EP0914458A1

EP0914458A1 - Living recombinant avian vaccine, using as a vector the infectious avian laryngotracheitis virus

Info

Publication number: EP0914458A1
Application number: EP97930591A
Authority: EP
Inventors: Jean-Christophe Audonnet; Michel Bublot; Michel Riviere
Original assignee: Merial SAS
Current assignee: Boehringer Ingelheim Animal Health France SAS
Priority date: 1996-06-27
Filing date: 1997-06-25
Publication date: 1999-05-12
Also published as: JP2000512844A; AU739374B2; ID18351A; PE52599A1; ZA975618B; FR2750866A1; TNSN97109A1; AR008620A1; WO1997049826A1; MA24222A1; AU3448797A; CO4700303A1; FR2750866B1; US6153199A

Abstract

The living recombinant avian vaccine comprises, as a vector, an ILTV virus comprising and expressing at least one heterologous nucleotide sequence, this nucleotide sequence being inserted in the insertion locus defined between the nucleotides 1624 and 3606 at the SEQ ID NO: 5. The vaccine may in particular comprise a sequence coding for an antigen of an avian pathogenic agent selected among the group consisting of the Newcastle disease virus (NDV), the infections bursal virus (IBDV), the Marek disease virus (MDV), the infectious bronchitis virus (IBV), the chicken anaemia virus (CAV), the chicken pneumovirosis virus, preferably under the control of a strong eukariotic promoter. A multivalent vaccine formula is also disclosed.

Description

Avian recombinant live vaccine, using avian infectious laryngotracheitis virus as a vector.

The present invention relates to vaccines for avian use based on infectious laryngotracheitis virus (ILTV), into which has been inserted, by genetic recombination, at least one heterologous nucleotide sequence, in particular coding for and expressing an antigenic polypeptide of an avian pathogen, under conditions ensuring immunization leading to effective protection of the animal vaccinated against said pathogen.

Infectious laryngotracheitis virus (ILTV) is an alphaherpesvirus (B Roizman, Arch. Virol. 1992. 123. 425-449) which causes an important respiratory pathology (infectious laryngotracheitis or ILT) in chicken (LE Hanson and TJ Bagust , Diseases ofPoυltry9th edn 1991. pp 485-495. Ames, lowa State University Press). The vaccines currently available against this disease contain an attenuated strain which can be administered by various routes, including the intranasal, conjunctival, cloacal routes, in drinking water and by aerosol (LE Hanson and TJ Bagust, Diseases of Poultry 9th Edition 1991.pp 485- 495. Ames, lowa State University Press).

Molecular biology studies of the ILTV virus have made it possible to characterize the viral genome (MA Johnson et al., Arch. Virol 1991. 119. 181-198) and to identify some virus genes (AM Griffin, J. Gen. Virol. 1989. 70. 3085-3089) including the genes coding for thymidine kinase (UL23) (AM Griffin and MEG Boursnell, J. Gen. Virol. 1990. 71. 841-850; CL Keeler er a /., Avian Dis. 1991. 35. 920-929), glycoprotein gB (UL27) (AM Griffin, J. Gen. Virol. 1991. 72. 393-398; K. Kongsuwan et al., Virology 1991. 184. 404-410; DJ Poulsen et al., Virus Genes

1991. 5. 335-347), the glycoprotein gC (UL44) (DH Kingsley et al., Virology 1994. 203. 336-343), the capsid protein p40 (UL26) (AM Griffin, Nucl. Acids Res. 1990 18. 3664), the protein homologous to the protein ICP4 of herpes simplex (HSV-1) (MA Johnson et al., Virus Research 1995. 35. 193-204), the proteins homologous to the proteins ICP27 (UL54) , HSV-1 gK glycoprotein (UL53) and DNA helicase (UL52) (MA Johnson et al., Arch. Virol. 1995. 140. 623-634), ribonucleotide reductase (AM Griffin, J. Gen. Virol 1989. 70. 3085-3089, WO-A- 90/02802), the genes present in the unique short genome sequence (U _s ) (MA Johnson et al., DNA Sequence- The Journal of Sequencing and Mapping 1995. Vol. 5 pp191-194; K. Kongsuwan et al., Arch. Virol. 1995. 140. 27-39; K.

Kongsuwan et al., Virus Research 1993. 29. 125-140; K. Kongsuwan et al., Gene Virus 1993. 7. 297-303; WO-A-92/03554; WO-A-95/08622).

The aim of the present invention is to develop an avian vaccine based on a recombinant ILTV virus expressing a heterologous gene, this virus being capable of replicating and of inducing immunity in the vaccinated host while retaining good safety.

Another objective of the invention is to propose such a vaccine which is at the same time particularly effective against infectious laryngotracheitis (ILT).

Another objective of the invention is to propose such a vaccine which can be used in mass vaccination by mucosal route, for example by aerosol route or in drinking water, in such a way that the replication of the virus at the mucosal level allows to induce mucosal and systemic immunity. Such mucosal immunity will be particularly effective in combating respiratory diseases, as well as against other diseases for which the pathway of the pathogen is mucosal. Another object of the invention is to provide such a vaccine which can be used both in adults and in young animals

A specific objective is to propose such a vaccine usable in mass vaccination by mucosal route of very young animals such as day-old chicks

Another objective of the invention is to provide a vaccine against the ILT which has an increased efficacy compared to the parental strain and which may even possibly allow the insertion and expression of a heterologous gene.

In the course of their work on the ILTV virus, the inventors have found a genomic region which has proved to be entirely suitable as a site for insertion of heterologous genes. This has made it possible to develop a recombinant live vaccine based on a ILTV vector in which is inserted at least one sequence coding for an avian immunogen, in particular the HN and F proteins of Newcastle disease virus (NDV), and / or the glycoprotein gB of Marek's disease virus (MDV) , and / or the VP2 protein of the Gumboro disease virus (IBDV), and / or the proteins S and M of the infectious bronchitis virus (IBV) Such a vaccine incorporating a sequence coding for proteins of NDV, of MDV and IBV provides satisfactory protection of animals against Newcastle disease, Marek's disease, Gumboro disease, and infectious bronchitis respectively.

The present invention therefore relates to a live recombinant avian vaccine comprising, as a vector, the ILTV virus comprising at least one heterologous nucleotide sequence, in particular coding for and expressing, an antigenic polypeptide of an avian pathogenic agent, inserted into the locus d insertion which, in a particular ILTV strain, is defined between nucleotides 1624 and 3606 in the sequence SEQ ID NO 5.

By heterologous sequence is meant a sequence which does not originate from this insertion locus, that is to say both a sequence not originating from the ILTV virus, and a sequence originating from another region. genomics of this virus By insertion into the insertion region is understood in particular to mean simple insertion or after total or partial deletion of the insertion locus.

An open reading frame (COL B) appearing between nucleotides 1713 and 2897 at SEQ ID NO: 5, and an intergenic region (between nucleotides 2898 and 3606) between COL B and COL has been determined in this insertion locus. C. It is therefore possible to insert both in COL B or in the intergenic region, as well as straddling these two regions. One or more expression cassettes can be inserted, each comprising at least one sequence to be expressed.

To express the inserted sequence, it is preferred to use a strong eukaryotic promoter such as the immediate early CMV promoter (IE), the Rous sarcoma virus LTR (RSV), and the early promoter of the SV40 virus.

By immediate early CMV promoter (IE) is meant the fragment given in the examples as well as its subfragments retaining the same promoter activity.

The CMV IE promoter can be the human promoter (HCMV IE) or the murine promoter (MCMV IE), or else a CMV IE promoter from another origin, for example from monkeys, rats, guinea pigs or pigs.

The nucleotide sequence inserted into the ILTV vector to be expressed can be any sequence coding for an antigenic polypeptide, of an avian pathogenic agent, capable, once expressed under the favorable conditions provided by the invention, of ensuring immunization leading to effective protection of the animal vaccinated against the pathogen. It is therefore possible to insert, under the conditions of the invention, the nudeotide sequences coding for the antigens of interest for a given disease.

This nucleotide sequence inserted into the ILTV vector can also code for an immunomodulatory polypeptide, and in particular a cytokine.

Remarkably, the vaccines according to the invention can be used for vaccination in ovo, day-old chicks or more and adults. Different routes of administration may be used: the parenteral route, or the mucosal routes such as oroπasale (drinking water, aerosol), conjunctival (drop in the eye) or cloacal, with a preference for the routes allowing a mucosal vaccination of mass (drinking water, aerosol). The invention proves to be particularly useful both for protection against respiratory pathologies and against systemic pathologies by blocking the natural pathways of entry of the pathogenic agent.

The invention can in particular be used for the insertion of a nucleotide sequence coding suitably for an antigenic protein of the NDV virus and in particular, the glycoprotein HN or the glycoprotein F One thus obtains a recombinant live vaccine ensuring, in addition to a protection against infectious laryngotracheitis, satisfactory protection against Newcastle disease

The recombinant Newcastle disease vaccine will preferably contain 10 to 10 ⁴ PFU / dose

Other preferred cases of the invention are the insertion of nudeotide sequences coding for antigens of other avian pathogens, and in particular, but not limited to, antigens of the Marek's disease virus, in particular gB genes , gD, and gH + gL (WO-A-90/02803), from the Gumboro disease virus, in particular the VP2 gene, from the infectious bronchitis virus

(IBV), in particular S and M genes (M. Binns et al., J Gen Virol 1985 66 719-726

M Boursnell et al, Virus Research 1984 1 303-313), chicken anemia virus (CAV), in particular VP1 (52 kDa) + VP2 (24 kDa) (N H M. Noteborn et al,

J Virol 1991 65 3131-3139), of the ILTV virus, in particular the genes coding for gB (AM Gnffin, J Gen Virol. 1991 72. 393-398), or for gD (MA Johnson et al, DNA Sequence-The Journal of Sequencmg and Mappmg 1995 Vol. 5 pp 191 - 194 Harwood Academy Publishers GmbH), or for gp60 (K K. Kongsuwan et al, Genes Virus 1993. 7 297-303), and infectious head swelling syndrome virus ("swollen head syndrome" or chicken pneumovirus or turkey rhinotracheitis virus (TRTV) from turkey; pneumovirus), in particular the fusion glycoprotein F (Q Yu et al., J Gen Virol 1991. 72. 75-81), or the attachment glycoprotein G (R ϋng et al., J Gen Virol. 1992. 73. 1709-1715, K. Juhasz and J. Easton, J Gen Virol 1994 75. 2873-2880) The doses will preferably be the same as those for the Newcastle vaccine In the context of the present invention, it is of course possible to insert more than one heterologous sequence into the same ILTV virus, in particular in this locus 7/49826 PC17FR97 / 01138

In particular, it is possible to insert sequences therefrom from the same virus or from different viruses, which also includes the insertion of sequences from ILTV and from another avian virus. It is also possible to associate therewith sequences coding for immunomodulators, and in particular cytokines. For example, the promoter CMV IE is associated with another promoter so that their 5 'ends are adjacent (which implies transcriptions in opposite directions), which makes it possible to insert, into the insertion zone, two nudeotide sequences , one under the control of the CMV IE promoter, the other under that of the associated promoter. This construction is remarkable by the fact that the presence of the CMV IE promoter, and in particular of its activating part (enhancer), activates the transcription induced by the associated promoter. The associated promoter may in particular be a promoter of a gene from the ILTV virus or from the MDV or HVT virus.

An interesting case of the invention is a vaccine comprising a nucleotide sequence coding for NDV HN and a nucleotide sequence coding for NDV F or an antigen of another avian disease, in particular those mentioned above, one of the genes being under the control of the CMV IE promoter, and the other under the control of the associated promoter.

It is also possible to mount two CMV IE promoters of different origins with their adjacent 5 ′ ends. Of course, the heterologous sequences and their associated promoters can be inserted more conventionally in tandem in the insertion locus, that is to say in the same direction of transcription.

The expression of several heterologous genes inserted into the insertion locus may also be possible by insertion of a sequence called "IRES" (Internai Ribosome Entry Site) originating in particular from a picornavirus such as the virus of swine vesicular disease. (swine vesicular disease virus, SVDV; B.-F. Chen et al., J. Virology, 1993, 67, 2142-2148), encephalomyocarditis virus (EMCV; RJ Kaufman er al., Nucleic Acids Research, 1991, 19, 4485-4490), the foot-and-mouth disease virus (FMDV; N. Luz and E. Beck, J. Virology, 1991, 65, 6486-6494), or of another origin. The content of these three articles is incorporated by reference. The expression cassette for two genes would therefore have the following minimum structure: promoter - gene 1 - IRES - gene 2 - polyadenylation signal. The recombinant live vaccine according to the invention may therefore comprise, inserted into the insertion locus, an expression cassette successively comprising a promoter, two or more genes separated in pairs by an IRES, and a polyadenylation signal.

In addition to insertion into the locus according to the invention, one or more other insertions, one or more mutations, or one or more deletions can be made elsewhere in the genome; if the parental strain is virulent, it is possible, for example, to disable (by deletion, insertion or mutation) genes involved in virulence such as the thymidine kinase gene, the ribonucleotide reductase gene, the gE gene, etc. In all cases, insertion into another locus than that described in the invention makes it possible to express other genes.

The present invention also relates to a vaccine against ILT comprising a recombinant ILTV virus into which have been inserted upstream genes coding for major immunogens of ILTV, preferably the genes coding for gB (AM Griffin, J. Gen. Virol. 1991. 72. 393-398), or for gD (MA Johnson et al., DNA Sequence-The Journal of Sequencing and Mapping 1995. Vol. 5. pp191-194. Harwood Academy Publishers GmbH), or for gp60 (KK Kongsuwan et al., Virus Genes 1993, 7, 297-303), an exogenous promoter, in particular a strong promoter as described above. This increases the level of expression of one or more of these genes and thus leads to a vaccine with increased efficacy against ILT. One can of course combine this with a construction as described above comprising the insertion of a heterologous sequence into the insertion locus.

The present invention also relates to a multivalent vaccine formula, comprising, as a mixture or to be mixed, a vaccine as defined above with another vaccine, and in particular another live recombinant avian vaccine as defined above, these vaccines comprising different inserted sequences, in particular of different pathogens.

The present invention also relates to a method for preparing the vaccines according to the invention, as it emerges from the description.

The present invention also relates to a method of avian vaccination The present invention also relates to a method of avian vaccination comprising the administration of a live recombinant vaccine or of a multivalent vaccine formula as defined above. It relates in particular to such a method for vaccination in ovo, day-old chicks or more and adults. Different routes of administration of the vaccine can be used (see above) with a preference for the routes allowing mass vaccination by mucosal route (aerosol, drinking water), the dose of vaccine being preferably chosen between 10 ¹ and 10 ⁴ per animal.

The present invention also relates to an ILTV virus comprising at least one heterologous nucleotide sequence as described above inserted into the insertion locus as defined above.

The subject of the invention is also a DNA fragment consisting of all or part of the sequence between nucleotides 1 and 3841 of SEQ ID NO: 5.

The invention will now be described in more detail with the aid of nonlimiting exemplary embodiments, taken with reference to the drawing, in which:

Figure 1 Restriction map, position of cloned fragments and position of

COLS

Figure 2 Sequence of 3841 bp and translation of COLs A, B and C Figure 3 Scheme for obtaining the plasmid pMB035 Figure 4 Scheme for obtaining the plasmid pMB039 Figure 5 Scheme for obtaining the plasmid pMB042 Figure 6 Scheme for obtaining the plasmid pEL024 Figure 7 Diagram for obtaining the plasmid pEL027 Figure 8 Diagram for the plasmid pMB043 Figure 9 Diagram for obtaining the plasmid pCD009 Figure 10 Diagram for obtaining the plasmid pEL070 Figure 11 Diagram for the plasmid pMB044 Figure 12 Diagram for the plasmid pMB045 Figure 13 Diagram for the plasmid plasmid pMB046 Figure 14 NDV HN gene sequence Figure 15 Diagram for obtaining the plasmid pEL030 Figure 16 Diagram for the plasmid pMB047 Figure 17 Diagram for the plasmid pEL033 Figure 18 Diagram for the plasmid pMB048 Figure 19 Diagram for double expression cassette Figure 20 Diagram for the plasmid pCD011 Figure 21 Diagram of the plasmid pMB049

List of sequences

SEQ ID NO: 1 Oligonucleotide EL207

SEQ ID NO: 2 Oligonucleotide EL208 SEQ ID NO: 3 Oligonucleotide LP018 SEQ ID NO: 4 Oligonucleotide LP020 SEQ ID NO: 5 Sequence of the Sall-BamHI fragment fragment (3841 bp; see Figure 2)

SEQ ID NO: 6 Oligonucleotide MB088 SEQ ID NO: 7 Oligonucleotide MB089 SEQ ID NO: 8 Oligonucleotide MB090 SEQ ID NO: 9 Oligonucleotide MB091 SEQ ID NO: 10 Oligonucleotide MB092

SEQ ID NO: 11 Oligonucleotide MB093 SEQ ID NO: 12 Oligonucleotide MB070 SEQ ID NO: 13 Oligonucleotide MB071 SEQ ID NO: 14 HN gene sequence of NDV (see Figure 14) SEQ ID NO: 15 Oligonucleotide EL071

SEQ ID NO: 16 Oligonucleotide EL073 SEQ ID NO: 17 Oligonucleotide EL074 SEQ ID NO: 18 Oligonucleotide EL075 SEQ ID NO: 19 Oligonucleotide EL076 SEQ ID NO: 20 Oligonucleotide EL077 SEQ ID NO: 21 Oligonucleotide CD001 SEQ ID NO: 22 Oligonucleotide CD002 SEQ ID NO: 23 Oligonucleotide CD003 SEQ ID NO: 24 Oligonucleotide CD004

EXAMPLES

All the plasmid constructions were carried out using the standard molecular biology techniques described by Sambrook J. et al. (Molecular Clonmg: A Laboratory Manuel. T * Edition. Cold Spring Harbor Laboratory Cold Spring Harbor. New York. 1989). All the restriction fragments used for the present invention were isolated using the "Geneclean" kit (BIO101 Inc. La Jolla, CA).

The virus used as parental virus can be chosen from the vaccine strains described in J.R. Andreasen et al. (Avian Diseases 1990. 34. 646-656) or strain T-20 12-8-66 from Select laboratories 10026 Main Street P.O Box 6 Berlin, Maryland 21811, USA. Virulent strains such as N-71851 (ATCC VR-783) or USDA strain 83-2 can also be used, which can be attenuated by known techniques, for example that described in WO-A -95/08622.

Example 1: Culture of the ILTV virus:

The ILTV virus is cultured on primary chicken kidney cells (CRP); these cells are cultured in MEM medium supplemented with 3% fetal calf serum (SVF) in culture flasks of 75 cm ² (2 10 ^s cells / cm ² ) one or two days before inoculation. On the day of inoculation, a vial of 1000 doses of lyophilized vaccine is resuspended in 10 ml of MEM medium supplemented with 1% of FCS, approximately 0.5 ml of this solution is then deposited on the CRP culture. The next day, the medium is changed, and the day after, when the cytopathogenic effect (ECP) becomes general, the culture flasks are frozen at -70 ° C. The culture of the ILTV virus can also be done on immortalized chicken liver cells, and in particular on the LMH line (WM Schnitziein et al, Avian Diseases 1994 38. 211-217)

EXAMPLE 2 Preparation of the Genomic DNA of ILTV

After 2 freeze / thaw cycles, the culture of ILTV (2 flasks of 75 cm ² ) is harvested and centrifuged at low speed (5000 rpm in a rotor 20, Beckman JA21 centrifuge, for 5 minutes) to remove large cellular debris. The supernatant is then ultracentrifuged (100,000 rpm TLA100.3 rotor, Beckman TL100 centrifuge, for 1 hour). The pellet is then taken up in 1.6 ml of TEN-SDS (Tris pH 8.0 10 mM; EDTA 1 mM; NaCl 0.5 M; sodium dodecyl sulfate 0.5%), and 35 μl of a proteinase K solution at 20 mg / ml are then added; the solution is incubated 3 to 4 hours in a water bath at 37 ° C, and the DNA is then extracted 3 times with phenol / chloroform and 1 time with chloroform, then it is precipitated with ethanol at -20 ° C After centrifugation , the pellet is rinsed with 70% ethanol, dried and resuspended in 200 μl TE (Tris pH8.0 10mM; EDTA 1mM). The nucleic acid concentration is then assayed with a spedrophotometer (DO ₂₆₀ ). This DNA solution can directly serve as a template for polymerase chain readion (PCR) experiments; similarly, it can also be used in transfusion experiments for obtaining a recombinant virus.

Example 3: Isolation and purification of recombinant ILTV virus The donor plasmid composed of an expression cassette for a polypeptide inserted between two flanking regions of the insertion locus is digested with a restriction enzyme allowing linearization of the plasmid, then it is extracted with a phenol / chloroform mixture, precipitated with absolute ethanol, and taken up in sterile water. 24 hour primary CRP cells are then transfected with the mixture following: 0.2 to 1 μg of linearized donor plasmid + 2 to 5 μg of ILTV viral DNA (prepared as in Example 2) in 300 μl of OptiMEM medium (Gibco BRL Cat # 041-01985H) and 100 μg of LipofectAMINE diluted in 300 μl of medium (final volume of the mixture = 600 μl). These 600 μl are then diluted in 3 ml (final volume) of medium and spread on 5.10 ^e CRP. The mixture is left in contact with the cells for 5 hours, then eliminated and replaced with 5 ml of culture medium. The cells are then left in culture for 3 to 8 days at + 37 ° C., then, when the cytopathogenic effect has appeared, they are frozen at -70 ° C. After thawing and possibly sonication, this viral population is cloned in limiting dilution in microplates (96 wells) in order to isolate a homogeneous population of recombinant virus. These plates are left in culture for 1 to 3 days, then the supernatant is collected in an empty 96-well plate and the plate containing the supernatants is placed at 4 ° C. or at -70 ° C. The cells remaining in the other plates are then fixed with 95% acetone for 20 to 30 minutes at -20 ° C, or for 5 minutes at room temperature. An indirect immunofluorescence reaction (IFI) is carried out with a monoclonal antibody directed against the expressed polypeptide to find the plaques expressing this polypeptide. A new cloning is then carried out in the same way (in dilution limit in 96-well plates) from the supernatant present in the wells of the plates set at 4 ° C. or at -70 ° C. and corresponding to the wells having positive plaques in IFI . In general, 4 successive isolation cycles (limiting dilution, harvesting of the supernatant, control of the cells by IFI, limiting dilution from the supernatant, etc.) are sufficient to obtain recombinant viruses whose entire progeny exhibit specific fluorescence. The genomic DNA of these recombinant viruses is characterized at the molecular level by standard PCR and Southern blot techniques using the appropriate oligonucleotides and DNA probes.

The isolation of recombinant virus can also be done by hybridization with a specific probe of the inserted expression cassette. For this, the viral population harvested after transfection is diluted and deposited on CRP cells (cultivated in a petri dish) so as to obtain isolated plaques. After 1 hour contact at 37 ° C, the infection medium is removed and replaced with 5 ml of 1% MEM medium of agarose, maintained in supercooled at 42 ° C. When the agarose is solidified, the dishes are incubated for 48 to 72 hours at 37 ° C. in a C0 ₂ oven until the appearance of plaques. The agarose layer is then eliminated and a transfer of the viral ranges is carried out on a sterile nitrocellulose membrane of the same diameter as the petri dish used for the culture. This membrane is itself transferred to another nitrocellulose membrane so as to obtain an inverted "copy" of the first transfer. The plaques transferred to this last copy are then hybridized, according to the usual techniques known to those skilled in the art, with a DNA fragment of the expression cassette labeled with digoxigenin (DNA Labeling Kit, Boehringer Mannheim, CAT # 1175033). After hybridization, washing and contact with the development substrate, the nitrocellulose membrane is brought into contact with an autoradiographic film. The positive hybridization images on this membrane indicate which plaques contain recombinant ILTV viruses which have inserted the expression cassette. The plaques corresponding to these positive plaques are cut sterile on the first nitrocellulose membrane, placed in an Eppendorf tube containing 0.5 ml of MEM medium and sonicated to release the virions from the membrane. The medium contained in the Eppendorf tube is then diluted in MEM medium and the dilutions thus obtained are used to infeder new cultures of CRP cells.

EXAMPLE 4 Amplification of a Genomic Region of the ILTV

The oligonucleotides EL207 (SEQ ID NO: 1) and EL208 (SEQ ID NO: 2) served as primers for a first polymerase chain reaction (PCR).

EL207 (SEQ ID NO: 1): 5 'AAGTATACTCGAAACTAGCGCAGTACTCTG 3' EL208 (SEQ JD NO: 2): 5 'AGATGCGATACCA I I I I I ACTGCCATTTGG 3'

The first PCR was performed in the presence of the oligonucleotides EL207 and EL208, PCR buffer, dNTP, DNA ILTV, Taq polymerase, and an anti-Taq antibody (TaqStart ™ Antibody, Clontech Lab., Palo Alto, CA, USA) to restrict non-specific amplifications. 35 cycles were run (30 seconds at 94 ° C, 30 seconds at 60 ° C and 8 minutes at 72 ° C) The gelation of an aliquot of the reaction product with eledrophoresis made it possible to detect an amplified DNA band of approximately 7 kb

A second PCR carried out with the oligonucleotides LP018 (SEQ ID NO: 3) (position 2677 to 2696 on the sequence SEQ ID NO: 5) and LP020 (SEQ ID NO 4) made it possible to amplify a fragment of 1190 bp.

LP018 (SEQ IDNO.3) 5'TCGTGTCTCTGCTATCACTG 3 'LP020 (SEQ ID NO4) 5'AGCTCTCCATGGATCTAGCG 3'

Example 5 Cloning and Characterization of this Genomic Region of ILTV The product of the first gene amplification reaction was purified by phenol / chloroform extraction, and then digested with the restriction enzymes EcoRI and Sacl for 2 hours at 37 ° C The restπdion enzymes were then inactivated by heating the tubes at 65 ° C for 20 minutes. The fragments resulting from this digestion were then ligated (overnight at 14 ° C) with the plasmid pBlueScπptll SK + (pBS SK +, Stratagene) digested with EcoRI and Sacl, the analysis of the clones obtained after transformation of E. coli DH5α bacteria and culture on dishes of medium supplemented with ampiαline made it possible to identify 3 EcoRI-Sacl mserts of different size present in 3 different plasmids: a fragment of approximately 0.6 kb (plasmid pLPOOl), 2.8 kb (plasmid pLP002) and 1.8 kb (plasmid pLP003)

The amplification product of the second PCR reaction was purified as above, digested with the enzymes EcoRI and BamHI and cloned in the plasmid pBS SK + previously digested with EcoRI and BamHI to obtain the clone pLP011. The partial sequencing of the insert present in pLP002 (on the right of the Sa / I site, see figure 1) and complete of that present in pLP003 and in pLP011 made it possible to highlight two open open frames of measurement (COLs) complete (COL A and COL B), and the N-terminal part of another COL (COL C). The restriction map of this cloned genomic region and of the sequenced region, as well as the position on this map of the inserts of the clones pLP001, pLP002, pLP003 and pLP011 are shown at Figure 1; the sequence of 3841 bp (SEQ ID NO: 5) is shown in FIG. 2. The position and the amino acid sequence of the COLs A, B and C are also shown in FIGS. 1 and 2 respectively.

The sequence between the COL A STOP codon (position 1624 on SEQ ID NO: 5) and the COL C ATG codon (position 3606 on SEQ ID NO: 5), comprising in particular COL B, followed by the intergenic region between the COLs B and C can be used to insert polypeptide expression cassettes into the ILTV genome. This sequence is called the insertion locus. The insertion can be done with or without deletion in the COL B (see example 6) or in the intergenic region (see example 7); the deletion can also cover all or part of the COL B and all or part of the intergenic region (see example 8).

Example 6: Construction of the donor plasmid pMB035 for insertion into the COL B

Plasmid pLP003 (4665 bp) was digested with the enzymes EcoRI and Xho \; this digested plasmid was then treated with DNA polymerase (Klenow fragment) in the presence of dNTP to make the ends blunt; after ligation and transformation of E. coli bacteria, the clone pMB034 (4636 bp) was obtained; this cloning step made it possible to delete the cloning sites between EcoRI and Xho \ in the plasmid pLP003. The plasmid pMB034 was then digested with the enzymes H / ndlll and Sph \; the 4.0 kbp fragment was then eluted and ligated to the oligonucleotides MB088 (SEQ ID NO: 6) and MB089 (SEQ ID NO: 7) previously hybridized. The plasmid pMB035 (3990 bp) was thus obtained after transformation of E. coli bacteria (see diagram for obtaining pMB035 in FIG. 3).

MB088 (SEQ ID NO: 6): 5 'AGCTGAATTCAAGCTTCCCGGGGTCGACATG 3'

MB089 (SEQ ID NO: 7): 5 'TCGACCCCGGGAAGCTTGAATTC 3 "

This plasmid pMB035 therefore contains: (1) a 5 ′ homologous sequence of COL B, (2) an inserted oligonucleotide sequence containing the unique EcoRI sites, Sma \, H / πdlll and Sa / 1, and (3) a 3 ′ homologous sequence of COL B. This plasmid therefore makes it possible to introduce an expression cassette into the unique sites cited in (2) placed between the 2 flanking regions (1) and (3). The recombinant ILTV viruses obtained will have a deletion in the COL B (between the Hind \\\ and Sph \ sites; amino acids 56 to 279 of the deleted COL B).

Example 7: Construction of the donor plasmid DMB039 for insertion into the intergenic region between the COLs B and C

The plasmid pLP011 (3883 bp) was digested with the enzymes EcoRI and H / πdlll and ligated to the restriction fragment of 1021 bp obtained by digestion of the plasmid pLP003 (4665 bp) with the enzymes EcoRI and / - // πdlll; the plasmid thus obtained (pMB036) has a size of 4892 bp. The plasmid pMB036 was digested with the enzymes H / πdlll and Apa \\ the digested plasmid was then treated with DNA polymerase (Klenow fragment) in the presence of dNTP to make the ends blunt; after ligation and transformation of E. coli baderies, the clone pMB037 (4862 bp) was obtained; this cloning step made it possible to delete the cloning sites between H / πdlll and Apal in the plasmid pMB036.

The plasmid pMB037 was digested with the enzymes Noti and fîamHI; the digested plasmid was then treated with DNA polymerase (Klenow fragment) in the presence of dNTP to make the ends blunt; after ligation and transformation of E. coli bacteria, the clone pMB038 (bp) was obtained; this cloning step made it possible to delete the cloning sites between NotI and BamHI in the plasmid pMB037. The plasmid pMB038 was then digested with the enzymes Sg / ll and EcoRI; the 4.5 kbp fragment was then eluted and ligated to the oligonucleotides MB090 (SEQ ID NO: 8) and MB091 (SEQ ID NO: 9) previously hybridized. The plasmid pMB039 (bp) was thus obtained after transformation of E. coli bacteria (see diagram for obtaining pMB039 in FIG. 4).

MB090 (SEQ ID NO: 8): 5 'GATCGTCGACCCCGGGAAGCTTG 3' MB091 (SEQ ID NO: 9): 5 'AATTCAAGCTTCCCGGGGTCGAC 3' This plasmid pMB039 therefore contains (1) a 5 ′ homologous sequence in COL B, (2) an inserted oligonucleotide sequence containing the unique sites EcoRI, Smal, H / πdlll and Sa / I, and (3) a homologous sequence in 3 ′ of the intergenic region between COLs B and C This plasmid therefore makes it possible to introduce an expression cassette into the unique sites mentioned in (2) placed between the 2 flanking regions (1) and (3). The recombinant ILTV viruses obtained will have a deletion of 344 bp in the intergenic region between the COLs B and C (between the EcoRI and ^β g / ll sites).

Example 8 Construction of the donor plasmid pMB042 for insertion into the genomic region straddling COL B and the intergenic region between COLs B and C

The 940 bp fragment obtained by digestion of the plasmid pLP011 (3883 bp) with the enzymes Sa / πHI and EcoRI, and the 1754 bp fragment obtained by digestion of the plasmid pLP003 (4665 bp) with the enzymes EcoRI and Sacl, were ligated plasmid pBS SK + digested with the enzymes SamHI and Sacl; the plasmid thus obtained (pMB040) has a size of 5623 bp. The plasmid pMB039 was digested with the enzymes BamH \ and Xπol; the digested plasmid was then treated with DNA polymerase (Klenow fragment) in the presence of dNTP to make the ends blunt; after ligation and transformation of E. coli bacteria, the clone pMB041 (5576 bp) was obtained; this cloning step made it possible to delete the cloning sites between BamHI and Xπol in the plasmid pMB040.

The plasmid pMB041 was then digested with the enzymes HindlW and Bgl \\; the 4.2 kbp fragment was then eluted and ligated to the oligonucleotides MB092 (SEQ ID NO: 10) and MB093 (SEQ ID NO: 11) previously hybridized. The plasmid pMB042 (4234 bp) was thus obtained after transformation of E. coli bacteria (see diagram for obtaining pMB042 in FIG. 5)

MB092 (SEQ ID NO: 10) ^• 5 'AGCTGAATTCAAGCTTCCCGGGGTCGAC 3' MB093 (SEQ ID NO: 11). 5 'GATCGTCGACCCCGGGAAGCTTGAATTC 3' This plasmid pMB042 therefore contains: (1) a 5 ′ homologous sequence of COL B, (2) an inserted oligonucleotide sequence containing the unique sites EcoRI, Smal, H / πdlll and Sa / I, and (3) a homologous sequence in 3 ′ of the intergenic region between COLs B and C. This plasmid therefore makes it possible to introduce an expression cassette into the unique sites mentioned in (2) placed between the 2 flanking regions (1) and (3). The recombinant ILTV viruses obtained will have a deletion of 1366 bp covering the C-terminal part of COL B (the 339 C-terminal amino acids of COL B) and the 5 'part of the intergenic region between COLs B and C (between H / πdlll and BglH sites, noted in Figure 1).

Example 9: Construction of the donor plasmid pMB043 for the insertion of an expression cassette for the VP2 gene of IBDV under the control of the HCMV IE promoter in the COL B site and isolation of vILTVI:

9.1 - Cloning of the VP2 gene from the Gumboro disease virus (IBDV) and construction of a VP2 expression cassette under the control of the HCMV IE promoter

The plasmid pEL004 (see FIG. 6; = plasmid pGH004 described in French patent application 92.13109) containing the IBDV VP2 gene in the form of a BamHI-Hindlll cassette was digested with BamHI and Xbai to isolate the BamHI-Xbal fragment (gene Truncated VP2) of 1104 bp. This fragment was cloned into the starter pBS SK +, previously digested with Xbal and BamHI to give the plasmid pEL022 of 4052 bp (FIG. 6). The pBS-SK + starter was digested with EcoRV and Xbal, then ligated on itself to give pBS-SK * (modified). Plasmid pEL004 was digested with Kpnl and Hindlll to isolate the Kpnl-Hindlll fragment of 1387 bp containing the complete IBDV VP2 gene. This fragment was cloned into the vector pBS-SK *, previously digested with Kpnl and Hindlll, to give the plasmid pEL023 of 4292 bp (FIG. 6). The plasmid pEL022 was digested with BamHI and NotI to isolate the BamHI-NotI fragment of 1122 bp (fragment A). The plasmid pEL023 was digested with BamHI and NotI to isolate the BamHI-NotI fragment of 333 bp (fragment B). Fragments A and B were ligated together with the vector pBS-SK +, previously digested with NotI and treated with alkaline phosphatase, to give the plasmid pEL024 of 4369 bp (figure 6).

Plasmid pEL024 was digested with NotI to isolate the 1445 bp NotI-NotI fragment. This fragment was ligated with the plasmid pCMVβ (Clontech Cat # 6177-1, FIG. 7), previously digested with NotI, to give the plasmid pEL026 of 5095 5 bp (FIG. 7).

Plasmid pEL026 was digested with EcoRI, SalI and Xmnl to isolate the EcoRI-SalI fragment of 2428 bp. This fragment was ligated with the vector pBS-SK +, previously digested with EcoRI and SalI, to give the plasmid pEL027 of 5379 bp (FIG. 7).

10 9.2 - Construction of the donor plasmid pMB043

Plasmid pEL027 was digested with EcoRI, SalI and Xmnl to isolate the EcoRI-SalI fragment of 2428 bp. This fragment was ligated into the plasmid pMB035 (see example 6 and FIG. 3), previously digested with EcoRI and SalI, to give the plasmid pMB043 of 6414 bp (FIG. 8).

15 9.3 - Isolation and purification of the recombinant virus vILTVI

The vILTVI virus was isolated and purified after cotransfection of the DNA of the plasmid pMB036 previously linearized with the enzyme Kpnl and of the viral DNA, as described in Example 3. This recombinant contains an HCMV-IE / IBDV VP2 cassette in the COL B of the partially deleted ILTV virus (see examples 5 and 6).

Example 10: Construction of the donor plasmid pMB044 for the insertion of an expression cassette for the VP2 gene of IBDV under the control of the MCMV IE promoter in the COL B site and isolation of VILTV2:

10.1 - Construction of pELOJO containing an expression cassette for the IBDV VP2 gene under the control of the immediate early (IE) promoter of MCMV (Mouse _5 CytoMegaloVirus)

The plasmid pCMVβ (Clontech Cat # 6177-1, FIG. 9) was digested with Sali and Smal to isolate the Sall-Smal fragment of 3679 bp containing the lacZ gene as well as the polyadenylation signal of the SV40 virus late gene. This fragment was inserted into the vector pBS-SK +, previously digested with Sali and EcoRV, to give the plasmid pCD002 of 6625 bp (FIG. 9). This plasmid contains the lacZ reporter gene but no promoter is located upstream of this gene. The MCMV virus strain Smith was obtained from the American Type Culture Collection, Rockville, Maryland, USA (ATCC No. VR-194). This virus was cultured on Balb / C mouse embryo cells and the viral DNA of this virus was prepared as described by Ebeling A. et al. (J. Virol. 1983. 47, 421-433). This viral genomic DNA was digested with PstI to isolate the Pstl-Pstl fragment of 2285 bp. This fragment was cloned into the vector pBS-SK +, previously digested with PstI and treated with alkaline phosphatase, to give the plasmid pCD004 (FIG. 9). The plasmid pCD004 was digested with Hpal and PstI to isolate the Hpal-PstI fragment of 1389 bp which contains the promoter / activator region of the Immediate-Early gene of the murine cytomegalovirus (Murine CytoMegaloVirus = MCMV) (Dorsch-Hâsler K. et al. Proc. Natl. Acad. Sci. 1985. 82. 8325-8329, and patent application WO-A-87/03905). This fragment was cloned into the plasmid pCD002, previously digested with PstI and SmaI, to give the plasmid pCD009 of 8007 bp (FIG. 9).

A double-stranded oligonucleotide was obtained by hybridization of the following two oligonucleotides: MB070 (SEQ ID NO: 12)

5 'CGAATTCACTAGTGTGTGTCTGCAGGCGGCCGCGTGTGTGTCGACGGTAC

3 '

MB071 (SEQ ID NO: 13)

5 'CGTCGACACACACGCGGCCGCCTGCAGACACACACTAGTGAATTCGAGCT 3'

This double-stranded oligonucleotide was ligated with the vector pBS-SK +, previously digested with Kpnl and Sac1, to give the plasmid pEL067 (FIG. 10). Plasmid pCD009 was digested with PstI and Spel to isolate the Pstl-Spel fragment of 1396 bp. This fragment was ligated with the plasmid pEL067, previously digested with PstI and Spel, to give the plasmid pEL068 of 4297 bp (FIG. 10). The plasmid pEL024 (see example 9, paragraph 9.1 and FIG. 6) was digested with Hindlll and Notl to isolate the Hindi ll-NotI fragment of 1390 bp (fragment A). The plasmid pEL027 (see example 9, paragraph 9.1 and FIG. 7) was digested with HindIII and SalI to isolate the Hindlll-SalI fragment of 235 bp (fragment B). Fragments A and B were ligated together with the plasmid pEL068, previously digested with NotI and SalI, to give the plasmid pEL070 of 5908 bp (FIG. 10). This plasmid therefore contains an expression cassette consisting of the IE promoter of MCMV, of the VP2 gene and of the polyA signal of SV40.

10.2 - Construction of the donor plasmid pMB044

The plasmid pEL070 was digested with EcoRI, SalI and Xmnl to isolate the EcoRI-SalI fragment of 3035 bp. This fragment was ligated into the plasmid pMB035 (see example 6 and FIG. 3), previously digested with EcoRI and SalI, to give the plasmid pMB044 of 7009 bp (FIG. 11). This plasmid allows the insertion of the MCMV-IE / IBDV-VP2 expression cassette into the partially de-altered COL B of the ILTV virus.

10.3 - Isolation and purification of the recombinant virus vIL TV2

The vlLTV2 virus was isolated and purified after cotransfection of the DNA of the plasmid ρMB044 previously linearized with the enzyme BssHII and of the viral DNA, as described in Example 3. This recombinant contains an MCMV-IE / IBDV VP2 cassette in the partially delimited COL B of the ILTV virus (see examples 5 and 6).

Example 11: Construction of the donor plasmid pMB045 for the insertion of an expression cassette for the VP2 gene of IBDV under the control of the MCMV IE promoter in the intergenic site between COLs B and C. and isolation of VILTV3:

The plasmid pEL070 (see example 10 and FIG. 10) was digested with EcoRI, SalI and Xmnl to isolate the EcoRI-SalI fragment of 3035 bp. This fragment was ligated into the plasmid pMB039 (see example 7 and FIG. 4), previously digested with EcoRI and SalI, to give the plasmid pMB045 of 7540 bp (FIG. 12). This plasmid allows the insertion of the MCMV-IE / IBDV-VP2 expression cassette in the region partially deleted intergene between COLs B and C of the ILTV virus. The vlLTV3 virus was isolated and purified after cotransfection of the DNA of the plasmid pMB045 previously linearized with the enzyme BssHII and of the viral DNA, as described in Example 3. This recombinant contains an MCMV-IE / IBDV VP2 cassette. inserted in the partially deleted intergenic region between the COLs B and C of the ILTV virus (see examples 5 and 7).

Example 12 Construction of the donor plasmid pMB046 for the insertion of an expression cassette for the VP2 gene of IBDV under the control of the promoter MCMV IE in the genomic region straddling COL B and the intergenic site between COLs B and C. and isolation of ylLTV4:

The plasmid pEL070 (see example 10 and FIG. 10) was digested with EcoRI, SalI and Xmnl to isolate the EcoRI-SalI fragment of 3035 bp. This fragment was ligated into the plasmid pMB042 (see example 8 and FIG. 5), previously digested with EcoRI and SalI, to give the plasmid pMB046 of 7253 bp (FIG. 13). This plasmid allows the insertion of the MCMV-IE / IBDV-VP2 expression cassette into the genomic region straddling COL B and the intergenic genomic region between COLs B and C of the ILTV virus.

The vlLTV4 virus was isolated and purified after cotransfection of the DNA of the plasmid pMB046 previously linearized with the enzyme BssHII and of the viral DNA, as described in Example 3. This recombinant contains an MCMV-IE / IBDV VP2 cassette. inserted into the genomic region straddling COL B and the intergenic genomic region between COLs B and C of the ILTV virus (see Examples 5 and 8).

Example 13: Construction of the donor plasmid DMB047 for the insertion of an expression cassette for the HN gene of NDV into the COL B and isolation of VILTV5:

13.1 - Cloning of the Newcastle disease virus (NDV) HN gene

The constitution of a DNA bank complementary to the genome of the Newcastle disease virus (NDV), Texas strain, was carried out as described by Taylor J. et al. (J. Virol. 1990. 64. 1441-1450). A clone pBR322 containing the end of the fusion gene (F), the entire hemagglutinin-neuraminidase (HN) gene and the start of the polymerase gene has been identified pHNOl The sequence of the NDV HN gene contained in this clone is shown in the figure 14 (SEQ ID NO: 14). Plasmid pHN01 was digested with Sphl and Xbal to isolate the Sphl-Xbal fragment of 2520 bp. This fragment was ligated with the starter pUC19, previously digested with Sphl and Xbal, to give the plasmid pHN02 of 5192 bp. The plasmid pHN02 was digested with ClaI and PstI to isolate the ClaI-PstI fragment of 700 bp (fragment A). A PCR was carried out with the following oligonucleotides: EL071 (SEQ ID NO: 15) 5 'CAGACCAAGCTTCTTAAATCCC 3'

EL073 (SEQ ID NO: 16) 5 'GTATTCGGGACAATGC 3' and the pHN02 template to produce a 270 bp PCR fragment. This fragment was digested with Hindlll and PstI to isolate a Hindlll-Pstl fragment of 220 bp (fragment B). Fragments A and B were ligated together with the starter pBS-SK +, previously digested with ClaI and HindIII, to give the plasmid pEL028 of 3872 bp (FIG. 15). Plasmid pHN02 was digested with Bsphl and ClaI to isolate the Bsphl-ClaI fragment of 425 bp (fragment C). A PCR was carried out with the following oligonucleotides: EL074 (SEQ ID NO: 17) 5 'GTGACATCACTAGCGTCATCC 3' EL075 (SEQ ID NO: 18)

5 'CCGCATCATCAGCGGCCGCGATCGGTCATGGACAGT 3' and the pHN02 matrix to produce a PCR fragment of 465 bp. This fragment was digested with Bsphl and Notl to isolate the Bsphl-Notl fragment of 390 bp (fragment D). Fragments C and D were ligated together with the vector pBS-SK +, previously digested with ClaI and NotI, to give the plasmid pEL029bis of 3727 bp (FIG. 15). The plasmid pEL028 was digested with ClaI and Sac11 to isolate the ClaI-SacII fragment of 960 bp (fragment E). The plasmid pEL029bis was digested with ClaI and NotI to isolate the ClaI-NotI fragment of 820 bp (fragment F). Fragments E and F were ligated together with the starter pBS-SK +, previously digested with NotI and Sacll, to give the plasmid pEL030 of 4745 bp (FIG. 15). 13.2 - Construction of the plasmid pMB047 containing an NDV HN expression cassette in the COL B

Plasmid pEL030 was digested with NotI to isolate the 1780 bp NotI-NotI fragment (whole NDV HN gene). This fragment was inserted into the NotI sites of the plasmid pMB044 (Example 10, FIG. 11) in place of the NotI-NotI fragment of 1405 bp containing the gene coding for the protein VP2 of IBDV; this cloning made it possible to isolate the plasmid pMB047 from 7385 bp (FIG. 16). This plasmid allows the insertion of the MCMV-IE / NDV-HN expression cassette into the partially deified COL B of the ILTV virus.

13.3 - Isolation and purification of the recombinant virus vIL TV5

The vlLTV5 virus was isolated and purified after cotransfion of the DNA of the plasmid pMB047 previously linearized by the enzyme BssHII and of the viral DNA, as described in Example 3. This recombinant contains an MCMV-IE / NDV HN cassette in the partially delimited COL B of the ILTV virus (see examples 5 and 6).

Example 14: Isolation of Other Recombinant ILTV Viruses Expressing the HN Gene of the NDV Virus:

In a similar manner to that described in Example 13 (paragraphs 13.2 and 13.3), the HN gene flanked by NotI sites (isolated from pEL030, FIG. 15) can replace the VP2 gene in the plasmids pMB045 (FIG. 12) and pMB046 (FIG. 13) to give plasmids allowing the isolation of recombinant viruses having an expression cassette for the ND HN gene in the intergenic part between COLs B and C, or straddling COL B and the intergenic part between COLS B and C.

Example 15: Construction of the donor plasmid ρMB048 for the insertion of an expression cassette for the NDV F gene into the COL B and isolation of vlUTV6:

15.1 - Cloning of the Newcastle disease virus (NDV) F gene

A clone from the DNA library complementary to the genome of the Newcastle disease virus (see example 13, paragraph 13.1) and containing the gene the entire fusion (F) was called pNDV81. This plasmid has been described previously and the sequence of the NDV F gene present on this clone has been published (Taylor J. et al. J. Virol. 1990. 64. 1441-1450). The plasmid pNDV81 was digested with Narl and PstI to isolate the Narl-Pstl fragment of 1870 bp (fragment A). A PCR was carried out with the following oligonucleotides:

EL076 (SEQ ID N ° 19) 5 'TGACCCTGTCTGGGATGA 3' EL077 (SEQ ID N ° 20)

5 ^* GGATCCCGGTCGACACATTGCGGCCGCAAGATGGGC 3 'and the matrix pNDV81 to produce a 160 bp fragment. This fragment was digested with PstI and SalI to isolate the PstI-SalI fragment of 130 bp (fragment B). Fragments A and B were ligated together with the vector pBS-SK +, previously digested with ClaI and SalI, to give the plasmid pEL033 of 4846 bp (FIG. 17).

15.2 - Construction of the plasmid pMB048 containing an expression cassette for the NDV F gene in the COL B

Plasmid pEL033 was digested with NotI to isolate the 1935 bp NotI-NotI fragment (whole F gene). This fragment was inserted into the NotI sites of the plasmid pMB044 (Example 10, FIG. 11) in place of the NotI-NotI fragment of 1405 bp containing the gene coding for the protein VP2 of IBDV; this cloning made it possible to isolate the plasmid ρMB048 from 7,538 bp (FIG. 18). This plasmid allows the insertion of the MCMV-IE / NDV-F expression cassette into the partially deified COL B of the ILTV virus.

15.3 - Isolation and purification of the vILTVβ recombinant virus The vILTV ^β virus was isolated and purified after cotransfection of the DNA of the plasmid pMB048 previously linearized with the enzyme BssHII and the viral DNA, as described in Example 3. This recombinant contains an MCMV-IE / NDV F cassette in the partially delimited COL B of the ILTV virus (see examples 5 and 6).

Example 16: Construction of a donor plasmid for the insertion of a double expression cassette for the NDV HN and F genes into the COL B site and isolation of a recombinant ILTV virus.

A double expression cassette for two genes, for example the HN and F genes of the NDV virus, can be constructed. Such a construction is shown diagrammatically in FIG. 19. In this construction, the 5 ′ end of the two promoters are adjacent so that the transcription of the two genes takes place in opposite directions. One of the two promoters is preferably a CMV IE promoter and the other promoter (called associated promoter) is any promoter active in eukaryotic cells of viral origin (and in particular of herpes virus) or not. In this configuration, the associated promoter is activated by the activating region of the CMV IE promoter. This double expression cassette can then be inserted into one of the 3 donor plasmids described above (pMB035, pMB039 and pMB042 described in Examples 6, 7 and 8 and shown in Figures 3, 4 and 5 respectively). The isolation of the recombinant viruses is carried out in the same manner as above (see example 3).

Example 17: Construction of the donor plasmid pMB049 for the insertion of an MDV gB gene expression cassette into the COL B and isolation of VILTV7:

17.1 - Cloning of the Marek disease virus gB gene

The 3.9 kbp EcoRI-Sall fragment of the genomic DNA of the MDV virus strain RB1 B containing the MDV gB gene (sequence published by Ross N. et al. J. Gen. Virol. 1989. 70. 1789-1804) was ligated with the vector pUC13, previously digested with EcoRI and SalI, to give the plasmid pCD007 of 6543 bp (FIG. 20). This plasmid was digested with SacI and Xbal to isolate the SacI-Xbal fragment of 2260 bp (central part of the gB gene = fragment A). A PCR was carried out with the following oligonucleotides:

CD001 (SEQ ID NO: 21)

5 'GACTGGTACCGCGGCCGCATGCAC IIII IAGGCGGAATTG 3' CD002 (SEQ ID NO: 22) 5 'TTCGGGACATTTTCGCGG 3' and the matrix pCD007 to produce a PCR fragment of 222 bp. This fragment was digested with Kpnl and Xbal to isolate a Kpnl-Xbal fragment of 190 bp (5 'end of the gB gene = fragment B). Another PCR was carried out with the following oligonucleotides:

CD003 (SEQ ID NO: 23) 5 'TATATGGCGTTAGTCTCC 3' CD004 (SEQ ID NO: 24) 5 'TTGCGAGCTCGCGGCCGCTTATTACACAGCATCATCTTCTG 3' and matrix pCD007 to produce a PCR fragment of 195 bp. This fragment was digested with Sac1 and Sacll to isolate the Sacl-Sacll fragment of 162 bp (3 'end of the gB gene = fragment C). Fragments A, B and C were ligated together with the pBS-SK + starter, previously digested with Kpnl and Sacl, to give the plasmid pCD011 of 5485 bp (FIG. 20).

17.2 - Construction of the plasmid pMB049 containing an expression cassette for the MDV gB gene in the COL B

Plasmid pCD011 was digested with NotI to isolate the NotI-NotI fragment of 2608 bp (whole MDB gB gene). This fragment was inserted into the NotI sites of the plasmid pMB044 (Example 10, FIG. 11) in place of the NotI-NotI fragment of 1405 bp containing the gene coding for the protein VP2 of IBDV; this cloning made it possible to isolate the plasmid pMB049 from 8213 bp (FIG. 21). This plasmid allows the insertion of the MCMV-IE / MDV-gB expression cassette into the partially de ﬁ ned COL B of the ILTV virus.

17.3 - Isolation and purification of the recombinant virus vIL TV7

The vlLTV7 virus was isolated and purified after cotransfion of the DNA of the plasmid pMB049 previously linearized by the enzyme BssHII and of the viral DNA, as described in Example 3. This recombinant contains an MCMV-IE / MDV gB cassette. in the partially delimited COL B of the ILTV virus (see examples 5 and 6).

EXAMPLE 18 Construction of a Donor Plasmid for the Insertion of an IBV Oene (s) Expression Cassette into COL B and Isolation of Recombinant ILTV Virus:

According to the same strategy as that described above for the insertion of simple cassettes (examples 9, 10, 11, 12, 13, 14, 15 and 17) or for the insertion of double cassettes (example 18), in the three sites described above (examples 6, 7 and 8), there it is possible to make recombinant ILTV viruses expressing at a high level the Membrane (M) or Spike (S) proteins, or part of Spike (S1 or S2), or Nucleocapsid (N) of the avian infectious bronchitis virus (IBV) . A double expression cassette is produced in particular with the S gene under the control of the CMV IE promoter and the M gene under the control of the associated promoter.

Example 19: Construction of ^p lasmides donors for insertion of gene expression cassettes (s) other avian pathogens or immunomodulatory peptide in the three sites described and isolation of recombinant virus ILTV:

According to the same strategy as that described above for the insertion of single cassettes (examples 9, 10, 11, 12, 13, 14, 15 and 17) or for the insertion of double cassettes (example 18), in the three sites described above (examples 6, 7 and 8), it is possible to produce recombinant ILTV viruses expressing a high level of CAV immunogens (and in particular a double expression cassette for the genes coding for VP1 and for VP2) , chicken pneumovirus virus, or other avian pathogens, or immunomodulatory peptides and in particular cytokines.

Example 20: Production of vaccines:

The recombinant viruses obtained according to the invention are produced on embryonic eggs. The harvested viral solution is then diluted in a stabilizing solution for lyophilization, distributed at the rate of 1000 vaccine doses per vial, and finally lyophilized.

Claims

1 - Avian recombinant living vaccine comprising, as vector, an ILTV virus comprising and expressing at least one heterologous nucleotide sequence, this nucleotide sequence being inserted into the insertion locus which, in a particular ILTV strain, is defined between the nucleotides 1624 and 3606 at SEQ ID NO: 5.

2 - Recombinant live vaccine according to claim 1, characterized in that the nudeotide sequence or sequences are inserted by simple insertion, or after total or partial deletion of the insertion locus. 3 - Recombinant live vaccine according to claim 1 or 2, caraderized in that the nudeotide sequence or sequences are inserted into the COL B appearing between nucleotides 1713 and 2897 at SEQ ID NO: 5.

4 - Recombinant live vaccine according to claim 1 or 2, characterized in that the nudeotide sequence or sequences are inserted in the intergenic region defined between nucleotides 2898 and 3606 at SEQ ID NO: 5.

5 - Recombinant live vaccine according to any one of claims 1 to 4, caraderized in that, to express the inserted nucleotide sequence, the vector comprises a strong eukaryotic promoter.

6 - Recombinant live vaccine according to claim 5, characterized in that the strong promoter is chosen from the group consisting of: immediate-early CMV promoter, preferably murine or human immediate-early CMV promoter, LTR promoter of the Sarcoma virus Rous (RSV), early promoter of the SV40 virus.

7 - Recombinant live vaccine according to any one of claims 1 to 6, characterized in that it comprises at least two nudeotide sequences inserted into the insertion locus under the control of different eukaryotic promoters.

8 - Recombinant live vaccine according to claim 7, characterized in that the eukaryotic promoters are immediate-early CMV promoters of different animal origins. 9 - Recombinant live vaccine according to claim 7, caradized in that it comprises a first nucleotide sequence associated with the immediate early CMV promoter and another promoter under the dependence of which is another nucleotide sequence, these two promoters being arranged so that their 5 'ends are adjacent.

10 - Recombinant live vaccine according to any one of claims 1 to 9, characterized in that it comprises a nucleotide sequence coding for an antigenic polypeptide of an avian pathogenic agent, this sequence being inserted into the insertion locus. 11 - Recombinant live vaccine according to claim 10, characterized in that it comprises a sequence coding for an antigen of an avian pathogen chosen from the group consisting of Newcastle disease virus (NDV), the virus of Gumboro disease (IBDV), Marek's disease virus (MDV), infidious bronchitis virus (IBV), chicken anemia virus (CAV), chicken pneumovirus virus.

12 - Recombinant live vaccine according to claim 11, characterized in that it comprises a nucleotide sequence, chosen from the nudeotide sequences coding for the F and HN polypeptides of the NDV virus.

13 - Recombinant live vaccine according to claim 11, characterized in that it comprises a nucleotide sequence, chosen from the nudeotide sequences coding for the gB, gD, gH + gL polypeptides of the MDV virus.

14 - Recombinant live vaccine according to claim 11, characterized in that it comprises at least one nucleotide sequence chosen from the group of sequences corresponding to the VP2 antigens of IBDV, to the S antigens, or part of S, M and N of the IBV virus, to the VP1 and VP2 antigens of CAV, to the G and F antigens of the chicken pneumovirus virus.

15 - Live recombinant vaccine according to any one of claims 1 to 14, characterized in that it comprises a nucleotide sequence coding for an immunomodulatory polypeptide, this sequence being inserted into the insertion locus.

16 - Live recombinant vaccine according to claim 15, characterized in that this nucleotide sequence is chosen from the group of sequences coding for cytokines.

17 - Recombinant live vaccine according to any one of claims 1 to 16, characterized in that it comprises, inserted into the insertion locus, an expression cassette successively comprising a promoter, two or more genes separated in pairs by an IRES, and a polyadenylation signal.

18 - Multivalent vaccine formula comprising, as a mixture or as a mixture, at least two recombinant live vaccines as defined in any one of claims 1 to 17, these vaccines comprising different inserted sequences.

19 - DNA fragment comprising all or part of the sequence defined by positions 1 to 3841 on the sequence SEQ ID NO: 5.

20 - An ILTV virus comprising at least one heterologous nucleotide sequence inserted into the insertion locus defined between nucleotides 1624 and 3606 at SEQ ID NO: 5.