rhone Merieux
Priority date: 1994-12-30
Filing date: 1995-12-29
Publication date: 1996-07-11
Also published as: AU4489896A

Abstract

An avian recombinant live vaccine including, as the vector, a Marek's disease virus, particularly HVT, including at least one nucleotide sequence coding for and expressing an antigenic polypeptide of an avian pathogen, and being inserted into the UL13 gene under the control of the immediate early CMV promoter. A multivalent vaccine formula includes at least two such vaccines with differing inserted sequences.

Description

Avian recombinant live vaccine.

The present invention relates to vaccines for avian use based on Marek's disease virus (MDV), and more particularly HVT virus (Herpes Virus of Turkey), into which has been inserted, by genetic recombination, the at least one nucleotide sequence coding for, and expressing, an antigenic polγpeptide of an avian pathogen, under conditions ensuring immunization leading to effective protection of the animal vaccinated against said pathogen.

A number of recombinant avian viral vectors have already been proposed with the intention of vaccinating birds against avian pathogens, in particular pathogenic viruses, among which are Marek's disease (MDV), Newcastle disease viruses (NDV), infectious laryngotracheitis (ILTV), Gumboro disease (Infectious Bursal Disease, IBDV), infectious bronchitis (IBV) and avian anemia (CAV).

The viral vectors used include avipox, in particular Fowlpox, (EP-A-0 517 292; H.-G. Heine ef al., Arch. Virol. 1993. 131. 277-292; DB Boyle et al., Veterinary Microbiology 1994. 41. 173-181; CD. Bayliss et al., Arch. Virol. 1991. 120. 193-205), Marek viruses, in particular serotypes 2 and 3 (HVT) (WO-A-87 04463 ; WO-A-89 01040; WO-A-93 25665; EP-A-0 513 921; J. McMillen, Poultry Condemnation Meeting, October 1994, 359-363; PJA Sondermeijer et al., Vaccine 1993. 11. 349 -357; RW Morgan et al., Avian Diseases 1992. 36. 858-870, and 1993. 37. 1032-1040) or also the ILTV virus and the avian adenovirus.

When used for vaccination, these recombinant viruses induce protections of variable levels, generally weak or partial, even if, in rare particular cases, significant protection can be demonstrated.

Among the protections most difficult to provide with live recombinant avian vaccines is that against the Gumboro disease virus, or IBDV virus. Indeed, although there are conventional live attenuated or inactivated vaccines effective against this disease, no recombinant live vaccine has yet demonstrated adequate efficacy.

The genome of the Gumboro disease virus is made up of double-stranded RNA. The largest segment (segment A) codes for a 1 15 kDa polyprotein secondarily cleaved into three proteins VP2 (41 kDa), VP4 (28 kDa), VP3 (32 kDa). VP4 is a protease involved in the maturation of the polyprotein 1 15 kDa. The position of the cleavage site between VP2 and VP4 is only determined approximately (M. Jagadish, J. Virol. 1988. 62. 1084-1087). The protein VP2 is an immunogen inducing neutralizing antibodies and a protection against Gumboro disease.

It has already been proposed to insert genes coding for immunogenic IBDV proteins into various living vectors: EP-A-0 517 292 (insertion of sequences coding for VP2 or the polyprotein in an avipox); CD. Bayliss 1991, H.-G. Heine 1993 and DB Boyle 1994 supra (VP2 in the Fowlpox).

Marek's disease viruses have also been proposed in

WO-A-90 02802 and WO-A-90 02803 (various insertion sites such as gC, TK,

RR1, RR2), in French patent applications Nos. 90 03105 (RR2) and 90

5 1 1146 (US3), as well as, in particular, in patent applications WO-A-87

04463 and WO-A-89 01040 (BamHI # 16 and # 19) and WO-A-93 25655 (US2).

Various promoters, including those generally available commercially, have been used in the various constructions of the prior art, including the PRV gX, HCMV IE (immediate immediate early CMV) promoters, herpes simplex alpha-4, FPV PE / L (promoter Fowlpox) (H. Heine et al., Arch. Virol. 1993. 131. 277-292), P7.5 (C. Bayliss et al., Arch. Virol. 1991. 120. 193-205) and P 11 of the vaccinia virus (D. Boyle et al. Vet. Microb. 1994. 41. 173-181), originating from the RSV virus (Rous Sarcoma Virus) LTR sequence, early SV40, as well as MDV promoters or HVT, 5 such as the promoters of the genes gB, gC, TK, RR2, etc., without a rule having appeared, in particular in the case of constructions in HVT. The sequences of certain promoters can inhibit the replication of the recombinant vectors HVT or MDV (D.R. Marshall et al., J. Vir. Meth. 1992. 40. 195-204 and Virology 1993. 195. 638-648). Among the promoters mentioned, a certain number, such as for example SV40, LTR RSV and PRV gX, have shown a certain effectiveness, as have certain promoters specific to certain genes of the Marek viruses, in particular of serotype 3.

The invention has made it possible to develop a recombinant live vaccine based on an HVT vector into which is inserted at least one sequence coding for an avian immunogen, in particular the protein VP2 of IBDV. Such a vaccine incorporating a sequence coding for VP2 ensures satisfactory protection of animals against Gumboro disease, namely protection against mortality and damage to the bursa of Fabricius.

The subject of the present invention is a live recombinant avian vaccine comprising, as vector, a Marek's disease virus, in particular HVT, comprising at least one nucleotide sequence encoding and expressing an antigenic polypeptide of an avian pathogenic agent. , inserted into the UL13 gene under the immediate early CMV promoter control.

By insertion into the UL13 gene is meant both the simple insertion into this gene without deletion thereof, and the insertion after total or partial deletion. We prefer insertion after partial deletion.

By immediate early CMV precursor (IE), is meant in particular the fragment do born in the examples as well as its sσus-f ragments retaining the m & ne fast-acting acti.

The CMV IE promoter can be the human promoter (HCMV IE or the murine promoter (MCMV IE), or a CMV IE promoter from another origin, for example from the rat or guinea pig.

The nucleotide sequence inserted into the Marek vector to be expressed may be any sequence coding for an antigenic polypeptide, of an avian pathogenic agent, capable, once expressed under the favorable conditions provided by the invention, of ensuring immunization leading to effective protection of the animal vaccinated against the pathogen. O can therefore insert, under the conditions of the invention, the nucleotide sequences coding for the antigens of interest for a given disease.

The vaccines according to the invention may be used for in ovo vaccination, chicks 1 day or older and adults.

The invention can in particular be used for the insertion of a nucleotide sequence coding suitably for the polypeptide VP2 of the IBDV virus. A recombinant live vaccine is thus obtained ensuring, in addition to protection against Marek's disease, satisfactory protection against Gumboro disease. If desired, it is also possible to insert a sequence coding for another IBDV antigen, such as VP3 or even the polyprotein VP2 + VP4 + VP3, these other possibilities not being preferred. The recombinant vaccine against Gumboro disease should preferably be presented at between 10 and 10 ⁴ PFU / dose.

Other preferred cases of the invention are sequence insertion nucleotides encoding antigens of the Marek disease virus, in particular gB, gC, gD and gH + gL genes (WO-A-90 02803), of Newcastle disease virus, in particular F and HN genes, infectious bronchitis virus (IBV), in particular S and M genes (M. Binns et al., J. Gen. Virol. 1985. 66. 719-726; M. Boursnell et al., Virus Research 1984. 1. 303-313), avian anemia virus (CAV), in particular VP1 (52 kDa) + VP2 (24 kDa) (NHM Noteborn et al., J. Virol. 1991. 65. 3131 -3139) and infectious laryngotracheitis virus (ILTV), in particular gB (WO-A-9002802), gC, gD and gH + gL. The doses will preferably be the same as those indicated for the Gumboro vaccine.

According to an advantageous development of the invention, the promoter CMV IE is associated with another promoter in a head-to-tail arrangement, which makes it possible to insert, into the insertion region, two nucleotide sequences, one dependent on the CMV IE promoter, the other under that of the associated promoter. This construction is remarkable by the fact that the presence of the CMV IE promoter, and in particular of its activating part (enhancer), activates the transcription induced by the associated promoter. A preferred associated promoter is the Marek RNA1.8 promoter, the transcription activity of which has been shown to be approximately multiplied by 4.4 under these conditions.

An interesting case of the invention is a vaccine comprising a nucleotide sequence coding for IBDV VP2 under the control of CMV IE and a nucleotide sequence coding for an antigen of another avian disease, in particular those mentioned above, under the control from the other promoter.

We can also head up two CMV IE promoters from different origins.

The RNA1.8 promoter may also be used alone in place of the CMV IE promoter, in particular for vaccines against Marek's disease, Newcastle disease, infectious laryngotracheitis, infectious bronchitis and avian anemia.

The present invention also relates to a vaccine formula multivalent, comprising, as a mixture or as a mixture, at least two recombinant live avian vaccines as defined above, these vaccines comprising different inserted sequences, in particular of different pathogens. The present invention also relates to a method of avian vaccination comprising the administration of a live recombinant vaccine or of a multivalent vaccine formula as defined above. It relates in particular to such a method for vaccination in ovo, chicks of 1 day or more and adults. The invention will now be described in more detail with the aid of nonlimiting exemplary embodiments, taken with reference to the drawing, in which:

List of figures and sequences for constructions in the UL13 site

Figure 1: HVT sequence U _s gl region Figure 2: Construction of plasmids pRD022 and pRD027 Figure 3: Construction of plasmids pRD023 and pRD029 Figure 4: plasmid pCMVβ Figure 5: plasmid pEL022 Figure 6: plasmid pEL023 Figure 7: plasmid pEL024 Figure 8: plasmid pEL025 Figure 9: Partial sequence HVT BamHI D fragment Figure 10 plasmid pMB025 Figure 11 plasmid pMB031 Figure 12 plasmid pMB032 Figure 13 plasmid pEL026 Figure 14 plasmid pMB033 Figure 15 plasmid pCD002 Figure 16 plasmid pCDOOΘ Figure 17 plasmid pEL068 Figure 18 plasmid pEL070 Figure 19 pEL074 Figure 20 plasmid pCD01 1 Figure 21 plasmid pCD020 Figure 22 plasmid pEL084 Figure 23 Sequence of the NDV HN gene Figure 24 plasmid pEL028 Figure 25 plasmid pEL029bis Figure 26 plasmid pEL030 Figure 27 plasmid pEL032 Figure 28 plasmid pEL085 Figure 29 plasmid pEL034 Figure 30 plasmid pEL034 Figure 31: plasmid pEL086

Figure 32: Sequence of the MDV RNA promoter 1.8 kbp

Figure 33: plasmid pBS002

Figure 34: plasmid pEL069 Figure 35: plasmid pELOδO

Figure 36: plasmid pEL081

Figure 37: plasmid pEL087

Figure 38: plasmid pEL097

List of SEQ ID sequences for constructions in the UL13 site

SEQ ID N ° 1 Oligonucletide RD045

SEQ ID N ° 2 Oligonucleotide pBRPst-

SEQ ID N ° 3 HVU sequence U _s gl region SEQ ID N ° 4 Oligonucleotide RD048

SEQ ID N ° 5 Oligonucleotide RD049

SEQ ID N ° 6 Partial sequence of the HVT BamHI D fragment

SEQ ID N ° 7 Oligonucleotide PB047

SEQ ID N ° 8 Oligonucleotide MB057 SEQ ID N ° 9 Oligonucleotide MB070

SEQ ID N ° 10 Oligonucleotide MB071

SEQ ID N ° 11 Oligonucleotide CD001

SEQ ID No. 12 Oligonucleotide CD002

SEQ ID N ° 13 Oligonucleotide CD003 SEQ ID N ° 14 Oligonucleotide CD004

SEQ ID N ° 15 NDV HN gene sequence

SEQ ID N ° 16 Oligonucleotide EL071

SEQ ID N ° 17 Oligonucleotide EL073

SEQ ID No. 18 Oligonucleotide EL074 SEQ ID No. 19 Oligonucleotide EL075

SEQ ID N ° 20 Oligonucleotide EL076

SEQ ID N ° 21 Oligonucleotide EL077

SEQ ID N ° 22 Sequence of promoter MDV RNA 1.8 kpb

SEQ ID N ° 23 Oligonucleotide MB047 SEQ ID N ° 24 Oligonucleotide MB048

SEQ ID N ° 25 Oligonucleotide MB072 2. EXAMPLES

All the plasmid constructions were carried out using the standard molecular biology techniques described by Sambrook J. et al. (Molecular Cloning: A Laboratory Manual. 2nd Edition. Cold Spring Harbor Laboratory. Cold Spring Harbor. New York. 1989). All the restriction fragments used for the present invention were isolated using the "Geneclean" kit (BIO101 Inc. La Jolla, CA).

The virus used as the parental virus is the strain FC126 of the herpesvirus of the turkey (HVT) isolated by Dr. Witter of the Regional Poultry Research Laboratory (USDA, East Lansing, Michigan), in a flock of turkeys of 23 weeks (Witter RL et al. Am. J. Vet. Res. 1970. 31. 525-538). The culture conditions for this virus are those described elsewhere (French patent application 90 03105).

EXAMPLE 1 Extraction of DNA from Marek's Disease Virus: The whole blood of a chicken tested at 7 days with the strain MDV RB1 B is collected with a syringe on anticoagulant (heparin solution at 100 IU / ml ) 14 days after infection. This blood is then centrifuged at 30 g for 15 minutes at room temperature. The plasma and the "buffy-coat" are removed and diluted in sterile PBS to have a final volume of 10 ml. After a 5-minute centrifugation at 150 g, the cell pellet is resuspended in 2 ml of culture medium 199 (Gibco-BRL Cat # 042-01 183M) containing 2% fetal calf serum (SVF)).

The total DNA of the infected lymphocytes is then extracted according to the technique described by R. Morgan et al. (Avian Diseases. 1990. 34. 345-351) and can directly serve as a template for PCR experiments. For the cloning of genomic fragments of the MDV virus, the RB1 B strain was cultured on CEP and the viral DNA was prepared from purified viral particles as described by Lee Y. et al. (J. Gen. Virol. 1980. 51. 245-253). EXAMPLE 2 Preparation of the DNA of the MCMV Virus (Mouse CytoMeαaloVirus)

The MCMV virus strain Smith was obtained from the American Type Culture Collection, Rockville, Maryland, USA (ATCC No. VR-194). This virus was cultured on Balb / C mouse embryo cells and the viral DNA of this virus was prepared as described by Ebeling A. et al. (J. Virol. 1983. 47, 421-433).

Example 3 Preparation of the DNA of the HVT Virus for Transfection Experiments:

The viral DNA used for the transfection experiments was prepared according to the technique described by R. Morgan et al. (Avian Diseases. 1990, 34, 345-351) from a culture of secondary CEPs (CEP II) infected with the FC126 strain of the HVT virus.

Construction of recombinant viruses

Example 4: Construction and isolation of vHVT1 The construction of the donor plasmid pGH010, the isolation and the purification of the recombinant virus vHVT1 were described in French patent application 92.13109. This recombinant HVT virus contains the gene coding for the capsid protein VP2 of the Gumboro disease virus ("IBDV" virus) placed under the control of the promoter of the RR2 gene of the HVT virus. In this recombinant virus, the VP2 gene was inserted in place of the HVT RR2 gene.

Example 5: Construction of the donor plasmid pEL025 and isolation of vHVT2

5.1. Construction of the donor plasmid pEL025

The 29 kbp BamHI A fragment of the HVT virus strain FC126 (Igarashi T. et al. Virology. 1989. 70. 1789-1804) was cloned into the BamHI site of the vector pBR322 to give the plasmid pRDOOl. The plasmid pRDOOl was digested with Pstl and the Pstl-Pstl fragments 2.8 kbp and 5.7 kbp were cloned into the Pst1 site of the vector pBR322 to give the plasmids pRD006 and pRD007 respectively. Plasmid pRD006 was digested with Pstl and Sacl to isolate the 340 bp Pstl-Sacl fragment (fragment A). A PCR was carried out with the oligonucleotides: RD045 (SEQ ID N ⁰ 1)

5 'TGCTGGTACCGTCGACAAGCTTGGATCCGTGCAGATAACACGTACTGGC 3' pBRPst- (SEQ ID N ° 2) 5 'CATGTAACTCGCCTTGATC 3' and the matrix pRD007 to obtain a fragment of 550 bp (positions (339) to 831 in figure 1 (SEQ ID N ° 3) 6491 to 6980 on the HVT U _s sequence (Zelnik V. et al. J. Gen. Virol. 1993. 74. 2151-2162) The 520 bp PCR fragment was then digested with Kpnl and Pstl to isolate a Pstl fragment -Kpnl of 520 bp (fragment B). The fragments A and B were ligated together with the vector pBS-SK + (Stratagene), previously digested with Kpnl and Sac1 to give the plasmid pRD022 (FIG. 2). The plasmid pRD007 a was digested with Sali and Xhol to isolate the 730 bp Sall-Xhol fragment (positions 1876 to 2608 on SEQ ID No. 1) (positions 6491 to 6980 on the HVT U _s sequence (Zelnik V. et al. J. Gen. Virol. 1993. 74. 2151 -2162) This fragment was cloned into the SalI site of the vector pBS-SK -i to give the plasmid pRD027 (FIG. 2). A synthesized oligonucleotide double stranded tick was obtained by hybridization of the following two oligonucleotides: RD048 (SEQ ID N ° 4) 5 'GATCCAGCTGAATTCAGCTA 3' RD049 (SEQ ID N ° 5) 5 'AGCTTAAGCTGAATTCAGCTG 3'

This oligonucleotide was cloned between the BamHI and HindIII sites of the plasmid pRD022 to give the plasmid pRD023 (Figure 3). The plasmid pCMVβ (Clontech Cat # 6177-1) (FIG. 4) was digested with EcoRI and SalI to isolate the EcoRI-SalI fragment of 4500 bp containing the expression cassette HCMV-IE = lacZ (fragment C). Plasmid pRD027 was digested with HindIII and Xhol to isolate the HindIII-Xhol fragment of 730 bp (fragment D). Fragments C and D were ligated together with the plasmid pRD023, previously digested with EcoRI and HindIII, to give the plasmid pRD029 of 8973 bp (FIG. 3). This plasmid contains the expression cassette HCMV-IE = lacZ in the gl site (complete deletion) of the HVT virus.

Plasmid pEL004 (= plasmid pGH004 described in French patent application 92.13109) containing the IBDV VP2 gene in the form of a cassette BamHI-Hindlll was digested with BamHI and Xbal to isolate the BamHI-Xbal fragment (truncated VP2 gene) of 1,104 bp. This fragment was cloned into the vector pBS-SK +, previously digested with Xbal and BamHI to give the plasmid pEL022 of 4052 bp (FIG. 5). The vector pBS-SK + was digested with EcoRV and Xbal, then ligated on itself to give pBS-SK * (modified). Plasmid pEL004 was digested with Kpnl and Hindlll to isolate the Kpnl-Hindlll fragment of 1387 bp containing the complete IBDV VP2 gene. This fragment was cloned into the vector pBS-SK *, previously digested with Kpnl and Hindlll, to give the plasmid pEL023 of 4292 bp (FIG. 6). The plasmid pEL022 was digested with BamHI and NotI to isolate the BamHI-NotI fragment of 1122 bp (fragment A). The plasmid pEL023 was digested with BamHI and NotI to isolate the BamHI-NotI fragment of 333 bp (fragment B). Fragments A and B were ligated together with the vector pBS-SK +, previously digested with NotI and treated with alkaline phosphatase, to give the plasmid pEL024 of 4369 bp (FIG. 7). Plasmid pEL024 was then digested with NotI to isolate the 1445 bp NotI-NotI fragment. This fragment was cloned into the plasmid pRD029, previously digested with NotI and treated with alkaline phosphatase, to give the plasmid pEL025 of 6904 bp (FIG. 8). 5.2. Isolation and purification of the recombinant vHVT2 The plasmid pEL025 was digested with SalI for linearization, then extracted with a phenol / chloroform mixture (19: 1), precipitated with absolute ethanol, and taken up in sterile water.

Primary 24-hour CEP cells were then transfected with the following mixture: 1 μg of linearized pEL025 plasmid + 5 μg of viral HVT DNA in 300 μ \ of OptiMEM medium (Gibco BRL Cat # 041-01985H) and 100 μg of LipofectAMINE diluted in 300 μ \ of medium (final volume of the mixture = 600 μ \). These 600 μl were then diluted in 3 ml (final volume) of medium and spread on 3.10 ⁶ CEP I. The mixture was left in contact with the cells for 5 hours, then eliminated and replaced with 5 ml of culture medium. The cells were then left in culture for 3 days at + 37 ° C., then they were pronased, mixed with fresh CEP II (mixture 3: 1), and re-spread on 1 96-well plate. This plate was left in culture for 3 days, then the cells were pronased, mixed with fresh CEP II, and re-spread on 2 96-well plates, an initial well giving 2 sister wells. The 96-well plates were cultured until the appearance of a cytopathic effect. After 72 hours of culture, one of the two 96-well plates was fixed with 95% acetone for 30 minutes and an indirect immunofluorescence reaction (IFI) was carried out with an anti-VP2 monoclonal antibody to find the plaques expressing the VP2 protein. The “sister” wells of the wells having positive IFI plaques were pronased, mixed with fresh CEP II, and deposited in limiting dilution on 96-well plates. After 3 days of culture, the wells showing a cytopathic effect were pronased, mixed with CEP H, and re-spread on 96-well plates, an initial well giving 2 sister wells. 3 days later, the plaques expressing the VP2 protein were again searched as previously by IFI on one of the 2 sister plates. In general, 4 successive isolation cycles (harvesting of a cup, re-spreading, control by IFI, subculturing of a sister cup, etc.) are sufficient to obtain recombinant viruses whose entire progeny exhibit specific fluorescence. A viral range which gave 100% of positive ranges in IFI with an anti-VP2 monoclonal antibody was designated vHVT2. The genomic DNA of this recombinant virus has been characterized at the molecular level by standard PCR and Southern blot techniques using the appropriate oligonucleotides and DNA probes. This recombinant contains an HCMV-IE / IBDV VP2 cassette in place of the gl gene of the HVT virus.

Example 6: Construction of the donor plasmid pMB033 and isolation of vHVT5 6.1. Construction of the donor plasmid pMB033

The 14.5 kbp BamHI D fragment of the HVT virus strain FC126 (Igarashi T. et al. Virology. 1989. 70. 1789-1804) was cloned into the vector pBR322 to give the plasmid pRD066. The partial sequence of this fragment was established on 5471 bp (Figure 9 and SEQ ID No. 6). This sequence contains the ORF homologous to the HSV-1 UL13 gene. This ORF extends from position 1493 to position 3037 on SEQ ID No. 6 and codes for a designated theoretical protein HVT UL13 of 514 amino acids (aa). The plasmid pRD066 was digested with BamHI and Hindlll to isolate the Hindlll-Hindlll fragments of 2.0 kbp (fragment A) and BamHI-Hindlll of 6.5 kbp (fragment B). Fragment A was cloned into the HindIII site of the vector pBS-SK + to give the plasmid pMB007. Fragment B was cloned between the BamHI and HindIII sites of the vector pBS-SK + to give the plasmid pMB013. Plasmid pMB013 was digested with SalI and Spel to isolate the 850 bp Sall-Spel fragment. This fragment was ligated with the vector pBS-SK +, previously digested with Sali and Xbal, to give the plasmid pMB025 (FIG. 10). The plasmid pMB013 was digested with Ncol and Hindlll to isolate the Hindlll-Ncol fragment of 3.8 kbp. This fragment was ligated with the vector pBS-SK +, previously digested with HindIII and Ncol, to give the plasmid pMB017. Plasmid pMB007 was digested with EcoRI, treated with Klenow polymerase, and digested with Hindlll to isolate the Hindlll-free end fragment of 850 bp. This fragment was ligated with the vector pBS-SK +, previously digested with Apal, treated with Klenow polymerase, then digested with Hindlll, to give the plasmid pMB031 (Figure 11). Plasmid pMB025 was digested with Kpnl and SalI to isolate the Kpnl-SalI fragment of 3700 bp (fragment A). Plasmid pMB031 was digested with Kpnl and Hindlll to isolate the Kpnl-Hindlll fragment of 850 bp (fragment B). A PCR reaction was carried out with the following 2 oligonucleotides:

PB047 (SEQ ID N ° 7) 5 'GTAAAACGACGGCCAGT 3'

MB057 (SEQ ID N ° 8)

5'GTGTGGTCGACGGATCCCGGGCATGCGAATTCTTTATTGGGACTGTTCGCGCGTTCCAC 3 'and the matrix pMB017 to produce a 540 bp PCR fragment. This fragment was digested with Hindlll and SalI to isolate a Hindlll-SalI fragment of 500 bp (fragment C).

Fragments A, B and C were ligated together to give the plasmid pMB032 of 5050 bp (Figure 12). The 5 ′ flanking arm of this plasmid has a size of 1226 bp (positions 564 to 1789 on SEQ ID No. 6) and contains the 99 aa N-terminals of HVT UL13. The 3 'flanking arm has a size of 854 bp (positions 2559 to 3412 on SEQ ID No. 6) and contains the 158 aa C-terminals of HVT UL13. The plasmid pMB032 therefore introduces a deletion of 770 bp (257 aa) in the ORF HVT UL13 during the recombination with the genomic DNA of the HVT virus. The plasmid pEL024 (see example 5) was digested with NotI to isolate the NotI-NotI fragment of 1445 bp. This fragment was ligated with the plasmid pCMVβ, previously digested with NotI, to give the plasmid pEL026 of 5095 bp (FIG. 13). The plasmid pEL026 was digested with Asp700, EcoRI and SalI to isolate the EcoRI-SalI fragment of 2400 bp (HCMV-IE / IBDV VP2 cassette). This fragment was ligated with the plasmid pMB032, previously digested with EcoRI and SalI to give the plasmid pMB033 of 7412 bp (FIG. 14). 6.2. Isolation and purification of the recombinant vHVTδ

A co-transfection with the plasmid pMB033 linearized with Kpnl and Pvull and the viral DNA of HVT was carried out as described in Example 5. The conditions for isolation and purification of the recombinant viral plaques resulting from this co-transfection were those described in Example 5. A viral range which gave 100% of positive ranges in IFI with an anti-IBDV VP2 monoclonal antibody was designated vHVTδ. The genomic DNA of this recombinant virus has been characterized at the molecular level by standard PCR and Southern blot techniques using the appropriate oligonucleotides and DNA probes.

Example 7: Construction of the donor plasmid pEL074 and isolation of vHVT11

The plasmid pCMVβ (FIG. 4) was digested with SalI and Smal to isolate the Sall-Smal fragment of 3679 bp containing the lacZ gene as well as the polγ-adenγlation signal from the late gene of the SV40 virus. This fragment was inserted into the vector pBS-SK + (Stratagene), previously digested with Sali and EcoRV, to give the plasmid pCD002 of 6625 bp (FIG. 15). This plasmid contains the lacZ reporter gene but no promoter is located upstream of this gene. The viral genomic DNA of the MCMV virus was prepared as described in Example 2 and digested with Pstl to isolate the Pstl-Pstl fragment of 2285 bp. This fragment was cloned into the vector pBS-SK +, previously digested with Pst1 and treated with alkaline phosphatase, to give the plasmid pCD004. Plasmid pCD004 was digested with Hpal and Pstl to isolate the Hpal-Pstl fragment of 1389 bp which contains the promoter / activator region of the Immediate-Early gene of the murine cytomόgalovirus (Murine CytoMegaloVirus = MCMV) (Dorsch-Hâsler K. et al. Proc. Natl. Acad. Sci. 1985. 82. 8325-8329, and patent application WO-A-87/03905). This fragment was cloned into the plasmid pCD002 previously digested with Pstl and SmaI, to give the plasmid pCD009 of 8007 bp (FIG. 16). A double-stranded oligonucleotide was obtained by hybridization of the following two oligonucleotides: MB070 (SEQ ID No. 9) 5 'CGAATTCACTAGTGTGTGTCTGCAGGCGGCCGCGTGTGTGTCGACGGTAC 3' MB071 (SEQ ID No. 10)

5 'CGTCGACACACACGCGGCCGCCTGCAGACACACACTAGTGAATTCGAGCT 3' This double-stranded oligonucleotide was ligated into the vector pBS-SK +, previously digested with Kpnl and Sac1, to give the plasmid pEL067. Plasmid pCD009 was digested with Pstl and Spel to isolate the Pstl-Spel fragment of 1396 bp. This fragment was ligated with the plasmid pEL067, previously

I digested with Pstl and Spel, to give the plasmid pEL068 of 4297 bp (FIG. 17). The plasmid pEL026 (see example 6) was digested with HindIII and SalI to isolate the Hindlll-SalI fragment of 235 bp (fragment B). Fragments A and B were ligated together with the plasmid pEL068, previously digested with NotI and SalI, to give the plasmid pEL070 of 5908 bp (FIG. 18). The plasmid pEL070 was digested with EcoRI, SalI and Xmnl to isolate the EcoRI-SalI fragment of 3035 bp. This fragment was ligated with the plasmid pMB032 (see example 6), previously digested with EcoRI and SalI, to give the plasmid pEL074 of 8006 bp (FIG. 19). This plasmid allows the insertion of the MCMV-IE / IBDV VP2 cassette into the UL13 site of the HVT virus.

A co-transfection carried out, as described in Example 5, with the plasmid pEL074 and the genomic DNA of the HVT virus led to the isolation and purification of the recombinant vHVT1 1.

Example 8 Construction of the donor plasmid pEL084 and isolation of vHVT12 The 3.9 kbp EcoRI-SalI fragment of the genomic DNA of the MDV virus strain RB1 B containing the MDV gB gene (sequence published by Ross N. et al. J. Gen. Virol. 1989. 70, 1789-1804) was ligated with the vector pUC13, previously digested with EcoRI and SalI, to give the plasmid pCD007. This plasmid was digested with Sac1 and Xhol to isolate the Sac1-Xhol fragment of 2260 bp (central part of the gB gene = fragment A). A PCR was carried out with the following oligonucleotides: CD001 (SEQ ID No. 11)

5 'GACTGGTACCGCGGCCGCATGCACTTTTTAGGCGGAATTG 3' CD002 (SEQ ID N ° 1 2) 5 'TTCGGGACATTTTCGCGG 3' and the matrix pCD007 to produce a PCR fragment of 222 bp. This fragment was digested with Kpnl and Xbal to isolate a Kpnl-Xbal fragment of 190 bp (5 'end of the gB gene = fragment B). Another PCR was carried out with the following oligonucleotides:

CD003 (SEQ ID N ° 1 3) 5 'TATATGGCGTTAGTCTCC 3' CD004 (SEQ ID N ° 14) 5 'TTGCGAGCTCGCGGCCGCTTATTACACAGCATCATCTTCTG 3' and the matrix pCD007 to produce a PCR fragment of 1 95 bp. This fragment was digested with Sac1 and Sacll to isolate the Sacl-Sacll fragment of 1662 bp (3 'end of the gB gene = fragment C). Fragments A, B and C were ligated together with the vector pBS-SK +, previously digested with Kpnl and Sacl, to give the plasmid pCD01 1 of 5485 bp (FIG. 20). Plasmid pCD01 1 was digested with NotI to isolate the NotI-NotI fragment of 2608 bp (whole MDV gB gene). This fragment was ligated with the plasmid pCMVβ, previously digested with NotI and treated with alkaline phosphatase, to give the plasmid pCD020 of 6299 bp (FIG. 21) (In this plasmid, the MDV gB gene replaces the lacZ gene). The plasmid pCD020 was digested with EcoRI and SalI to isolate the EcoRI-SalI fragment of 3648 bp. This fragment was ligated with the plasmid pMB032 (see example 6), previously digested with EcoRI and SalI, to give the plasmid pEL084 of 861 5 bp (FIG. 22). This plasmid allows the insertion of the HCMV-IE / MDV gB expression cassette into the UL13 site of the HVT virus.

A co-transfection carried out, as described in Example 5, with the plasmid pEL084 and the genomic DNA of the HVT virus led to the isolation and the purification of the recombinant vHVT12.

Example 9: Construction of the donor plasmid pEL085 and isolation of vHVT13

The constitution of a DNA bank complementary to the genome of the Newcastle disease virus (NDV), Texas strain, was carried out as described by Taylor J. et al. (J. Virol. 1990. 64. 1441 -1450). A clone pBR322 containing the end of the fusion gene (F), the entire hemagglutinin-neuraminidase (HN) gene and the start of the polymerase gene was identified pHN01. The sequence of the NDV HN gene contained in this clone is presented in FIG. 23 (SEQ ID No. 15). Plasmid pHN01 was digested with Sphl and Xbal to isolate the Sphl-Xbal fragment of 2520 bp. This fragment was ligated with the vector pUC19, previously digested with Sphl and Xbal, to give the plasmid pHN02 of 5192 bp. The plasmid pHN02 was digested with Clal and Pstl to isolate the Clal-Pstl fragment of 700 bp (fragment A). A PCR was carried out with the following oligonucleotides: EL071 (SEQ ID No. 16) 5 'CAGACCAAGCTTCTTAAATCCC 3' EL073 (SEQ ID No. 17) 5 'GTATTCGGGACAATGC 3' and the pHN02 template to produce a PCR fragment of 270 bp. This fragment was digested with Hindlll and Pstl to isolate a Hindlll-Pstl fragment of 220 bp (fragment B). Fragments A and B were ligated together with the vector pBS-SK +, previously digested with ClaI and HindIII, to give the plasmid pEL028 of 3872 bp (FIG. 24). Plasmid pHN02 was digested with Bsphl and ClaI to isolate the Bsphl-ClaI fragment of 425 bp (fragment C). A PCR was carried out with the following oligonucleotides: EL074 (SEQ ID N ° 18) 5 'GTGACATCACTAGCGTCATCC 3' E L 0 7 5 (S E Q I D N ° 1 9) 5 '

CCGCATCATCAGCGGCCGCGATCGGTCATGGACAGT 3 'and the pHN02 template to produce a 425 bp PCR fragment. This fragment was digested with Bsphl and Notl to isolate the Bsphl-Notl fragment of 390 bp (fragment D). Fragments C and D were ligated together with the vector pBS-SK -ι-, previously digested with ClaI and NotI, to give the plasmid pEL029bis of 3727 bp (FIG. 25). Plasmid pEL028 was digested with ClaI and Sacll to isolate the Clal-Sacll fragment of 960 bp (fragment E). The plasmid pEL029bis was digested with ClaI and NotI to isolate the ClaI-NotI fragment of 820 bp (fragment F). Fragments E and F were ligated together with the vector pBS-SK +, previously digested with NotI and Sacll, to give the plasmid pEL030 of 4745 bp (FIG. 26). Plasmid pEL030 was digested with NotI to isolate the 1780 bp NotI-NotI fragment (whole NDV HN gene). This fragment was ligated, in place of the lacZ gene, with the plasmid pCMVβ, previously digested with NotI and treated with alkaline phophatase, to give the plasmid pEL032 of 5471 bp (FIG. 27). The plasmid pEL032 was digested with EcoRI and ClaI to isolate the EcoRI-ClaI fragment of 1636 bp (fragment G). The plasmid pEL032 was digested with ClaI and SalI to isolate the ClaI-SalI fragment of 1,182 bp (fragment H). Fragments G and H were ligated together with the plasmid pMB032 (see example 6), previously digested with EcoRI and SalI, to give the plasmid pEL085 of 7787 bp (FIG. 28). This plasmid allows the insertion of the HCMV-IE / NDV HN expression cassette into the UL13 site of the HVT virus.

A co-transfection carried out, as described in Example 5, with the plasmid pEL084 and the genomic DNA of the HVT virus led to the isolation and purification of the recombinant vHVT13.

Example 10: Construction of the donor plasmid pEL086 and isolation of vHVT14

A clone originating from the DNA library complementary to the genome of the Newcastle disease virus (see example 9) and containing the entire fusion (F) gene was called pNDV81. This plasmid has been described previously and the NDV F gene sequence has been published (Taylor J. et al. J. Virol. 1990. 64. 1441 -1450). The plasmid pNDV81 was digested with Narl and Pstl to isolate the Narl-Pstl fragment of 1870 bp (fragment A). A PCR was carried out with the following oligonucleotides: EL076 (SEQ ID No. 20) 5 'TGACCCTGTCTGGGATGA 3' EL077 (SEQ ID No. 21)

5 'GGATCCCGGTCGACACATTGCGGCCGCAAGATGGGC 3' and the pNDV81 matrix to produce a 160 bp fragment. This fragment was digested with Pstl and SalI to isolate the Pstl-SalI fragment of 130 bp (fragment B). Fragments A and B were ligated together with the vector pBS-SK +, previously digested with ClaI and SalI, to give the plasmid pEL033 of 4846 bp (FIG. 29). Plasmid pEL033 was digested with NotI to isolate the 1935 bp NotI-NotI fragment (whole F gene). This fragment was ligated with the plasmid pCMVβ, previously digested with NotI and treated with alkaline phosphatase, to give the plasmid pEL034 of 5624 bp (the NDV F gene replaced the lacZ gene) (FIG. 30). Plasmid pEL034 was digested with EcoRI and Kpnl to isolate the EcoRI-Kpnl fragment of 866 bp (fragment C). Plasmid pEL032 was digested with Kpnl and SalI to isolate the Kpnl-SalI fragment of 21 14 bp (fragment D). Fragments C and D were ligated together with the plasmid pMB032 (see example 6), previously digested with EcoRI and SalI, to give the plasmid pEL086 of 7940 bp (FIG. 31). This plasmid allows the insertion of the HCMV-IE / NDV F expression cassette into the UL13 site of the HVT virus.

A co-transfection carried out, as described in Example 5, with the plasmid pEL086 and the genomic DNA of the HVT virus led to the isolation and the purification of the recombinant vHVT14.

Example 11: Construction of the donor plasmid pEL087 and isolation of vHVT15

The sequences located upstream of the 1.8 kbp MDV RNA gene are described in Bradley G. et al. (J. Virol. 1989. 63. 2534-2542) (Figure 32 and SEQ ID No. 22). PCR amplification was carried out using DNA extracted from lymphocytes harvested from chickens infected with the MDV RB1 B strain (see example 1) with the following oligonucleotides:

MB047 (SEQ ID N ° 23) 5 'GGTCTACTAGTATTGGACTCTGGTGCGAACGC 3' MB048 (SEQ ID N ° 24) 5 'GTCCAGAATTCGCGAAGAGAGAAGGAACCTC 3' The 163 bp PCR fragment thus obtained was digested with EcoRI and Spel, then ligated with the plasmid pCD2 Example 7), previously digested with EcoRI and Spel, to give the plasmid pBS002 of 6774 bp (FIG. 33). The plasmid pBS002 contains the promoter of the MDV RNA 1 .8 kb gene cloned upstream of the lacZ gene.

A PCR was carried out with the oligonucleotides: MB047 (SEQ ID N ° 23) and MB072 (SEQ ID N ° 25)

5 'GTGTCCTGCAGTCGCGAAGAGAGAAGGAACCTC 3' and the matrix pBS002. The PCR fragment thus obtained was digested with Pstl and Spel to isolate a Pstl-Spel fragment of 200 bp. This fragment was ligated with the plasmid pEL067 (see example 7), previously digested with Pstl and Spel, to give the plasmid pEL069 (FIG. 34). Plasmid pCD007 (see Example 8) was digested with EcoRI and Xbal to isolate the EcoRI-Xbal fragment of 2670 bp (fragment A). The plasmid pCD01 1 (see example 8) was digested with NotI and Xbal to isolate the NotI-Xbal fragment of 180 bp (fragment B). Plasmid pEL069 was digested with NotI and Spel to isolate the NotI-Spel fragment of 180 bp (fragment C). The fragments A, B and C were ligated together with the plasmid pEL067 (see example 7), previously digested with EcoRI and Spel, to give the plasmid pELOδO of 5939 bp (FIG. 35). The plasmid pEL070 (see example 7) was digested with Kpnl and Spel to isolate the Kpnl-Spel fragment of 1345 bp (fragment D). Plasmid pEL070 was also digested with Kpnl and SalI to isolate the Kpnl-SalI fragment of 1658 bp (fragment E). Fragments D and E were ligated together with the plasmid pEL080, previously digested with Sali and Spel, to give the plasmid pEL081 of 8938 bp (FIG. 36). Plasmid pEL081 was digested with EcoRI and SalI to isolate the EcoRI-SalI fragment of 6066 bp. This fragment was ligated with the plasmid pMB032 (see example 6), previously digested with EcoRI and SalI, to finally give the plasmid pEL087 of 1106 bp (FIG. 37). This plasmid makes it possible to insert the double expression cassette VP2 / MCMV-IE // RNA 1.8 kbp / MDV gB into the UL1 3 site of the HVT virus. A co-transfection carried out, as described in Example 5, with the plasmid pEL087 and the genomic DNA of the HVT virus led to the isolation and purification of the recombinant vHVT1 5. Example 12: Construction of the donor plasmid pEL097 and isolation of VHVT23

The plasmid pELOδO (see example 11) was digested with EcoRI and SalI to isolate the EcoRI-SalI fragment of 3040 bp (RNA cassette 1.8 kbp / MDV gB). This fragment was ligated with the plasmid pMB032 (see example 6), previously digested with EcoRI and SalI, to give the plasmid pEL097 of 8037 bp (FIG. 38). This plasmid allows the insertion of the RNA 1 .8 kbp / MDV gB cassette into the UL13 site of the HVT virus.

A co-transfection carried out, as described in Example 5, with the plasmid pEL097 and the genomic DNA of the HVT virus led to the isolation of the recombinant vHVT23.

Example 13 Construction of Donor Plasmids for the Insertion of IBV M and S Expression Cassettes into the UL13 Site of the HVT Virus

According to the same strategy as that described above for the insertion of expression cassettes (genes placed under the control of the HCMV-IE promoters or

MCMV-IE or double promoter MCMV-IE // RNA 1 .8 kpb) in the UL13 site, it is possible to produce recombinant HVT viruses expressing at a high level the membrane (M) or spike (S) proteins of the virus avian infectious bronchitis (IBV). A construction is preferably carried out where the IBV S gene is under the dependence of the HCMV-IE promoter or of the MCMV-IE promoter, or else a construction where the IBV M and IBV S genes are inserted together with the double MCMV-IE / promoter 1.8 kbp RNA in the UL13 site, the M gene being under the control of the 0.8 kbp RNA promoter and the S gene being under the control of the MCMV-IE promoter. In this configuration, the 1.8 kbp RNA promoter is activated by the activator region of the MCMV-IE promoter.

Example 14: Preparation of a vaccine according to the invention

The preparation of the vaccines obtained according to the invention can be done for any usual technique known to those skilled in the art, for example by culture in a roller bottle. Rolling vials (175cm ² ), seeded with 200.10 ⁶ primary cells of chicken embryo, are inoculated after 24 hours of incubation at 37 ° C. with 1 ml of a viral solution of recombinant HVT virus having a titre of 10 ⁵ pfu / ml. After a 4-day incubation at 37 ° C, the supernatant is removed, the cells are dissociated with a solution of trypsin versene, then harvested. The infected cells are then centrifuged. The supernatant is removed and the cells are taken up in 20 ml of a solution containing a stabilizer for lyophilization (for example SPGA). This mixture is then sonicated, distributed in bottles at the rate of fractions of 1 ml, and finally lyophilized.

Claims

1 - Live recombinant avian vaccine comprising, as a vector, a Marek's disease virus, comprising at least one nucleotide sequence coding for, and expressing, an antigenic polypeptide of an avian pathogenic agent, inserted into the UL13 gene under the control of promoter CMV immediate early.

2 - Live recombinant avian vaccine according to claim 1, characterized in that the vector is the HVT virus.

3 - Live recombinant avian vaccine according to claim 1 or

2, characterized in that the nucleotide sequence is inserted into the UL13 gene after partial deletion of this gene.

4 - Avian recombinant live vaccine according to any one of claims 1 to 3, characterized in that the immediate early CMV promoter is the human promoter HCMV IE or the murine promoter MCMV IE.

5 - Avian recombinant live vaccine according to any one of claims 1 to 4, characterized in that the nucleotide sequence inserted into the UL13 gene under the control of the immediate early CMV promoter is a nucleotide sequence coding for an antigen chosen from the group antigens from Gumboro disease, Marek's disease, Newcastle disease, infectious bronchitis, infectious laryngotracheitis and avian anemia.

6 - Avian recombinant live vaccine according to any one of claims 1 to 5, characterized in that the nucleotide sequence inserted into the UL13 gene under the control of the immediate early CMV promoter is a nucleotide sequence encoding the VP2 polypeptide of the IBDV virus.

7 - Avian recombinant live vaccine according to any one of claims 1 to 6, characterized in that it comprises, associated with the immediate early CMV promoter in head-to-tail arrangement with the latter, another promoter, two nucleotide sequences being inserted into the UL13 gene, one dependent on the immediate early CMV promoter, the other dependent on the associated promoter.

δ - Live avian recombinant vaccine according to claim 7, characterized in that the associated promoter and the promoter Marek RNA1 .8.

9 - Live avian recombinant vaccine according to claim 7 or

8, characterized in that the nucleotide sequence inserted under the control of the immediate early CMV promoter is a nucleotide sequence coding for the polypeptide VP2 of the IBDV virus and in that the nucleotide sequence inserted under the control of the associated promoter is a nucleotide sequence coding for an antigen from another avian disease.

10 - Avian recombinant live vaccine according to claim 9, characterized in that the nucleotide sequence coding for an antigen of another avian disease is chosen from the group of antigens of Marek's disease, Newcastle disease, bronchitis infectious disease, infectious laryngotracheitis and avian anemia.

1 1 - Live avian recombinant vaccine according to claim 7, characterized in that the associated promoter is an immediate early CMV promoter of different origin.

1 2 - Avian recombinant live vaccine according to any one of claims 1 to 1 1, characterized in that the nucleotide sequence (s) inserted into the UL1 3 gene are chosen from the group of sequences encoding for genes:

- VP2, VP3 and VP2 + VP4 + VP3 of the Gumboro disease virus,

- gB, gC, gD and gH + gL of Marek's disease viruses,

- VP1 (52 kDa) + VP2 (24 kDa) of the avian anemia virus, - S and M of the infectious bronchitis virus, and

- gB, gC, gD and gH + gL of the infectious laryngotracheitis virus.

13 - Avian recombinant live vaccine according to one of claims 1 to 5, characterized in that, instead of the immediate early CMV promoter, the RNA1.8 promoter is used.

14 - Multivalent vaccine formula comprising, as a mixture or as a mixture, at least two live recombinant avian vaccines as defined in any one of claims 1 to 13, these vaccines comprising different inserted sequences.

15 - Multivalent vaccine formula according to claim 14, characterized in that the different inserted nucleotide sequences come from different pathogens.