WO1996012019A9 - Her4 human receptor tyrosine kinase or the epidermal growth factor receptor family - Google Patents

Her4 human receptor tyrosine kinase or the epidermal growth factor receptor family

Info

Publication number
WO1996012019A9
WO1996012019A9 PCT/US1995/013524 US9513524W WO9612019A9 WO 1996012019 A9 WO1996012019 A9 WO 1996012019A9 US 9513524 W US9513524 W US 9513524W WO 9612019 A9 WO9612019 A9 WO 9612019A9
Authority
WO
WIPO (PCT)
Prior art keywords
her4
leu
gly
pro
glu
Prior art date
Application number
PCT/US1995/013524
Other languages
French (fr)
Other versions
WO1996012019A2 (en
WO1996012019A3 (en
Filing date
Publication date
Application filed filed Critical
Priority to AU39632/95A priority Critical patent/AU3963295A/en
Priority to JP8513469A priority patent/JPH10507362A/en
Priority to EP95937555A priority patent/EP0787187A1/en
Priority to MX9702664A priority patent/MX9702664A/en
Publication of WO1996012019A2 publication Critical patent/WO1996012019A2/en
Publication of WO1996012019A9 publication Critical patent/WO1996012019A9/en
Publication of WO1996012019A3 publication Critical patent/WO1996012019A3/en
Priority to FI971532A priority patent/FI971532A/en
Priority to NO971686A priority patent/NO971686L/en

Links

Definitions

  • the present invention is generally directed to a novel receptor tyrosine inase related to the epidermal growth factor receptor, termed HER4/pl80 rB " * ("HER4") , and to novel diagnostic and therapeutic compositions comprising HER4-derived or HER4-related biological components.
  • HER4/pl80 rB " * HER4
  • the invention is based in part upon applicants discovery of human HER4, its complete nucleotide coding sequence, and functional properties of the HER4 receptor protein.
  • the invention is directed to HER4 biologies comprising, for example, polynucleotide molecules encoding HER4, HER4 polypeptides, anti-HER4 antibodies which recognize epitopes of HER4 polypeptides, ligands which interact with HER4, and diagnostic and therapeutic compositions and methods based fundamentally upon such molecules.
  • HER4 HER4 biologies comprising, for example, polynucleotide molecules encoding HER4, HER4 polypeptides, anti-HER4 antibodies which recognize epitopes of HER4 polypeptides, ligands which interact with HER4, and diagnostic and therapeutic compositions and methods based fundamentally upon such molecules.
  • the present invention provides a framework upon which effective biological therapies may be designed.
  • the invention is hereinafter described in detail, in part by way of experimental examples specifically illustrating various aspects of the invention and particular embodiments thereof. 2. Background of the Invention
  • RTKs receptor tyrosine kinases
  • EGF epidermal growth factor
  • PDGF platelet-derived growth factor
  • NGF neurotrophins
  • FGF fibroblast growth factor
  • ligands for several previously-characterized receptors have been identified, including ligands for c-kit (steel factor) , met (hepatocyte growth factor) , trk (nerve growth factor) (see, respectively, Zsebo et al . , 1990, Cell 63:195-201; Bottardo et al . , 1991, Science 251:802-04; Kaplan et al . , 1991, Nature 350:158-160) .
  • the soluble factor NDF, or heregulin- alpha (HRG- ⁇ ) has been identified as the ligand for HER2 , a receptor which is highly related to HER4 (Wen et al . , 1992, Cell 69:559-72; Holmes et al . , 1992, Science 256:1205-10) .
  • the heregulins are a family of molecules that were first isolated as specific ligands for HER2 (Wen, et al . , 1992, Cell. 69:559-572; Holmes et al . , 1992, Science 256:1205-1210; Falls et ai . , 1993, Cell 72:801-815; and Marchionni et al . , 1993, Nature 362:312-318) .
  • a rat homologue was termed Neu differentiation factor (NDF) based on its ability to induce differentiation of breast cancer cells through its interaction with HER2/Neu (Wen et al . , supra ) .
  • Heregulin also appears to play an important role in development and maintenance of the nervous system based on its abundant expression in cells of neuronal origin and on the recognition that alternatively spliced forms of the heregulin gene encode for two recently characterized neurotrophic activities.
  • One neural-derived factor is termed acetylcholine receptor inducing activity (ARIA) (Falls et al . , supra ) .
  • ARIA acetylcholine receptor inducing activity
  • GGF glial growth factor reflecting the proliferative affect this molecule has on glial cells in the central and peripheral nervous system (Marchionni et al . , supra ) .
  • HER2-neutralizing antibodies fail to block heregulin activation of human breast cancer cells. Heregulin only activates tyrosine phosphorylation of HER2 in cells of breast, colon, and neuronal origin, and not in fibroblasts or ovarian cell lines that overexpress recombinant HER2 (Peles et al . , 1993, EMBO J. 12:961-971).
  • EGFR EGF receptor
  • HER2/pl85** r "" 3 Three human EGFR-family members have been identified and are known to those skilled in the art: EGFR, HER2/pl85** r "" 3 and HER3/pl60 «rM3 (see, respectively, Ullrich et al . , 1984, Nature 309:418-25; Coussens et al . , 1985, Science 230:1132-39; Plowman et al . , 1990, Proc. Natl. Acad. Sci. U.S.A. 87:4905-09). EGFR-related molecules from other species have also been identified.
  • EGFR-family members The complete nucleotide coding sequence of other EGFR-family members has also been determined from other organisms including: the drosophila EGFR ("DER”: Livneh et al . , 1985, Cell 40:599-607), nematode EGFR ("let-23”: Aroian et al . , 1990, Nature 348:693-698), chicken EGFR ("CER”: Lax et al . , 1988, Mol. Cell. Biol. 8:1970-1978), rat EGFR (Petch et al . , 1990, Mol. Cell. Biol. 10:2973-2982), rat HER2/Neu (Bargmann et al .
  • DER Livneh et al . , 1985, Cell 40:599-607
  • nematode EGFR let-23”: Aroian et al . , 1990, Nature 348:693-698
  • X rk Wittbrodt et al . , 1989, Nature 342:415-4231
  • PCR technology has led to the isolation of other short DNA fragments that may encode novel receptors or may represent species- specific homologs of known receptors.
  • isolation tyro-2 Lai, C. and Lemke, G., 1991, Neuron 6:691-704
  • tyro-2 a fragment encoding 54 amino acids that is most related to the EGFR family.
  • EGFR-family receptors Overexpression of EGFR-family receptors is frequently observed in a variety of aggressive human epithelial carcinomas. In particular, increased expression of EGFR is associated with more aggressive carcinomas of the breast, bladder, lung and stomach
  • HER2 has been associated with a wide variety of human malignancies, particularly breast and ovarian carcinomas, for which a strong correlation between HER2 overexpression and poor clinical prognosis and/or increased relapse probability have been established (see, for example, Slamon et al .
  • HER2 has also been correlated with other human carcinomas, including carcinoma of the stomach, endometrium, salivary gland, bladder, and lung (Yokota et al . , 1986, Lancet 1:765- 67; Fukushigi et al . , 1986, Mol. Cell. Biol. 6:955-58; Yonemura et al . , 1991, Cancer Res. 51:1034; Weiner et al . , 1990, Cancer Res. 50:421-25; Geurin et al . , 1988, Onco ⁇ ene Res. 3:21-31; Semba et al .
  • EGF transforming growth factor-alpha
  • AR amphiregulin
  • HB-EGF heparin-binding EGF
  • VVF vaccinia virus growth factor
  • NDF neu differentiation factor
  • Both of these proteins are similar size (44- 45 kDa) , increase tyrosine phosphorylation of HER2 in MDA-MB-453 cells and not the EGF-receptor, and have been reported to bind to HER2 in cross-linking studies on human breast cancer cells.
  • NDF has been shown to induce differentiation of human mammary tumor cells to milk-producing, growth-arrested cells, whereas the heregulin family have been reported to stimulate proliferation of cultured human breast cancers cell monolayers.
  • HER3 binds heregulin (Carraway et al . , 1994, J. Biol. Chem. 269:14303-14306), and in fact, this receptor seems to be involved in the heregulin-mediated tyrosine kinase activation of HER2 (Carraway et al . , supra ; Sliwkowski et al . , 1994, J. Biol. Chem. 269:14661- 14665) .
  • receptor polypeptides transduce regulatory signals in response to ligand binding
  • important components of the process have been uncovered, including the understanding that phosphorylation of and by cell surface receptors hold fundamental roles in signal transduction.
  • the intracellular phenomena of receptor dimerizati ⁇ n and receptor crosstalk function as primary components of the circuit through which ligand binding triggers a resulting cellular response.
  • Ligand binding to transmembrane receptor tyrosine kinases induces receptor dimerization, leading to activation of kinase function through the interaction of adjacent cytoplasmic domains.
  • Receptor crosstalk refers to intracellular communication between two or more proximate receptor molecules mediated by, for example, activation of one receptor through a mechanism involving the kinase activity of the other.
  • One particularly relevant example of such a phenomenon is the binding of EGF to the EGFR, resulting in activation of the EGFR kinase domain and cross- phosphorylation of HER2 (Kokai et al . , 1989, Cell 58:287-92; Stern et al . , 1988, EMBO J. 7:995-1001; King et al . , 1989, Onco ⁇ ene 4:13-18).
  • HER4 is the fourth member of the EGFR-family of receptor tyrosine kinases and is likely to be involved not only in regulating normal cellular function but also in the loss of normal growth control associated with certain human cancers.
  • HER4 appears to be closely connected with certain carcinomas of epithelial origin, such as adenocarcinoma of the breast.
  • the invention includes embodiments directly involving the production and use of HER4 polynucleotide molecules.
  • the invention provides HER4 polypeptides, such as the prototype HER4 polypeptide disclosed and characterized in the sections which follow. Polypeptides sharing nearly equivalent structural characteristics with the prototype HER4 molecule are also included within the scope of this invention.
  • the invention includes polypeptides which interact with HER4 expressed on the surface of certain cells thereby affecting their growth and/or differentiation.
  • the invention is also directed to anti-HER4 antibodies, which have a variety of uses including but not limited to their use as components of novel biological approaches to human cancer diagnosis and therapy provided by the invention.
  • the invention also relates to the identification of HER4 ligands and methods for their purification.
  • the invention also relates to the discovery of an apparent functional relationship between HER4 and HER2, and the therapeutic aspects of the invention include those which are based on applicants' preliminary understanding of this relationship.
  • Applicants' data strongly suggests that HER4 interacts with HER2 either by heterodimer formation or receptor crosstalk, and that such interaction appears to be one mechanism by which the HER4 receptor mediates effects on cell behavior.
  • the reciprocal consequence is that HER2 activation is in some circumstances mediated through HER4.
  • HER4 as a primary component of the heregulin signal transduction pathway opens a number of novel approaches to the diagnosis and treatment of human cancers in which the aberrant expression and/or function of heregulin and/or HER4 are involved.
  • the therapeutic aspects of this invention thus include mediating a ligand's affect on HER4 and HER2 through antagonists, agonists or antibodies to HER4 ligands or HER4 receptor itself.
  • the invention also relates to chimeric proteins that specifically target and kill HER4 expressing tumor cells, polynucleotides encoding such chimeric proteins, and methods of using both in the therapeutic treatment of cancer and other human malignancies.
  • the invention further relates to a method allowing determination of the cytotoxic activity of HER4 directed cytotoxic substances on cancer cells, thereby providing a powerful diagnostic tool; this will be of particular interest for prognosis of the e fectiveness of these substances on an individual malignancy prior their therapeutic use.
  • Figures 1/1 through 1/5 Nucleotide sequence [SEQ ID No:l] and deduced amino acid sequence of HER4 of the coding sequence from position 34 to 3961 (1308 amino acid residues) [SEQ ID No:2]. Nucleotides are numbered on the left, and amino acids are numbered above the sequence.
  • Figures 2/1 through 2/4 Nucleotide sequence [SEQ ID No: 3] and deduced amino acid sequence ([SEQ ID No: 4] of cDNAs encoding HER4 with alternate 3' end and without autophosphorylation domain. This sequence is identical with that of HER4 shown in Figures 1/1 through 1/5 up to nucleotide 3168, where the sequence diverges and the open reading frame stops after 13 - II - amino acids, followed by an extended, unique 3'- untranslated region.
  • This sequence contains the 3 '-portion of the HER4 sequence where nucleotide position 156 of the truncated sequence aligns with position 2335 of the complete HER4 sequence shown in Figures 1/1 through 1/5 (just downstream from the region encoding the ATP- binding site of the HER4 kinase) .
  • the first 155 nucleotides of the truncated sequence are unique from HER4 and may represent the 5 ' -untranslated region of a transcript derived from a cryptic promoter within an intron of the HER4 gene. (Section 6.2.2., infra ) .
  • Figures 4/1, 4/2 and 5. The deduced amino acid sequence of two variant forms of human HER4 aligned with the full length HER4 receptor as represented in Figures 1/1 through 1/5. Sequences are displayed using the single-letter code and are numbered on the right with the complete HER4 sequence on top and the variant sequences below. Identical residues are indicated by a colon between the aligned residues.
  • FIGS 4/1 and 4/2 HER4 with alternate 3 '-end, lacking an autophosphorylation domain [SEQ ID No. 4]. This sequence is identical with that of HER4 , shown in Figures 1/1 through 1/5, up to amino acid 1045, where the sequence diverges and continues for 13 amino acids before reaching a stop codon. Figure 5. HER4 with N-terminal truncation [SEQ ID No. 6]. This sequence is identical to the 3'- portion of the HER4 shown in Figures 1/1 through 1/5 beginning at amino acid 768. (Section 6.2.2., infra ) . Figures 6/1 and 6/2. Deduced amino acid sequence of human HER4 and alignment with other human EGFR- family members (EGFR [SEQ ID No:7]; HER2 [SEQ ID NO:9]
  • cysteine residues are marked with an asterisk, and N-linked glycosylation sites are denoted with a plus (+) .
  • Potential protein kinase C phosphorylation sites are indicated by arrows (HER4 amino acid positions 679, l() 685, and 699) .
  • the predicted ATP-binding site is shown with 4 circled crosses, C-terminal tyrosines are denoted with open triangles, and tyrosines in HER4 that are conserved with the major autophosphorylation sites in the EGFR are indicated with black triangles.
  • the predicted extracellular domain extends from the boundary of the signal sequence marked by an arrow at position 25, to the hydrophobic transmembrane domain which is overlined from amino acid positions 650 through 675.
  • FIG. 7 Hydropathy profile of HER4 , aligned 5 with a comparison of protein domains for HER4 (1308 amino acids) , EGFR (1210 amino acids) , HER2 (1255 amino acids) , and HER3 (1342 amino acids) .
  • the signal peptide is represented by a stippled box, the cysteine-rich extracellular subdomains are hatched, 0 the transmembrane domain is filled, and the cytoplas ic tyrosine kinase domain is stippled.
  • the percent amino acid sequence identities between HER4 and other EGFR-family members are indicated.
  • Sig signal peptide
  • I, II, III, and IV extracellular 5 domains
  • TM transmembrane domain
  • JM juxtamembrane domain
  • Cain calcium influx and internalization domain
  • 3'UTR 3' untranslated region.
  • Figures 8A and 8B Northern blot analysis from human tissues hybridized to HER4 probes. RNA size markers (in kilobases) are shown on the left. Lanes 1 through 8 represent 2 ⁇ g of poly(A)+ mRNA from pancreas, kidney, skeletal muscle, liver, lung, placenta, brain, and heart, respectively.
  • Figure 8A
  • FIG. 9A and 9B Immunoblot analysis of recombinant HER4 stably expressed in CHO-KI cells, according to procedure outlined in Section 7.1.3, infra .
  • Membrane preparations from CHO-KI cells expressing recombinant HER4 were separated on 7% SDS- polyacrylamide gels and transferred to nitrocellulose.
  • blots were hybridized with a monoclonal antibody to the C-terminus of HER2 (Ab3, Oncogene Science, Uniondale, NY) that cross-reacts with HER .
  • Figure 9B blots were hybridized with a sheep antipeptide polyclonal antibody to a common epitope of HER2 and HER4.
  • Lane 1 parental CHO-KI cells; lanes 2 - 4, CHO-KI/HER4 cell clones 6, 21, and 3, respectively. Note the 180 kDa HER4 protein and the 130 kDa cross-reactive species.
  • the size in kilodaltons of prestained high molecular weight markers (BioRad, Richmond, CA) is shown on the left.
  • FIGS 10A through 10D Specific activation of HER4 tyrosine kinase by a breast cancer differentiation factor (see Section 8., infra ) .
  • a breast cancer differentiation factor see Section 8., infra
  • HER4 were prepared according to the methods described in Sections 7.1.2 and 8.1. , infra . Cells from each of the four recombinant cell lines were stimulated with various ligand preparations and assayed for receptor tyrosine phosphorylation using the assay described in Section 8.2. , infra .
  • Figure 1 Cells from each of the four recombinant cell lines were stimulated with various ligand preparations and assayed for receptor tyrosine phosphorylation using the assay described in Section 8.2. , infra . Figure
  • Figure IOC NRHER5 cells; and Figure 10D, 293/HER3 cells.
  • the size (in kilodaltons) of the prestained molecular weight markers are labeled on the left of each panel.
  • FIGS 11A through 11F Biological and biochemical properties of the MDA-MB-453-cell differentiation activity purified from the conditioned media of HepG2 cells (Section 9., infra ) .
  • Figures 11A and 11B show induction of morphologic differentiation. Conditioned media from HepG2 cells was subjected to ammonium sulfate fractionation, followed by dialysis against PBS. Dilutions of this material were added to MDA-MB-453 monolayer at the indicated protein concentrations.
  • Figure 11A control; Figure 11B, 80 ng per well; Figure 11C, 2.0 ⁇ g per well; Figure 11D, Phenyl-5PW column elution profile monitored at 230 nm absorbance; Figure HE, Stimulation of MDA-MB- 453 tyrosine autophosphorylation with the following ligand preparations: None (control with no factor added) ; TGF- ⁇ (50 ng/ml) ; CM (16-fold concentrated HepG2 .conditioned medium tested at 2 ⁇ l and 10 ⁇ l per well); fraction (phenyl column fractions 13 to 20, 10 ⁇ l per well) .
  • Figure 11F Densitometry analysis of the phosphorylation signals shown in Figure HE. Figures 12A and 12B.
  • FIG. 12A MDA-MB-453 cells (lane 1, mock transfected COS cell supernatant; lane 2, NDF transfected COS cell supernatant) ;
  • Figure 12B CHO/HER4 21-2 cells (lanes 1 and 2, mock transfected COS cell supernatant; lanes 3 and 4, NDF transfected COS cell supernatant) .
  • Tyrosine phosphorylation was determined by the tyrosine kinase stimulation assay described in Section 8.2., infra .
  • Figures 13A and 13B Regional location of the HER4 gene to human chromosome 2 band q33.
  • Figure 13A Distribution of 124 sites of hybridization on human chromosomes;
  • Figure 13B Distribution of autoradiographic grains on diagram of chromosome 2.
  • FIG. 14 Amino acid sequence of HER4-Ig fusion protein [SEQ ID No: 10] (Section 5.4., infra ) .
  • Figure 15. Recombinant heregulin induces tyrosine phosphorylation of HER4. Tyrosine phosphorylated receptors were detected by Western blotting with an anti-phosphotyrosine Mab. Arrows indicate the HER2 and HER4 proteins. Monolayers of MDA-MB453 or CHO/HER4 cells were incubated with media from COS-1 cells transfected with a rat heregulin expression plasmid (HRG) , or with a cDM8 vector control (-) .
  • HRG rat heregulin expression plasmid
  • - cDM8 vector control
  • Solubilized cells were immunoprecipitated with anti-phosphotyrosine Mab.
  • Monolayers of CHO/HER2 cells were incubated as above with transfected Cos-1 cell supernatants or with two stimulatory Mabs to HER2 (Mab 28 and 29) . Solubilized cells were immunoprecipitated with anti-HER2 Mab.
  • FIGs 16A through 16C Expression of recombinant HER2 and HER4 in human CEM cells. Transfected CEM cells were selected that stably express either HER2 , HER4 , or both recombinant receptors.
  • recombinant HER2 was detected by immunmoprecipitation of cell lysates with anti-HER2 Mab (Ab-2) and Western blotting with another anti-HER2 Mab (Ab-3) .
  • Recombinant HER4 was detected by immunoprecipitation of S-labeled cell lysates with HER4-specific rabbit anti-peptide antisera.
  • FIG 16C Three CEM cell lines were selected that express one or both recombinant receptors and aliquots of each were incubated with media control (-) , with two HER2-stimulatory Mabs (Mab 28 and 29) , or with an isotype matched control Mab (18.4) . Solubilized cells were immunoprecipitated with anti-HER2 Mab (Ab-2) and tyrosine phosphorylated HER2 was detected by Western blotting with an anti- phosphotyrosine Mab. The size in kilodaltons of prestained high molecular weight markers (Bio-Rad) is shown on the left and arrows indicate the HER2 and HER4 proteins.
  • Figures 17A through 17C Three CEM cell lines were selected that express one or both recombinant receptors and aliquots of each were incubated with media control (-) , with two HER2-stimulatory Mabs (Mab 28 and 29) , or with an isotype matched
  • Heregulin induces tyrosine phosphorylation in CEM cells expressing HER .
  • Three CEM cell lines that express either HER2 or HER4 alone (CEM 1-3 and CEM 3-13) or together (CEM 2-9) were incubated with 7x concentrated supernatants from mock-(-) or heregulin-transfected (+) COS-1 cells. Solubilized cells were immunoprecipitated (IP) with anti-phosphotyrosine Mab (PY20) ; in Figure 17A, HER2-specific anti-HER2 Mab (Ab-2) ; in Figure 17B,
  • CHO/HER4 or CH0/HER2 cells for 2 h at 4° C. Washed cells were cross-linked with BS , lysed, and the proteins separated using 7% PAGE. Labeled bands were detected on the phosphorimager. Molecular weight markers are shown on the left.
  • Figures 19A through 19D Purification of p45 from HepG2 conditioned media. Column fractions were tested for their potential to induce differentiation of MDA-MB-453 cells. Active fractions were pooled as indicated by an horizontal bar. Figure 19A,
  • Figures 21A through 21C Stimulation of tyrosine phosphorylation by p45.
  • Figure 21A Size exclusion column fractions were tested on MDA-MB-453 cells for the induction of tyrosine phosphorylation. Cell lysates were then electrophoresed on a 4-15% polyacrylamide gel. After transfer to nitrocellulose, proteins were probed with a phosphotyrosine antibody and phosphoproteins detected by chemiluminescence.
  • FIG. 21B The molecular mass of the predominantly phosphorylated protein is indicated.
  • Figure 21B the experiments were performed on cells that had been transfected with expression plasmids for either HER4 (CHO/HER4) or HER2 (CH0/HER2) . Cell monolayers were incubated in the absence or the presence of p45 (size exclusion column fraction 32, 100 ng/ml) . Samples were then processed as indicated in Figure 21A except that a 7.5% polyacrylamide gel was used to separate the CHO/HER2 cell lysates.
  • Figure 21C CHO/HER2 cells were incubated in the presence or the absence of N29 monoclonal antibody to the extracellular domain of pl85 er .
  • Cell lysates were immunopjrreecciipitated with the Ab-3 monoclonal antibody to pl85.
  • erb 2 Precipitated proteins were subjected to SDS-PAGE, and phosphoproteins were detected as indicated under Section 13.4. , supra .
  • Figures 22A and 22B Binding and cross-linking of 125 I-p45 to CHO-KI, CHO-HER2 and CHO/HER4 cells.
  • I-p45 was incubated with cell monolayers for 2 h at 4° C. Nonspecific binding was subtracted from all cell-associated radioactivity data values. A Scatchard plot as well as a saturation curve of the binding data are shown.
  • Figure 22B Covalent cross- linking. I-p45 was added to the cells in the presence or absence of an excess of unlabeled p45 for 2 h at 4° C. After washing of the cells to remove unbound iodinated material, the cross-linking reagent bis-(sulfosuccinimidyl) -suberate was added to the cells for 45 min. at 4° C. Cells were lysed and
  • FIGS 23A and 23B Construction of the HAR-TX ⁇ 2 expression plasmid, encoding the hydrophilic leader sequence of amphiregulin (AR) , heregulin ⁇ 2, and PE40, under control of the IPTG inducible T7 promoter;
  • Figure 23A schematic diagram of the expression
  • HAR-TX ⁇ 2 composed of the AR leader sequence and rat heregulin ⁇ 2 [SEQ ID No:40].
  • Figures 24A and 24B cDNA sequence [SEQ ID 0 No: 41] and deduced amino acid sequence [SEQ ID No:42] of the chimera HAR-TX ⁇ 2 , comprising the amphiregulin (AR) leader sequence and the coding sequences of rat heregulin Pseudomona ⁇ exotoxin PE40.
  • the linker sequence between the two portions is indicated by a 5 bar above the sequence, the ligand portion is located at the 5' (N-terminal) , the PE40 exotoxin portion is located at the 3' (C-terminal) part of the sequence. Nucleotides are numbered on the right side, and amino acids are numbered below the sequence. 0 Figure 25.
  • HAR-TX b2 protein Purification of the chimeric HAR-TX b2 protein: shown is a Coo assie brilliant blue stained SDS-PAGE (4-20%) of the different purification steps. Lanes 1 - 5 have been loaded under reducing conditions. Lane 1, MW standards; lane 2, refolded 5 HAR-TX ⁇ 2, 2Ox concentrated; lane 3, POROS HS flow- through, 20x concentrated; lane 4, POROS HS eluate; lane 5, Source 15S eluate (pure HAR-TX ⁇ 2, 2 ⁇ g) ; lane
  • FIG. 26 Membrane-based ELISA binding analysis, performed to determine the binding activity of the purified HAR-TX ⁇ 2 protein. Binding of HAR-TX ⁇ 2 (O) and PE40 (•) to membranes prepared from the HER4 expressing human breast carcinoma cell line.
  • Figure 27 HAR-TX b ⁇ 2 induced tyrosine phosphorylation in transfected CEM cells.
  • the arrow indicates the phosphorylated receptor band, the molecular weight is indicated in kDA.
  • Figures 28A and 28B Cytotoxic effect of HAR-TX ⁇ 2 on tumor cell lines.
  • Figure 28A following 48 hours incubation with HAR-TX ⁇ 2, the cell killing effect of HAR-TX ⁇ 2 on the tumor cell lines LNCaP ( ⁇ ) , AU565 (O) , SKBR3 (•) , and SKOV3 (, ) by quantification of fluorescent calcein cleaved from calcein-AM.
  • FIG. 28B Competitive cytotoxicity of HAR-TX ⁇ 2 with heregulin ⁇ 2-Ig.
  • LNCaP cells were co-incubated with 50 ng/ml HAR-TX ⁇ 2 and increasing concentrations (2-5000 ng/ml) of either heregulin ⁇ 2-Ig ( Z ) or L6-Ig ( ⁇ ) .
  • the data represent the mean of triplicate assays.
  • Figure 29 HAR-TX ⁇ 2 induced tyrosine phosphorylation in tumor cells expressing HER3 (L2987) or co-expressing HER2 and HER3 (H3396) . Cells were incubated in the presence (+) or in the absence (-) of
  • HAR-TX ⁇ 2 solubilized, and immunoblotted with the monoclonal anti-phosphotyrosine antibody PY20.
  • Phosphorylated receptors are indicated by an arrow, the molecular weight is indicated in kDa.
  • HER4/pl80 erbB4 (“HER4"), a closely related yet distinct member of the Human EGF Receptor (HER) /neu subfamily of receptor tyrosine kinases, as well as HER4-encoding polynucleotides (e.g., cDNAs, geno ic DNAs, RNAs, anti-sense RNAs, etc.) , the production of mature and precursor forms of HER4 from a HER4 polynucleotide coding sequence, recombinant HER4 expression vectors, HER4 analogues and derivatives, anti-HER4 antibodies, HER4 ligands, and diagnostic and therapeutic uses of HER4 polynucleotides, polypeptides, ligands, and antibodies in the field of human oncology and neurobiology.
  • HER4-encoding polynucleotides e.g., cDNAs, geno ic DNAs, RNAs, anti-sense RNA
  • HER2 has been reported to be associated with a wide variety of human malignancies, thus the understanding of its activation mechanisms as well as the identification of molecules involved are of particular clinical interest.
  • This invention uncovers an apparent functional relationship between the HER4 and HER2 receptors involving HER4- mediated phosphorylation of HER2 , potentially via intracellular receptor crosstalk or receptor dimerization.
  • the invention also
  • HER4 ligands capable of inducing cellular differentiation in breast carcinoma cells that appears to involve HER4-mediated phosphorylation of HER2.
  • heregulin mediates biological effects on such cells not directly through HER2 , as has been reported (Peles et al . , 1992, Cell 69:205-216) , but instead by means of a direct interaction with HER4 , and/or through an interaction with a HER2/ HER4 complex.
  • binding of heregulin to HER4 may stimulate HER2 either by heterodimer formation of these two related receptors or by intracellular receptor crosstalk.
  • HER3 has been reported to bind heregulin (see Section 2, supra ) .
  • various observations indicate that the heregulin-mediated activation of HER3 varies considerably, depending on the context of expression, suggesting that other cellular components may be involved in the modulation of HER3 activity (reviewed in: Carraway and Cantley, 1994, Cell 78:5-8) .
  • the practice of the present invention utilizes standard techniques of molecular biology and molecular cloning, microbiology, immunology, and recombinant DNA known in the art.
  • One aspect of the present invention is directed to HER4 polynucleotides, including recombinant polynucleotides encoding the prototype HER4 polypeptide shown in FIG. IA and IB, polynucleotides which are related or are complementary thereto, and recombinant vectors and cell lines incorporating such recombinant polynucleotides.
  • polynucleotide refers to a polynucleotide of genomic, cDNA, synthetic or semisynthetic origin which, by virtue of its origin or manipulation, is not associated with any portion of the polynucleotide with which it is associated in nature, and may be linked to a polynucleotide other than that to which it is linked in nature, and includes single or double stranded polymers of ribonucleotides, deoxyribonucleotides, nucleotide analogs, or combinations thereof.
  • the term also includes various modifications known in the art, including but not limited to radioactive and chemical labels, methylation, caps, internucleotide modifications such as those with charged linkages (e.g., phosphorothothioates, phosphorodithothioates, etc.) and uncharged linkages (e . g . , methyl phosphonates , phosphotriesters, phosphoamidites, carbamites, etc.), as well as those containing pendant moeties, intercalcators, chelators, alkylators, etc.
  • charged linkages e.g., phosphorothothioates, phosphorodithothioates, etc.
  • uncharged linkages e.g . methyl phosphonates , phosphotriesters, phosphoamidites, carbamites, etc.
  • HER4 polynucleotides are those having a contiguous stretch of about 200 or more nucleotides and sharing at least about 80% homology to a corresponding sequence of nucleotides within the nucleotide sequence disclosed in FIG. IA and IB.
  • HER4 polynucleotides and vectors are provided in example Sections 6 and 7, infra .
  • HER4 polynucleotides may be obtained using a variety of general techniques known in the art, including molecular cloning and chemical synthetic methods. One method by which the molecular cloning of cDNAs encoding the prototype HER4 polypeptide of the invention (FIG.
  • IA and I B are described by way of example in Section 6., infra .
  • conserveed regions of the sequences of EGFR, HER2 , HER3 , and Xmrk are used for selection of the degenerate oligonucleotide primers which are then used to isolate HER4. Since many of these sequences have extended regions of amino acid identity, it is difficult to determine if a short PCR fragment represents a unique molecule or merely the species-specific counterpart of EGFR, HER2 , or HER3. Often the species differences for one protein are as great as the differences within species for two distinct proteins.
  • fish Xmrk has regions of 47/55 (85%) amino acid identity to human EGFR, suggesting it might be the fish EGFR, however isolation of another clone that has an amino acid sequence identical to Xmrk in this region (57/57) shows a much higher homology to human EGFR in its flanking sequence (92% amino acid homology) thereby suggesting that it, and not Xmrk, is the fish EGFR (Wittbrodt et al . , 1989, Nature 342:415-421).
  • HER4 polynucleotides may be obtained from a variety of cell sources which produce HER4-like activities and/or which express HER4-encoding mRNA .
  • suitable human cell sources for HER4 polynucleotides including but not limited to brain, cerebellum, pituitary, heart, skeletal muscle, and a variety of breast carcinoma cell lines (see Section 6. , infra ) .
  • polynucleotides encoding HER4 polypeptides may be obtained by cD ⁇ A cloning from R ⁇ A isolated and purified from such cell sources or by genomic cloning.
  • Either cD ⁇ A or genomic libraries of clones may be prepared using techniques well known in the art and may be screened for particular HER4- encoding D ⁇ As with nucleotide probes which are substantially complementary to any portion of the HER4 gene.
  • Various PCR cloning techniques may also be used to obtain the HER4 polynucleotides of the invention.
  • a number of PCR cloning protocols suitable for the isolation of HER4 polynucleotides have been reported in the literature (see, for example, PCR protocols: A
  • polynucleotides containing the entire coding region of the desired HER4 may be isolated as full length clones or prepared by splicing two or more polynucleotides together.
  • HER4-encoding D ⁇ As may be synthesized in whole or in part by chemical synthesis using techniques standard in the art. Due to the inherent degeneracy of nucleotide coding sequences, any polynucleotide encoding the desired HER4 polypeptide may be used for recombinant expression.
  • the nucleotide sequence encoding the prototype HER4 of the invention provided in FIG. IA and IB may be altered by substituting nucleotides such that the same HER4 product is obtained.
  • the invention also provides a number of useful applications of the HER4 polynucleotides of the invention, including but not limited to their use in the preparation of HER4 expression vectors, primers and probes to detect and/or clone HER4, and diagnostic reagents. Diagnostics based upon HER4 polynucleotides include various hybridization and PCR assays known in the art, utilizing HER4 polynucleotides as primers or probes, as appropriate.
  • One particular aspect of the invention relates to a PCR kit comprising a pair of primers capable of priming cDNA synthesis in a PCR reaction, wherein each of the primers is a HER4 polynucleotide of the invention.
  • Such a kit may be useful in the diagnosis of certain human cancers which are characterized by aberrant HER4 expression.
  • certain human carcinomas may overexpress HER4 relative to their normal cell counterparts, such as human carcinomas of the breast.
  • detection of HER4 overexpression mRNA in breast tissue may be an indication of neoplasia.
  • human carcinomas characterized by overexpression of HER2 and expression or overexpression of HER4 may be diagnosed by a polynucleotide-based assay kit capable of detecting both HER2 and HER4 mRNAs, such a kit comprising, for example, a set of PCR primer pairs derived from divergent sequences in the HER2 and HER4 genes, respectively.
  • HER4 polypeptides including the prototype HER4 polypeptide provided herein, as well as polypeptides derived from or having substantial homology to the amino acid sequence of the prototype HER4 molecule.
  • polypeptide in this context refers to a polypeptide prepared by synthetic or recombinant means, or which is isolated from natural sources.
  • substantially homologous in this context refers to polypeptides of about 80 or more amino acids sharing greater than about 90% amino acid homology to a corresponding contiguous amino acid sequence in the prototype HER4 primary structure (FIG. IA and IB) .
  • prototype HER4 refers to a polypeptide having the amino acid sequence of precursor or mature HER4 as provided in FIG. IA and IB, which is encoded by the consensus cDNA nucleotide sequence also provided therein, or by any polynucleotide sequence which encodes the same amino acid sequence.
  • HER4 polypeptides of the invention may contain deletions, additions or substitutions of amino acid residues relative to the sequence of the prototype HER4 depicted in FIG. IA and IB which result in silent changes thus producing a bioactive product.
  • amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or the amphipathic nature of the resides involved.
  • negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; amino acids with uncharged polar head groups or nonpolar head groups having similar hydrophilicity values include the following: leucine, isoleucine, valine; glycine, alanine; asparagine, glutamine; serine, threonine; phenylalanine, tyrosine.
  • the HER4 polypeptide depicted in FIG. IA and IB has all of the fundamental structural features characterizing the EGFR-family of receptor tyrosine kinases (Hanks et al . , 1988, Science 241:42-52) .
  • the precursor contains a single hydrophobic stretch of 26 amino acids characteristic of a transmembrane region that bisects the protein into a 625 amino acid extracellular ligand binding domain, and a 633 amino acid C-terminal cytoplasmic domain.
  • the ligand binding domain can be further divided into 4 subdomains (I - IV) , including two cysteine-rich regions (II, residues 186-334; and IV, residues 496- 633) , and two flanking domains (I, residues 29-185; and III, residues 335-495) that may define specificity for ligand binding (Lax et al . , 1988, Mol. Cell. Biol. 8:1970-78).
  • the extracellular domain of HER4 is most similar to HER3 , where domains II-IV of HER4 share 56- 67% identity to the respective domains of HER3.
  • the same regions of EGFR and HER2 exhibit 43-51% and 34-46% homology to HER4 , respectively (FIG.
  • HER4 conserves all 50 cysteines present in the extracellular portion of EGFR, HER2, and HER3 , except that the HER2 protein lacks the fourth cysteine in domain IV.
  • There are 11 potential N-linked glycosylation sites in HER4 conserving 4 of 12 potential sites in EGFR, 3 of 8 sites in HER2 , and 4 of 10 sites in HER3.
  • HER4 Following the transmembrane domain of HER4 is a cytoplasmic juxtamembrane region of 37 amino acids. This region shares the highest degree of homology with EGFR (73% amino acid identity) and contains two consensus protein kinase C phosphorylation sites at amino acid residue numbers 679 (Serine) and 699 (Threonine) in the FIG. IA and IB sequence, the latter of which is present in EGFR and HER2. Notably, HER4 lacks a site analogous to Thr654 of EGFR. Phosphorylation of this residue in the EGFR appears to block ligand-induced internalization and plays an important role in its transmembrane signaling (Livneh et al .
  • HER4 also contains Thr692 analogous to Thr694 of HER2. This threonine is absent in EGFR and HER3 and has been proposed to impart cell-type specificity to the mitogenic and transforming activity of the HER2 kinase (DiFiore et al . 1992, EMBO J. 11:3927-33).
  • the juxta embrane region of HER4 also contains a MAP kinase consensus phosphorylation site at amino acid number 699 (Threonine) , in a position homologous to Thr699 of EGFR which is phosphorylated by MAP kinase in response to EGF stimulation (Takishima et al . , 1991, Proc. Natl. Acad. Sci. U.S.A. 88:2520-25).
  • the remaining cytoplasmic portion of HER4 consists of a 276 amino acid tyrosine kinase domain, an acidic helical structure of 38 amino acids that is homologous to a domain required for ligand-induced internalization of the EGFR (Chen et al . , 1989, Cell 59:33-43), and a 282 amino acid region containing 18 tyrosine residues characteristic of the autophosphorylation domains of other EGFR-related proteins (FIG. 6A and 6B) .
  • the 276 amino acid tyrosine kinase domain conserves all the diagnostic structural motifs of a tyrosine kinase, and is most related to the catalytic domains of EGFR (79% identity) and HER2 (77% identity) , and to a lesser degree, HER3 (63% identity) . In this same region, EGFR and HER2 share 83% identity.
  • Examples of the various conserved structural motifs include the following: the ATP-binding motif (GXGXXG) [SEQ ID No:11] with a distal lysine residue that is predicted to be involved in the phosphotransfer reaction (Hanks et al .
  • the HER4 polypeptides of the invention may be produced by the cloning and expression of DNA encoding the desired HER4 polypeptide.
  • DNA may be ligated into a number of expression vectors well known in the art and suitable for use in a number of acceptable host organisms, in fused or mature form, and may contain a signal sequence to permit secretion.
  • Both prokaryotic and eukaryotic host expression systems may be employed in the production of recombinant HER4 polypeptides.
  • the prototype HER4 precursor coding sequence or its functional equivalent may be used in a host cell capable of processing the precursor correctly.
  • the coding sequence for mature HER4 may be used to directly express the mature HER4 molecule.
  • Functional equivalents of the HER4 precursor coding sequence include any DNA sequence which, when expressed inside the appropriate host cell, is capable of directing the synthesis, processing and/or export of HER4.
  • Production of a HER4 polypeptide using recombinant DNA technology may be divided into a four- step process for the purposes of description: (1) isolation or generation of DNA encoding the desired HER4 polypeptide; (2) construction of an expression vector capable of directing the synthesis of the desired HER4 polypeptide; (3) transfection or transformation of appropriate host cells capable of replicating and expressing the HER4 coding sequence and/or processing the initial product to produce the desired HER4 polypeptide; and (4) identification and purification of the desired HER4 product.
  • HER4-encoding DNA may be used to construct recombinant expression vectors which will direct the expression of the desired HER4 polypeptide product.
  • DNA encoding the prototype HER4 polypeptide (FIG. IA and IB) , or fragments or functional equivalents thereof, may be used to generate the recombinant molecules which will direct the expression of the recombinant HER4 product in appropriate host cells.
  • HER4-encoding nucleotide sequences may be obtained from a variety of cell sources which produce HER4-like activities and/or which express HER4-encoding mRNA.
  • HER4-encoding cDNAs may be obtained from the breast adenocarcinoma cell line MDA-MB-453 (ATCC HTB131) as described in Section 6., infra .
  • MDA-MB-453 ATCC HTB131
  • a number of human cell sources are suitable for obtaining HER4 cDNAs, including but not limited to various epidermoid and breast carcinoma cells, and normal heart, kidney, 5 and brain cells (see Section 6.2.3., infra ) .
  • the HER4 coding sequence may be obtained by molecular cloning from RNA isolated and purified from such cell sources or by genomic cloning. Either cDNA or genomic libraries of clones may be prepared using
  • HER4-encoding DNAs with nucleotide probes which are substantially complementary to any portion of the HER4 gene.
  • cDNA or genomic DNA may be used as templates for PCR cloning
  • Full length clones i.e., those containing the entire coding region of the desired HER4 may be selected for constructing expression vectors, or overlapping cDNAs can be ligated together to form a complete coding
  • HER4-encoding DNAs may be synthesized in whole or in part by chemical synthesis using techniques standard in the art.
  • HER4 polypeptides may be utilized equally well by those skilled in the art for the recombinant expression of HER4 polypeptides.
  • Such systems include but are not limited to microorganisms
  • bacteria transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing the desired HER4 coding sequence such as bacteria transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing the desired HER4 coding sequence; yeast transformed with recombinant yeast expression vectors containing the desired HER4 coding __ sequence; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing the desired HER4 coding sequence; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing the desired HER4 coding sequence; or animal cell systems infected with recombinant virus expression vectors (e.g., adenovirus, vaccinia virus) including cell
  • the expression elements of these vectors vary in their strength and specificities. Depending on the host/vector system utilized, any one of a number of suitable transcription and translation elements may be used. For instance, when cloning in mammalian cell systems, promoters isolated from the genome of mammalian cells, (e.g., mouse metallothionein promoter) or from viruses that grow in these cells, (e . g. , vaccinia virus 7.5K promoter or Moloney murine sarcoma virus long terminal repeat) may be used. Promoters produced by recombinant DNA or synthetic techniques may also be used to provide for transcription of the inserted sequences.
  • promoters isolated from the genome of mammalian cells e.g., mouse metallothionein promoter
  • viruses that grow in these cells e. g. , vaccinia virus 7.5K promoter or Moloney murine sarcoma virus long terminal repeat
  • Promoters produced by recombinant DNA or synthetic techniques may also be used
  • Specific initiation signals are also required for sufficient translation of inserted protein coding sequences. These signals include the ATG initiation codon and adjacent sequences. In cases where the entire HER4 gene including its own initiation codon and adjacent sequences are inserted into the appropriate expression vectors, no additional translational control signals may be needed. However, in cases where only a portion of the coding sequence is inserted, exogenous translational control signals, including the ATG initiation codon must be provided. Furthermore, the initiation codon must be in phase with the reading frame of the HER4 coding sequences to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of transcription attenuation sequences, enhancer elements, etc.
  • the desired HER4 coding sequence may be ligated to an adenovirus transcription/translation control complex, e . g . , the late promoter and tripartite leader sequence.
  • This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g., region E3 or E4) will result in a recombinant virus that is viable and capable of expressing HER4 in infected hosts.
  • the vaccinia 7.5K promoter may be used.
  • An alternative expression system which could be used to express HER4 is an insect system.
  • Autographa californica nuclear polyhidrosis virus (AcNPV) is used as a vector to express foreign genes.
  • the virus grows in Spodoptera fr giperda cells.
  • the HER4 coding sequence may be cloned into non-essential regions (for example the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (for example the polyhedrin promoter) .
  • Successful insertion of the HER4 coding sequence will result in inactivation of the polyhedrin gene and production of non-occluded recombinant virus (i . e . , virus lacking the proteinaceous coat encoded by the polyhedrin gene) .
  • a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Expression from certain promoters can be elevated in the presence of certain inducers (e.g., zinc and cadmium ions for metallothionein promoters) . Therefore, expression of the recombinant HER4 polypeptide may be controlled. This is important if the protein product of the cloned foreign gene is lethal to host cells. Furthermore, modifications (e.g., phosphorylation) and processing (e . g . , cleavage) of protein products are important for the function of the protein. Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of protein. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed.
  • inducers e.g., zinc and cadmium ions for metallothionein promoters
  • the host cells which contain the recombinant coding sequence and which express the desired HER4 polypeptide product may be identified by at least four general approaches (a) DNA-DNA, DNA-RNA or RNA- antisense RNA hybridization; (b) the presence or absence of "marker" gene functions; (c) assessing the level of transcription as measured by the expression of HER4 mRNA transcripts in the host cell; and (d) detection of the HER4 product as measured by immunoassay and, ultimately, by its biological activities.
  • the presence of HER4 coding sequences inserted into expression vectors can be detected by DNA-DNA hybridization using hybridization probes and/or primers for PCR reactions comprising polynucleotides that are homologous to the HER4 coding sequence.
  • the recombinant expression vector/host system can be identified and selected based upon the presence or absence of certain "marker" gene functions (e.g., thymidine kinase activity, resistance to antibiotics, resistance to methotrexate (MTX) , resistance to methionine sulfoximine (MSX) , transformation phenotype, occlusion body formation in baculovirus, etc.) .
  • certain "marker” gene functions e.g., thymidine kinase activity, resistance to antibiotics, resistance to methotrexate (MTX) , resistance to methionine sulfoximine (MSX) , transformation phenotype, occlusion body formation in baculovirus, etc.
  • a marker gene can be placed in tandem with the HER4 sequence under the control of the same or different promoter used to control the expression of the HER4 coding sequence. Expression of the marker in response to induction or selection indicates expression of the HER4 coding sequence.
  • a HER4 expression vector incorporating glutamine synthetase as a selectable marker is constructed, used to transfect CHO cells, and amplified expression of HER4 in CHO cells is obtained by selection with increasing concentration of MSX.
  • transcriptional activity for the HER4 coding region can be assessed by hybridization assays.
  • polyadenylated RNA can be isolated and analyzed by Northern blot using a probe homologous to the HER4 coding sequence or particular portions thereof.
  • total nucleic acids of the host cell may be extracted and assayed for hybridization to such probes.
  • the expression of HER4 can be assessed immunologically, for example by Western blots, immunoa ⁇ says such as radioimmunoprecipitation, enzyme-linked immunoassays and the like.
  • expression of HER4 may be assessed by detecting a biologically active product. Where the host cell secretes the gene product the cell free media obtained from the cultured transfectant host cell may be assayed for HER4 activity. Where the gene product is not secreted, cell lysates may be assayed for such activity. In either case, assays which measure ligand binding to HER4, HER4 phosphorylation, or other bioactivities of HER4 may be used.
  • Anti-HE Antibodies The invention is also directed to polyclonal and monoclonal antibodies which recognize epitopes of HER4 polypeptides.
  • Anti-HER4 antibodies are expected to have a variety of useful applications in the field of oncology, several of which are described generally below. More detailed and specific descriptions of various uses for anti-HER4 antibodies are provided in the sections and subsections which follow. Briefly, anti-HER4 antibodies may be used for the detection and quantification of HER4 polypeptide expression in cultured cells, tissue samples, and in vivo . Such immunological detection of HER4 may be used, for example, to identify, monitor, and assist in the prognosis of neoplasms characterized by aberrant or attenuated HER4 expression and/or function.
  • monoclonal antibodies recognizing epitopes from different parts of the HER4 structure may be used to detect and/or distinguish between native HER4 and various subcomponent and/or mutant forms of the molecule.
  • Anti-HER4 antibody preparations are also envisioned as useful biomodulatory agents capable of effectively treating particular human cancers.
  • a number of industrial and research applications will be obvious to those skilled in the art, including, for example, the use of anti-HER4 antibodies as affinity reagents for the purification of HER4 polypeptides, and as immunological probes for elucidating the biosynthesis, metabolism and biological functions of HER4.
  • Anti-HER4 antibodies may be useful for influencing cell functions and behaviors which are directly or indirectly mediated by HER4.
  • modulation of HER4 biological activity with anti-HER4 antibodies may influence HER2 activation and, as a consequence, modulate intracellular signals generated by HER2.
  • anti-HER4 antibodies may be useful to effectively block ligand- induced, HER4-mediated activation of HER2 , thereby affecting HER2 biological activity.
  • anti- HER4 antibodies capable of acting as HER4 ligands may be used to trigger HER4 biological activity and/or initiate a ligand-induced, HER4-mediated effect on HER2 biological activity, resulting in a cellular response such as differentiation, growth inhibition, etc.
  • anti-HER4 antibodies conjugated to cytotoxic compounds may be used to selectively target such compounds to tumor cells expressing HER4, resulting in tumor cell death and reduction or eradication of the tumor.
  • toxin-conjugated antibodies having the capacity to bind to HER4 and internalize into such cells are administered systemically for targeted cytotoxic effect.
  • the preparation and use of radionuclide and toxin conjugated anti-HER4 antibodies are further described in Section 5.5., infra .
  • HER4 is expressed in certain human carcinomas in which HER2 overexpression is present. Therefore, anti-HER4 antibodies may have growth and differentiation regulatory effects on cells which overexpress HER2 in combination with HER4 expression, including but not limited to breast adenocarcinoma cells. Accordingly, this invention includes antibodies capable of binding to the HER4 receptor and modulating HER2 or HER2-HER4 functionality, thereby affecting a response in the target cell.
  • agents capable of selectively and specifically affecting the intracellular molecular interaction between these two receptors may be conjugated to internalizing anti-HER4 antibodies. The specificity of such agents may result in biological effects only in cells which co-express HER2 and HER4, such as breast cancer cells.
  • polyclonal antibodies to epitopes of HER4.
  • a number of host animals are acceptable for the generation of anti-HER4 antibodies by immunization with one or more injections of a HER4 polypeptide preparation, including but not limited to rabbits, mice, rats, etc.
  • adjuvants may be used to increase the immunological response in the host animal, depending on the host species, including but not limited to Freund's (complete and incomplete) , mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, oil emulsions, keyhole lympet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum.
  • BCG Bacille Calmette-Guerin
  • Corynebacterium parvum bacille Calmette-Guerin
  • a monoclonal antibody to an epitope of HER4 may be prepared by using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include but are not limited to the hybridoma technique originally described by Kohler and Milstein (1975, Nature 256, 495-497) , and the more recent human B-cell hybridoma technique (Kosbor et al . , 1983, Immunolo ⁇ v Today 4:72) and EBV-hybridoma technique (Cole et al . , 1985, Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc. , pp. 77-96) . In addition, techniques developed for the production of "chimeric antibodies" by splicing the genes from a mouse antibody molecule of appropriate antigen specificity together with genes from a human antibody molecule of appropriate biological activity may be used (Morrison et al . ,
  • humanized anti-HER2 monoclonal antibody may also be employed in the production of humanized anti-HER4 antibodies (Carter et al . , 1992, Proc. Natl. Acad. Sci. U.S.A. 89:4285- 89) .
  • techniques for generating a recombinant phage library of random combinations of heavy and light regions may be used to prepare recombinant anti-HER4 antibodies (e . g . , Huse et al . , 1989, Science 246:1275-81).
  • anti-HER4 monoclonal antibodies may be generated by immunization of mice with cells selectively overexpressing HER4 (e .
  • CHO/HER4 21-2 cells as deposited with the ATCC or with partially purified recombinant HER4 polypeptides.
  • the full length HER4 polypeptide (FIG. IA and IB) may be expressed in Baculovirus systems, and membrane fractions of the recombinant cells used to immunize mice. Hybridomas are then screened on CHO/HER4 cells (e.g., CHO HER4 21-2 cells as deposited with the ATCC) to identify monoclonal antibodies reactive with the extracellular domain of HER4.
  • Such monoclonal antibodies may be evaluated for their ability to block NDF, or HepG2-differentiating factor, binding to HER4; for their ability to bind and stay resident on the cell surface, or to internalize into cells expressing HER4; and for their ability to directly upregulate or downregulate HER4 tyrosine autophosphorylation and/or to directly induce a HER4- mediated signal resulting in modulation of cell growth or differentiation.
  • monoclonal antibodies N28 and N29 directed to HER2, specifically bind HER2 with high affinity.
  • monoclonal N29 binding results in receptor internalization and downregulation, morphologic differentiation, and inhibition of HER2 expressing tumor cells in athymic mice.
  • HER4-Ig soluble recombinant HER4-Immunoglobulin
  • the soluble HER4-Ig fusion protein may then be used to screen phage libraries designed so that all available combinations of a variable domain of the antibody binding site are presented on the surfaces of the phages in the library.
  • Recombinant anti-HER4 antibodies may be propagated from phage which specifically recognize the HER4-Ig fusion protein.
  • Antibody fragments which contain the idiotype of the molecule may be generated by known techniques.
  • such fragments include but are not limited to: the F(ab)'E2 fragment which can be produced by pepsin digestion of the intact antibody molecule; the Fab' fragments which can be generated by reducing the disulfide bridges of the F(ab')2 fragment, and the two Fab fragments which can be generated by treating the antibody molecule with papain and a reducing agent.
  • Fab expression libraries may be constructed (Huse et al . , 1989, Science. 246:1275-1281) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity to HER4 protein.
  • HER4 ligands are capable of binding to the 180K transmembrane protein, HER4/pl80 erB4 or functional analogues thereof, and activating tyrosine kinase activity.
  • Functional analogues of HER4/pl80 ⁇ ri * 4 -ligands are capable of activating HER4 tyrosine kinase activity.
  • Activation of the tyrosine kinase activity may stimulate autophosphorylation and may affect a biological activity mediated by HER4. It has been observed in systems described in Section 12 and 13 that binding of HER4 ligands to HER4 triggers tyrosine phosphorylation and affects differentiation of breast cancer cells.
  • the HER4 ligands of the present invention include NDF, a 44 kDa glycoprotein isolated from ras- transformed rat fibroblasts (Wen et al . , 1992, Cell 69:559-572); heregulin, its human homologue, which exists as multiple isoforms (Peles et al . , 1992, Cell 69:205-218 and Holmes et al .
  • HER4 ligands of the present invention can be prepared by synthetic or recombinant means, or can be 5 isolated from natural sources.
  • the HER4 ligand of the present invention may contain deletions, additions or substitutions of amino acid residues relative to the sequence of NDF, p45 or other heregulins or any HER4 ligand known in the art as long as the ligand 0 maintains HER4 receptor binding and tyrosine kinase activation capacity.
  • Such amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or the amphipathic nature of the resides involved.
  • negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; amino acids with uncharged polar head groups or nonpolar head groups having similar hydrophilicity values include 0 the following: leucine, isoleucine, valine; glycine, alanine; asparagine, gluta ine; serine, threonine; phenylalanine, tyrosine.
  • the HER4 ligands of the present invention may be produced by the cloning and expression of DNA encoding the desired HER4 ligand. Such DNA may be ligated into a number of expression vectors well known in the art
  • HER4 ligands suitable for use in a number of acceptable host organisms, in fused or mature form, and may contain a signal sequence to permit secretion. Both prokaryotic and eukaryotic host expression systems may be employed in the production of recombinant HER4 ligands.
  • a HER4 ligand precursor coding sequence or its functional equivalent may be used in a host cell capable of processing the precursor correctly.
  • the coding sequence for a mature HER4 ligand may be used to directly express the mature HER4 ligand molecule.
  • Functional equivalents of the HER4 ligand precursor coding sequence include any DNA sequence which, when expressed inside the appropriate host cell, is capable of directing the synthesis, processing and/or export of the HER4 ligand.
  • Production of a HER4 ligand using recombinant DNA technology may be divided into a four-step process for the purposes of description: (1) isolation or generation of DNA encoding the desired HER4 ligand; (2) construction of an expression vector capable of directing the synthesis of the desired HER4 ligand; (3) transfection or transformation of appropriate host cells capable of replicating and expressing the HER4 ligand coding sequence and/or processing the initial product to produce the desired HER4 ligand; and (4) identification and purification of the desired HER4 ligand product.
  • HER4 ligand-encoding nucleic acid sequences may be obtained from human hepatocellular carcinoma cell lines, specifically the HepG2 cells available from the ATCC, accession number HB 8065.
  • a number of human cell sources are suitable for obtaining HER4 ligand nucleic acids, including MDA-MB-231 cells available from the ATCC, accession number HTB 26, brain tissue (Falls et al . , 1993, Cell 72:801-815 and Marchionni et al .
  • HER4/pl80 erB4 any cell source capable of producing an activity capable of binding to the 180K transmembrane protein, HER4/pl80 erB4 , encoded by the HER4/ERBB4 gene and activating tyrosine kinase activity.
  • Methods useful in assaying for the identification of HER4 ligands is disclosed in Section 5.8., infra .
  • the techniques disclosed in Sections 5.3.2. and 5.3.3., infra apply to the construction of HER4 ligand expression vectors and identification of recombinant transformants expressing HER4 ligand gene products.
  • the present invention is also directed to polyclonal and monoclonal antibodies which recognize eptitopes of HER4 ligand polypeptides.
  • Anti-HER4 ligand antibodies are expected to have a variety of useful applications in the field of oncology. Briefly, anti-HER4 ligand antibodies may be used for the detection and quantification of HER4 ligand polypeptide expression in cultured cells, tissue samples, and in vivo .
  • monoclonal antibodies recognizing epitopes from different parts of the HER4 ligand structure may be used to detect and/or distinguish binding from non-binding regions of the ligand.
  • Anti-HER4 ligand antibody preparations are also envisioned as useful biomodulatory agents capable of effectively treating particular human cancers.
  • anti-HER4 ligand antibody could be used to block signal transduction mediated through HER4, thereby inhibiting undesirable biological responses.
  • anti-HER4 ligand antibodies a number of industrial and research applications will be obvious to those skilled in the art, including, for example, the use of anti-HER4 ligand antibodies as affinity reagents for the purification of HER4 ligand polypeptides, and as immunological probes for elucidating the biosynthesis, metabolism and biological functions of HER4 ligands.
  • Anti-HER4 ligand antibodies may be useful for influencing cell functions and behaviors which are directly or indirectly mediated by HER4.
  • anti-HER4 ligand antibodies may influence HER2 activation and, as a consequence, modulate intracellular signals generated by HER2.
  • anti-HER4 ligand antibodies may be useful to effectively block ligand-induced, HER4-mediated activation of HER2, thereby affecting HER2 biological activity.
  • anti-HER4 ligand antibodies capable of acting as HER4 ligands may be used to trigger HER4 biological activity and/or initiate a ligand-induced, HER4-mediated effect on HER2 biological activity, resulting in a cellular response such as differentiation, growth inhibition, etc.
  • anti-HER4 ligand antibodies conjugated to cytotoxic compounds may be used to selectively target such compounds to tumor cells expressing HER4 , resulting in tumor cell death and reduction or eradication of the tumor.
  • the invention also relates to the detection of human neoplastic conditions, particularly carcinomas of epithelial origin, and more particularly human breast carcinomas.
  • oligomers corresponding to portions of the consensus HER4 cDNA sequence provided in FIG. IA and IB are used for the quantitative detection of HER4 mRNA levels in a human biological sample, such as blood, serum, or tissue biopsy samples, using a suitable hybridization or PCR format assay, in order to detect cells or tissues expressing abnormally high levels of HER4 as an indication of neoplasia.
  • detection of HER4 mRNA may be combined with the detection HER2 mRNA overexpression, using appropriate HER2 sequences, to identify ne ⁇ plasias in which a functional relationship between HER2 and HER4 may exist.
  • labeled anti-HER4 antibodies or antibody derivatives are used to detect the presence of HER4 in biological samples, using a variety of immunoassay formats well known in the art, and may be used for in situ diagnostic radioimmunoimaging. Current diagnostic and staging techniques do not routinely provide a comprehensive scan of the body for etastatic tumors. Accordingly, anti-HER4 antibodies labeled with, for example, fluorescent, chemiluminescent, and radioactive molecules may overcome this limitation.
  • a gamma-emitting diagnostic radionuclide is attached to a monoclonal antibody which is specific for an epitope of HER4, but not significantly cross-reactive with other EGFR-family members.
  • the labeled antibody is then injected into a patient systemically, and total body imaging for the distribution and density of HER4 molecules is performed using gamma cameras, followed by localized imaging using computerized tomography or magnetic resonance imaging to confirm and/or evaluate the condition, if necessary.
  • Preferred diagnostic radionuclides include but are not limited to technetium-99m, indium-Ill, iodine-123, and iodine- 131.
  • Ab-MTs Recombinant antibody-metallothionein chimeras
  • Such Ab-MTs can be loaded with technitium-99m by virtue of the metallothionein chelating function, and may offer advantages over chemically conjugated chelators.
  • the highly conserved metallothionein structure may result in minimal immunogenicity.
  • Cell lines overexpressing a single member of the EGFR-family can be generated by transfection of a variety of parental cell types with an appropriate expression vector as described in Section 7., infra .
  • m - Candidate ligands, or partially purified preparations may be applied to such cells and assayed for receptor binding and/or activation.
  • a CHO-KI cell line transfected with a HER4 expression plasmid and lacking detectable EGFR, HER2, or HER3 may be used to screen for HER4-specific ligands.
  • a particular embodiment of such a cell line is described in Section 7. , infra , and has been deposited with the ATCC (CHO/HER4 21-2) .
  • Ligands may be identified by detection of HER4 autophosphorylation, stimulation of
  • the invention also relates to a bioassay for testing potential analogs of
  • HER4 ligands based on a capacity to affect a biological activity mediated by the HER4 receptor.
  • the invention is also directed to methods for the treatment of human cancers involving abnormal expression and/or function of HER4 and cancers in which HER2 overexpression is combined with the proximate expression of HER , including but not limited to human breast carcinomas and other neoplasms overexpressing HER4 or overexpressing HER2 in combination with expression of HER4.
  • the cancer therapy methods of the invention are generally based on treatments with unconjugated, toxin- or radionuclide- conjugated HER4 antibodies, ligands, and derivatives or fragments thereof.
  • such HER4 antibodies or ligands may be used for systemic and targeted therapy of certain cancers overexpressing HER2 and/or HER4 , such as metastatic breast cancer, with minimal toxicity to normal tissues and organs.
  • an anti-HER2 monoclonal antibody has been shown to inhibit the growth of human tumor cells overexpressing HER2 (Bacus et al . , 1992, Cancer Res. 52:2580-89) .
  • modulation of heregulin signaling through HER4 provides a means to affect the growth and differentiation of cells overexpressing HER2 , such as certain breast cancer cells, using HER4-neutralizing monoclonal antibodies, NDF/HER4 antagonists, monoclonal antibodies or ligands which act as super- agonists for HER4 activation, or agents which block the interaction between HER2 and HER4 , either by disrupting heterodimer formation or by blocking HER- mediated phosphorylation of the HER2 substrate.
  • various drugs or toxins may be conjugated to anti-HER4 antibodies and fragments thereof, such as plant and bacterial toxins.
  • ricin a cytotoxin from the Ricinis communis plant may be conjugated to an anti-HER4 antibody using methods known in the art (e.g., Blakey et al . , 1988, Pro ⁇ . Allergy 45:50-90; Marsh and Neville, 1988, J. Immunol. 140:3674-78).
  • ricin Once ricin is inside the cell cytoplasm, its A chain inhibits protein synthesis by inactivating the 60S ribosomal subunit (May et al . , 1989, EMBO J. 8:301- 08) . Immunotoxins of ricin are therefore extremely cytotoxic.
  • ricin immunotoxins are not ideally specific because the B chain can bind to virtually all cell surface receptors, and immunotoxins made with ricin A chain alone have increased specificity. Recombinant or deglycosylated forms of the ricin A chain may result in improved survival (i.e., slower clearance from circulation) of the immunotoxins.
  • Methods for conjugating ricin A chain to antibodies are known (e.g., Vitella and Thorpe, in: Seminars in Cell Biolo ⁇ v. pp 47-58; Saunders, Philadelphia 1991) .
  • Additional toxins which may be used in the formulation of immunotoxins include but are not limited to daunorubicin, methotrexate, ribosome inhibitors (e . g.
  • Immunotoxins for targeted cancer therapy may be administered by any route which will result in antibody interaction with the target cancer cells, including systemic administration and injection directly to the site of tumor.
  • Another therapeutic strategy may be the administration of immunotoxins by sustained-release systems, such as semipermeable matrices of solid hydrophobic polymers containing the therapeutic agent.
  • sustained-release materials have been established and are well known by those skilled in the art. Sustained-release capsules may, depending on their chemical nature, release immunotoxic molecules for a few weeks up to over 100 days. Depending on the chemical nature and the biological stability of the therapeutic reagent, additional strategies for protein stabilization may be employed.
  • preferred radionuclides for labeling include alpha, beta, and Auger electron emitters.
  • alpha emitters include astatine 211 and bismuth 212; beta emitters include iodine 131, rhenium 188, copper 67 and yttrium 90; and iodine 125 is an example of an Auger electron emitter.
  • purified ligand molecules may be chemically conjugated to cytotoxic substances.
  • recombinant ligand-toxins may be used to specifically target HER4 expressing cancer cells.
  • a particular embodiment of such a ligand-toxin is disclosed herein and described in more detail in Sections 5.8.2., infra , and Section 15, infra. 5.8.2.
  • HER4 expressing tumor cells may be specifically targeted and killed by contacting such tumor cells with a fusion protein comprising a cytotoxic polypeptide covalently linked to a polypeptide which is capable of activating HER4 expressed on such cells.
  • a fusion protein comprising a chimeric heregulin ⁇ 2 ligand and the cytotoxic substance PE40 is generated by expression of the corresponding chimeric coding sequence.
  • PE40 is a derivative of the Pseudomonas exotoxin PE, a potent cell killing agent made by Pseudomonas aeruginosa (Fitzgerald et al . , 1980, Cell 21:867-873).
  • the wildtype protein PE contains three domains whose functions are cell recognition, membrane translocation, and ADP ribosylation of elongation factor 2.
  • PE40 kills cells by binding to a cell surface receptor, entering the cell via an endocytotic vesicle and catalyzing ADP-ribosylation of elongation factor 2.
  • the derivative PE40 lacks the cell binding function of the wildtype protein, but still exhibits strong cytotoxic activity. Generation of PE40 fusion proteins with specific cell targeting molecules have been described (Kondo et al . , 1988, J. Biol. Chem.
  • the AR leader has no influence on the binding specificity of the recombinant heregulin-toxin.
  • Related embodiments include, for example, PE40 linked to other members of the heregulin family, like heregulin-,..l and heregulin- ⁇ , and other molecules capable of activating HER4.
  • the applicants demonstrate specificity of the cytotoxic effect of the chimeric heregulin-PE40 protein to HER4 expressing cancer cells; they include but are not limited to prostate carcinoma, bladder carcinoma, and a considerable number of different breast cancer types, including breast carcinoma cells with amplified HER2 expression.
  • PE40 provides a very potent and targeted reagent.
  • An effective therapeutic amount of heregulin- toxin will depend upon the therapeutic objectives, the route of administration, and the condition of the patient. Accordingly, dosages should be titrated and the route of administration modified as required to obtain the optimal therapeutic effect.
  • a typical daily dosage may be in the range of 0.1 mg/kg - 1 mg/kg, preferably between 0.1 and 0.5 mg/kg, with intravenous administration. For regression of solid tumors, it may take 3-5 doses, with schedules such as 3 doses, each four days apart. Also the use of sustained-release preparations (see Section 5.8.1., supra) may be considered for administration of the reagent.
  • the therapeutic efficacy of heregulin-toxin may be between 2 and 10, which means that a tumor regression effect would be expected between 2- and 10- fold below the toxic dose (see Section 15, infra ) .
  • the heregulin-toxin will be administered at a dose and frequency that achieves the desired therapeutic effect, which can be monitored using conventional assays.
  • Cancer therapy with heregulin-toxins of the invention may be combined with chemotherapy, surgery, and radiation therapy, depending on the type of tumor.
  • One advantage of using a low molecular weight toxin drug is that they are capable of targeting metastatic lesions that cannot be located and removed by surgery.
  • Heregulin-toxins may also be particularly useful on patients that are MDR (Multi Drug Resistance) positive since their mechanism of action is not inhibited by the p-glycoprotein pump of MDR positive cells as are many standard cancer therapeutic drugs.
  • MDR Multi Drug Resistance
  • HER4 ligands may include other diseases caused by deficient HER4 receptor tyrosine kinase activation rather than by hyperactivation.
  • type II diabetes mellitus is the consequence of deficient insulin- mediated signal transduction, caused by mutations in the insulin-receptor, including mutations in the ligand-binding domain (Taira et al . , 1889, Science 245:63-66; Odawara et al . , 1989, Science 245:66-68; Ober eier-Kusser et al . , 1989, J. Biol. Chem.
  • Such diseases might be treated by administration of modified ligands or ligand-analogues which re-establish a functional ligand-receptor interaction. 5.10. HER4 Analogues
  • derivatives, analogues and peptides related to HER4 are also envisioned and are within the scope of the invention.
  • Such derivatives, analogues and peptides may be used to compete with native HER4 for binding of HER4 specific ligand, thereby inhibiting HER4 signal transduction and function.
  • the inhibition of HER4 function may be utilized in several applications, including but not limited to the treatment of cancers in which HER4 biological activity is involved.
  • a series of deletion mutants in the HER4 nucleotide coding sequence depicted in FIG. IA and IB may be constructed and analyzed to determine the minimum amino acid sequence requirements for binding of a HER4 ligand.
  • Deletion mutants of the HER4 coding sequence may be constructed using methods known in the art which include but are not limited to use of nucleases and/or restriction enzymes; site-directed mutagenesis techniques, PCR, etc. The mutated polypeptides expressed may be assayed for their ability to bind HER4 ligand.
  • the DNA sequence encoding the desired HER4 analogue may then be cloned into an appropriate expression vector for overexpression in either bacteria or eukaryotic cells.
  • Peptides may be purified from cell extracts in a number of ways including but not limited to ion-exchange chromatography or affinity chromatography using HER4 ligand or antibody. Alternatively, polypeptides may be synthesized by solid phase techniques followed by cleavage from resin and purification by high performance liquid chromatography. 6.
  • EGFR and the related proteins, HER2, HER3, and Xmrk exhibit extensive amino acid homology in their tyrosine kinase domains (Kaplan et al . , 1991, Nature 350:158-160; Wen et al . , 1992, Cell 69:559-72; Holmes et al . , 1992, Science 256:1205-10; Hirai et al . , Science 1987 238:1717-20).
  • there is strict conservation of the exon-intron boundaries within the genomic regions that encode these catalytic domains (Wen et ai . , supra ; Lindberg and Hunter, 1990, Mol. Cell. Biol. 10:6316-24; and unpublished observations) .
  • oligonucleotide primers were designed based on conserved amino acids encoded by a single exon or adjacent exons from the kinase domains of these four proteins. These primers were used in a polymerase chain reaction (PCR) to isolate genomic fragments corresponding to murine EGFR, erbB2 and er_B3. In addition, a highly related DNA fragment (designated MER4) was identified as distinct from these other genes. A similar strategy was used to obtain a cDNA clone corresponding to the human homologue of MER4 from the breast cancer cell line, MDA-MB-453. Using this fragment as a probe, several breast cancer cell lines and human heart were found to be an abundant source of the EGFR-related transcript. cDNA libraries were constructed using RNA from human heart and MDA-MB-453 cells, and overlapping clones were isolated spanning the complete open reading frame of HER4/er_>B4.
  • MER4-85 one clone was identified that contained a 144 nucleotide insert corresponding to murine erj B4.
  • This 32P-labeled insert was used to isolate a 17-kilobase fragment from a murine T-cell genomic library (Stratagene, La Jolla, CA) that was found to contain two exons of the murine erbB4 gene.
  • a specific oligonucleotide (4M3070) was synthesized based on the DNA sequence of an erj B4 exon, and used in a PCR protocol with a degenerate 5'-oligonucleotide (H4PIKWMA) on a template of single stranded MDA-MB-453 cDNA. This reaction generated a 260 nucleotide fragment (pMDAPIK) corresponding to human HER4.
  • cDNA libraries were constructed in lambda ZAP II (Stratagene) from oligo(dT)- and specific-primed MDA- MB453 and human heart RNA (Plowman et al . , supra ; Plowman et al . , 1990, Mol. Cell.
  • HER4-specific clones were isolated by probing the libraries with the "P-labeled insert from pMDAPIK. To complete the cloning of the 5'-portion of HER4, we used a PCR strategy to allow for rapid amplification of cDNA ends (Plowman et ai. , supra ; Frohman et al . , 1988, Proc. Natl. Acad. Sci. U.S.A. 85:8998-9002). All cDNA clones and several PCR generated clones were sequenced on both strands using T7 polymerase with oligonucleotide primers (Tabor and Richardson, 1987, Proc. Natl. Acad. Sci. U.S.A. 84:4767-71) .
  • 3'- and 5'-HER4 specific [ ⁇ 3 P]UTP-labeled antisense RNA probes were synthesized from the linearized plasmids pHtlB1.6 (containing an 800 bp HER4 fragment beginning at nucleotide 3098) and p5'H4E7 (containing a 1 kb fragment from the 5'-end of the HER4 sequence) , respectively.
  • the Northern blot (Clontech, Palo Alto, CA) contained 2 Mg poly(A) + mRNA per lane from 8 human tissue samples immobilized on a nylon membrane.
  • the filter was prehybridized at 60° C for several hours in RNA hybridization mixture (50% formamide, 5x SSC, 0.5% SDS, lOx Denhardt's solution, 100 ⁇ g/ml denatured herring sperm DNA, 100 ⁇ g/ml tRNA, and 10 ⁇ g/ml polyadenosine) and hybridized in the same buffer at 60° C, overnight with 1-1.5 x 106 cpm/ml of 32P- labeled antisense RNA probe.
  • the filters were washed in O.lXSSC/0.1% SDS, 65° C, and exposed overnight on a Phospholmager (Molecular Dynamics, Sunnyvale, CA) .
  • RNA was isolated from a variety of human cell lines, fresh frozen tissues, and primary tumors. Single stranded cDNA was synthesized from 10 ⁇ g of each RNA by priming with an oligonucleotide containing a T17 track on its 3 '-end
  • FIG. IA and IB The complete HER4 nucleotide sequence assembled from these cDNAs is shown in FIG. IA and IB and contains a single open reading frame encoding a polypeptide of 1308 amino acids.
  • the HER4 coding region is flanked by a 33 nucleotide 5'-untranslated region and a 1517 nucleotide 3'-untranslated region ending with a poly(A) tail.
  • a 25 amino acid hydrophobic signal sequence follows a consensus initiating methionine at position number 1 in the amino acid sequence depicted in FIG. IA and IB. In relation to this signal sequence, the mature HER4 polypeptide would be predicted to begin at amino acid residue number 26 in the sequence depicted in FIG.
  • the prototype mature HER4 of the invention is a polypeptide of 1284 amino acids, having a calculated Mr of 144,260 daltons and an amino acid sequence corresponding to residues 26 through 1309 in FIG. IA and IB.
  • HER4 nucleotide sequence is unique, and revealed a 60/64 amino acid identity with HER2 and a 54/54 amino acid identity to a fragment of a rat EGFR homolog, tyro-2.
  • the first alternative type of cDNA was identical to the consensus HER4 nucleotide sequence up to nucleotide 3168 (encoding Arg at amino acid position 1045 in the FIG. IA and IB) and then abruptly diverges into an apparently unrelated sequence (FIG. 2A and 2B, FIG. 4) . Downstream from this residue the open reading frame continues for another 13 amino acids before reaching a stop codon followed by a 2 kb 3'- untranslated sequence and poly(A) tail. This cDNA would be predicted to result in a HER4 variant having the C-terminal autophosphorylation domain of the prototype HER4 deleted.
  • a second type of cDNA was isolated as 4 independent clones each with a 3'-sequence identical to the HER4 consensus, but then diverging on the 5'- side of nucleotide 2335 (encoding Glu at amino acid position 768 in the FIG. IA and IB) , continuing upstream for only another 114-154 nucleotides (FIG. 3, FIG. 5) .
  • Nucleotide 2335 is the precise location of an intron-exon junction in the HER2 gene (Coussens et al . , 1985, Science 230:1132-39; Semba et al . , 1985, Proc. Natl. Acad. Sci. U.S.A.
  • Northern blots of poly(A)+ mRNA from human tissue samples were hybridized with antisense RNA probes to the 3'-end of HER4, encoding the autophosphorylation domain, as described in Section 6.1.2., supra .
  • a HER4 mRNA transcript of approximately 6kb was identified, and was found to be most abundant in the heart and skeletal muscle (FIG. 8, Panel l) .
  • An mRNA of greater than approximately 15 kb was detected in the brain, with lower levels also detected in heart, skeletal muscle, kidney, and pancreas tissue samples.
  • HER4 mR ⁇ A Various human tissues were also examined for the presence of HER4 mR ⁇ A using the semi-quantitative PCR assay described in Section 6.1.3., supra . The results are shown in Table II, together with results of the assay on primary tumor samples and neoplastic cell lines (Section 6.2.4., immediately below). These results correlate well with the Northern and solution hybridization analysis results on the selected RNA samples.
  • the highest levels of HER4 transcript expression were found in heart, kidney, and brain tissue samples.
  • high levels of HER4 mRNA expression were found in parathyroid, cerebellum, pituitary, spleen, testis, and breast tissue samples. Lower expression levels were found in thymus, lung, salivary gland, and pancreas tissue samples.
  • low or negative expression was observed in liver, prostate, ovary, adrenal, colon, duodenum, epidermis, and bone marrow samples.
  • HER4 mRNA expression profiles in several primary tumors and a number of cell lines of diverse neoplastic origin were determined with the semi- quantitative PCR assay (Section 6.1.3, supra) using primers from sequences in the HER4 kinase domain. The results are included in Table II. This analysis detected the highest expression of HER4 RNA in 4 human mammary adenocarcinoma cell lines (T-47D, MDA-MB-453, BT-474, and H3396) , and in neuroblastoma (SK-N-MC) , and pancreatic carcinoma (Hs766T) cell lines.
  • MDB-MB-231 (breast) MDA-MB-468 (breast) MDA-MB-157 (breast) G-401 (kidney) SK-BR-3 (breast) HepG2 (liver) A-431 (vulva) PANC-1 (pancreas) Caki-1 (kidney) AsPC-1(pancreas) Caki-2 (kidney) Capan-1 (pancreas) SK-HEP-1 (liver) HT-29 (colon) THP-1 (macrophage) CaSki (cervix) PA-1 (ovary)
  • Adrenal SK-MEL-28 (melanoma)
  • CHO-KI cells were obtained from the ATCC
  • Transfected cell colonies expressing HER4 were selected in glutamine-free Glasgow modified Eagle's medium (GMEM-S, Gibco) supplemented with 10% dialyzed fetal bovine serum an increasing concentrations of methionine sulfoximine (Bebbington, 1991, in Methods: A Companion to Methods in Enzymology 2:136-145 Academic Press) .
  • GMEM-S Glasgow modified Eagle's medium
  • HER4 The complete 4 kilobase coding sequence of prototype HER4 was reconstructed and inserted into a glutamine synthetase expression vector, pEE14, under the control of the cytomegalovirus immediate-early promoter (Bebbington, supra ) to generate the HER4 expression vector pEEHER4.
  • This construct (pEEHER4) was linearized with Mlul and transfected into CHO-KI cells by calcium phosphate precipitation using standard techniques. Cells were placed on selective media consisting of GMEM-S supplemented with 10% dialyzed fetal bovine serum and methionine sulfoximine at an initial concentration of 25 ⁇ M (L-MSX) as described in Bebbington, supra , for the selection of initial resistant colonies.
  • HER4 expression immunoassay Confluent cell monolayers were scraped into hypotonic lysis buffer (10 M Tris pH7.4, 1 mM KC1, 2 mM MgC12) at 4° C, dounce homogenized with 30 strokes, and the cell debris was removed by centrifugation at 3500 x g, 5 min.
  • HER4 polypeptide was detected by immunoblot analysis on solubilized cells or membrane preparations using HER2 immunoreagents generated to either a 19 amino acid region of the HER2 kinase domain, which coincidentally is identical to the HER4 sequence (residues 927-945) , or to the C-terminal 14 residues of HER2, which share a stretch of 7 consecutive residues with a region near the C-terminus of HER4.
  • HER4 was detected from solubilized cell extracts by immunoblot analysis with PY20 anti-phosphotyrosine antibody (ICN Biochemicals) , presumably reflecting autoactivation and autophosphorylation of HER4 due to receptor aggregation resulting from abberantly high receptor density. More specifically, expression was detected by immunobloting with a primary murine monoclonal antibody to HER2 (Neu-Ab3, Oncogene
  • CHO-KI cells transfected with a vector encoding the complete human prototype HER4 polypeptide were selected for amplified expression in media containing increasing concentrations of methionine sulfoximine as outlined in Section 7.1., et seq. , supra . Expression of HER4 was evaluated using the immunoassay described in Section 7.1.3., supra .
  • Several transfected CHO-KI cell clones stably expressing HER4 were isolated.
  • One particular clone, CHO/HER4 21-2 was selected in media supplemented with 250 ⁇ M MSX, and expresses high levels of HER4. CH0/HER4 21-2 cells have been deposited with the ATCC.
  • HER4 expressed in CHO/HER4 cells migrated with an apparent Mr of 180,000, slightly less than HER2 , whereas the parental CHO cells showed no cross-reactive bands (FIG. 9) .
  • a 130 kDa band was also detected in the CHO/HER4 cells, and presumably represents a degradation product of the 180 kDa mature protein.
  • CHO/HER4 cells were used to identify ligand specific binding and autophosphorylation of the HER4 tyrosine kinase (see Section 9., et seq., infra ) .
  • Cell Lines A panel of four recombinant cell lines, each expressing a single member of the human EGFR-family, were generated for use in the tyrosine kinase stimulatory assay described in Section 8.2., below.
  • the cell line CHO/HER4 3 was generated as described in Section 7.1.2, supra .
  • CHO/HER2 cells (clone 1-2500) were selected to express high levels of recombinant human pl85 er* ° B2 by dihydrofolate reductase-induced gene amplification in dhfr-deficient CHO cells.
  • the HER2 expression plasmid, cDNeu was generated by insertion of a full length HER2 coding sequence into a modified pCDM8 (Invitrogen, San Diego, CA) expression vector (Seed and Aruffo, 1987, Proc. Natl. Adad. Sci. U.S.A. 84:3365-69) in which an expression cassette from pSV2DHFR (containing the murine dhfr cDNA driven by the SV40 early promoter) has been inserted at the pCDM8 vector's unique BamHI site. This construct drives HER2 expression from the CMV immediate-early promoter.
  • NRHER5 cells (Velu et a . , 1987, Science 1408-10) were obtained from Dr.
  • Hsing-Jien Kung (Case Western Reserve University, Cleveland, OH) .
  • This murine cell line was clonally isolated from NR6 cells infected with a retrovirus stock carrying the human EGFR, and was found to have approximately 10 ⁇ human EGFRs per cell.
  • the cell line 293/HER3 was selected for high level expression of pl60 erbB3 .
  • the parental cell line 293 human embryonic kidney cells, constitutively expresses adenovirus Ela and have low levels of EGFR expression. This line was established by cotransfection of linearized cHER3 (Plowman et al . , 1990, Proc. Natl. Acad. Sci. U.S.A. 87:4905-09) and pMClneoPolyA (neomycin selectable marker with an Herpes simplex thymidine kinase promoter, Stratagene) , with selection in DMEM/F12 media containing 500 ⁇ g/ml G418. 8.2.
  • Tyrosine Kinase Stimulation Assay Cells were plated in 6-well tissue culture plates (Falcon), and allowed to attach at 37° C for 18-24 hr. Prior to the assay, the cells were changed to serum- free media for at least l hour. Cell monolayers were then incubated with the amounts of ligand preparations indicated in Section 7.3., below for 5 min at 37° C. Cells were then washed with PBS and solubilized on ice with 0.5 ml PBSTDS containing phosphatase inhibitors (10 mM NaHP04, 7.25, 150 m NaCl, 1% Triton X-100,
  • deoxycholate 0.1% SDS, 0.2% sodium azide, 1 mM NaF, 1 mM EGTA, 4 mM sodium orthovanadate, 1% aprotinin, 5 mg/ml leupeptin) .
  • PY20 antiphosphotyrosine antibody diluted 1:1000 in TNET was used as the primary antibody followed by 125 I-goat anti-mouse Ig F(ab')2 diluted 1:500 in TNET. Blots were washed with TNET and exposed on a phosphorimager (Molecular Dynamics) .
  • EGF EGF, AR, TGF- ⁇ , and HB- EGF, four related ligands which mediate their growth regulatory signals in part through interaction with EGFR, were able to stimulate tyrosine phosphorylation of EGFR expressed in recombinant NIH3T3 cells (for EGF, see FIG. 10, Panel 3, lane 2), but not HER4, HER2, or HER3 expressed in recombinant CHO or 293 cells (FIG. 10, Panel 1, 2, 4, lanes 2 and 3).
  • the assay identified a HepG2-derived preparation (fraction 17) as a HER4 ligand capable of specifically stimulating tyrosine phoshorylation of HER4 expressed in CHO/HER4 cells alone.
  • HER2, HER3 or HER4 the receptor expression profile of MDA-MB-453 cells offers an excellent indicator for morphologic differentiation inducing activity.
  • This cell line is known to express HER2 and HER3, but contains no detectable EGFR.
  • the results of the semi- quantitative PCR assays indicated high level expression of HER4 in MDA-MB-453 cells.
  • cDNA encoding the prototype HER4 polypeptide of the invention was first isolated from this cell line (Section 6., supra ) .
  • MDA-MB-453 cells (7500/well) were grown in 50 ml DMEM supplemented with 5% FBS and lx essential amino acids. Cells were allowed to adhere to 96-well plates for 24 hr. Samples were diluted in the above medium, added to the cell monolayer in 50 ml final volume, and the incubation continued for an additional 3 days. Cells were then examined by inverted light microscopy for morphologic changes. 9.1.2. Source Cells
  • Serum free media from a panel of cultures of human cancer cells were screened for growth regulatory activity on MDA-MB-453 cells.
  • a human hepatocarcinoma cell line, HepG2 was identified as a source of a factor which induced dramatic morphologic differentiation of the MDA-MB-453 cells.
  • Section 10.1.1., supra was used throughout the purification procedure to monitor the column fractions that induce morphological changes in MDA-MB-453 cells.
  • HepG2 cells were cultured in DMEM containing 10% fetal bovine serum using Nunc cell factories. At about 70% confluence, cells were washed then incubated with serum-free DMEM.
  • Conditioned medium HepG2-CM was collected 3 days later, and fresh serum-free medium added to the cells. Two additional harvests of HepG2- CM were collected per cell factory. The medium was centrifuged and stored at -20° C in the presence of 500 mM PMSF.
  • HepG2-CM Ten litres of HepG2-CM were concentrated 16-fold using an Amicon ultrafiltration unit (10,000 molecular weight cutoff membrane) , and subjected to sequential precipitation with 20% and 60% ammonium sulfate. After centrifugation at 15,000 x g, the supernatant was extensively dialyzed against PBS and passed through a DEAE-sepharose (Pharmacia) column pre- equilibrated with PBS. The flow-through fraction was then applied onto a 4 ml heparin-acrylic (Bio-Rad) column equilibrated with PBS. Differentiation inducing activity eluted from the heparin column between 0.4 and 0.8 M NaCl.
  • Amicon ultrafiltration unit 10,000 molecular weight cutoff membrane
  • Active heparin fractions were pooled, brought to 2.0 M ammonium sulfate, centrifuged at 12,000 x g for 5 min, and the resulting supernatant was loaded onto a phenyl-5PW column (8 x 75 mm, Waters) .
  • Bound proteins were eluted with a decreasing gradient from 2.0 M ammonium sulfate in 0.1 M Na 2 HPO « , pH 7.4 to 0.1 M Na-HPO, .
  • Dialyzed fractions were assayed for tyrosine phosphorylation of MDA-MB- 453 cells, essentially as described (Wen et al .
  • PY20 horseradish peroxidase-conjugated goat F(ab')2 anti-mouse Ig (Cappell) and chemiluminescence were used for detection. Phosphorylation signals were analyzed using the Molecular Dynamics personal densitometer.
  • MDA-MB-453 cells are moderately adherent and show a rounded morphology (FIG. 11, Panel 1) .
  • the addition of semi-purified HepG2-derived factor induces these cells to display a noticeably flattened morphology with larger nuclei and increased cytoplasm (FIG. 11, Panel 2 and 3) .
  • This HepG2-derived factor preparation also binds to heparin, a property which was utilized for purifying the activity.
  • FIG. 11, Panel 4 shows the phenyl column elution profile.
  • Tyrosine phosphorylation assays of the phenyl column fractions revealed that the same fractions found to induce differentiation of the human breast carcinoma cells are also able to stimulate tyrosine phosphorylation of a 185 kDa protein in MDA-MB-453 cells (FIG. 11, Panel 5).
  • fraction 16 induced a 4.5-fold increase in the phosphorylation signal compared to the baseline signal observed in unstimulated cells, as determined by densitometry analysis (FIG. 11, Panel 6) .
  • Adjacent fraction 14 was used as a control and had no effect on the phosphorylation of any of the EGFR- family receptors (FIG. 10, Panel 1-4, lane 5). Further purification and analysis of the factor present in fraction 17 indicates that it is a glycoprotein of 40 to 45 kDa, approximately the same size as NDF and HRG.
  • the HepG2-derived factor also has functional properties similar to NDF and HRG, inasmuch as it stimulates tyrosine phosphorylation of HER2/pl85 in MDA-MB-453 cells, but not EGFR in NR5 cells, and induces morphologic differentiation of HER2 overexpressing human breast cancer cells.
  • Recombinant NDF was expressed in COS cells and tested for its activity on HER4 in an assay system essentially devoid of other known members of the EGFR- family, notably EGFR and HER2.
  • the crude NDF supernatants were also tested for the ability to phosphorylate EGFR (NR5 cells) , HER2
  • a HER4 cDNA probe corresponding to the 5' portion of the gene was used for in situ hybridization mapping of the HER4 gene.
  • In situ hybridization to metaphase chromosomes from lymphocytes of two normal male donors was conducted using the HER4 probe labeled with 3 H to a specific activity of 2.6 x 10 7 cpm/ ⁇ g as described (Marth et al . , 1986, Proc. Natl. Acad. Sci. U.S.A. 83:7400-04). The final probe concentration was 0.05 ⁇ g/ ⁇ l of hybridization mixture. Slides were exposed for one month. Chromosomes were identified by Q banding.
  • CHO cells expressing recombinant HER4 or HER2 were generated as previously described in Section 8.
  • MDA-MB453 were seeded in 24 well plates and cultured
  • Recombinant rat heregulin was produced as follows. A 1.6 kb fragment encoding the entire open reading frame of rat heregulin (and 324 bp of 5'- untranslated sequence) was obtained by PCR using normal rat kidney RNA as a template. This fragment was inserted into a CDM8-based expression vector
  • DMEM Dulbecco's Modified Eagle Medium
  • FBS Dulbecco's Modified Eagle Medium
  • Clarified conditioned medium was either used directly or was dialyzed against 0.1 M acetic acid for 2 days, dried, and resuspended as a 20-fold concentrate in DMEM.
  • HER Tyrosine Phosphorylation As shown in FIG. 15, recombinant heregulin induces tyrosine phosphorylation of HER4. Tyrosine phosphorylated receptors were detected by Western blotting with an anti-phosphotyrosine Mab a, Monolayers of MDA-MB453 or CHO/HER4 cells were incubated with media from COS-1 cells transfected with a rat heregulin expression plasmid (HRG) , or with a cDM8 vector control (-) . The media was either applied directly (lx) or after concentrating 20-fold (20x, and vector control) . Solubilized cells were immunoprecipitated with anti-phosphotyrosine Mab.
  • HRG rat heregulin expression plasmid
  • - cDM8 vector control
  • rat heregulin does not directly interact with rat HER2/neu (Peles et al . , supra).
  • rat, rabbit, and human heregulin share high sequence homology and have been shown to induce tyrosine phosphorylation in their target cells of human origin (Wen D. et ai . , supra ; Holmes et al . , supra ; and Falls et al . , supra ) .
  • CNHER2 and CNHER4 expression plasmids were generated by insertion of the complete coding sequences of human HER2 and HER4 into cNEO, an expression vector that contains an SV2-NEO expression unit inserted at a unique BamHI site of CDM8. These constructs were linearized and transfected into CEM cells by electroporation with a Bio-Rad Gene Pulser apparatus essentially as previously described (Wen et al . , supra ) . Stable clones were selected in RPMI/10% FBS supplemented with 500 ⁇ g/ml active Geneticin. HER2 immunoprecipitations were as described in FIG.
  • Lysates were then incubated for 6 h, 4 * C with 3 ⁇ l each of two rabbit antisera raised against synthetic peptides corresponding to two regions of the cytoplasmic domain of human HER4 ('"LARLLEGDEKEYNADGG" [SEQ ID No:31] and
  • FIG. 16 Transfected CEM cells were selected that stably express either HER2, HER4, or both recombinant receptors.
  • Panel 1 recombinant HER2 was detected by immunmoprecipitation of cell lysates with anti-HER2 Mab (Ab-2) and Western blotting with another anti-HER2 Mab (Ab-3) .
  • Panel 2 recombinant HER4 was detected by immunoprecipitation of 3S S-labeled cell lysates with HER4-specific rabbit anti-peptide antisera.
  • FIG. 16 Transfected CEM cells were selected that stably express either HER2, HER4, or both recombinant receptors.
  • Panel 2 Panel 2
  • recombinant HER4 was detected by immunoprecipitation of 3S S-labeled cell lysates with HER4-specific rabbit anti-peptide antisera.
  • Example 12 supports the earlier observation that HER2 alone is not sufficient to transduce the heregulin signal.
  • a panel of human CEM cells that express the recombinant receptors either alone or in combination was established.
  • the desired model system was of human origin, since many of the reagents against erbB family members are specific to the human homologues.
  • CEM cells are a human T lymphoblastoid cell line and were found to lack expression of EGF receptor, HER2, HER3, or HER4, by a variety of immunologic, biologic, and genetic analyses (data not shown) .
  • FIG. 16 demonstrates the selection of three CEM cell lines that express only HER2 (CEM 1-3), only HER4 (CEM 3-13), or both HER2 and HER4 (CEM 2-9).
  • CEM 1-3 CEM 1-3
  • CEM 3-13 CEM 3-13
  • CEM 2-9 CEM 2-9
  • the presence of a functionally and structurally intact HER2 in the appropriate cells was confirmed by the induction of HER2 tyrosine phosphorylation by each of the two antibodies specific to the extracellular domain of HER2, but not by an isotype matched control antibody (FIG. 16, Panel 3).
  • Recombinant rat heregulin was prepared as in FIG. 15, and diluted to 7x in RPMI.
  • the HER4-specific Mab was prepared by immunization of mice with recombinant HER4 (manuscript in preparation) .
  • CEM cells (5 x 10 6 ) were treated with the concentrated supernatants for 10 min, room temperature and precipitated with PY20 or anti-HER2 Mab (Ab-2) as described in FIG. 15.
  • Immunoprecipitation with anti-HER4 Mab was performed by incubation of cells lysates with a 1:5 dilution of hybridoma supernatent for several hours followed by 2 ⁇ g rabbit anti-mouse Ig (cappel) and Protein A Sepharose CL-4B (Pharmacia) . PY20 Westerns as described in FIG. 15.
  • heregulin induces tyrosine phosphorylation in CEM cells expressing HER4.
  • CEM cell lines that express either HER2 or HER4 alone (CEM 1-3 and CEM 3-13) or together (CEM 2-9) were incubated with 7x concentrated supernatants from mock- (-) or heregulin-transfected (+) COS-l cells.
  • Solubilized cells were immunoprecipitated (IP) with anti-phosphotyrosine Mab (PY20) (FIG. 17, Panel 1) ; HER2-specific anti-HER2 Mab (Ab-2) (FIG. 17, Panel 2); or HER4-specific Mab (6-4) (FIG. 17, Panel 3).
  • IP immunoprecipitated
  • PY20 anti-phosphotyrosine Mab
  • Ab-2 HER2-specific anti-HER2 Mab
  • HER4-specific Mab 6-4
  • tyrosine phosphorylated receptors were detected by Western blotting with anti-phosphotyrosine Mab.
  • the size in kilodaltons of prestained molecular weight markers (BioRad)
  • recombinant heregulin was produced as an epitope-tagged fusion with amphiregulin.
  • the 63 amino acid EGF-structural motif of rat heregulin (Wen et al . , supra ) from serine 177 to tyrosine 239 was fused to the N-terminal 141 amino acids of the human amphiregulin precursor (Plowman et al . , supra) .
  • This truncated portion of heregulin has previously been shown to be active when expressed in E . coli (Holmes et al . , supra ) , and the N-terminal residues of amphiregulin provide an epitope for immunologic detection and purification of the recombinant protein.
  • This cDNA fragment was spliced into a cDM8 based expression vector for transient expression in COS-l cells.
  • Recombinant heregulin was purified by anion exchange and reverse phase chromatography as shown to be active based on the specific stimulation of HER4 tyrosine phosphorylation. Purified heregulin was iodinated with 250 ⁇ Ci of 1 S I- labeled Bolton-Hunter reagent (NEN) . CH0/HER4 or CH0/HER2 cells were incubated with 125 I-heregulin (10 s - cpm) for 2 h at 4° C.
  • Monolayers were washed in PBS and 3 mM Bis(sulfosuccinimidyl) suberate (BS 3 , Pierce) was added for 30 min on ice.
  • the cells were washed in tris-buffered saline, dissolved in SDS sample buffer, run on a 7% polyacrylamide gel, and visualized on the phosphorimager.
  • heregulin induces tyrosine phosphorylation of HER4 in the absence of HER2. In contrast, heregulin does not directly stimulate HER2. However, in the presence of HER4, heregulin induces phosphorylation of HER2, presumably either by transphosphorylation or through receptor heterodimerization. Together, these experiments suggest that HER4 is the receptor for heregulin. Most breast cancer cells that overexpress HER2 have been shown to be responsive to heregulin, whereas HER2-positive ovarian and fibroblast lines do not respond to the ligand. This observation could be explained by the fact that HER4 is co-expressed with HER2 in most or all of the breast cancer cell lines studied, but not in the ovarian carcinomas.
  • HER2 in heregulin- responsive breast cancer cells leads to increased binding, whereas expression of HER2 in heregulin- unresponsive ovarian or fibroblast cells has no effect (Peles et al . , supra ) .
  • MDA-MB 453 cells were obtained from the American Type Culture Collection (Rockville, MD) and cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum and amino acids (Life Technologies, Inc.).
  • DMEM Dulbecco's modified Eagle's medium
  • HepG2 cells were obtained from Dr. S. Radka and cultured in 10% fetal bovine serum containing DMEM. For large scale production of serum-free conditioned medium, HepG2 cells were propagated in Nunc cell factories.
  • CHO-KI Chinese hamster ovary cells
  • CH0/HER2 recombinant human pl85 erB2
  • CHO/HER4 recombinant human pi80 erbB
  • N29 monoclonal antibody to the extracellular portion of the human HER2 receptor was a gift from Dr. Y. Yarden.
  • Ab-3 c- neu monoclonal antibody that reacts with the human pl85 erbB2 was from Oncogene Science Inc.
  • MDA-MB-453 human breast cancer cells overexpress pl85 ertB2 but do not express the EGFR at their surface
  • Bound proteins were eluted with a 240 ml linear decreasing gradient from 1.9 M to 0 M (NH 4 ) 2 S0 4 in 0.1 M phosphate buffer, pH 7.4. The flow rate was 70 ml/h, and 5.8-ml fractions were collected. Active fractions were pooled, concentrated, dialyzed against PBS, and then applied (three separate runs) to a DEAE- Sepharose column (2.5 x 25 cm, Pharmacia) equilibrated with PBS, pH 7.3. The flow rate was 1 ml/min. The column flow-through was then loaded (two separate runs) on a CM-Sepharose Fast Flow column (2.5 x 13.5 cm, Pharmacia) pre-equilibrated with PBS, pH 7.3.
  • Proteins were eluted at 1 ml/min. with a 330-ml gradient from PBS to 1 M NaCl in PBS. Fractions of 5 ml were collected. The active material was loaded on a TSKgel heparin-5PW HPLC column (7.5 x 75 mm, TosoHaas) equilibrated with PBS. The flow rate was 0.5 ml/min. A 50-ml linear NaCl gradient (PBS to 2 M in PBS) followed by an isocratic elution with 2 M NaCl was used to elute the bound proteins. Fractions of 1 ml were collected. Active fractions corresponding to the 1.3 M NaCl peak of protein were pooled and concentrated.
  • a Protein Pak SW-200 size exclusion chromatography column (8 x 300 mm, Waters) equilibrated with 100 mM Na 2 HP0 4 , pH7.4, 0.01% Tween 20 was used as a final step of purification. The flow rate was 0.5 ml/min., and 250- ⁇ l fractions were collected. Column fractions were then analyzed by SDS-PAGE (12.5% gel) under reducing conditions and proteins detected by silver staining. 13.1.4. Detection of Tyrosine-
  • the membrane was blocked for 2 h at room temperature with 6% hovine serum albumin in 10 mM Tria-HCl, pH 8.0, 150 mM NaCl, 0.05% Tween 20.
  • PY20 monoclonal anti-phosphotyrosine antibody (ICN, 2 h at 22° C) and horseradish peroxidase-conjugated goat anti- mouse IgG F(ab') 2 (Cappel, lh at 22° C) were used as primary and secondary probing reagents, respectively. Proteins phosphorylated on tyrosine residues were detected with a chemiluminescence reagent (Amersham Corp. ) .
  • CHO/HER2 Stimulation Assay CHO/HER2 cells were seeded in 24-well plates at 1 x 10 s cells/well and cultured 24 h. Monoclonal antibody N29 specific to the extracellular domain of p 185 ⁇ r , B2 (stancovski et al . , 1991, PNAS 88:8691-8695) was added at 25 ⁇ g/ml. Following a 20-min. incubation at room temperature, media were removed and cells were solubilized for 10 min.
  • Immune complexes were washed 3 times with PBS-TDS, resolved on a 7% polyacrylamide gel, and electrophoretically transferred to nitrocellulose. Phosphorylation of the receptor was assessed by Western blot using a 1:1000 dilution of PY20 phosphotyrosine primary antibody (ICN).
  • HPLC-purified p45 (1.5 ⁇ g) was iodinated with 250 ⁇ Ci of 14 I-labeled Bolton-Hunter reagent obtained from
  • 125 I-p45 was purified by filtration through a Pharmacia PD-10 column. The specific activity was 10 4 cpm/ng. 125 I-p45 retained its biological activity as confirmed in a differentiation assay as well as a kinase stimulation assay (data not shown) . Binding of radiolabeled p45 was performed on
  • the monolayers were washed twice with PBS and then incubated in the presence of 1 mM jbis(sulfosuccinimidyl)suberate (BS 3 , Pierce) in PBS for
  • CHO/HER2 cells (2 x 10 s cells/well) were seeded in 24- well plates. After 48 h, cells were washed with binding buffer and then incubated with increasing concentrations of 125 I-p45. Nonspecific binding was determined in the presence of excess unlabeled p45. After a 2-h incubation at 4° C, the cells were washed three times with binding buffer and then lysed in 500 ⁇ l of 0.5M NaOH, 0.1% SDS. Cell-associated radioactivity was determined by using a ⁇ -counter. Scatchard analysis was performed using the computerized LIGAND program (Munson and Rodbard, 1980, Anal. Biochem 107:220-239).
  • N-terminal Amino Acid Sequence The N-terminal sequence analysis of p45 (25 pmol) was performed as previously described (Shoyab et al . , 1990, Proc. Natl. Acad. Sci. 87:7912-7916).
  • the biologically active column flow-through (174 mg of protein) was subjected to a cation-exchange chromotography (FIG. 19, Panel 2) with activity eluting between 0.35 and 0.48 M NaCl.
  • the active fractions were pooled (1.5 mg of protein) and applied to an analytical heparin column (FIG. 19, Panel 3).
  • the differentiation activity eluted from the heparin column between 0.97 and 1.45 M NaCl (fractions 27-38).
  • Size exclusion chromatography of the heparin column fractions 35-38 achieved a homogeneous preparation of the human breast cancer cell differentiation factor.
  • a major protein peak eluted with a molecular weight greater than 70,000 (FIG. 19, Panel 4) .
  • FIG. 21, Panel 1 shows the stimulatory effect of sequential fractions from the size exclusion chromatography column on tyrosine phosphorylation in MDA-MB- 53 cells. Densitometric analysis of the autoradiogram revealed that fractions 30-34 were essentially equipotent. Homogeneously purified p45 specifically stimulated tyrosine phosphorylation of pl80 erbB4 (FIG. 21, Panel 2). p45 was not able to stimulate phosphorylation in CHO/HER2 cells, and the cell were found to express functional pl85 erbB2 receptor as evidenced by immunoreactivity with 5 monoclonal antibodies specific to different regions of pl85 erbB2 . p45 has an N-terminal amino acid sequence similar to the recently isolated pl85 ⁇ rbB2 ligand.
  • Binding and cross-linking studies were performed in order to confirm that p45 was able to bind to pl80 ⁇ rbB4 . Binding studies revealed that while no specific binding of 125 I-p45 to CHO-KI and CHO/HER2 cells could be measured, CHO/HER4 cells displayed a single high affinity site (Kd about 5nM) with 7 x 104 receptors/cell (FIG. 22, Panel 1). The results of iodinated p45 cross-linking to CHO-KI, CHO/HER2, or CHO/HER4 cells are presented in FIG. 22, Panel 2.
  • the 210 kDa band corresponds to the p45-pl80 erbB4 complex (assuming an equimolar stoichiometry of ligand and receptor) , whereas the high molecular weight band is presumed to be a dimerized form of the receptor- ligand complex.
  • the 100 kDa band could represent a truncated portion of the extracellular domain of the pl80 ⁇ rB4 receptor complexed to 125 I-p45 or a covalently associated p45 dimer.
  • the c-kit ligand provides precedence for cross-linked dimers (Williams et al . , 1990, Cell 63:167-174).
  • the HER4 ligand, p45 purified from medium conditioned by HepG2, induces differentiation of breast cancer cells and activates tyrosine phosphorylation of a 185 kDa protein in MDA-MB-453 cells.
  • p45 is not capable of directly binding to pl85 erbB2 but shows specificity to HER4/pl80 erB4 . 14.
  • Heregulin -32-Ig and the mouse monoclonal antibody directed against the Pseudomonas exotoxin (PE) was supplied by Dr. J.-M. Colusco and by Dr. Tony Siadek, respectively (Bristol-Myers-Squibb, Seattle, WA) .
  • the cell lines BT474, MDA-MB-453, T47D, SKBR-3, and MCF-7 (all breast carcinoma) , LNCaP (prostate carcinoma) , CEM (T-cell leukemia) and SKOV3 (ovarian carcinoma) were obtained from ATCC (Rockville, MD) .
  • the H3396 breast carcinoma cell line and the L2987 lung carcinoma cell line were established at Bristol-Myers- Squibb (Seattle, WA) .
  • the AU565 breast carcinoma cell line was purchased from the Cell Culture laboratory. Naval Biosciences Laboratory (Naval Supply Center, Oakland, CA) . All cell lines were of human origin.
  • BT474 and T47D cells were cultured in IMDM supplemented with 10% fetal bovine serum (FBS) and 10 ⁇ g/ml insulin.
  • MCF-7, H3396, LNCaP and L2987 were cultured in IMDM supplemented with 10% FBS.
  • SKBR3 and SKOV3 cells were grown in McCoys media supplemented with 10% FBS and 0.5% non-essential amino acids.
  • AU565 cells were cultured in RPMI 1640 media supplemented with 15% FBS and CEM transfectants (see section 15.1.5., infra ) were cultured in RPMI 1640 supplemented with 10% FBS and 500 ⁇ g/ml G418.
  • Rat heregulin cDNA (Wen et al . , 1994, Mol. Cell. Biol. 14:1909-1919) was isolated by RT-PCR using mRNA from rat kidney cells as template.
  • the cDNA was prepared in chimeric form with the AR leader sequence by a two-step PCR insertional cloning protocol using cARP (Plowman et al . , 1990, Mol. Cell. Biol. 10:1969- 1981) as template to amplify the 5' end of the chimeric ligand using the oligonucleotide primers CARP5: (5'-CGGAAGCTTCTAGAGATCCCTCGAC-3' ) [SEQ ID No:34] and
  • ANSHLIK2 (3 'CCGCACACTTTATGTGTTGGCTTGTGTTTCTTCTATTTTTTCCA TTTTTG-5') [SEQ ID No:35].
  • the EGF-like domain PCR was amplified from CNDF1.6 (Plowman et al . , 1993, Nature 366:473-475) using the oligonucleotide primers ANSHLIKl:
  • XNDF1053 (3 '-GTCTCTAGATTAGTAGAGTTCCTCCGCTTTTTCTTG-5' ) [SEQ ID No:37] .
  • the products were combined and rea plified using the oligonucleotide primers CARP5 and XNDF1053.
  • the HAR (heregulin-amphiregulin) construct (cNANSHLIK) was PCR amplified in order to insert an Nde I restriction site on the 5' end and a Hind III restriction site on the 3' end with the oligonucleotide primers
  • NARP1 (5'-GTCAGAGTTCATATGGTAGTTAAGCCCCCCCAAAAC-3' ) [SEQ ID No:38] and NARP4: (3 '-GGCAGTTCTATGAACACGTTCACGGGCTTGCTTAAATGACCGCTGGCA ACGGTCTTGATACAATACCGTAGAAAAATGTTTAGCCTCCTTGAGATGTTCGAA TCTCCTAGAAAC-5') [SEQ ID No: 39].
  • the resulting 287 bp DNA fragment was digested with Nde I and Hind III, followed by ligation into the compatibly digested expression plasmid pBW 7.0 which contained, in frame at the 5' fusion site, the nucleotide sequence encoding for of PE40 (Friedman et al . , 1993, Cancer Res. 53:334-339).
  • the resulting expression plasmid pSE 8.4 then contained the gene fusion encoding the chimeric heregulin-toxin protein, under the control of a IPTG-inducible T7 promoter.
  • the plasmid pSE 8.4 encoding the chimeric protein HAR-TX ⁇ 2 was transformed into the E. coli strain BL21 ( ⁇ DE3) .
  • the cell pellet was frozen at -70°C, then thawed and resuspended at 4°C in solubilization buffer (50 mM Tris-HCl (pH 8.0), 10 mM EDTA, 1 ug/ml leupeptin, 2 ug/ml aprotinin, 1 ug/ml pepstatin-A, 0.5 mM PMSF) containing 1% tergitol by homogenization and sonication.
  • solubilization buffer 50 mM Tris-HCl (pH 8.0), 10 mM EDTA, 1 ug/ml leupeptin, 2 ug/ml aprotinin, 1 ug/ml pepstatin-A, 0.5 mM PMSF
  • the resulting pellet containing pre-purified inclusion bodies was dissolved in 6.5 M guanidine-HCl, 0.1 M Tris-HCl (pH 8.0), 5 mM EDTA; sonicated; and refolded by rapid dilution (100-fold) into 0.1 M Tris- HCl (pH 8.0), 1.3 M urea, 5 mM EDTA, 1 mM glutathione, and 0.1 mM oxidized glutathione at 4°C.
  • the addition of the denaturating agent urea at low concentration was utilized to allow slow refolding and avoid the formation of aggregates.
  • the refolded HAR-TX ⁇ 2 protein was diluted 2-fold with 50 mM sodium phosphate (pH 7.0) and applied to a cation-exchange resin (POROS 50 HS, PerSeptive Biosystems, Cambridge, MA), pre- equilibrated in the same buffer.
  • the HAR-TX ⁇ 2 protein was eluted with a 450 nM NaCl step gradient in 50 mM sodium phosphate (pH 7.0) and fractions were analyzed using SDS-PAGE and Coomassie blue staining.
  • Membranes from 5 x 10 7 MDA-MB-453 cells were prepared and coated to 96 well plates as previously described for H3396 human breast carcinoma cells (Siegall et al . , 1994, J. Immunol. 152:2377-2384) . Subsequently, the membranes were incubated with titrations of either HAR-TX ⁇ 2 or PE40 ranging from 0.3 - 300 ug/ml and the mouse monoclonal anti-PE antibody EXA2-1H8 as the secondary reagent (Siegall et al . , supra ) . The isolate of the toxin portion PE40 alone was used to determine unspecific binding activity to the membrane preparations, in comparison with the specific binding activity of HAR-TX ⁇ 2 . 14.1.5. Phosphotyrosine Analysis of transfected CEM cell lines
  • EGF-R family (1-5 x 10 6 cells) were stimulated with 500 ng/ml HAR-TX ⁇ 2 for 5 minutes at room temperature.
  • the cells were pelleted and resuspended in 0.1 ml lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 5 mM MgCl 2 , 1% NP40, 0.5% deoxycholate, 0.1% sodium dodecylsulfate, 1 mM sodium orthovanadate) at 4°C. 0 Insoluble material was pelleted by centrifugation at 0.1 ml lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 5 mM MgCl 2 , 1% NP40, 0.5% deoxycholate, 0.1% sodium dodecylsulfate, 1 mM sodium orthovanadate) at 4°C. 0 Insoluble material was pelleted by centrifugation at
  • cytotoxicity assays For cytotoxicity assays, tumor cells (10 5 cells/ml) in growth medium were added to 96-well flat _ bottom tissue culture plates (0.1 ml/well) and incubated at 37°C for 16 h. Cells were incubated with HAR-TX ⁇ 2 for 48 h at 37°C, washed twice with phosphate buffered saline (PBS) , followed by addition of 200 ⁇ l/well of 1.5 ⁇ M calcein-AM (Molecular Probes Inc., 5 Eugene, OR) . The plates were incubated for 40 minutes at room temperature (RT) , and the fluorescence measured using a Fluorescence Concentration Analyzer (Baxter Heathcare Corp.
  • PBS phosphate buffered saline
  • HER expressed in baculovirus, was used as the immunogen for subcutaneous injection into 4-6 week old female BALB/c mice. Immunization was performed 4 times (approximately 1 month apart) with 20 ⁇ g of HER4 protein given each time. Spleen cells from immunized mice were removed four days after the final immunization and fused with the mouse myeloma line P2x63-Ag8.653 as previously described (Siegall et al . , supra ) . Positive hybridoma supernatants were selected by ELISA screening on plates coated with HER4 transfected CHO cells (Plowman et al .
  • HER2 staining was performed by using mouse anti-HER2 mAb 24.7 (Stancovski et al . , 1991, Proc. Natl. Acad. Sci. USA 88:8691-8695) as primary, and biotinylated goat anti-mouse IgG (Jackson Labs, West Grove, PA) as secondary antibody as previously described (Bacus et al . , 1993, Cancer Res. 53:5251- 5261) .
  • the primary antibodies used were, respectively, mouse anti-HER3 mAb RTJ2 (Santa Cruz Biotech, Santa Cruz, CA) at 2.5 ⁇ g/ml concentration or mouse anti-HER4 mAb 6-4-11 at 15 ⁇ g/ml concentration followed by incubation with biotinylated rabbit anti-mouse IgG (Zymed Labs, South San Francisco, CA) .
  • the staining procedure was performed at RT as follows: cells were fixed in 10% neutral buffered formalin for 60 minutes, washed with H 2 0 and rinsed with Tris buffered saline (TBS; 0.05 M Tris, 0.15 M NaCl, pH 7.6). Unspecific binding sites were blocked by incubation with 10% goat serum (for HER2) or rabbit serum (for HER3 and HER4) in 0.1% bovine serum albumin/TBS for 15 minutes. Subsequently, cells were incubated with primary and secondary antibodies for 30 and 20 minutes, respectively, followed by incubation with alkaline phosphatase conjugated streptavidin (Jackson Labs) for 15 minutes, with TBS washing between the steps.
  • TBS Tris buffered saline
  • Detection of antibody binding was achieved using CAS Red Chromagen (Becton Dickinson Cellular Imaging System, supra) for 4 minutes (HER2) , 8-10 minutes (HER3) , and 10-12 minutes (HER4) . Cells were counterstained as described in the CAS DNA stain protocol (Becton Dickinson Cellular Imaging System) .
  • the HAR-TX ⁇ 2 expression plasmid encoding the hydrophilic leader sequence from amphiregulin (AR) , heregulin ⁇ 2 , and PE40, under control of the IPTG inducible T7 promoter, was constructed as described in Section 15.1.2., supra , and is diagrammatically shown in FIG. 23, Panel 1.
  • the AR leader sequence was added to the N-terminus of heregulin to facilitate the purification procedure (FIG. 23, Panel 2).
  • FIG. 24A and 24B show the nucleotide sequence and the deduced amino acid sequence of the cDNA encoding HAR-TX -52 Chimeric HAR-TX ⁇ 2 protein was expressed in E. coli of inclusion bodies.
  • Recombinant protein was denatured and refolded as described in Section 15.1.2., supra, and applied to cation-exchange chromatography on a POROS HS column.
  • Semi-purified HAR-TX ⁇ 2 protein was detected by PAGE and Coomassie blue staining as major band migrating at 51 kDa (FIG. 25, lane 2) .
  • the column flow-through from POROS HS contained only small amounts of HAR-TX ⁇ 2 (FIG. 25, lane 3) .
  • POROS HS chromatography resulted in >50% purity of HAR-TX ⁇ 2 (FIG. 25, lane 4).
  • HAR-TX ⁇ 2 To determine the specific binding activity of HAR-TX ⁇ 2 , an ELISA assay was performed using membranes of the HER4 positive human breast carcinoma cell line MDA-MB-453 as the target for binding. HAR- TX ⁇ 2 was found to bind to the immobilized cell membranes in a dose-dependent fashion up to 300 ⁇ g/ml (FIG. 26) . PE40, the toxin component of HAR-TX ⁇ 2 used as negative control, was unable to bind to MDA- MB-453 membranes.
  • HER4 receptor phosphorylation assay was performed as previously described for heregulin (Carraway et al . ,
  • HAR-TX ⁇ 2 induced tyrosine phosphorylation in CEM cells expressing HER4 either alone or together with HER2, but not in cells expressing only HER2 or HERl.
  • This result demonstrates that HER4 is sufficient and necessary for induction of tyrosine phosphorylation in response to HAR-TX ⁇ 2 , which is not true for HERl and for HER2.
  • HAR-TX 02 does not induce tyrosine phosphorylation in CEM cells transfected with
  • HERl confirms that the hydrophilic leader sequence of amphiregulin does not affect the specificity of the v i heregulin moiety in its selective interaction between receptor family members.
  • the cell killing activity of HAR-TX ⁇ 2 was determined against a variety of human cancer cell lines.
  • AU565 and SKBR3 breast carcinomas and LNCaP prostate carcinoma were sensitive to HAR-TX ⁇ 2 with EC 50 values of 25, 20, 4.5 ng/ml, respectively, while SKOV3 ovarian carcinoma cells were insensitive to HAR- TX ⁇ 2 (EC S0 >2000 ng/ml) (FIG. 28, Panel 1).
  • Addition of heregulin 02-Ig to LNCaP cells reduced the cytotoxic activity of HAR-TX ⁇ 2 (FIG. 28, Panel 2).
  • L6-Ig a chimeric mouse-human antibody with a non-related specificity but matching human Fc domains (Hellstr ⁇ m et al . , supra )
  • L6-Ig did not inhibit the HAR-TX 02 cytotoxic activity (FIG. 28, Panel 2).
  • the cytotoxic effect of HAR-TX 02 was due to specific heregulin-mediated binding. Similar data were obtained using MDA-MB-453 cells (not shown) .
  • HER2, HER3, and HER4 Receptor Density on Human Tumor Cells Correlation with HAR-TX 02- Mediated Cytotoxicity
  • HAR-TX 02 was found to induce tyrosine phosphorylation in both tumor cell types (FIG. 29) similar to that previously seen in COS-7 cells transfected with HER2 and HER3 (Sliwkowski et al . , supra ) .
  • SKOV3 cells were found to exhibit the same tyrosine phosphorylation pattern in the presence or absence of heregulin and thus direct interaction between receptors and heregulin could not be established (data not shown) .
  • heregulin does not bind to these cells (Peles et al . , supra ) .
  • Cyto cytoplasmic domain
  • ECD extracellular domain
  • FACS fluorescence-activated cell sorter analysis
  • f ibro cytoplasmic domain
  • f ibroblasts extracellular domain
  • ICC immunocytochemistry
  • RIP receptor immunoprecipitation
  • AATTGTCAGC ACGGGATCTG AGACTTCCAA AAA ATG AAG CCG GCG ACA GGA CTT 54
  • GGT GGA AGA GTA CTC TAT AGT GGC CTG TCC TTG CTT ATC CTC AAG CAA 1350 Gly Gly Arg Val Leu Tyr Ser Gly Leu Ser Leu Leu He Leu Lys Gin 425 430 435
  • AAG GAA CTG GCT GCT GAG TTT TCA AGG ATG GCT CGA GAC CCT CAA AGA 2982 Lys Glu Leu Ala Ala Glu Phe Ser Arg Met Ala Arg Asp Pro Gin Arg 970 975 980
  • AAAGTTTCCA TTAGAACAAA
  • AGAATAACAT TTTCTATAAC ATATGATAGT GTCTGAAATT 4477
  • AATTGTCAGC ACGGGATCTG AGACTTCCAA AAA ATG AAG CCG GCG ACA GGA CTT
  • GGT GGA AGA GTA CTC TAT AGT GGC CTG TCC TTG CTT ATC CTC AAG CAA 1350 Gly Gly Arg Val Leu Tyr Ser Gly Leu Ser Leu Leu He Leu Lys Gin 430 435
  • AAG GAA CTG GCT GCT GAG TTT TCA AGG ATG GCT CGA GAC CCT CAA AGA 2982 Lys Glu Leu Ala Ala Glu Phe Ser Arg Met Ala Arg Asp Pro Gin Arg 975 980
  • AAACCTACTC TATATGAATT CCATTCTTTC TTTGAAAGCT GTCAAATCCA TGCATTTATT 3827
  • AAAAGTTTAA AATTAGATCA ATGGATAGGT AAATGAATAA TCNTTCTTTT GCTTGTGAGA 4787
  • MOLECULE TYPE DNA (genomic)
  • GAG AAA GGA GAA CGT TTG CCT CAG CCT CCC ATC TGC ACT ATT GAC GTT 701 Glu Lys Gly Glu Arg Leu Pro Gin Pro Pro He Cys Thr He Asp Val 170 175 180
  • ATC CCA CCT CCC ATC TAT ACT TCC AGA GCA AGA ATT GAC TCG AAT AGG 989 He Pro Pro Pro He Tyr Thr Ser Arg Ala Arg He Asp Ser Asn Arg 270 275

Abstract

The molecular cloning, expression, and biological characteristics of a novel receptor tyrosine kinase related to the epidermal growth factor receptor, termed HER4/p180?erbB4¿, are described. An HER4 ligand capable of inducing cellular differentiation of breast cancer cells is also disclosed. In view of the expression of HER4 in several human cancers and in certain tissues of neuronal and muscular origin, various diagnostic and therapeutic uses of HER4-derived and HER4-related biological compositions are provided.

Description

HER4 HUMAN RECEPTOR TYROSINE KINASE
This application is a continuation-in-part of United States Application Serial No. 08/150,704, filed November 10, 1993, which is a continuation-in-part of United States Application Serial No. 07/981,165, filed November 24, 1992, each of which applications are incorporated herein in their entireties.
l. Introduction
The present invention is generally directed to a novel receptor tyrosine inase related to the epidermal growth factor receptor, termed HER4/pl80rB"* ("HER4") , and to novel diagnostic and therapeutic compositions comprising HER4-derived or HER4-related biological components. The invention is based in part upon applicants discovery of human HER4, its complete nucleotide coding sequence, and functional properties of the HER4 receptor protein. More specifically, the invention is directed to HER4 biologies comprising, for example, polynucleotide molecules encoding HER4, HER4 polypeptides, anti-HER4 antibodies which recognize epitopes of HER4 polypeptides, ligands which interact with HER4, and diagnostic and therapeutic compositions and methods based fundamentally upon such molecules. In view of the expression of HER4 in several human cancers and in certain tissues of neuronal and muscular origin, the present invention provides a framework upon which effective biological therapies may be designed. The invention is hereinafter described in detail, in part by way of experimental examples specifically illustrating various aspects of the invention and particular embodiments thereof. 2. Background of the Invention
Cells of virtually all tissue types express transmembrane receptor molecules with intrinsic tyrosine kinase activity through which various growth and differentiation factors mediate a range of biological effects (reviewed in Aaronson, 1991, Science 254:1146-52) . Included in this group of receptor tyrosine kinases (RTKs) are the receptors for polypeptide growth factors such as epidermal growth factor (EGF) , insulin, platelet-derived growth factor (PDGF) , neurotrophins (i.e., NGF) , and fibroblast growth factor (FGF) . Recently, the ligands for several previously-characterized receptors have been identified, including ligands for c-kit (steel factor) , met (hepatocyte growth factor) , trk (nerve growth factor) (see, respectively, Zsebo et al . , 1990, Cell 63:195-201; Bottardo et al . , 1991, Science 251:802-04; Kaplan et al . , 1991, Nature 350:158-160) . In addition, the soluble factor NDF, or heregulin- alpha (HRG-α) , has been identified as the ligand for HER2 , a receptor which is highly related to HER4 (Wen et al . , 1992, Cell 69:559-72; Holmes et al . , 1992, Science 256:1205-10) .
The heregulins are a family of molecules that were first isolated as specific ligands for HER2 (Wen, et al . , 1992, Cell. 69:559-572; Holmes et al . , 1992, Science 256:1205-1210; Falls et ai . , 1993, Cell 72:801-815; and Marchionni et al . , 1993, Nature 362:312-318) . A rat homologue was termed Neu differentiation factor (NDF) based on its ability to induce differentiation of breast cancer cells through its interaction with HER2/Neu (Wen et al . , supra ) . Heregulin also appears to play an important role in development and maintenance of the nervous system based on its abundant expression in cells of neuronal origin and on the recognition that alternatively spliced forms of the heregulin gene encode for two recently characterized neurotrophic activities. One neural-derived factor is termed acetylcholine receptor inducing activity (ARIA) (Falls et al . , supra ) . This heregulin isoform is responsible for stimulation of neurotransmitter receptor synthesis during formation of the neuromuscular junction. A second factor is called glial growth factor (GGF) reflecting the proliferative affect this molecule has on glial cells in the central and peripheral nervous system (Marchionni et al . , supra ) . Additional, less well characterized molecules that appear to be isoforms of heregulin, include p45, gp30, and p75 (Lupu et al. , 1990, Science 249:1552-1555; and Lupu et al . , 1992, Proc. Natl. Acad. Sci. U.S.A. 89:2287-2291).
Several HER2-neutralizing antibodies fail to block heregulin activation of human breast cancer cells. Heregulin only activates tyrosine phosphorylation of HER2 in cells of breast, colon, and neuronal origin, and not in fibroblasts or ovarian cell lines that overexpress recombinant HER2 (Peles et al . , 1993, EMBO J. 12:961-971).
Biological relationships between various human malignancies and genetic aberrations in growth factor- receptor tyrosine kinase signal pathways are known to exist. Among the most notable such relationships involve the EGF receptor (EGFR) family of receptor tyrosine kinases (see Aaronson, supra) . Three human EGFR-family members have been identified and are known to those skilled in the art: EGFR, HER2/pl85**r""3 and HER3/pl60«rM3 (see, respectively, Ullrich et al . , 1984, Nature 309:418-25; Coussens et al . , 1985, Science 230:1132-39; Plowman et al . , 1990, Proc. Natl. Acad. Sci. U.S.A. 87:4905-09). EGFR-related molecules from other species have also been identified.
The complete nucleotide coding sequence of other EGFR-family members has also been determined from other organisms including: the drosophila EGFR ("DER": Livneh et al . , 1985, Cell 40:599-607), nematode EGFR ("let-23": Aroian et al . , 1990, Nature 348:693-698), chicken EGFR ("CER": Lax et al . , 1988, Mol. Cell. Biol. 8:1970-1978), rat EGFR (Petch et al . , 1990, Mol. Cell. Biol. 10:2973-2982), rat HER2/Neu (Bargmann et al . , 1986, Nature, 319:226-230) and a novel member isolated from the fish and termed Xiphophorus melanoma related kinase ("X rk": Wittbrodt et al . , 1989, Nature 342:415-421). In addition, PCR technology has led to the isolation of other short DNA fragments that may encode novel receptors or may represent species- specific homologs of known receptors. One recent example is the isolation tyro-2 (Lai, C. and Lemke, G., 1991, Neuron 6:691-704) a fragment encoding 54 amino acids that is most related to the EGFR family.
Overexpression of EGFR-family receptors is frequently observed in a variety of aggressive human epithelial carcinomas. In particular, increased expression of EGFR is associated with more aggressive carcinomas of the breast, bladder, lung and stomach
(see, for example, Neal et al . , 1985, Lancet 1:366-68; Sainsbury et al . , 1987, Lancet 1:1398-1402; Yasui et al . , 1988, Int. J. Cancer 41:211-17; Veale et al . , 1987, Cancer 55:513-16). In addition, amplification and overexpression of HER2 has been associated with a wide variety of human malignancies, particularly breast and ovarian carcinomas, for which a strong correlation between HER2 overexpression and poor clinical prognosis and/or increased relapse probability have been established (see, for example, Slamon et al . , 1987, Science 235:177-82, and 1989, Science 244:707-12). Overexpression of HER2 has also been correlated with other human carcinomas, including carcinoma of the stomach, endometrium, salivary gland, bladder, and lung (Yokota et al . , 1986, Lancet 1:765- 67; Fukushigi et al . , 1986, Mol. Cell. Biol. 6:955-58; Yonemura et al . , 1991, Cancer Res. 51:1034; Weiner et al . , 1990, Cancer Res. 50:421-25; Geurin et al . , 1988, Oncoσene Res. 3:21-31; Semba et al . , 1985, Proc. Natl. Acad. Sci. U.S.A. 82:6497-6501; Zhau et al . , 1990, Mol. Carcinoσ. 3:354-57; McCann et al . , 1990, Cancer 65:88-92). Most recently, a potential link between HER2 overexpression and gastric carcinoma has been reported (Jaehne et al . , 1992, J. Cancer Res. Clin. Oncol. 118:474-79). Finally, amplified expression of the recently described HER3 receptor has been observed in a wide variety of human adenocarcinomas (Poller et al . , 1992, J. Path 168:275-280; Krause et al . , 1989, Proc. Natl. Acad. Sci. U.S.A. 86:9193-97; European Patent Application No. 91301737, published 9.4.91, EP 444 961) .
Several structurally related soluble polypeptides capable of specifically binding to EGFR have been identified and characterized, including EGF, transforming growth factor-alpha (TGF-α) , amphiregulin (AR) , heparin-binding EGF (HB-EGF) , and vaccinia virus growth factor (VGF) (see, respectively, Savage et al . , 1972, J. Biol. Chem. 247:7612-21; Marquardt et al . , 1984, Science 223:1079-82; Shoyab et al . , 1989, Science 243:1074-76; Higashiyama et al . , 1991, Science 251:936-39; Twardzik et al . , 1985, Proc. Natl. Acad. Sci. U.S.A. 82:5300-04). Despite the close structural relationships among receptors of the EGFR-family, none of these ligands has been conclusively shown to interact with HER2 or HER3. Recently, several groups have reported the identification of specific ligands for HER2. Some of these ligands, such as gp30 (Lupu et al . , 1990, Science 249:1552-55; Bacus et al . , 1992, Cell Growth and Differentiation 3:401-11) interact with both EGFR and HER2 , while others are reported to bind specifically to HER2 (Wen et al . , 1992, Cell 69:559- 72; Peles et al . , 1992, Cell 69:205-16; Holmes et al . , 1992, Science 256:1205-10; Lupu et al . , 1992, Proc. Natl. Acad. Sci. U.S.A. 89:2287-91; Huang et al . , 1992, J. Biol. Chem. 276:11508-121) . The best characterized of these ligands are neu differentiation factor (NDF) purified and cloned from ras-transformed Ratl-EJ cells (Wen et al . , Peles et al . , supra ) , and the heregulins (HRG-α, -βi , -e>2 , -S3) , purified and cloned from human MDA-MB-231 cells (Holmes et al . , supra ) . NDF and HRG-α share 93% sequence identity and appear to be the rat and human homologs of the same protein. Both of these proteins are similar size (44- 45 kDa) , increase tyrosine phosphorylation of HER2 in MDA-MB-453 cells and not the EGF-receptor, and have been reported to bind to HER2 in cross-linking studies on human breast cancer cells. In addition, NDF has been shown to induce differentiation of human mammary tumor cells to milk-producing, growth-arrested cells, whereas the heregulin family have been reported to stimulate proliferation of cultured human breast cancers cell monolayers.
Interestingly, although members of the heregulin family are capable of stimulating tyrosine phosphorylation of HER2 in many mammary carcinoma cell lines, they are not able to act on this receptor in the ovarian carcinoma cell line SK0V3 or in HER2 transfected fibroblasts (Peles et al . , 1993, EMBO J. 12:961-971) . These observations indicated the existence of other receptors for heregulin responsible for the activation of HER2. Such cross-activation between members of the receptor tyrosine kinase family has been already reported and is believed to arise from a ligand induced receptor heterodimerization event (Wada et al . , 1990, Cell 61:1339-1347). Recently, it has been reported that HER3 binds heregulin (Carraway et al . , 1994, J. Biol. Chem. 269:14303-14306), and in fact, this receptor seems to be involved in the heregulin-mediated tyrosine kinase activation of HER2 (Carraway et al . , supra ; Sliwkowski et al . , 1994, J. Biol. Chem. 269:14661- 14665) .
The means by which receptor polypeptides transduce regulatory signals in response to ligand binding is not fully understood, and continues to be the subject of intensive investigation. However, important components of the process have been uncovered, including the understanding that phosphorylation of and by cell surface receptors hold fundamental roles in signal transduction. In addition to the involvement of phosphorylation in the signal process, the intracellular phenomena of receptor dimerizatiσn and receptor crosstalk function as primary components of the circuit through which ligand binding triggers a resulting cellular response. Ligand binding to transmembrane receptor tyrosine kinases induces receptor dimerization, leading to activation of kinase function through the interaction of adjacent cytoplasmic domains. Receptor crosstalk refers to intracellular communication between two or more proximate receptor molecules mediated by, for example, activation of one receptor through a mechanism involving the kinase activity of the other. One particularly relevant example of such a phenomenon is the binding of EGF to the EGFR, resulting in activation of the EGFR kinase domain and cross- phosphorylation of HER2 (Kokai et al . , 1989, Cell 58:287-92; Stern et al . , 1988, EMBO J. 7:995-1001; King et al . , 1989, Oncoσene 4:13-18).
3. Summary of the Invention
HER4 is the fourth member of the EGFR-family of receptor tyrosine kinases and is likely to be involved not only in regulating normal cellular function but also in the loss of normal growth control associated with certain human cancers. In this connection, HER4 appears to be closely connected with certain carcinomas of epithelial origin, such as adenocarcinoma of the breast. As such, its discovery, and the elucidation of the HER4 coding sequence, open a number of novel approaches to the diagnosis and treatment of human cancers in which the aberrant expression and/or function of this cell surface receptor is involved.
The complete nucleotide sequence encoding the prototype HER4 polypeptide of the invention is disclosed herein, and provides the basis for several general aspects of the invention hereinafter described. Thus, the invention includes embodiments directly involving the production and use of HER4 polynucleotide molecules. In addition, the invention provides HER4 polypeptides, such as the prototype HER4 polypeptide disclosed and characterized in the sections which follow. Polypeptides sharing nearly equivalent structural characteristics with the prototype HER4 molecule are also included within the scope of this invention. Furthermore, the invention includes polypeptides which interact with HER4 expressed on the surface of certain cells thereby affecting their growth and/or differentiation. The invention is also directed to anti-HER4 antibodies, which have a variety of uses including but not limited to their use as components of novel biological approaches to human cancer diagnosis and therapy provided by the invention.
The invention also relates to the identification of HER4 ligands and methods for their purification.
The invention also relates to the discovery of an apparent functional relationship between HER4 and HER2, and the therapeutic aspects of the invention include those which are based on applicants' preliminary understanding of this relationship. Applicants' data strongly suggests that HER4 interacts with HER2 either by heterodimer formation or receptor crosstalk, and that such interaction appears to be one mechanism by which the HER4 receptor mediates effects on cell behavior. The reciprocal consequence is that HER2 activation is in some circumstances mediated through HER4.
In this connection, it appears that although heregulin induces phosphorylation of HER2 in cells expressing HER2 and HER4. Heregulin does not directly stimulate HER2 but acts by stimulating tyrosine phosphorylation of HER4.
Recognition of HER4 as a primary component of the heregulin signal transduction pathway opens a number of novel approaches to the diagnosis and treatment of human cancers in which the aberrant expression and/or function of heregulin and/or HER4 are involved. The therapeutic aspects of this invention thus include mediating a ligand's affect on HER4 and HER2 through antagonists, agonists or antibodies to HER4 ligands or HER4 receptor itself. The invention also relates to chimeric proteins that specifically target and kill HER4 expressing tumor cells, polynucleotides encoding such chimeric proteins, and methods of using both in the therapeutic treatment of cancer and other human malignancies.
Applicants' data demonstrate that such recombinant chimeric proteins specifically bind to the HER4 receptor and are cytotoxic against tumor cells that express HER4 on their surface. The bifunctional retention of both the specificity of the cell-binding portion of the molecule and the cytotoxic potential of the toxin portion makes for a very potent and targeted reagent.
The invention further relates to a method allowing determination of the cytotoxic activity of HER4 directed cytotoxic substances on cancer cells, thereby providing a powerful diagnostic tool; this will be of particular interest for prognosis of the e fectiveness of these substances on an individual malignancy prior their therapeutic use.
4. Brief Description of the Figures
Figures 1/1 through 1/5. Nucleotide sequence [SEQ ID No:l] and deduced amino acid sequence of HER4 of the coding sequence from position 34 to 3961 (1308 amino acid residues) [SEQ ID No:2]. Nucleotides are numbered on the left, and amino acids are numbered above the sequence.
Figures 2/1 through 2/4. Nucleotide sequence [SEQ ID No: 3] and deduced amino acid sequence ([SEQ ID No: 4] of cDNAs encoding HER4 with alternate 3' end and without autophosphorylation domain. This sequence is identical with that of HER4 shown in Figures 1/1 through 1/5 up to nucleotide 3168, where the sequence diverges and the open reading frame stops after 13 - II - amino acids, followed by an extended, unique 3'- untranslated region.
Figures 3/1 through 3/3. Nucleotide sequence
[SEQ ID No: 5] and deduced amino acid sequence [SEQ ID No: 6] of cDNA encoding HER4 with a N-terminal truncation. This sequence contains the 3 '-portion of the HER4 sequence where nucleotide position 156 of the truncated sequence aligns with position 2335 of the complete HER4 sequence shown in Figures 1/1 through 1/5 (just downstream from the region encoding the ATP- binding site of the HER4 kinase) . The first 155 nucleotides of the truncated sequence are unique from HER4 and may represent the 5 ' -untranslated region of a transcript derived from a cryptic promoter within an intron of the HER4 gene. (Section 6.2.2., infra ) .
Figures 4/1, 4/2 and 5. The deduced amino acid sequence of two variant forms of human HER4 aligned with the full length HER4 receptor as represented in Figures 1/1 through 1/5. Sequences are displayed using the single-letter code and are numbered on the right with the complete HER4 sequence on top and the variant sequences below. Identical residues are indicated by a colon between the aligned residues.
Figures 4/1 and 4/2. HER4 with alternate 3 '-end, lacking an autophosphorylation domain [SEQ ID No. 4]. This sequence is identical with that of HER4 , shown in Figures 1/1 through 1/5, up to amino acid 1045, where the sequence diverges and continues for 13 amino acids before reaching a stop codon. Figure 5. HER4 with N-terminal truncation [SEQ ID No. 6]. This sequence is identical to the 3'- portion of the HER4 shown in Figures 1/1 through 1/5 beginning at amino acid 768. (Section 6.2.2., infra ) . Figures 6/1 and 6/2. Deduced amino acid sequence of human HER4 and alignment with other human EGFR- family members (EGFR [SEQ ID No:7]; HER2 [SEQ ID
No: 8]; HER3 [SEQ ID No:9]) . Sequences are displayed using the single-letter code and are numbered on the left. Identical residues are denoted with dots, gaps
5 are introduced for optimal alignment, cysteine residues are marked with an asterisk, and N-linked glycosylation sites are denoted with a plus (+) .
Potential protein kinase C phosphorylation sites are indicated by arrows (HER4 amino acid positions 679, l() 685, and 699) . The predicted ATP-binding site is shown with 4 circled crosses, C-terminal tyrosines are denoted with open triangles, and tyrosines in HER4 that are conserved with the major autophosphorylation sites in the EGFR are indicated with black triangles.
15 The predicted extracellular domain extends from the boundary of the signal sequence marked by an arrow at position 25, to the hydrophobic transmembrane domain which is overlined from amino acid positions 650 through 675. Various subdo ains are labeled on the 0 right: I, II, III, and IV = extracellular subdomains (domains II and IV are cysteine-rich) ; TM = transmembrane domain; TK = tyrosine kinase domain. Domains I, III, TK are boxed.
Figure 7. Hydropathy profile of HER4 , aligned 5 with a comparison of protein domains for HER4 (1308 amino acids) , EGFR (1210 amino acids) , HER2 (1255 amino acids) , and HER3 (1342 amino acids) . The signal peptide is represented by a stippled box, the cysteine-rich extracellular subdomains are hatched, 0 the transmembrane domain is filled, and the cytoplas ic tyrosine kinase domain is stippled. The percent amino acid sequence identities between HER4 and other EGFR-family members are indicated. Sig, signal peptide; I, II, III, and IV, extracellular 5 domains; TM, transmembrane domain; JM, juxtamembrane domain; Cain, calcium influx and internalization domain; 3'UTR, 3' untranslated region.
Figures 8A and 8B. Northern blot analysis from human tissues hybridized to HER4 probes. RNA size markers (in kilobases) are shown on the left. Lanes 1 through 8 represent 2 μg of poly(A)+ mRNA from pancreas, kidney, skeletal muscle, liver, lung, placenta, brain, and heart, respectively. Figure 8A,
Northern blot analysis of mRNA from human tissues hybridized to HER4 probes from the 3 ' - autophosphorylation domain; Figure 8B, Northern blot analysis from human tissues hybridized to HER4 probes from the 5 ' -extracellular domain (see Section 6.2.3., infra ) . Figures 9A and 9B. Immunoblot analysis of recombinant HER4 stably expressed in CHO-KI cells, according to procedure outlined in Section 7.1.3, infra . Membrane preparations from CHO-KI cells expressing recombinant HER4 were separated on 7% SDS- polyacrylamide gels and transferred to nitrocellulose. In Figure 9A, blots were hybridized with a monoclonal antibody to the C-terminus of HER2 (Ab3, Oncogene Science, Uniondale, NY) that cross-reacts with HER . In Figure 9B, blots were hybridized with a sheep antipeptide polyclonal antibody to a common epitope of HER2 and HER4. Lane 1, parental CHO-KI cells; lanes 2 - 4, CHO-KI/HER4 cell clones 6, 21, and 3, respectively. Note the 180 kDa HER4 protein and the 130 kDa cross-reactive species. The size in kilodaltons of prestained high molecular weight markers (BioRad, Richmond, CA) is shown on the left.
Figures 10A through 10D. Specific activation of HER4 tyrosine kinase by a breast cancer differentiation factor (see Section 8., infra ) . Four recombinant cell lines, each of which was engineered to overexpress a single member of EGFR-family of tyrosine kinase receptors (EGFR, HER2 , HER3 , and
HER4) , were prepared according to the methods described in Sections 7.1.2 and 8.1. , infra . Cells from each of the four recombinant cell lines were stimulated with various ligand preparations and assayed for receptor tyrosine phosphorylation using the assay described in Section 8.2. , infra . Figure
10A, CHO/HER4 #3 cells; Figure 10B, CHO/HER2 cells;
Figure IOC, NRHER5 cells; and Figure 10D, 293/HER3 cells. Cells stimulated with: lane 1, buffer control; lane 2, 100 ng/ml EGF; lane 3, 200 ng/ml amphiregulin; lane 4, 10 ml phenyl, column fraction 17 (Section 9, infra ) ; lane 5, 10 μl phenyl column fraction 14 (Section 9. , infra , and see description of Figure 11, below) . The size (in kilodaltons) of the prestained molecular weight markers are labeled on the left of each panel. The phosphorylated receptor in each series migrates just below the 221 kDa marker. Bands at the bottom of the gels are extraneous and are due to the reaction of secondary antibodies with the antibodies used in the immunoprecipitation.
Figures 11A through 11F. Biological and biochemical properties of the MDA-MB-453-cell differentiation activity purified from the conditioned media of HepG2 cells (Section 9., infra ) . Figures 11A and 11B show induction of morphologic differentiation. Conditioned media from HepG2 cells was subjected to ammonium sulfate fractionation, followed by dialysis against PBS. Dilutions of this material were added to MDA-MB-453 monolayer at the indicated protein concentrations. Figure 11A, control; Figure 11B, 80 ng per well; Figure 11C, 2.0 μg per well; Figure 11D, Phenyl-5PW column elution profile monitored at 230 nm absorbance; Figure HE, Stimulation of MDA-MB- 453 tyrosine autophosphorylation with the following ligand preparations: None (control with no factor added) ; TGF-α (50 ng/ml) ; CM (16-fold concentrated HepG2 .conditioned medium tested at 2 μl and 10 μl per well); fraction (phenyl column fractions 13 to 20, 10 μl per well) . Figure 11F, Densitometry analysis of the phosphorylation signals shown in Figure HE. Figures 12A and 12B. NDF-induced tyrosine phosphorylation. Figure 12A, MDA-MB-453 cells (lane 1, mock transfected COS cell supernatant; lane 2, NDF transfected COS cell supernatant) ; Figure 12B, CHO/HER4 21-2 cells (lanes 1 and 2, mock transfected COS cell supernatant; lanes 3 and 4, NDF transfected COS cell supernatant) . See Section 10., infra . Tyrosine phosphorylation was determined by the tyrosine kinase stimulation assay described in Section 8.2., infra .
Figures 13A and 13B. Regional location of the HER4 gene to human chromosome 2 band q33. Figure 13A, Distribution of 124 sites of hybridization on human chromosomes; Figure 13B, Distribution of autoradiographic grains on diagram of chromosome 2.
Figure 14. Amino acid sequence of HER4-Ig fusion protein [SEQ ID No: 10] (Section 5.4., infra ) . Figure 15. Recombinant heregulin induces tyrosine phosphorylation of HER4. Tyrosine phosphorylated receptors were detected by Western blotting with an anti-phosphotyrosine Mab. Arrows indicate the HER2 and HER4 proteins. Monolayers of MDA-MB453 or CHO/HER4 cells were incubated with media from COS-1 cells transfected with a rat heregulin expression plasmid (HRG) , or with a cDM8 vector control (-) . The media was either applied directly (lx) or after concentrating 20-fold (20x, and vector control) . Solubilized cells were immunoprecipitated with anti-phosphotyrosine Mab. Monolayers of CHO/HER2 cells were incubated as above with transfected Cos-1 cell supernatants or with two stimulatory Mabs to HER2 (Mab 28 and 29) . Solubilized cells were immunoprecipitated with anti-HER2 Mab.
Figures 16A through 16C. Expression of recombinant HER2 and HER4 in human CEM cells. Transfected CEM cells were selected that stably express either HER2 , HER4 , or both recombinant receptors. In Figure 16A, recombinant HER2 was detected by immunmoprecipitation of cell lysates with anti-HER2 Mab (Ab-2) and Western blotting with another anti-HER2 Mab (Ab-3) . In Figure 16B, Recombinant HER4 was detected by immunoprecipitation of S-labeled cell lysates with HER4-specific rabbit anti-peptide antisera. In Figure 16C, Three CEM cell lines were selected that express one or both recombinant receptors and aliquots of each were incubated with media control (-) , with two HER2-stimulatory Mabs (Mab 28 and 29) , or with an isotype matched control Mab (18.4) . Solubilized cells were immunoprecipitated with anti-HER2 Mab (Ab-2) and tyrosine phosphorylated HER2 was detected by Western blotting with an anti- phosphotyrosine Mab. The size in kilodaltons of prestained high molecular weight markers (Bio-Rad) is shown on the left and arrows indicate the HER2 and HER4 proteins. Figures 17A through 17C. Heregulin induces tyrosine phosphorylation in CEM cells expressing HER . Three CEM cell lines that express either HER2 or HER4 alone (CEM 1-3 and CEM 3-13) or together (CEM 2-9) were incubated with 7x concentrated supernatants from mock-(-) or heregulin-transfected (+) COS-1 cells. Solubilized cells were immunoprecipitated (IP) with anti-phosphotyrosine Mab (PY20) ; in Figure 17A, HER2-specific anti-HER2 Mab (Ab-2) ; in Figure 17B,
HER4-specific Mab (6-4) ; in Figure 17C, in each case tyrosine phosphorylated receptors were detected by
Western blotting with anti-phosphotyrosine Mab. The size in kilodaltons of prestained molecular weight markers (BioRad) is shown on the left and arrows indicate the HER2 and HER4 proteins. HRG, recombinant rat heregulin.
Figure 18. Covalent cross-linking of iodinated heregulin to HER4. 125I-heregulin was added to
CHO/HER4 or CH0/HER2 cells for 2 h at 4° C. Washed cells were cross-linked with BS , lysed, and the proteins separated using 7% PAGE. Labeled bands were detected on the phosphorimager. Molecular weight markers are shown on the left.
Figures 19A through 19D. Purification of p45 from HepG2 conditioned media. Column fractions were tested for their potential to induce differentiation of MDA-MB-453 cells. Active fractions were pooled as indicated by an horizontal bar. Figure 19A,
Concentrated HepG2 conditioned medium was subjected to 50% ammonium sulfate precipitation. Supernatant resulting from this step was subjected to hydrophobic interaction chromatography using phenyl-Sepharose. Pooled fractions were then loaded on a DEAE-Sepharose column. Figure 19B, the DEAE-Sepharose column flow- through was subjected to CM-Sepharose chromatography. Figure 19C, Affinity Chromatography of the MDA-MB-453 differentiation factor using heparin-5PW column. Fractions 35-38 eluting around 1.3M NaCl were pooled. Figure 19D, Size Exclusion chromatography of the differentiation factor. The molecular masses of calibration standards are ■ indicated in kilodaltons. Figure 20. Aliquots (25 microliter) of the active size exclusion column fractions (30 and 32) were electrophoresed under reducing conditions on a 12.5% polyacrylamide gel. The gel was silver-stained. Molecular masses of Bio-Rad silver stain standards are indicated in kilodaltons.
Figures 21A through 21C. Stimulation of tyrosine phosphorylation by p45. Figure 21A, Size exclusion column fractions were tested on MDA-MB-453 cells for the induction of tyrosine phosphorylation. Cell lysates were then electrophoresed on a 4-15% polyacrylamide gel. After transfer to nitrocellulose, proteins were probed with a phosphotyrosine antibody and phosphoproteins detected by chemiluminescence.
The molecular mass of the predominantly phosphorylated protein is indicated. Figure 21B, the experiments were performed on cells that had been transfected with expression plasmids for either HER4 (CHO/HER4) or HER2 (CH0/HER2) . Cell monolayers were incubated in the absence or the presence of p45 (size exclusion column fraction 32, 100 ng/ml) . Samples were then processed as indicated in Figure 21A except that a 7.5% polyacrylamide gel was used to separate the CHO/HER2 cell lysates. Figure 21C, CHO/HER2 cells were incubated in the presence or the absence of N29 monoclonal antibody to the extracellular domain of pl85er . Cell lysates were immunopjrreecciipitated with the Ab-3 monoclonal antibody to pl85. erb 2 Precipitated proteins were subjected to SDS-PAGE, and phosphoproteins were detected as indicated under Section 13.4. , supra .
Figures 22A and 22B. Binding and cross-linking of 125I-p45 to CHO-KI, CHO-HER2 and CHO/HER4 cells.
125 Figure 22A, Scatchard analysis of the binding of I- p45 to CHO/HER4 cells. Increasing concentrations of
125 I-p45 were incubated with cell monolayers for 2 h at 4° C. Nonspecific binding was subtracted from all cell-associated radioactivity data values. A Scatchard plot as well as a saturation curve of the binding data are shown. Figure 22B, Covalent cross- linking. I-p45 was added to the cells in the presence or absence of an excess of unlabeled p45 for 2 h at 4° C. After washing of the cells to remove unbound iodinated material, the cross-linking reagent bis-(sulfosuccinimidyl) -suberate was added to the cells for 45 min. at 4° C. Cells were lysed and
5 proteins separated by electrophoresis on a 7.5% polyacrylamide gel. Molecular masses of protein standards are indicated in kilodaltons. A Molecular
Dynamics Phospholmager was used to visualize the radioactive species.
It) Figures 23A and 23B. Construction of the HAR-TX β2 expression plasmid, encoding the hydrophilic leader sequence of amphiregulin (AR) , heregulin β2, and PE40, under control of the IPTG inducible T7 promoter; Figure 23A, schematic diagram of the expression
15 plasmid pSE 8.4, encoding HAR-TX β2 ; Figure 23B, amino acid sequence of HAR β2 , the ligand portion of
HAR-TX β2 , composed of the AR leader sequence and rat heregulin β2 [SEQ ID No:40].
Figures 24A and 24B. cDNA sequence [SEQ ID 0 No: 41] and deduced amino acid sequence [SEQ ID No:42] of the chimera HAR-TX β2 , comprising the amphiregulin (AR) leader sequence and the coding sequences of rat heregulin Pseudomonaε exotoxin PE40. The linker sequence between the two portions is indicated by a 5 bar above the sequence, the ligand portion is located at the 5' (N-terminal) , the PE40 exotoxin portion is located at the 3' (C-terminal) part of the sequence. Nucleotides are numbered on the right side, and amino acids are numbered below the sequence. 0 Figure 25. Purification of the chimeric HAR-TX b2 protein: shown is a Coo assie brilliant blue stained SDS-PAGE (4-20%) of the different purification steps. Lanes 1 - 5 have been loaded under reducing conditions. Lane 1, MW standards; lane 2, refolded 5 HAR-TX β2, 2Ox concentrated; lane 3, POROS HS flow- through, 20x concentrated; lane 4, POROS HS eluate; lane 5, Source 15S eluate (pure HAR-TX β2, 2 μg) ; lane
6, 2 μg HAR-TX β2 , loaded under non-reducing conditions.
Figure 26. Membrane-based ELISA binding analysis, performed to determine the binding activity of the purified HAR-TX β2 protein. Binding of HAR-TX β2 (O) and PE40 (•) to membranes prepared from the HER4 expressing human breast carcinoma cell line. Figure 27. HAR-TX bβ2 induced tyrosine phosphorylation in transfected CEM cells. CEM cells co-expressing HER4 and HER2 (H2,4) , or expressing HER4 (H4) , HER2 (H2) , HER1 (HI) alone, respectively, were incubated in the presence (+) or absence (-) of HAR-TX β2 , then solubilized, and immunoblotted with the monoclonal anti-phosphotyrosine antibody PY20. The arrow indicates the phosphorylated receptor band, the molecular weight is indicated in kDA.
Figures 28A and 28B. Cytotoxic effect of HAR-TX β2 on tumor cell lines. Figure 28A, following 48 hours incubation with HAR-TX β2, the cell killing effect of HAR-TX β2 on the tumor cell lines LNCaP (■) , AU565 (O) , SKBR3 (•) , and SKOV3 (, ) by quantification of fluorescent calcein cleaved from calcein-AM.
Figure 28B, Competitive cytotoxicity of HAR-TX β2 with heregulin β2-Ig. LNCaP cells were co-incubated with 50 ng/ml HAR-TX β2 and increasing concentrations (2-5000 ng/ml) of either heregulin β2-Ig ( Z ) or L6-Ig (■) . The data represent the mean of triplicate assays. Figure 29. HAR-TX β2 induced tyrosine phosphorylation in tumor cells expressing HER3 (L2987) or co-expressing HER2 and HER3 (H3396) . Cells were incubated in the presence (+) or in the absence (-) of
HAR-TX β2, solubilized, and immunoblotted with the monoclonal anti-phosphotyrosine antibody PY20. Phosphorylated receptors are indicated by an arrow, the molecular weight is indicated in kDa.
5. Detailed Description of the Invention The present invention is directed to
HER4/pl80erbB4 ("HER4"), a closely related yet distinct member of the Human EGF Receptor (HER) /neu subfamily of receptor tyrosine kinases, as well as HER4-encoding polynucleotides (e.g., cDNAs, geno ic DNAs, RNAs, anti-sense RNAs, etc.) , the production of mature and precursor forms of HER4 from a HER4 polynucleotide coding sequence, recombinant HER4 expression vectors, HER4 analogues and derivatives, anti-HER4 antibodies, HER4 ligands, and diagnostic and therapeutic uses of HER4 polynucleotides, polypeptides, ligands, and antibodies in the field of human oncology and neurobiology.
As discussed in Section 2, supra , HER2 has been reported to be associated with a wide variety of human malignancies, thus the understanding of its activation mechanisms as well as the identification of molecules involved are of particular clinical interest. This invention uncovers an apparent functional relationship between the HER4 and HER2 receptors involving HER4- mediated phosphorylation of HER2 , potentially via intracellular receptor crosstalk or receptor dimerization. In this connection, the invention also
provides HER4 ligands capable of inducing cellular differentiation in breast carcinoma cells that appears to involve HER4-mediated phosphorylation of HER2. Furthermore, applicants' data provide evidence that heregulin mediates biological effects on such cells not directly through HER2 , as has been reported (Peles et al . , 1992, Cell 69:205-216) , but instead by means of a direct interaction with HER4 , and/or through an interaction with a HER2/ HER4 complex. In cell lines expressing both HER2 and HER4 , binding of heregulin to HER4 may stimulate HER2 either by heterodimer formation of these two related receptors or by intracellular receptor crosstalk.
Recently, also HER3 has been reported to bind heregulin (see Section 2, supra ) . However, various observations indicate that the heregulin-mediated activation of HER3 varies considerably, depending on the context of expression, suggesting that other cellular components may be involved in the modulation of HER3 activity (reviewed in: Carraway and Cantley, 1994, Cell 78:5-8) .
Unless otherwise indicated, the practice of the present invention utilizes standard techniques of molecular biology and molecular cloning, microbiology, immunology, and recombinant DNA known in the art.
Such techniques are described and explained throughout the literature, and can be found in a number of more comprehensive publications such as, for example, Sambrook et al . , Molecular Cloning; A Laboratory Manual (Second Edition, 1989) .
5.1. HER4 Polynucleotides
One aspect of the present invention is directed to HER4 polynucleotides, including recombinant polynucleotides encoding the prototype HER4 polypeptide shown in FIG. IA and IB, polynucleotides which are related or are complementary thereto, and recombinant vectors and cell lines incorporating such recombinant polynucleotides. The term "recombinant polynucleotide" as used herein refers to a polynucleotide of genomic, cDNA, synthetic or semisynthetic origin which, by virtue of its origin or manipulation, is not associated with any portion of the polynucleotide with which it is associated in nature, and may be linked to a polynucleotide other than that to which it is linked in nature, and includes single or double stranded polymers of ribonucleotides, deoxyribonucleotides, nucleotide analogs, or combinations thereof. The term also includes various modifications known in the art, including but not limited to radioactive and chemical labels, methylation, caps, internucleotide modifications such as those with charged linkages (e.g., phosphorothothioates, phosphorodithothioates, etc.) and uncharged linkages (e . g . , methyl phosphonates , phosphotriesters, phosphoamidites, carbamites, etc.), as well as those containing pendant moeties, intercalcators, chelators, alkylators, etc. Related polynucleotides are those having a contiguous stretch of about 200 or more nucleotides and sharing at least about 80% homology to a corresponding sequence of nucleotides within the nucleotide sequence disclosed in FIG. IA and IB. Several particular embodiments of such HER4 polynucleotides and vectors are provided in example Sections 6 and 7, infra . HER4 polynucleotides may be obtained using a variety of general techniques known in the art, including molecular cloning and chemical synthetic methods. One method by which the molecular cloning of cDNAs encoding the prototype HER4 polypeptide of the invention (FIG. IA and I B) , as well as several HER4 polypeptide variants, is described by way of example in Section 6., infra . Conserved regions of the sequences of EGFR, HER2 , HER3 , and Xmrk are used for selection of the degenerate oligonucleotide primers which are then used to isolate HER4. Since many of these sequences have extended regions of amino acid identity, it is difficult to determine if a short PCR fragment represents a unique molecule or merely the species-specific counterpart of EGFR, HER2 , or HER3. Often the species differences for one protein are as great as the differences within species for two distinct proteins. For example, fish Xmrk has regions of 47/55 (85%) amino acid identity to human EGFR, suggesting it might be the fish EGFR, however isolation of another clone that has an amino acid sequence identical to Xmrk in this region (57/57) shows a much higher homology to human EGFR in its flanking sequence (92% amino acid homology) thereby suggesting that it, and not Xmrk, is the fish EGFR (Wittbrodt et al . , 1989, Nature 342:415-421). As described in Section 6., infra , it was necessary to confirm that a murine HER4/eriB4 PCR fragment was indeed a unique gene, and not the murine homolog of EGFR, HER2, or HER3, by isolating genomic fragments corresponding to murine EGFR, er__>B2 and eri_>B3. Sequence analysis of these clones confirmed that this fragment was a novel member of the EGFR family. Notably a region of the murine clone had a stretch of 60/64 amino acid identity to human HER2 , but comparison with the amino acid and DNA sequences of the other EGFR homologs from the same species (mouse) firmly established it encoded a novel transcript. HER4 polynucleotides may be obtained from a variety of cell sources which produce HER4-like activities and/or which express HER4-encoding mRNA . In this connection, applicants have identified a number of suitable human cell sources for HER4 polynucleotides, including but not limited to brain, cerebellum, pituitary, heart, skeletal muscle, and a variety of breast carcinoma cell lines (see Section 6. , infra ) .
For example, polynucleotides encoding HER4 polypeptides may be obtained by cDΝA cloning from RΝA isolated and purified from such cell sources or by genomic cloning. Either cDΝA or genomic libraries of clones may be prepared using techniques well known in the art and may be screened for particular HER4- encoding DΝAs with nucleotide probes which are substantially complementary to any portion of the HER4 gene. Various PCR cloning techniques may also be used to obtain the HER4 polynucleotides of the invention. A number of PCR cloning protocols suitable for the isolation of HER4 polynucleotides have been reported in the literature (see, for example, PCR protocols: A
Guide to Methods and Applications, Eds. Inis et al . , Academic Press, 1990) .
For the construction of expression vectors, polynucleotides containing the entire coding region of the desired HER4 may be isolated as full length clones or prepared by splicing two or more polynucleotides together. Alternatively, HER4-encoding DΝAs may be synthesized in whole or in part by chemical synthesis using techniques standard in the art. Due to the inherent degeneracy of nucleotide coding sequences, any polynucleotide encoding the desired HER4 polypeptide may be used for recombinant expression. Thus, for example, the nucleotide sequence encoding the prototype HER4 of the invention provided in FIG. IA and IB may be altered by substituting nucleotides such that the same HER4 product is obtained.
The invention also provides a number of useful applications of the HER4 polynucleotides of the invention, including but not limited to their use in the preparation of HER4 expression vectors, primers and probes to detect and/or clone HER4, and diagnostic reagents. Diagnostics based upon HER4 polynucleotides include various hybridization and PCR assays known in the art, utilizing HER4 polynucleotides as primers or probes, as appropriate. One particular aspect of the invention relates to a PCR kit comprising a pair of primers capable of priming cDNA synthesis in a PCR reaction, wherein each of the primers is a HER4 polynucleotide of the invention. Such a kit may be useful in the diagnosis of certain human cancers which are characterized by aberrant HER4 expression. For example, certain human carcinomas may overexpress HER4 relative to their normal cell counterparts, such as human carcinomas of the breast. Thus, detection of HER4 overexpression mRNA in breast tissue may be an indication of neoplasia. In another, related embodiment, human carcinomas characterized by overexpression of HER2 and expression or overexpression of HER4 may be diagnosed by a polynucleotide-based assay kit capable of detecting both HER2 and HER4 mRNAs, such a kit comprising, for example, a set of PCR primer pairs derived from divergent sequences in the HER2 and HER4 genes, respectively.
5.2. HER4 Polypeptides
Another aspect of the invention is directed to HER4 polypeptides, including the prototype HER4 polypeptide provided herein, as well as polypeptides derived from or having substantial homology to the amino acid sequence of the prototype HER4 molecule. The term "polypeptide" in this context refers to a polypeptide prepared by synthetic or recombinant means, or which is isolated from natural sources. The term "substantially homologous" in this context refers to polypeptides of about 80 or more amino acids sharing greater than about 90% amino acid homology to a corresponding contiguous amino acid sequence in the prototype HER4 primary structure (FIG. IA and IB) . The term "prototype HER4" refers to a polypeptide having the amino acid sequence of precursor or mature HER4 as provided in FIG. IA and IB, which is encoded by the consensus cDNA nucleotide sequence also provided therein, or by any polynucleotide sequence which encodes the same amino acid sequence.
HER4 polypeptides of the invention may contain deletions, additions or substitutions of amino acid residues relative to the sequence of the prototype HER4 depicted in FIG. IA and IB which result in silent changes thus producing a bioactive product. Such amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or the amphipathic nature of the resides involved. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; amino acids with uncharged polar head groups or nonpolar head groups having similar hydrophilicity values include the following: leucine, isoleucine, valine; glycine, alanine; asparagine, glutamine; serine, threonine; phenylalanine, tyrosine.
The HER4 polypeptide depicted in FIG. IA and IB has all of the fundamental structural features characterizing the EGFR-family of receptor tyrosine kinases (Hanks et al . , 1988, Science 241:42-52) . The precursor contains a single hydrophobic stretch of 26 amino acids characteristic of a transmembrane region that bisects the protein into a 625 amino acid extracellular ligand binding domain, and a 633 amino acid C-terminal cytoplasmic domain. The ligand binding domain can be further divided into 4 subdomains (I - IV) , including two cysteine-rich regions (II, residues 186-334; and IV, residues 496- 633) , and two flanking domains (I, residues 29-185; and III, residues 335-495) that may define specificity for ligand binding (Lax et al . , 1988, Mol. Cell. Biol. 8:1970-78). The extracellular domain of HER4 is most similar to HER3 , where domains II-IV of HER4 share 56- 67% identity to the respective domains of HER3. In contrast, the same regions of EGFR and HER2 exhibit 43-51% and 34-46% homology to HER4 , respectively (FIG. 6A and 6B) . The 4 extracellular subdomains of EGFR and HER2 share 39-50% identity. HER4 also conserves all 50 cysteines present in the extracellular portion of EGFR, HER2, and HER3 , except that the HER2 protein lacks the fourth cysteine in domain IV. There are 11 potential N-linked glycosylation sites in HER4 , conserving 4 of 12 potential sites in EGFR, 3 of 8 sites in HER2 , and 4 of 10 sites in HER3.
Following the transmembrane domain of HER4 is a cytoplasmic juxtamembrane region of 37 amino acids. This region shares the highest degree of homology with EGFR (73% amino acid identity) and contains two consensus protein kinase C phosphorylation sites at amino acid residue numbers 679 (Serine) and 699 (Threonine) in the FIG. IA and IB sequence, the latter of which is present in EGFR and HER2. Notably, HER4 lacks a site analogous to Thr654 of EGFR. Phosphorylation of this residue in the EGFR appears to block ligand-induced internalization and plays an important role in its transmembrane signaling (Livneh et al . , 1988, Mol. Cell. Biol. 8:2302-08). HER4 also contains Thr692 analogous to Thr694 of HER2. This threonine is absent in EGFR and HER3 and has been proposed to impart cell-type specificity to the mitogenic and transforming activity of the HER2 kinase (DiFiore et al . 1992, EMBO J. 11:3927-33). The juxta embrane region of HER4 also contains a MAP kinase consensus phosphorylation site at amino acid number 699 (Threonine) , in a position homologous to Thr699 of EGFR which is phosphorylated by MAP kinase in response to EGF stimulation (Takishima et al . , 1991, Proc. Natl. Acad. Sci. U.S.A. 88:2520-25). The remaining cytoplasmic portion of HER4 consists of a 276 amino acid tyrosine kinase domain, an acidic helical structure of 38 amino acids that is homologous to a domain required for ligand-induced internalization of the EGFR (Chen et al . , 1989, Cell 59:33-43), and a 282 amino acid region containing 18 tyrosine residues characteristic of the autophosphorylation domains of other EGFR-related proteins (FIG. 6A and 6B) . The 276 amino acid tyrosine kinase domain conserves all the diagnostic structural motifs of a tyrosine kinase, and is most related to the catalytic domains of EGFR (79% identity) and HER2 (77% identity) , and to a lesser degree, HER3 (63% identity) . In this same region, EGFR and HER2 share 83% identity. Examples of the various conserved structural motifs include the following: the ATP-binding motif (GXGXXG) [SEQ ID No:11] with a distal lysine residue that is predicted to be involved in the phosphotransfer reaction (Hanks et al . , 198, Science 241:42-52; Hunter and Cooper, in The Enzymes Vol. 17 (eds. Boyer and Krebs) pp. 191-246 (Academic Press 1986) ) ; tyrosine-kinase specific signature sequences (DLAARN [SEQ ID No:12] and PIKWMA [SEQ ID No:13]) and Tyr875 (FIG. 6A and 6B) , a residue that frequently serves as an autophosphorylation site in many tyrosine kinases (Hunter and Cooper, supra) ; and approximately 15 residues that are either highly or completely conserved among all known protein kinases (Plowman et al . , 1990, Proc. Natl. Acad. Sci. U.S.A. 87:4905-09; Hanks et al . , supra ) . The C- terminal 282 amino acids of HER4 has limited homology with HER2 (27%) and EGFR (19%) . However, the C- terminal domain of each EGFR-family receptor is proline-rich and conserves stretches of 2-7 amino acids that are generally centered around a tyrosine residue. These residues include the major tyrosine autophosphorylation sites of EGFR at Tyrl068, Tyrl086, Tyrll48, and Tyrll73 (FIG. 6A and 6B, filled triangles; Margolis et al . , 1989, J. Biol. Chem. 264:10667-71).
5.3. Recombinant Synthesis of HER4 Polypeptides
The HER4 polypeptides of the invention may be produced by the cloning and expression of DNA encoding the desired HER4 polypeptide. Such DNA may be ligated into a number of expression vectors well known in the art and suitable for use in a number of acceptable host organisms, in fused or mature form, and may contain a signal sequence to permit secretion. Both prokaryotic and eukaryotic host expression systems may be employed in the production of recombinant HER4 polypeptides. For example, the prototype HER4 precursor coding sequence or its functional equivalent may be used in a host cell capable of processing the precursor correctly. Alternatively, the coding sequence for mature HER4 may be used to directly express the mature HER4 molecule. Functional equivalents of the HER4 precursor coding sequence include any DNA sequence which, when expressed inside the appropriate host cell, is capable of directing the synthesis, processing and/or export of HER4. Production of a HER4 polypeptide using recombinant DNA technology may be divided into a four- step process for the purposes of description: (1) isolation or generation of DNA encoding the desired HER4 polypeptide; (2) construction of an expression vector capable of directing the synthesis of the desired HER4 polypeptide; (3) transfection or transformation of appropriate host cells capable of replicating and expressing the HER4 coding sequence and/or processing the initial product to produce the desired HER4 polypeptide; and (4) identification and purification of the desired HER4 product.
5.3.1. Isolation or Generation of HER4
Encoding DNA
HER4-encoding DNA, or functional equivalents thereof, may be used to construct recombinant expression vectors which will direct the expression of the desired HER4 polypeptide product. In a specific embodiment, DNA encoding the prototype HER4 polypeptide (FIG. IA and IB) , or fragments or functional equivalents thereof, may be used to generate the recombinant molecules which will direct the expression of the recombinant HER4 product in appropriate host cells. HER4-encoding nucleotide sequences may be obtained from a variety of cell sources which produce HER4-like activities and/or which express HER4-encoding mRNA. For example, HER4- encoding cDNAs may be obtained from the breast adenocarcinoma cell line MDA-MB-453 (ATCC HTB131) as described in Section 6., infra . In addition, a number of human cell sources are suitable for obtaining HER4 cDNAs, including but not limited to various epidermoid and breast carcinoma cells, and normal heart, kidney, 5 and brain cells (see Section 6.2.3., infra ) .
The HER4 coding sequence may be obtained by molecular cloning from RNA isolated and purified from such cell sources or by genomic cloning. Either cDNA or genomic libraries of clones may be prepared using
10 techniques well known in the art and may be screened for particular HER4-encoding DNAs with nucleotide probes which are substantially complementary to any portion of the HER4 gene. Alternatively, cDNA or genomic DNA may be used as templates for PCR cloning
15 with suitable oligonucleotide primers. Full length clones, i.e., those containing the entire coding region of the desired HER4 may be selected for constructing expression vectors, or overlapping cDNAs can be ligated together to form a complete coding
20 sequence. Alternatively, HER4-encoding DNAs may be synthesized in whole or in part by chemical synthesis using techniques standard in the art.
5.3.2. Construction of HER4 Expression
25 Vectors
Various expression vector/host systems may be utilized equally well by those skilled in the art for the recombinant expression of HER4 polypeptides. Such systems include but are not limited to microorganisms
30 such as bacteria transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing the desired HER4 coding sequence; yeast transformed with recombinant yeast expression vectors containing the desired HER4 coding __ sequence; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing the desired HER4 coding sequence; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing the desired HER4 coding sequence; or animal cell systems infected with recombinant virus expression vectors (e.g., adenovirus, vaccinia virus) including cell lines engineered to contain multiple copies of the HER4 DNA either stably amplified (e . g . , CHO/dhfr, CHO/gluta ine synthetase) or unstably amplified in double-minute chromosomes (e . g . , murine cell lines) .
The expression elements of these vectors vary in their strength and specificities. Depending on the host/vector system utilized, any one of a number of suitable transcription and translation elements may be used. For instance, when cloning in mammalian cell systems, promoters isolated from the genome of mammalian cells, (e.g., mouse metallothionein promoter) or from viruses that grow in these cells, (e . g. , vaccinia virus 7.5K promoter or Moloney murine sarcoma virus long terminal repeat) may be used. Promoters produced by recombinant DNA or synthetic techniques may also be used to provide for transcription of the inserted sequences.
Specific initiation signals are also required for sufficient translation of inserted protein coding sequences. These signals include the ATG initiation codon and adjacent sequences. In cases where the entire HER4 gene including its own initiation codon and adjacent sequences are inserted into the appropriate expression vectors, no additional translational control signals may be needed. However, in cases where only a portion of the coding sequence is inserted, exogenous translational control signals, including the ATG initiation codon must be provided. Furthermore, the initiation codon must be in phase with the reading frame of the HER4 coding sequences to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of transcription attenuation sequences, enhancer elements, etc.
For example, in cases where an adenovirus is used as a vector for driving expression in infected cells, the desired HER4 coding sequence may be ligated to an adenovirus transcription/translation control complex, e . g . , the late promoter and tripartite leader sequence. This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g., region E3 or E4) will result in a recombinant virus that is viable and capable of expressing HER4 in infected hosts. Similarly, the vaccinia 7.5K promoter may be used. An alternative expression system which could be used to express HER4 is an insect system. In one such system, Autographa californica nuclear polyhidrosis virus (AcNPV) is used as a vector to express foreign genes. The virus grows in Spodoptera fr giperda cells. The HER4 coding sequence may be cloned into non-essential regions (for example the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (for example the polyhedrin promoter) . Successful insertion of the HER4 coding sequence will result in inactivation of the polyhedrin gene and production of non-occluded recombinant virus (i . e . , virus lacking the proteinaceous coat encoded by the polyhedrin gene) . These recombinant viruses are then used to infect Spodoptera frugiperda cells in which the inserted gene is expressed. Yet another approach uses retroviral vectors prepared in amphotropic packaging cell lines, which permit high efficiency expression in numerous cells types. This method allows one to assess cell- type specific processing, regulation or function of the inserted protein coding sequence.
In addition, a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Expression from certain promoters can be elevated in the presence of certain inducers (e.g., zinc and cadmium ions for metallothionein promoters) . Therefore, expression of the recombinant HER4 polypeptide may be controlled. This is important if the protein product of the cloned foreign gene is lethal to host cells. Furthermore, modifications (e.g., phosphorylation) and processing (e . g . , cleavage) of protein products are important for the function of the protein. Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of protein. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed.
5.3.3. Transformants Expressing HE 4 Gene Products
The host cells which contain the recombinant coding sequence and which express the desired HER4 polypeptide product may be identified by at least four general approaches (a) DNA-DNA, DNA-RNA or RNA- antisense RNA hybridization; (b) the presence or absence of "marker" gene functions; (c) assessing the level of transcription as measured by the expression of HER4 mRNA transcripts in the host cell; and (d) detection of the HER4 product as measured by immunoassay and, ultimately, by its biological activities. In the first approach, for example, the presence of HER4 coding sequences inserted into expression vectors can be detected by DNA-DNA hybridization using hybridization probes and/or primers for PCR reactions comprising polynucleotides that are homologous to the HER4 coding sequence.
In the second approach, the recombinant expression vector/host system can be identified and selected based upon the presence or absence of certain "marker" gene functions (e.g., thymidine kinase activity, resistance to antibiotics, resistance to methotrexate (MTX) , resistance to methionine sulfoximine (MSX) , transformation phenotype, occlusion body formation in baculovirus, etc.) . For example, if the HER4 coding sequence is inserted within a marker gene sequence of the vector, recombinants containing that coding seguence can be identified by the absence of the marker gene function. Alternatively, a marker gene can be placed in tandem with the HER4 sequence under the control of the same or different promoter used to control the expression of the HER4 coding sequence. Expression of the marker in response to induction or selection indicates expression of the HER4 coding sequence. In a particular embodiment described by way of example herein, a HER4 expression vector incorporating glutamine synthetase as a selectable marker is constructed, used to transfect CHO cells, and amplified expression of HER4 in CHO cells is obtained by selection with increasing concentration of MSX. In the third approach, transcriptional activity for the HER4 coding region can be assessed by hybridization assays. For example, polyadenylated RNA can be isolated and analyzed by Northern blot using a probe homologous to the HER4 coding sequence or particular portions thereof. Alternatively, total nucleic acids of the host cell may be extracted and assayed for hybridization to such probes.
In the fourth approach, the expression of HER4 can be assessed immunologically, for example by Western blots, immunoaεsays such as radioimmunoprecipitation, enzyme-linked immunoassays and the like. Alternatively, expression of HER4 may be assessed by detecting a biologically active product. Where the host cell secretes the gene product the cell free media obtained from the cultured transfectant host cell may be assayed for HER4 activity. Where the gene product is not secreted, cell lysates may be assayed for such activity. In either case, assays which measure ligand binding to HER4, HER4 phosphorylation, or other bioactivities of HER4 may be used.
5.4. Anti-HE Antibodies The invention is also directed to polyclonal and monoclonal antibodies which recognize epitopes of HER4 polypeptides. Anti-HER4 antibodies are expected to have a variety of useful applications in the field of oncology, several of which are described generally below. More detailed and specific descriptions of various uses for anti-HER4 antibodies are provided in the sections and subsections which follow. Briefly, anti-HER4 antibodies may be used for the detection and quantification of HER4 polypeptide expression in cultured cells, tissue samples, and in vivo . Such immunological detection of HER4 may be used, for example, to identify, monitor, and assist in the prognosis of neoplasms characterized by aberrant or attenuated HER4 expression and/or function. Additionally, monoclonal antibodies recognizing epitopes from different parts of the HER4 structure may be used to detect and/or distinguish between native HER4 and various subcomponent and/or mutant forms of the molecule. Anti-HER4 antibody preparations are also envisioned as useful biomodulatory agents capable of effectively treating particular human cancers. In addition to the various diagnostic and therapeutic utilities of anti-HER4 antibodies, a number of industrial and research applications will be obvious to those skilled in the art, including, for example, the use of anti-HER4 antibodies as affinity reagents for the purification of HER4 polypeptides, and as immunological probes for elucidating the biosynthesis, metabolism and biological functions of HER4.
Anti-HER4 antibodies may be useful for influencing cell functions and behaviors which are directly or indirectly mediated by HER4. As an example, modulation of HER4 biological activity with anti-HER4 antibodies may influence HER2 activation and, as a consequence, modulate intracellular signals generated by HER2. In this regard, anti-HER4 antibodies may be useful to effectively block ligand- induced, HER4-mediated activation of HER2 , thereby affecting HER2 biological activity. Conversely, anti- HER4 antibodies capable of acting as HER4 ligands may be used to trigger HER4 biological activity and/or initiate a ligand-induced, HER4-mediated effect on HER2 biological activity, resulting in a cellular response such as differentiation, growth inhibition, etc.
Additionally, anti-HER4 antibodies conjugated to cytotoxic compounds may be used to selectively target such compounds to tumor cells expressing HER4, resulting in tumor cell death and reduction or eradication of the tumor. In a particular embodiment, toxin-conjugated antibodies having the capacity to bind to HER4 and internalize into such cells are administered systemically for targeted cytotoxic effect. The preparation and use of radionuclide and toxin conjugated anti-HER4 antibodies are further described in Section 5.5., infra .
Overexpression of HER2 is associated with several human cancers. Applicants' data indicate that HER4 is expressed in certain human carcinomas in which HER2 overexpression is present. Therefore, anti-HER4 antibodies may have growth and differentiation regulatory effects on cells which overexpress HER2 in combination with HER4 expression, including but not limited to breast adenocarcinoma cells. Accordingly, this invention includes antibodies capable of binding to the HER4 receptor and modulating HER2 or HER2-HER4 functionality, thereby affecting a response in the target cell. For the treatment of cancers involving HER4-mediated regulation of HER2 biological activity, agents capable of selectively and specifically affecting the intracellular molecular interaction between these two receptors may be conjugated to internalizing anti-HER4 antibodies. The specificity of such agents may result in biological effects only in cells which co-express HER2 and HER4, such as breast cancer cells.
Various procedures known in the art may be used for the production of polyclonal antibodies to epitopes of HER4. For the production of polyclonal antibodies, a number of host animals are acceptable for the generation of anti-HER4 antibodies by immunization with one or more injections of a HER4 polypeptide preparation, including but not limited to rabbits, mice, rats, etc. Various adjuvants may be used to increase the immunological response in the host animal, depending on the host species, including but not limited to Freund's (complete and incomplete) , mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, oil emulsions, keyhole lympet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum.
A monoclonal antibody to an epitope of HER4 may be prepared by using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include but are not limited to the hybridoma technique originally described by Kohler and Milstein (1975, Nature 256, 495-497) , and the more recent human B-cell hybridoma technique (Kosbor et al . , 1983, Immunoloσv Today 4:72) and EBV-hybridoma technique (Cole et al . , 1985, Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc. , pp. 77-96) . In addition, techniques developed for the production of "chimeric antibodies" by splicing the genes from a mouse antibody molecule of appropriate antigen specificity together with genes from a human antibody molecule of appropriate biological activity may be used (Morrison et al . ,
1984, Proc. Natl. Acad. Sci.. 81:6851-6855; Neuberger et ai . , 1984, Nature, 312:604-608; Takeda et al . ,
1985, Nature, 314:452-454). Alternatively, techniques described for the production of single chain antibodies (U.S. Patent 4,946,778) can be adapted to produce HER -specific single chain antibodies. Recombinant human or humanized versions of anti-HER4 monoclonal antibodies are a preferred embodiment for human therapeutic applications. Humanized antibodies may be prepared according to procedures in the literature (e . g . , Jones et al . , 1986, Nature 321:522- 25; Reichman et al . , 1988, Nature 332:323-27; Verhoeyen et al . , 1988, Science 239:1534-36). The recently described "gene conversion mutagenesis" strategy for the production of humanized anti-HER2 monoclonal antibody may also be employed in the production of humanized anti-HER4 antibodies (Carter et al . , 1992, Proc. Natl. Acad. Sci. U.S.A. 89:4285- 89) . Alternatively, techniques for generating a recombinant phage library of random combinations of heavy and light regions may be used to prepare recombinant anti-HER4 antibodies (e . g . , Huse et al . , 1989, Science 246:1275-81). As an example, anti-HER4 monoclonal antibodies may be generated by immunization of mice with cells selectively overexpressing HER4 (e . g . , CHO/HER4 21-2 cells as deposited with the ATCC) or with partially purified recombinant HER4 polypeptides. In one embodiment, the full length HER4 polypeptide (FIG. IA and IB) may be expressed in Baculovirus systems, and membrane fractions of the recombinant cells used to immunize mice. Hybridomas are then screened on CHO/HER4 cells (e.g., CHO HER4 21-2 cells as deposited with the ATCC) to identify monoclonal antibodies reactive with the extracellular domain of HER4. Such monoclonal antibodies may be evaluated for their ability to block NDF, or HepG2-differentiating factor, binding to HER4; for their ability to bind and stay resident on the cell surface, or to internalize into cells expressing HER4; and for their ability to directly upregulate or downregulate HER4 tyrosine autophosphorylation and/or to directly induce a HER4- mediated signal resulting in modulation of cell growth or differentiation. In this connection, monoclonal antibodies N28 and N29, directed to HER2, specifically bind HER2 with high affinity. However, monoclonal N29 binding results in receptor internalization and downregulation, morphologic differentiation, and inhibition of HER2 expressing tumor cells in athymic mice. In contrast, monoclonal N28 binding to HER2 expressing cells results in stimulation of autophosphorylation, and an acceleration of tumor cell growth both in vitro and in vivo (Bacus et al . , 1992, Cancer Res. 52:2580-89; Stancovski et al . , 1991, Proc. Natl. Acad. Sci. U.S.A. 88:8691-95). In yet another embodiment, a soluble recombinant HER4-Immunoglobulin (HER4-Ig) fusion protein is expressed and purified on a Protein A affinity column. The amino acid sequence of one such HER4-Ig fusion protein is provided in FIG. 14. The soluble HER4-Ig fusion protein may then be used to screen phage libraries designed so that all available combinations of a variable domain of the antibody binding site are presented on the surfaces of the phages in the library. Recombinant anti-HER4 antibodies may be propagated from phage which specifically recognize the HER4-Ig fusion protein.
Antibody fragments which contain the idiotype of the molecule may be generated by known techniques. For example, such fragments include but are not limited to: the F(ab)'E2 fragment which can be produced by pepsin digestion of the intact antibody molecule; the Fab' fragments which can be generated by reducing the disulfide bridges of the F(ab')2 fragment, and the two Fab fragments which can be generated by treating the antibody molecule with papain and a reducing agent. Alternatively, Fab expression libraries may be constructed (Huse et al . , 1989, Science. 246:1275-1281) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity to HER4 protein.
5.5. HER4 Ligands
One aspect of the present invention is directed to HER4 ligands. As defined herein, HER4 ligands are capable of binding to the 180K transmembrane protein, HER4/pl80erB4 or functional analogues thereof, and activating tyrosine kinase activity. Functional analogues of HER4/pl80βri*4-ligands are capable of activating HER4 tyrosine kinase activity. Activation of the tyrosine kinase activity may stimulate autophosphorylation and may affect a biological activity mediated by HER4. It has been observed in systems described in Section 12 and 13 that binding of HER4 ligands to HER4 triggers tyrosine phosphorylation and affects differentiation of breast cancer cells.
The HER4 ligands of the present invention include NDF, a 44 kDa glycoprotein isolated from ras- transformed rat fibroblasts (Wen et al . , 1992, Cell 69:559-572); heregulin, its human homologue, which exists as multiple isoforms (Peles et al . , 1992, Cell 69:205-218 and Holmes et al . , 1992, Science 256:1205- 1210) including p45, a 45K heparin-binding glycoprotein that shares several features with the heregulin-family of proteins including molecular weight, ability to induce differentiation of breast cancer cells, activation of tyrosine phosphorylation in MDA-MB453 cells, and N-terminal amino acid sequence (Section 13, infra ) , gp30, and p75 (Lupu et al . , 1990, Science 249:1552-1555 and Lupu et al . , 1992, Proc. Natl. Acad. Sci. USA 89:2287-2291).
HER4 ligands of the present invention can be prepared by synthetic or recombinant means, or can be 5 isolated from natural sources. The HER4 ligand of the present invention may contain deletions, additions or substitutions of amino acid residues relative to the sequence of NDF, p45 or other heregulins or any HER4 ligand known in the art as long as the ligand 0 maintains HER4 receptor binding and tyrosine kinase activation capacity. Such amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or the amphipathic nature of the resides involved. 5 For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; amino acids with uncharged polar head groups or nonpolar head groups having similar hydrophilicity values include 0 the following: leucine, isoleucine, valine; glycine, alanine; asparagine, gluta ine; serine, threonine; phenylalanine, tyrosine.
5.5.1. Recombinant Expression of HER4 25 Ligands
The HER4 ligands of the present invention may be produced by the cloning and expression of DNA encoding the desired HER4 ligand. Such DNA may be ligated into a number of expression vectors well known in the art
_- and suitable for use in a number of acceptable host organisms, in fused or mature form, and may contain a signal sequence to permit secretion. Both prokaryotic and eukaryotic host expression systems may be employed in the production of recombinant HER4 ligands. For
3_ example, a HER4 ligand precursor coding sequence or its functional equivalent may be used in a host cell capable of processing the precursor correctly. Alternatively, the coding sequence for a mature HER4 ligand may be used to directly express the mature HER4 ligand molecule. Functional equivalents of the HER4 ligand precursor coding sequence include any DNA sequence which, when expressed inside the appropriate host cell, is capable of directing the synthesis, processing and/or export of the HER4 ligand.
Production of a HER4 ligand using recombinant DNA technology may be divided into a four-step process for the purposes of description: (1) isolation or generation of DNA encoding the desired HER4 ligand; (2) construction of an expression vector capable of directing the synthesis of the desired HER4 ligand; (3) transfection or transformation of appropriate host cells capable of replicating and expressing the HER4 ligand coding sequence and/or processing the initial product to produce the desired HER4 ligand; and (4) identification and purification of the desired HER4 ligand product.
5.5.2. Isolation of HER4 Encoding DNA
HER4 ligand-encoding nucleic acid sequences may be obtained from human hepatocellular carcinoma cell lines, specifically the HepG2 cells available from the ATCC, accession number HB 8065. In addition, a number of human cell sources are suitable for obtaining HER4 ligand nucleic acids, including MDA-MB-231 cells available from the ATCC, accession number HTB 26, brain tissue (Falls et al . , 1993, Cell 72:801-815 and Marchionni et al . , 1993 Nature 362:312-318), and any cell source capable of producing an activity capable of binding to the 180K transmembrane protein, HER4/pl80erB4, encoded by the HER4/ERBB4 gene and activating tyrosine kinase activity. Methods useful in assaying for the identification of HER4 ligands is disclosed in Section 5.8., infra . The techniques disclosed in Sections 5.3.2. and 5.3.3., infra apply to the construction of HER4 ligand expression vectors and identification of recombinant transformants expressing HER4 ligand gene products.
5.5.3. Anti-HER4 Ligand Antibodies
The present invention is also directed to polyclonal and monoclonal antibodies which recognize eptitopes of HER4 ligand polypeptides. Anti-HER4 ligand antibodies are expected to have a variety of useful applications in the field of oncology. Briefly, anti-HER4 ligand antibodies may be used for the detection and quantification of HER4 ligand polypeptide expression in cultured cells, tissue samples, and in vivo . For example, monoclonal antibodies recognizing epitopes from different parts of the HER4 ligand structure may be used to detect and/or distinguish binding from non-binding regions of the ligand. Anti-HER4 ligand antibody preparations are also envisioned as useful biomodulatory agents capable of effectively treating particular human cancers. An anti-HER4 ligand antibody could be used to block signal transduction mediated through HER4, thereby inhibiting undesirable biological responses. In addition to the various diagnostic and therapeutic utilities of anti-HER4 ligand antibodies, a number of industrial and research applications will be obvious to those skilled in the art, including, for example, the use of anti-HER4 ligand antibodies as affinity reagents for the purification of HER4 ligand polypeptides, and as immunological probes for elucidating the biosynthesis, metabolism and biological functions of HER4 ligands. Anti-HER4 ligand antibodies may be useful for influencing cell functions and behaviors which are directly or indirectly mediated by HER4. As an example, modulation of HER4 biological activity with anti-HER4 ligand antibodies may influence HER2 activation and, as a consequence, modulate intracellular signals generated by HER2. In this regard, anti-HER4 ligand antibodies may be useful to effectively block ligand-induced, HER4-mediated activation of HER2, thereby affecting HER2 biological activity. Conversely, anti-HER4 ligand antibodies capable of acting as HER4 ligands may be used to trigger HER4 biological activity and/or initiate a ligand-induced, HER4-mediated effect on HER2 biological activity, resulting in a cellular response such as differentiation, growth inhibition, etc.
Additionally, anti-HER4 ligand antibodies conjugated to cytotoxic compounds may be used to selectively target such compounds to tumor cells expressing HER4 , resulting in tumor cell death and reduction or eradication of the tumor.
Various procedures known in the art may be used for the production of antibodies to epitopes of HER4 ligand (see Section 5.4, supra ) .
5.6. Diagnostic Methods
The invention also relates to the detection of human neoplastic conditions, particularly carcinomas of epithelial origin, and more particularly human breast carcinomas. In one embodiment, oligomers corresponding to portions of the consensus HER4 cDNA sequence provided in FIG. IA and IB are used for the quantitative detection of HER4 mRNA levels in a human biological sample, such as blood, serum, or tissue biopsy samples, using a suitable hybridization or PCR format assay, in order to detect cells or tissues expressing abnormally high levels of HER4 as an indication of neoplasia. In a related embodiment, detection of HER4 mRNA may be combined with the detection HER2 mRNA overexpression, using appropriate HER2 sequences, to identify neσplasias in which a functional relationship between HER2 and HER4 may exist.
In another embodiment, labeled anti-HER4 antibodies or antibody derivatives are used to detect the presence of HER4 in biological samples, using a variety of immunoassay formats well known in the art, and may be used for in situ diagnostic radioimmunoimaging. Current diagnostic and staging techniques do not routinely provide a comprehensive scan of the body for etastatic tumors. Accordingly, anti-HER4 antibodies labeled with, for example, fluorescent, chemiluminescent, and radioactive molecules may overcome this limitation. In a preferred embodiment, a gamma-emitting diagnostic radionuclide is attached to a monoclonal antibody which is specific for an epitope of HER4, but not significantly cross-reactive with other EGFR-family members. The labeled antibody is then injected into a patient systemically, and total body imaging for the distribution and density of HER4 molecules is performed using gamma cameras, followed by localized imaging using computerized tomography or magnetic resonance imaging to confirm and/or evaluate the condition, if necessary. Preferred diagnostic radionuclides include but are not limited to technetium-99m, indium-Ill, iodine-123, and iodine- 131.
Recombinant antibody-metallothionein chimeras (Ab-MTs) may be generated as recently described (Das et al . , 1992, Proc. Natl. Acad. Sci. U.S.A. 89:9749- 53) . Such Ab-MTs can be loaded with technitium-99m by virtue of the metallothionein chelating function, and may offer advantages over chemically conjugated chelators. In particular, the highly conserved metallothionein structure may result in minimal immunogenicity.
5.7. Assays for the Identification of HER4
10 Ligands
Cell lines overexpressing a single member of the EGFR-family can be generated by transfection of a variety of parental cell types with an appropriate expression vector as described in Section 7., infra . m - Candidate ligands, or partially purified preparations, may be applied to such cells and assayed for receptor binding and/or activation. For example, a CHO-KI cell line transfected with a HER4 expression plasmid and lacking detectable EGFR, HER2, or HER3 may be used to screen for HER4-specific ligands. A particular embodiment of such a cell line is described in Section 7. , infra , and has been deposited with the ATCC (CHO/HER4 21-2) . Ligands may be identified by detection of HER4 autophosphorylation, stimulation of
2S DNA synthesis, induction of morphologic differentiation, relief from serum or growth factor requirements in the culture media, and direct binding of labeled purified growth factor. The invention also relates to a bioassay for testing potential analogs of
30 HER4 ligands based on a capacity to affect a biological activity mediated by the HER4 receptor.
35 5.8. Use Of The Invention in Cancer Therapy
5.8.1. Targeted Cancer Therapy
The invention is also directed to methods for the treatment of human cancers involving abnormal expression and/or function of HER4 and cancers in which HER2 overexpression is combined with the proximate expression of HER , including but not limited to human breast carcinomas and other neoplasms overexpressing HER4 or overexpressing HER2 in combination with expression of HER4. The cancer therapy methods of the invention are generally based on treatments with unconjugated, toxin- or radionuclide- conjugated HER4 antibodies, ligands, and derivatives or fragments thereof. In one specific embodiment, such HER4 antibodies or ligands may be used for systemic and targeted therapy of certain cancers overexpressing HER2 and/or HER4 , such as metastatic breast cancer, with minimal toxicity to normal tissues and organs. Importantly, in this connection, an anti-HER2 monoclonal antibody has been shown to inhibit the growth of human tumor cells overexpressing HER2 (Bacus et al . , 1992, Cancer Res. 52:2580-89) . In addition to conjugated antibody therapy, modulation of heregulin signaling through HER4 provides a means to affect the growth and differentiation of cells overexpressing HER2 , such as certain breast cancer cells, using HER4-neutralizing monoclonal antibodies, NDF/HER4 antagonists, monoclonal antibodies or ligands which act as super- agonists for HER4 activation, or agents which block the interaction between HER2 and HER4 , either by disrupting heterodimer formation or by blocking HER- mediated phosphorylation of the HER2 substrate. For targeted immunotoxin- ediated cancer therapy, various drugs or toxins may be conjugated to anti-HER4 antibodies and fragments thereof, such as plant and bacterial toxins. For example, ricin, a cytotoxin from the Ricinis communis plant may be conjugated to an anti-HER4 antibody using methods known in the art (e.g., Blakey et al . , 1988, Proσ. Allergy 45:50-90; Marsh and Neville, 1988, J. Immunol. 140:3674-78). Once ricin is inside the cell cytoplasm, its A chain inhibits protein synthesis by inactivating the 60S ribosomal subunit (May et al . , 1989, EMBO J. 8:301- 08) . Immunotoxins of ricin are therefore extremely cytotoxic. However, ricin immunotoxins are not ideally specific because the B chain can bind to virtually all cell surface receptors, and immunotoxins made with ricin A chain alone have increased specificity. Recombinant or deglycosylated forms of the ricin A chain may result in improved survival (i.e., slower clearance from circulation) of the immunotoxins. Methods for conjugating ricin A chain to antibodies are known (e.g., Vitella and Thorpe, in: Seminars in Cell Bioloσv. pp 47-58; Saunders, Philadelphia 1991) . Additional toxins which may be used in the formulation of immunotoxins include but are not limited to daunorubicin, methotrexate, ribosome inhibitors (e . g. , trichosanthin, trichokirin, gelonin, saporin, mormordin, and pokeweed antiviral protein) and various bacterial toxins (e . g . , Pseudomonaε exotoxin) . Immunotoxins for targeted cancer therapy may be administered by any route which will result in antibody interaction with the target cancer cells, including systemic administration and injection directly to the site of tumor. Another therapeutic strategy may be the administration of immunotoxins by sustained-release systems, such as semipermeable matrices of solid hydrophobic polymers containing the therapeutic agent. Various of sustained-release materials have been established and are well known by those skilled in the art. Sustained-release capsules may, depending on their chemical nature, release immunotoxic molecules for a few weeks up to over 100 days. Depending on the chemical nature and the biological stability of the therapeutic reagent, additional strategies for protein stabilization may be employed.
For targeted radiotherapy using anti-HER4 antibodies, preferred radionuclides for labeling include alpha, beta, and Auger electron emitters. Examples of alpha emitters include astatine 211 and bismuth 212; beta emitters include iodine 131, rhenium 188, copper 67 and yttrium 90; and iodine 125 is an example of an Auger electron emitter.
Similarly as suggested for the use of toxin- conjugated antibodies as therapeutic agents for targeted cancer therapy, purified ligand molecules may be chemically conjugated to cytotoxic substances. In addition, recombinant chimeric polypeptides comprising a HER4 binding (■=ligand) portion fused to all or part of a cytotoxin may be engineered by constructing vectors comprising DNA encoding the ligand in reading frame with DNA encoding the toxin or part thereof. Such recombinant ligand-toxins may be used to specifically target HER4 expressing cancer cells. A particular embodiment of such a ligand-toxin is disclosed herein and described in more detail in Sections 5.8.2., infra , and Section 15, infra. 5.8.2. The Generation Of A Heregulin-toxin
Specifically Targeting HER4 Expressing Tumor Cells
Another aspect of the invention relates to the development of a strategy to selectively target and kill HER4 expressing tumor cells. More particularly, HER4 expressing tumor cells may be specifically targeted and killed by contacting such tumor cells with a fusion protein comprising a cytotoxic polypeptide covalently linked to a polypeptide which is capable of activating HER4 expressed on such cells.
In a specific embodiment described by way of example in Section 15, infra , a fusion protein comprising a chimeric heregulin β2 ligand and the cytotoxic substance PE40 is generated by expression of the corresponding chimeric coding sequence. PE40 is a derivative of the Pseudomonas exotoxin PE, a potent cell killing agent made by Pseudomonas aeruginosa (Fitzgerald et al . , 1980, Cell 21:867-873). The wildtype protein PE contains three domains whose functions are cell recognition, membrane translocation, and ADP ribosylation of elongation factor 2. It kills cells by binding to a cell surface receptor, entering the cell via an endocytotic vesicle and catalyzing ADP-ribosylation of elongation factor 2. The derivative PE40 lacks the cell binding function of the wildtype protein, but still exhibits strong cytotoxic activity. Generation of PE40 fusion proteins with specific cell targeting molecules have been described (Kondo et al . , 1988, J. Biol. Chem.
263:9470-9475 (PE40 fusions with different monoclonal antibodies); Friedman et al . , 1993, Cancer Res. 53:334-339 (BR96/PE40 fusions); U.S. Pat. No. 5206353 (CD4/PE40 fusions); U.S. Pat. No. 5082927 (IL-4/PE40 fusions) and U.S. Pat. No. 4892827 (TGF-α/PE40 and IL- 2/PE40 fusions) ) . The chimeric heregulin-toxin protein HAR-TX β2 described in Section 15, infra , contains the amphiregulin (AR) leader sequence thereby facilitating the purification of the recombinant protein. As confirmed by applicants' data, the AR leader has no influence on the binding specificity of the recombinant heregulin-toxin. Related embodiments include, for example, PE40 linked to other members of the heregulin family, like heregulin-,..l and heregulin- α, and other molecules capable of activating HER4.
In a cytotoxicity assay with cultured tumor cell lines, the applicants demonstrate specificity of the cytotoxic effect of the chimeric heregulin-PE40 protein to HER4 expressing cancer cells; they include but are not limited to prostate carcinoma, bladder carcinoma, and a considerable number of different breast cancer types, including breast carcinoma cells with amplified HER2 expression. The bifunctional retention of both the specificity of the cell binding portion of the molecule and the cytotoxic potential of
PE40 provides a very potent and targeted reagent.
An effective therapeutic amount of heregulin- toxin will depend upon the therapeutic objectives, the route of administration, and the condition of the patient. Accordingly, dosages should be titrated and the route of administration modified as required to obtain the optimal therapeutic effect. A typical daily dosage may be in the range of 0.1 mg/kg - 1 mg/kg, preferably between 0.1 and 0.5 mg/kg, with intravenous administration. For regression of solid tumors, it may take 3-5 doses, with schedules such as 3 doses, each four days apart. Also the use of sustained-release preparations (see Section 5.8.1., supra) may be considered for administration of the reagent. The therapeutic efficacy of heregulin-toxin may be between 2 and 10, which means that a tumor regression effect would be expected between 2- and 10- fold below the toxic dose (see Section 15, infra ) . Desirably, the heregulin-toxin will be administered at a dose and frequency that achieves the desired therapeutic effect, which can be monitored using conventional assays.
Cancer therapy with heregulin-toxins of the invention may be combined with chemotherapy, surgery, and radiation therapy, depending on the type of tumor. One advantage of using a low molecular weight toxin drug is that they are capable of targeting metastatic lesions that cannot be located and removed by surgery. Heregulin-toxins may also be particularly useful on patients that are MDR (Multi Drug Resistance) positive since their mechanism of action is not inhibited by the p-glycoprotein pump of MDR positive cells as are many standard cancer therapeutic drugs.
5.9. Other Therapeutic Use Of HER4 Ligands
Additional therapeutic uses of HER4 ligands may include other diseases caused by deficient HER4 receptor tyrosine kinase activation rather than by hyperactivation. In this regard, type II diabetes mellitus is the consequence of deficient insulin- mediated signal transduction, caused by mutations in the insulin-receptor, including mutations in the ligand-binding domain (Taira et al . , 1889, Science 245:63-66; Odawara et al . , 1989, Science 245:66-68; Ober eier-Kusser et al . , 1989, J. Biol. Chem.
264:9497-9504). Such diseases might be treated by administration of modified ligands or ligand-analogues which re-establish a functional ligand-receptor interaction. 5.10. HER4 Analogues
The production and use of derivatives, analogues and peptides related to HER4 are also envisioned and are within the scope of the invention. Such derivatives, analogues and peptides may be used to compete with native HER4 for binding of HER4 specific ligand, thereby inhibiting HER4 signal transduction and function. The inhibition of HER4 function may be utilized in several applications, including but not limited to the treatment of cancers in which HER4 biological activity is involved.
In a specific embodiment, a series of deletion mutants in the HER4 nucleotide coding sequence depicted in FIG. IA and IB may be constructed and analyzed to determine the minimum amino acid sequence requirements for binding of a HER4 ligand. Deletion mutants of the HER4 coding sequence may be constructed using methods known in the art which include but are not limited to use of nucleases and/or restriction enzymes; site-directed mutagenesis techniques, PCR, etc. The mutated polypeptides expressed may be assayed for their ability to bind HER4 ligand.
The DNA sequence encoding the desired HER4 analogue may then be cloned into an appropriate expression vector for overexpression in either bacteria or eukaryotic cells. Peptides may be purified from cell extracts in a number of ways including but not limited to ion-exchange chromatography or affinity chromatography using HER4 ligand or antibody. Alternatively, polypeptides may be synthesized by solid phase techniques followed by cleavage from resin and purification by high performance liquid chromatography. 6. Example: Isolation of cDNAs Encoding EER4
EGFR and the related proteins, HER2, HER3, and Xmrk exhibit extensive amino acid homology in their tyrosine kinase domains (Kaplan et al . , 1991, Nature 350:158-160; Wen et al . , 1992, Cell 69:559-72; Holmes et al . , 1992, Science 256:1205-10; Hirai et al . , Science 1987 238:1717-20). In addition, there is strict conservation of the exon-intron boundaries within the genomic regions that encode these catalytic domains (Wen et ai . , supra ; Lindberg and Hunter, 1990, Mol. Cell. Biol. 10:6316-24; and unpublished observations) . Degenerate oligonucleotide primers were designed based on conserved amino acids encoded by a single exon or adjacent exons from the kinase domains of these four proteins. These primers were used in a polymerase chain reaction (PCR) to isolate genomic fragments corresponding to murine EGFR, erbB2 and er_B3. In addition, a highly related DNA fragment (designated MER4) was identified as distinct from these other genes. A similar strategy was used to obtain a cDNA clone corresponding to the human homologue of MER4 from the breast cancer cell line, MDA-MB-453. Using this fragment as a probe, several breast cancer cell lines and human heart were found to be an abundant source of the EGFR-related transcript. cDNA libraries were constructed using RNA from human heart and MDA-MB-453 cells, and overlapping clones were isolated spanning the complete open reading frame of HER4/er_>B4.
6.1. Materials and Methods
6.1.1. Molecular Cloning Several pools of degenerate oligonucleotides were synthesized based on conserved sequences from EGFR- family members (Table I) (5'-ACNGTNTGGGARYTNAYHAC-3' [SEQ ID No:14]; 5'-CAYGTNAARATHACNGAYTTYGG-3 ' [SEQ ID No: 16] ; 5'-GACGAATTCCNATHAARTGGATGGC-3 ' [SEQ ID No: 17]; 5'-AANGTCATNARYTCCCA-3 ' [SEQ ID No: 18]; 5'- TCCAGNGCGATCCAYTTDATNGG-3' [SEQ ID No: 19]; 5'- GGRTCDATCATCCARCCT-3' [SEQ ID No:20]; 5'-
CTGCTGTCAGCATCGATCAT-3' [SEQ ID No: 21]; TVWELMT [SEQ ID No:22]; HVKITDFG [SEQ ID No:23]; PIKWMA [SEQ ID No: 13]; VYMIILK [SEQ ID No: 24]; WELMTF [SEQ ID No: 25]; PIKWMALE [SEQ ID No:26]; CWMIDP [SEQ ID No:27]. Total genomic DNA was isolated from subconfluent murine
K1735 melanoma cells and used as a template with these oligonucleotide primers in a 40 cycle PCR amplification. PCR products were resolved on agarose gels and hybridized to 32P-labeled probes from the kinase domain of human EGFR and HER2. Distinct DNA bands were isolated and subcloned for sequence analysis. Using the degenerate oligonucleotides H4VWELM and H4VYMIIL as primers in a PCR amplification (Plowman et al . , 1990, Proc. Natl. Acad. Sci. U.S.A. 87:4905-09), one clone (MER4-85) was identified that contained a 144 nucleotide insert corresponding to murine erj B4. This 32P-labeled insert was used to isolate a 17-kilobase fragment from a murine T-cell genomic library (Stratagene, La Jolla, CA) that was found to contain two exons of the murine erbB4 gene. A specific oligonucleotide (4M3070) was synthesized based on the DNA sequence of an erj B4 exon, and used in a PCR protocol with a degenerate 5'-oligonucleotide (H4PIKWMA) on a template of single stranded MDA-MB-453 cDNA. This reaction generated a 260 nucleotide fragment (pMDAPIK) corresponding to human HER4. cDNA libraries were constructed in lambda ZAP II (Stratagene) from oligo(dT)- and specific-primed MDA- MB453 and human heart RNA (Plowman et al . , supra ; Plowman et al . , 1990, Mol. Cell. Biol. 10:1969-81) . HER4-specific clones were isolated by probing the libraries with the "P-labeled insert from pMDAPIK. To complete the cloning of the 5'-portion of HER4, we used a PCR strategy to allow for rapid amplification of cDNA ends (Plowman et ai. , supra ; Frohman et al . , 1988, Proc. Natl. Acad. Sci. U.S.A. 85:8998-9002). All cDNA clones and several PCR generated clones were sequenced on both strands using T7 polymerase with oligonucleotide primers (Tabor and Richardson, 1987, Proc. Natl. Acad. Sci. U.S.A. 84:4767-71) .
TABLE I OLIGONUCLEOTIDE PREPARATIONS FOR CLONING HER4
Figure imgf000061_0001
6.1.2. Northern Blot Analysis
3'- and 5'-HER4 specific [α3P]UTP-labeled antisense RNA probes were synthesized from the linearized plasmids pHtlB1.6 (containing an 800 bp HER4 fragment beginning at nucleotide 3098) and p5'H4E7 (containing a 1 kb fragment from the 5'-end of the HER4 sequence) , respectively. For tissue distribution analysis (Section 6.2.3., infra) , the Northern blot (Clontech, Palo Alto, CA) contained 2 Mg poly(A) + mRNA per lane from 8 human tissue samples immobilized on a nylon membrane. The filter was prehybridized at 60° C for several hours in RNA hybridization mixture (50% formamide, 5x SSC, 0.5% SDS, lOx Denhardt's solution, 100 μg/ml denatured herring sperm DNA, 100 μg/ml tRNA, and 10 μg/ml polyadenosine) and hybridized in the same buffer at 60° C, overnight with 1-1.5 x 106 cpm/ml of 32P- labeled antisense RNA probe. The filters were washed in O.lXSSC/0.1% SDS, 65° C, and exposed overnight on a Phospholmager (Molecular Dynamics, Sunnyvale, CA) .
6.1.3. Semi-Quantitative PCR Detection of HER4
RNA was isolated from a variety of human cell lines, fresh frozen tissues, and primary tumors. Single stranded cDNA was synthesized from 10 μg of each RNA by priming with an oligonucleotide containing a T17 track on its 3 '-end
(XSCT17:5'GACTCGAGTCGACATCGATTTTTTTTTTTTTTTTT-3' )
[SEQ ID No:28] . 1% or 5% of each single strand template preparation was then used in a 35 cycle PCR reaction with two HER4-specific oligonucleotides:
4H267 : 5'-GAAGAAAGACGACTCGTTCATCGG-3 '
[SEQ ID No:29] , and
4H2965: 5'-GACCATGACCATGTAAACGTCAATA-3 '
[SEQ ID No:30] . Reaction products were electrophoresed on 2% agarose gels, stained with ethidium bromide and photographed on a UV light box. The relative intensity of the 291- bp HER4-specific bands were estimated for each sample as shown in Table II. 6 . 2 . Results
6.2.1. Sequence Analysis of cDNA Clones Encoding HER4 cDNA clones encoding parts of the HER4 coding and non-coding nucleotide sequences were isolated by PCR cloning according to the method outlined in Section
6.1.1., supra . The complete HER4 nucleotide sequence assembled from these cDNAs is shown in FIG. IA and IB and contains a single open reading frame encoding a polypeptide of 1308 amino acids. The HER4 coding region is flanked by a 33 nucleotide 5'-untranslated region and a 1517 nucleotide 3'-untranslated region ending with a poly(A) tail. A 25 amino acid hydrophobic signal sequence follows a consensus initiating methionine at position number 1 in the amino acid sequence depicted in FIG. IA and IB. In relation to this signal sequence, the mature HER4 polypeptide would be predicted to begin at amino acid residue number 26 in the sequence depicted in FIG. IA and IB (Gin) , followed by the next 1283 amino acids in the sequence. Thus the prototype mature HER4 of the invention is a polypeptide of 1284 amino acids, having a calculated Mr of 144,260 daltons and an amino acid sequence corresponding to residues 26 through 1309 in FIG. IA and IB.
Comparison of the HER4 nucleotide and deduced amino acid sequences (FIG. IA and IB) with the available DNA and protein sequence databases indicated that the HER4 nucleotide sequence is unique, and revealed a 60/64 amino acid identity with HER2 and a 54/54 amino acid identity to a fragment of a rat EGFR homolog, tyro-2.
6.2.2. Sequence Analysis of Related cDNAs Several cDNAs encoding polypeptides related to the prototype HER4 polypeptide (FIG. IA and IB) were also isolated from the MDA-MB-453 cDNA library and comprised two forms.
The first alternative type of cDNA was identical to the consensus HER4 nucleotide sequence up to nucleotide 3168 (encoding Arg at amino acid position 1045 in the FIG. IA and IB) and then abruptly diverges into an apparently unrelated sequence (FIG. 2A and 2B, FIG. 4) . Downstream from this residue the open reading frame continues for another 13 amino acids before reaching a stop codon followed by a 2 kb 3'- untranslated sequence and poly(A) tail. This cDNA would be predicted to result in a HER4 variant having the C-terminal autophosphorylation domain of the prototype HER4 deleted. A second type of cDNA was isolated as 4 independent clones each with a 3'-sequence identical to the HER4 consensus, but then diverging on the 5'- side of nucleotide 2335 (encoding Glu at amino acid position 768 in the FIG. IA and IB) , continuing upstream for only another 114-154 nucleotides (FIG. 3, FIG. 5) . Nucleotide 2335 is the precise location of an intron-exon junction in the HER2 gene (Coussens et al . , 1985, Science 230:1132-39; Semba et al . , 1985, Proc. Natl. Acad. Sci. U.S.A. 82:6497-6501) , suggesting these cDNAs could be derived from mRNAs that have initiated from a cryptic promoter within the flanking intron. These 5'-truncated transcripts contain an open reading frame identical to that of the HER4 cDNA sequence of FIG. IA and IB, beginning with the codon for Met at amino acid position 772 in FIG.
IA and IB. These cDNAs would be predicted to encode a cytoplasmic HER4 variant polypeptide that initiates just downstream from the ATP-binding domain of the HER4 kinase. 6.2.3. Human Tissue Distribution of HER4 Expression
Northern blots of poly(A)+ mRNA from human tissue samples were hybridized with antisense RNA probes to the 3'-end of HER4, encoding the autophosphorylation domain, as described in Section 6.1.2., supra . A HER4 mRNA transcript of approximately 6kb was identified, and was found to be most abundant in the heart and skeletal muscle (FIG. 8, Panel l) . An mRNA of greater than approximately 15 kb was detected in the brain, with lower levels also detected in heart, skeletal muscle, kidney, and pancreas tissue samples.
The same blot was stripped and rehybridized with a probe from the 5'-end of HER4, within the extracellular domain coding region, using identical procedures. This hybridization confirmed the distribution of the 15 kb HER4 RΝA species, and detected a 6.5 kb mRΝA species in heart, skeletal muscle, kidney, and pancreas tissue samples (FIG. 8, Panel ) with weaker signals in lung, liver, and placenta. In addition, minor transcripts of 1.7-2.6 kb were also detected in pancreas, lung, brain, and skeletal muscle tissue samples. The significance of the different sized RΝA transcripts is not known. Various human tissues were also examined for the presence of HER4 mRΝA using the semi-quantitative PCR assay described in Section 6.1.3., supra . The results are shown in Table II, together with results of the assay on primary tumor samples and neoplastic cell lines (Section 6.2.4., immediately below). These results correlate well with the Northern and solution hybridization analysis results on the selected RNA samples. The highest levels of HER4 transcript expression were found in heart, kidney, and brain tissue samples. In addition, high levels of HER4 mRNA expression were found in parathyroid, cerebellum, pituitary, spleen, testis, and breast tissue samples. Lower expression levels were found in thymus, lung, salivary gland, and pancreas tissue samples, Finally, low or negative expression was observed in liver, prostate, ovary, adrenal, colon, duodenum, epidermis, and bone marrow samples.
6.2.4. HER4 mRNA Expression in Primary Tumors and Various Cell Lines of Neoplastic Origin
HER4 mRNA expression profiles in several primary tumors and a number of cell lines of diverse neoplastic origin were determined with the semi- quantitative PCR assay (Section 6.1.3, supra) using primers from sequences in the HER4 kinase domain. The results are included in Table II. This analysis detected the highest expression of HER4 RNA in 4 human mammary adenocarcinoma cell lines (T-47D, MDA-MB-453, BT-474, and H3396) , and in neuroblastoma (SK-N-MC) , and pancreatic carcinoma (Hs766T) cell lines. Intermediate expression was detected in 3 additional mammary carcinoma cell lines (MCF-7, MDA-MB-330, MDA- MB-361) . Low or undetectable expression was found in other cell lines derived from carcinomas of the breast (MDB-MB-231, MDA-MB-157, MDA-MB-468, SK-BR-3), kidney (Caki-1, Caki-2, G-401) , liver (SK-HEP-1, HepG2) , pancreas (PANC-1, AsPC-1, Capan-1) , colon (HT-29) , cervix (CaSki) , vulva (A-41) , ovary (PA-1, Caov-3) , melanoma (SK-MEL-28) , or in a variety of leukemic cell lines. Finally, high level expression was observed in Wilms (kidney) and breast carcinoma primary tumor samples. TABLE II HER4 EXPRESSION BY PRC ANALYSIS
VERY STRONG STRONG MEDIUM T47D ( breast ) HDA-MB-453 (breast) MCF-7 (breast) BT-474 (breast) MDA-MB-330 (breast) H3396 (breast) MDA-MB-157 (breast) Hβ766T (pancreatic) JEG-3
( chor iocar cinoma )
SK-N-MC (neural) HEPM (palate) Wilms Tumor (kidney) 45β(medullablastoma) Breast Carcinoma
Kidney Brain Skeletal Muscle
Heart Cerebellum Thymus
Parathyroid Pituitary Pancreas
Breast Lung
Testis Salivary Gland
Spleen
WEAK NEGATIVE
MDB-MB-231 (breast) MDA-MB-468 (breast) MDA-MB-157 (breast) G-401 (kidney) SK-BR-3 (breast) HepG2 (liver) A-431 (vulva) PANC-1 (pancreas) Caki-1 (kidney) AsPC-1(pancreas) Caki-2 (kidney) Capan-1 (pancreas) SK-HEP-1 (liver) HT-29 (colon) THP-1 (macrophage) CaSki (cervix) PA-1 (ovary)
Prostate Caov-3 (ovary)
Adrenal SK-MEL-28 (melanoma)
Ovary HUF (fibroblast)
Colon H2981 (lung)
Placenta Ovarian tumor GEO (colon) ALL bone marrow AML bone marrow Duodenum Epidermis Liver Bone marrow stroma
Example: Recombinant Expression of HER4 7.1. Materials and Methods
7.1.1. CHO-KI Cells and Culture Conditions
CHO-KI cells were obtained from the ATCC
(Accession Number CCL 61) . These cells lack any detectable EGFR, HER2, or HER3 by immunoblot, tyrosine phosphorylation, and 35S-labeled immunoprecipitation analysis. Transfected cell colonies expressing HER4 were selected in glutamine-free Glasgow modified Eagle's medium (GMEM-S, Gibco) supplemented with 10% dialyzed fetal bovine serum an increasing concentrations of methionine sulfoximine (Bebbington, 1991, in Methods: A Companion to Methods in Enzymology 2:136-145 Academic Press) .
7.1.2. Expression Vector Construction and
Transfections
The complete 4 kilobase coding sequence of prototype HER4 was reconstructed and inserted into a glutamine synthetase expression vector, pEE14, under the control of the cytomegalovirus immediate-early promoter (Bebbington, supra ) to generate the HER4 expression vector pEEHER4. This construct (pEEHER4) was linearized with Mlul and transfected into CHO-KI cells by calcium phosphate precipitation using standard techniques. Cells were placed on selective media consisting of GMEM-S supplemented with 10% dialyzed fetal bovine serum and methionine sulfoximine at an initial concentration of 25 μM (L-MSX) as described in Bebbington, supra , for the selection of initial resistant colonies. After 2 weeks, isolated colonies were transferred to 48-well plates and expanded for HER4 expression immunoassays as described immediately below. Subsequent rounds of selection using higher concentrations of MSX were used to isolate cell colonies tolerating the highest concentrations of MSX. A number of CHO/HER4 clones selected at various concentrations of MSX were isolated in this manner. 7.1.3. HER4 Expression Immunoassay Confluent cell monolayers were scraped into hypotonic lysis buffer (10 M Tris pH7.4, 1 mM KC1, 2 mM MgC12) at 4° C, dounce homogenized with 30 strokes, and the cell debris was removed by centrifugation at 3500 x g, 5 min. Membrane fractions were collected by centrifugation at 100,000 x g, 20 min, and the pellet was resuspended in hot Laemmli sample buffer with 2- mercaptoethanol. Expression of the HER4 polypeptide was detected by immunoblot analysis on solubilized cells or membrane preparations using HER2 immunoreagents generated to either a 19 amino acid region of the HER2 kinase domain, which coincidentally is identical to the HER4 sequence (residues 927-945) , or to the C-terminal 14 residues of HER2, which share a stretch of 7 consecutive residues with a region near the C-terminus of HER4. On further amplification, HER4 was detected from solubilized cell extracts by immunoblot analysis with PY20 anti-phosphotyrosine antibody (ICN Biochemicals) , presumably reflecting autoactivation and autophosphorylation of HER4 due to receptor aggregation resulting from abberantly high receptor density. More specifically, expression was detected by immunobloting with a primary murine monoclonal antibody to HER2 (Neu-Ab3, Oncogene
Science) diluted 1:50 in blotto (2.5% dry milk, 0.2% NP40 in PBS) using 15I-goat anti-mouse Ig F(ab')2 (Amersham, UK) diluted 1:500 in blotto as a second antibody. Alternatively, a sheep polyclonal antipeptide antibody against HER2 residues 929-947
(Cambridge Research Biochemicals, Valleystream, NY) was used as a primary immunoreagent diluted 1:100 in blotto with 125I-Protein G (Amersham) diluted 1:200 in blotto as a second antibody. Filters were washed with blotto and exposed overnight on a phospholmager (Molecular Dynamics) .
7.2. Results CHO-KI cells transfected with a vector encoding the complete human prototype HER4 polypeptide were selected for amplified expression in media containing increasing concentrations of methionine sulfoximine as outlined in Section 7.1., et seq. , supra . Expression of HER4 was evaluated using the immunoassay described in Section 7.1.3., supra . Several transfected CHO-KI cell clones stably expressing HER4 were isolated. One particular clone, CHO/HER4 21-2, was selected in media supplemented with 250 μM MSX, and expresses high levels of HER4. CH0/HER4 21-2 cells have been deposited with the ATCC.
Recombinant HER4 expressed in CHO/HER4 cells migrated with an apparent Mr of 180,000, slightly less than HER2 , whereas the parental CHO cells showed no cross-reactive bands (FIG. 9) . In addition, a 130 kDa band was also detected in the CHO/HER4 cells, and presumably represents a degradation product of the 180 kDa mature protein. CHO/HER4 cells were used to identify ligand specific binding and autophosphorylation of the HER4 tyrosine kinase (see Section 9., et seq., infra ) .
8. Example: Assay for Detecting EGFR-Family Ligands 8.1. Cell Lines A panel of four recombinant cell lines, each expressing a single member of the human EGFR-family, were generated for use in the tyrosine kinase stimulatory assay described in Section 8.2., below. The cell line CHO/HER4 3 was generated as described in Section 7.1.2, supra . CHO/HER2 cells (clone 1-2500) were selected to express high levels of recombinant human pl85er*°B2 by dihydrofolate reductase-induced gene amplification in dhfr-deficient CHO cells. The HER2 expression plasmid, cDNeu, was generated by insertion of a full length HER2 coding sequence into a modified pCDM8 (Invitrogen, San Diego, CA) expression vector (Seed and Aruffo, 1987, Proc. Natl. Adad. Sci. U.S.A. 84:3365-69) in which an expression cassette from pSV2DHFR (containing the murine dhfr cDNA driven by the SV40 early promoter) has been inserted at the pCDM8 vector's unique BamHI site. This construct drives HER2 expression from the CMV immediate-early promoter. NRHER5 cells (Velu et a . , 1987, Science 1408-10) were obtained from Dr. Hsing-Jien Kung (Case Western Reserve University, Cleveland, OH) . This murine cell line was clonally isolated from NR6 cells infected with a retrovirus stock carrying the human EGFR, and was found to have approximately 10β human EGFRs per cell.
The cell line 293/HER3 was selected for high level expression of pl60erbB3. The parental cell line, 293 human embryonic kidney cells, constitutively expresses adenovirus Ela and have low levels of EGFR expression. This line was established by cotransfection of linearized cHER3 (Plowman et al . , 1990, Proc. Natl. Acad. Sci. U.S.A. 87:4905-09) and pMClneoPolyA (neomycin selectable marker with an Herpes simplex thymidine kinase promoter, Stratagene) , with selection in DMEM/F12 media containing 500μg/ml G418. 8.2. Tyrosine Kinase Stimulation Assay Cells were plated in 6-well tissue culture plates (Falcon), and allowed to attach at 37° C for 18-24 hr. Prior to the assay, the cells were changed to serum- free media for at least l hour. Cell monolayers were then incubated with the amounts of ligand preparations indicated in Section 7.3., below for 5 min at 37° C. Cells were then washed with PBS and solubilized on ice with 0.5 ml PBSTDS containing phosphatase inhibitors (10 mM NaHP04, 7.25, 150 m NaCl, 1% Triton X-100,
0.5% deoxycholate, 0.1% SDS, 0.2% sodium azide, 1 mM NaF, 1 mM EGTA, 4 mM sodium orthovanadate, 1% aprotinin, 5 mg/ml leupeptin) . Cell debris was removed by centrifugation (12000 x g, 15 min, 4° C) and the cleared supernatant reacted with 1 mg murine monoclonal antibody to phosphotyrosine (PY20, ICN Biochemicals, Cleveland, Ohio) for CH0/HER4 and 293/HER3 cells, or 1 mg murine monoclonal antibody to HER2 (Neu-Ab3, Oncogene Sciences) for CHO/HER2 cells, or 1 mg murine monoclonal antibody EGFR-1 to human EGFR (Amersham) for NRHER5 cells. Following a 1 hr incubation at 4° C, 30 μl of a 1:1 slurry (in PBSTDS) of anti-mouse IgG-agarose (for PY20 and Neu-Ab3 antibodies) or protein A-sepharose (for EGFR-R1 antibody) was added and the incubation was allowed to continue an additional 30 minutes. The beads were washed 3 times in PBSTDS and the complexes resolved by electrophoresis on reducing 7% SDS-polyacrylamide gels. The gels were transferred to nitrocellulose and blocked in TNET (10 mM Tris pH7.4 , 75 M NaCl, 0.1% Tween-20, 1 mM EDTA) . PY20 antiphosphotyrosine antibody diluted 1:1000 in TNET was used as the primary antibody followed by 125I-goat anti-mouse Ig F(ab')2 diluted 1:500 in TNET. Blots were washed with TNET and exposed on a phosphorimager (Molecular Dynamics) .
8.3. Results Several EGF-fa ily member polypeptide and ligand preparations were tested for their ability to stimulate tyrosine phosphorylation of each of four EGFR-family receptors expressed in recombinant CHO cells using the tyrosine phosphorylation stimulation assay described in Section 8.2., above. The particular preparations tested for each of the four recombinant cell lines and the results obtained in the assay are tabulated below, and autoradiographs of some of these results are shown in FIG. 10.
TABLE III
STIMULATION OF TYR PHOSPHORYLATION OF EGFR-FAMILY RECEPTORS
PREPARATION RECOMBINANT CELLS
CHO/HER4#3 CH0/HER2 NRHER5 2293/HER3
EGF - - + -
AMPHIREGULIN - - + -
TGF-α - - + -
HB-EGF - - + -
FRACTION 17* +
FRACTION 14* - - - -
* The identification of the HER4 tryrosine kinase stimulatory activity within the conditioned media of HepG2 cells and the isolation of these preparations is described in Section 9, infra .
The results indicate that EGF, AR, TGF-α, and HB- EGF, four related ligands which mediate their growth regulatory signals in part through interaction with EGFR, were able to stimulate tyrosine phosphorylation of EGFR expressed in recombinant NIH3T3 cells (for EGF, see FIG. 10, Panel 3, lane 2), but not HER4, HER2, or HER3 expressed in recombinant CHO or 293 cells (FIG. 10, Panel 1, 2, 4, lanes 2 and 3).
Additionally, as discussed in more detail below, the assay identified a HepG2-derived preparation (fraction 17) as a HER4 ligand capable of specifically stimulating tyrosine phoshorylation of HER4 expressed in CHO/HER4 cells alone.
9. Example: Isolation of a HER4 Ligand 9.1. Materials and Methods
9.1.1. Cell Differentiation Assay For the identification of ligands specific for
HER2, HER3 or HER4, the receptor expression profile of MDA-MB-453 cells offers an excellent indicator for morphologic differentiation inducing activity. This cell line is known to express HER2 and HER3, but contains no detectable EGFR. The results of the semi- quantitative PCR assays (Table III) indicated high level expression of HER4 in MDA-MB-453 cells. In addition, cDNA encoding the prototype HER4 polypeptide of the invention was first isolated from this cell line (Section 6., supra ) .
MDA-MB-453 cells (7500/well) were grown in 50 ml DMEM supplemented with 5% FBS and lx essential amino acids. Cells were allowed to adhere to 96-well plates for 24 hr. Samples were diluted in the above medium, added to the cell monolayer in 50 ml final volume, and the incubation continued for an additional 3 days. Cells were then examined by inverted light microscopy for morphologic changes. 9.1.2. Source Cells
Serum free media from a panel of cultures of human cancer cells were screened for growth regulatory activity on MDA-MB-453 cells. A human hepatocarcinoma cell line, HepG2, was identified as a source of a factor which induced dramatic morphologic differentiation of the MDA-MB-453 cells.
9.1.3. Purification of HER4 Ligand The cell differentiation assay described in
Section 10.1.1., supra , was used throughout the purification procedure to monitor the column fractions that induce morphological changes in MDA-MB-453 cells. For large-scale production of conditioned medium, HepG2 cells were cultured in DMEM containing 10% fetal bovine serum using Nunc cell factories. At about 70% confluence, cells were washed then incubated with serum-free DMEM. Conditioned medium (HepG2-CM) was collected 3 days later, and fresh serum-free medium added to the cells. Two additional harvests of HepG2- CM were collected per cell factory. The medium was centrifuged and stored at -20° C in the presence of 500 mM PMSF.
Ten litres of HepG2-CM were concentrated 16-fold using an Amicon ultrafiltration unit (10,000 molecular weight cutoff membrane) , and subjected to sequential precipitation with 20% and 60% ammonium sulfate. After centrifugation at 15,000 x g, the supernatant was extensively dialyzed against PBS and passed through a DEAE-sepharose (Pharmacia) column pre- equilibrated with PBS. The flow-through fraction was then applied onto a 4 ml heparin-acrylic (Bio-Rad) column equilibrated with PBS. Differentiation inducing activity eluted from the heparin column between 0.4 and 0.8 M NaCl. Active heparin fractions were pooled, brought to 2.0 M ammonium sulfate, centrifuged at 12,000 x g for 5 min, and the resulting supernatant was loaded onto a phenyl-5PW column (8 x 75 mm, Waters) . Bound proteins were eluted with a decreasing gradient from 2.0 M ammonium sulfate in 0.1 M Na2HPO«, pH 7.4 to 0.1 M Na-HPO, . Dialyzed fractions were assayed for tyrosine phosphorylation of MDA-MB- 453 cells, essentially as described (Wen et al . , 1992, Cell 69:559-72) , except PY20 was used as the primary antibody and horseradish peroxidase-conjugated goat F(ab')2 anti-mouse Ig (Cappell) and chemiluminescence were used for detection. Phosphorylation signals were analyzed using the Molecular Dynamics personal densitometer.
9.2. Results
Semi-purified HepG2-derived factor demonstrated a capacity to induce differentiation in MDA-MB-453 cells (FIG. 11, Panel 1-3) . With reference to the micrographs shown in FIG. 11, Panel 1-3, untreated
MDA-MB-453 cells are moderately adherent and show a rounded morphology (FIG. 11, Panel 1) . In contrast, the addition of semi-purified HepG2-derived factor induces these cells to display a noticeably flattened morphology with larger nuclei and increased cytoplasm (FIG. 11, Panel 2 and 3) . This HepG2-derived factor preparation also binds to heparin, a property which was utilized for purifying the activity.
On further purification, the HepG2-derived factor was found to elute from a phenyl hydrophobic interaction column at 1.0M ammonium sulfate (fractions 16 to 18) . FIG. 11, Panel 4, shows the phenyl column elution profile. Tyrosine phosphorylation assays of the phenyl column fractions revealed that the same fractions found to induce differentiation of the human breast carcinoma cells are also able to stimulate tyrosine phosphorylation of a 185 kDa protein in MDA-MB-453 cells (FIG. 11, Panel 5). In particular, fraction 16 induced a 4.5-fold increase in the phosphorylation signal compared to the baseline signal observed in unstimulated cells, as determined by densitometry analysis (FIG. 11, Panel 6) .
The phenyl fractions were also tested against the panel of cell lines which each overexpress a single member of the EGFR-family (Section 9.1., supra ) . Fraction 17 induced a significant and specific activation of the HER4 kinase ( FIG. 10, Panel 1, lane 4) without directly affecting the phosphorylation of HER2, EGFR, or HER3 (FIG. 10, Panel 1-4, lane 4).
Adjacent fraction 14 was used as a control and had no effect on the phosphorylation of any of the EGFR- family receptors (FIG. 10, Panel 1-4, lane 5). Further purification and analysis of the factor present in fraction 17 indicates that it is a glycoprotein of 40 to 45 kDa, approximately the same size as NDF and HRG. The HepG2-derived factor also has functional properties similar to NDF and HRG, inasmuch as it stimulates tyrosine phosphorylation of HER2/pl85 in MDA-MB-453 cells, but not EGFR in NR5 cells, and induces morphologic differentiation of HER2 overexpressing human breast cancer cells.
Recently, several groups have reported the identification of specific ligands for HER2 (see Section 2 . , supra . , including NDF and HRG-α. In contrast to these molecules, the HepG2-derived factor described herein failed to stimulate phosphorylation of HER2 in CH0/HER2 cells, but did stimulate phosphorylation of HER4 in CHO/HER4 cells. These findings are intriguing in view of the ability of the HepG2-derived factor to stimulate phosphorylation of MDA-MD-453 cells, a cell line known to overexpress HER2 and HER3 and the source from which HER4 was cloned. Since EGFR and HER2 have been shown to act 5 synergistically, it is conceivable that HER4 may also interact with other EGFR-family members. In this connection, these results suggest that NDF may bind to HER4 in MDA-MB-453 cells resulting in the activation of HER2. The results described in Section 10., 10 immediately below, provide evidence that NDF interacts directly with HER4 , resulting in activation of HER2.
10. Example: Recombinant NDF-Induced, HER4 Mediated Phosphorylation of HER2
15 Recombinant NDF was expressed in COS cells and tested for its activity on HER4 in an assay system essentially devoid of other known members of the EGFR- family, notably EGFR and HER2.
A full length rat NDF cDNA was isolated from
20 normal rat kidney RNA and inserted into a cDM8-based expression vector to generate cNDFl.6. This construct was transiently expressed in COS cells, and conditioned cell supernatants were tested for NDF activity using the tyrosine kinase stimulation assay _5 described in Section 8.2., supra . Supernatants from cNDFl.6 transfected cells upregulated tyrosine phosphorylation in MDA-MB-453 cells relative to mock transfected COS media FIG. 12, Panel l. Phosphorylation peaked 10-15 minutes after addition on
30 NDF'
The crude NDF supernatants were also tested for the ability to phosphorylate EGFR (NR5 cells) , HER2
(CHO/HER2 1-2500 cells) , and HER4 (CHO/HER4 21-2 cells) . The NDF preparation had no effect on
35 phosphorylation of EGFR, or HER2 containing cells, but induced a 2.4 to 4 fold increase in tyrosine phosphorylation of HER4 after 15 minutes incubation (see FIG. 12, Panel 2). These findings provide preliminary evidence that NDF/HRG-α mediate their effects not through direct binding to HER2, but instead by means of a direct interaction with HER4. In cell lines expressing both HER2 and HER4, such as MDA-MB-453 cells and other breast carcinoma cells, binding of NDF to HER4 may stimulate HER2 either by heterodimer formation of these two related transmembrane receptors, or by intracellular crosstalk. Formal proof of the direct interaction between NDF and HER4 will require crosslinking of 125I- NDF to CHO/HER4 cells and a detailed analysis of its binding characteristics.
11. Example: Chromosomal Mapping of the HER4 Gene
A HER4 cDNA probe corresponding to the 5' portion of the gene (nucleotide positions 34-1303) was used for in situ hybridization mapping of the HER4 gene. In situ hybridization to metaphase chromosomes from lymphocytes of two normal male donors was conducted using the HER4 probe labeled with 3H to a specific activity of 2.6 x 107 cpm/μg as described (Marth et al . , 1986, Proc. Natl. Acad. Sci. U.S.A. 83:7400-04). The final probe concentration was 0.05 μg/μl of hybridization mixture. Slides were exposed for one month. Chromosomes were identified by Q banding.
ll.l. Results A total of 58 metaphase cells with autoradiographic grains were examined. Of the 124 hybridization sites scored, 38 (31%) were located on the distal portion of the long arm of chromosome 2 (FIG. 13) . The greatest number of grains (21 grains) was located at band q33, with significant numbers of grains on bands q34 (10 grains) and q35 (7 grains) . No significant hybridization on other human chromosomes was detected.
12. Example: Activation of the HER4 Receptor is Involved in Signal Transduction by Heregulin
12.1. Recombinant Heregulin Induction of Tyrosine Phosphorylation of HER4
12.1.1 Materials and Methods
CHO cells expressing recombinant HER4 or HER2 were generated as previously described in Section 8.
Cells (1 x 10s of CH0/HER2 and CH0/HER4, and 5 x 105 of
MDA-MB453) were seeded in 24 well plates and cultured
24 h. Cells were starved in serum free media for 1-6 h prior to addition of conditioned media from transfected COS cells, or 25 μg/ml HER2-stimulatory
Mab (N28 and N29) (Stancovski et al . , 1991, Proc.
Natl. Acad. Sci. U.S.A. 88:8691-8695) . Following 10 min treatment at room temperature, cells were solubilized (Section 13, infra) and immunoprecipitated with 2 μg anti-phosphotyrosine Mab (PY20, ICN
Biochemicals) or anti-HER2 Mab (c-neu Ab-2 , Oncogene
Sciences) and anti-mouse IgG-agarose (Sigma) . Western blots were performed using PY20 as described supra , and bands were detected on a Molecular Dynamics phosphorimager.
Recombinant rat heregulin was produced as follows. A 1.6 kb fragment encoding the entire open reading frame of rat heregulin (and 324 bp of 5'- untranslated sequence) was obtained by PCR using normal rat kidney RNA as a template. This fragment was inserted into a CDM8-based expression vector
(Invitrogen) to generate cNDFl.6. The expression plasmid was introduced into COS-1 cells using the
DEAE-dextranchloroquine method (Seed et al . , Proc.
Natl. Acad. Sci. U.S.A. 1987, 84:3365-3369) . After two days of growth in Dulbecco's Modified Eagle Medium (DMEM)/10% FBS, the medium was replaced with DMEM and the incubation continued for an additional 48 h. Clarified conditioned medium was either used directly or was dialyzed against 0.1 M acetic acid for 2 days, dried, and resuspended as a 20-fold concentrate in DMEM.
12.1.2. HER Tyrosine Phosphorylation As shown in FIG. 15, recombinant heregulin induces tyrosine phosphorylation of HER4. Tyrosine phosphorylated receptors were detected by Western blotting with an anti-phosphotyrosine Mab a, Monolayers of MDA-MB453 or CHO/HER4 cells were incubated with media from COS-1 cells transfected with a rat heregulin expression plasmid (HRG) , or with a cDM8 vector control (-) . The media was either applied directly (lx) or after concentrating 20-fold (20x, and vector control) . Solubilized cells were immunoprecipitated with anti-phosphotyrosine Mab. b, Monolayers of CH0/HER2 cells were incubated as above with transfected Cos-1 cell supernatants or with two stimulatory Mabs to HER2 (Mab 28 and 29) . Solubilized cells were immunoprecipitated with anti-HER2 Mab. Arrows indicate the HER2 and HER4 proteins.
12.1.3. Results
In order to determine if HER4 is involved in signaling by heregulin, the ability of recombinant rat heregulin to stimulate tyrosine phosphorylation in a panel of Chinese hamster ovary (CHO) cells that ectopically express human HER2 or HER4 was examined. The activity of recombinant heregulin was first confirmed by its ability to stimulate differentiation of human breast cancer cells (data not shown) and to induce tyrosine phosphorylation of a high molecular weight protein in MDA-MB453 cells (FIG. 15, Panel 1). Heregulin had no effect on CHO cells expressing only HER2 (FIG. 15, Panel 3), yet these cells were shown to have a functional receptor since their tyrosine kinase activity could be stimulated by either of two antibodies specific to the extracellular domain of HER2 (FIG. 15, Panel 3). However, heregulin was able to induce tyrosine phosphorylation of a 180K protein in CHO cells expressing HER4 (FIG. 15, Panel 2) . Species differences in ligand-receptor interactions have been reported for EGF receptor (Lax et al . , 1988, Mol. Cell. Biol. 8:1970-1978). It is unlikely that such differences are responsible for our failure to detect a direct interaction between rat heregulin and human HER2, since previous studies have shown that rat heregulin does not directly interact with rat HER2/neu (Peles et al . , supra). In addition, rat, rabbit, and human heregulin share high sequence homology and have been shown to induce tyrosine phosphorylation in their target cells of human origin (Wen D. et ai . , supra ; Holmes et al . , supra ; and Falls et al . , supra ) .
12.2. Expression of Recombinant HER2 and HER4 in Human CEM Cells
12.2.1. Materials and Methods
CNHER2 and CNHER4 expression plasmids were generated by insertion of the complete coding sequences of human HER2 and HER4 into cNEO, an expression vector that contains an SV2-NEO expression unit inserted at a unique BamHI site of CDM8. These constructs were linearized and transfected into CEM cells by electroporation with a Bio-Rad Gene Pulser apparatus essentially as previously described (Wen et al . , supra ) . Stable clones were selected in RPMI/10% FBS supplemented with 500 μg/ml active Geneticin. HER2 immunoprecipitations were as described in FIG. 15, using 5 x 10β cells per reaction, and the HER2 Western blots were performed with a second anti-HER2 Mab (c-neu Ab-3, Oncogence Sciences). For metabolic labeling of HER4, 5 x 106 cells were incubated for 4-6 h in methionine and cysteine-free Minimal Essential Medium (MEM) supplemented with 2% FBS and 250 μCi/ml [35S]Express protein labeling mix (New England Nuclear) . Cells were washed twice in RPMI and solubilized as above. Lysates were then incubated for 6 h, 4* C with 3 μl each of two rabbit antisera raised against synthetic peptides corresponding to two regions of the cytoplasmic domain of human HER4 ('"LARLLEGDEKEYNADGG" [SEQ ID No:31] and
1010EEDLEDMMDAEEY1022 [SEQ ID No:32]). Immune complexes were precipitated with 5 μg goat anti-rabbit Ig (Cappel) and Protein G Sepharose (Pharmacia) . Proteins were resolved on 7% SDS-polyacrylamide gels and exposed on the phosphorimager. For Mab- stimulation assays, 5 x 106 cells were resuspended in 100 μl RPMI and 25 μg/ml Mab was added for 15 min at room temperature. Control Mab 18.4 is a murine IgG. specific to human amphiregulin (Plowman et al . , 1990, Mol. Cell. Biol. 10:1969-1981). Following Mab- treatment, cells were washed in PBS, solubilized (Section 13, infra) , and immunoprecipitated with anti- HER2 Mab (Ab-2). Tyrosine phosphorylated HER2 was detected by PY20 Western blot as in FIG. 15.
12.2.2. Expression of HER2 and HER4 in Human CEM Cells
Expression of recombinant HER2 and HER4 in human
CEM cells is shown in FIG. 16. Transfected CEM cells were selected that stably express either HER2, HER4, or both recombinant receptors. In FIG. 16, Panel 1, recombinant HER2 was detected by immunmoprecipitation of cell lysates with anti-HER2 Mab (Ab-2) and Western blotting with another anti-HER2 Mab (Ab-3) . In FIG. 16, Panel 2, recombinant HER4 was detected by immunoprecipitation of 3SS-labeled cell lysates with HER4-specific rabbit anti-peptide antisera. In FIG. 16, Panel 3, three CEM cell lines were selected that express one or both recombinant receptors and aliquots of each were incubated with media control (-) , with two HER2-stimulatory Mabs (Mab 28 and 29) , or with an isotype matched control Mab (18.4). Solubilized cells were immunoprecipitated with anti-HER2 Mab (Ab-2) and tyrosine phosphorylated HER2 was detected by Western blotting with an anti-phosphotyrosine Mab. The size in kilodaltons of prestained high molecular weight markers (Bio-Rad) is shown on the left and arrows indicate the HER2 and HER4 proteins.
12.2.3. Results These findings of Example 12 support the earlier observation that HER2 alone is not sufficient to transduce the heregulin signal. To further address this possibility, a panel of human CEM cells that express the recombinant receptors either alone or in combination was established. The desired model system was of human origin, since many of the reagents against erbB family members are specific to the human homologues. CEM cells are a human T lymphoblastoid cell line and were found to lack expression of EGF receptor, HER2, HER3, or HER4, by a variety of immunologic, biologic, and genetic analyses (data not shown) . FIG. 16 demonstrates the selection of three CEM cell lines that express only HER2 (CEM 1-3), only HER4 (CEM 3-13), or both HER2 and HER4 (CEM 2-9). The presence of a functionally and structurally intact HER2 in the appropriate cells was confirmed by the induction of HER2 tyrosine phosphorylation by each of the two antibodies specific to the extracellular domain of HER2, but not by an isotype matched control antibody (FIG. 16, Panel 3).
12.3. Heregulin Induction of Tyrosine
Phosphorylation in CEM Cells Expressing HER4
12.3.1. Materials and Methods Recombinant rat heregulin was prepared as in FIG. 15, and diluted to 7x in RPMI. The HER4-specific Mab was prepared by immunization of mice with recombinant HER4 (manuscript in preparation) . CEM cells (5 x 106) were treated with the concentrated supernatants for 10 min, room temperature and precipitated with PY20 or anti-HER2 Mab (Ab-2) as described in FIG. 15. Immunoprecipitation with anti-HER4 Mab was performed by incubation of cells lysates with a 1:5 dilution of hybridoma supernatent for several hours followed by 2 μg rabbit anti-mouse Ig (cappel) and Protein A Sepharose CL-4B (Pharmacia) . PY20 Westerns as described in FIG. 15.
12.3.2. Heregulin Induction of Tyrosine Phosphorylation in CEM Cells
Expressing HER4
As shown in FIG. 17, heregulin induces tyrosine phosphorylation in CEM cells expressing HER4. Three
CEM cell lines that express either HER2 or HER4 alone (CEM 1-3 and CEM 3-13) or together (CEM 2-9) were incubated with 7x concentrated supernatants from mock- (-) or heregulin-transfected (+) COS-l cells. Solubilized cells were immunoprecipitated (IP) with anti-phosphotyrosine Mab (PY20) (FIG. 17, Panel 1) ; HER2-specific anti-HER2 Mab (Ab-2) (FIG. 17, Panel 2); or HER4-specific Mab (6-4) (FIG. 17, Panel 3). In each case, tyrosine phosphorylated receptors were detected by Western blotting with anti-phosphotyrosine Mab. The size in kilodaltons of prestained molecular weight markers (BioRad) is shown on the left and arrows indicate the HER2 and HER4 proteins.
12.3.3 Results The panel of CEM cells were then analyzed by phosphotyrosine Western blots of cells lysates following treatment with heregulin and immunoprecipitation with three different monoclonal antibodies (Mabs) . Precipitation with an anti- phosphotyrosine antibody (PY20) again demonstrates that heregulin is able to stimulate tyrosine phosphorylation in cells expressing HER4, but not in cells expressing only HER2 (FIG. 17, Panel 1). However, precipitation with an antibody specific to the extracellular domain of HER2 demonstrates that HER2 is tyrosine phosphorylated in response to heregulin in cells that co-express HER4 (FIG. 17, Panel 2) . Furthermore, precipitation with a HER4- specific Mab confirms that heregulin induces tyrosine phosphorylation of HER4 irrespective of HER2 expression (FIG. 17, Panel 3). Due to co-expression of HER2 and HER4 in many breast carcinomas, these findings suggest that earlier studies of heregulin- HER2 interactions may require reevaluation.
12.4. Covalent Cross-linking of Iodinated Heregulin to HER
12.4.1. Materials and Methods
To facilitate purification, recombinant heregulin was produced as an epitope-tagged fusion with amphiregulin. The 63 amino acid EGF-structural motif of rat heregulin (Wen et al . , supra ) from serine 177 to tyrosine 239 was fused to the N-terminal 141 amino acids of the human amphiregulin precursor (Plowman et al . , supra) . This truncated portion of heregulin has previously been shown to be active when expressed in E . coli (Holmes et al . , supra ) , and the N-terminal residues of amphiregulin provide an epitope for immunologic detection and purification of the recombinant protein. This cDNA fragment was spliced into a cDM8 based expression vector for transient expression in COS-l cells. Recombinant heregulin was purified by anion exchange and reverse phase chromatography as shown to be active based on the specific stimulation of HER4 tyrosine phosphorylation. Purified heregulin was iodinated with 250 μCi of 1 SI- labeled Bolton-Hunter reagent (NEN) . CH0/HER4 or CH0/HER2 cells were incubated with 125I-heregulin (10s- cpm) for 2 h at 4° C. Monolayers were washed in PBS and 3 mM Bis(sulfosuccinimidyl) suberate (BS3, Pierce) was added for 30 min on ice. The cells were washed in tris-buffered saline, dissolved in SDS sample buffer, run on a 7% polyacrylamide gel, and visualized on the phosphorimager.
12.4.2. Results As shown in FIG. 18, previous binding and covalent cross-linking studies have demonstrated that p45 binds specifically to HER4 and displays a single high-affinity site with a Kd of 5 nM on CH0/HER4 cells (Section 13, infra ) . Preliminary cross-linking studies have been performed on these cells with recombinant heregulin revealing a high molecular weight species that corresponds to the heregulin-HER4 receptor complex. 12 . 5 Results
As the data demonstrate heregulin induces tyrosine phosphorylation of HER4 in the absence of HER2. In contrast, heregulin does not directly stimulate HER2. However, in the presence of HER4, heregulin induces phosphorylation of HER2, presumably either by transphosphorylation or through receptor heterodimerization. Together, these experiments suggest that HER4 is the receptor for heregulin. Most breast cancer cells that overexpress HER2 have been shown to be responsive to heregulin, whereas HER2-positive ovarian and fibroblast lines do not respond to the ligand. This observation could be explained by the fact that HER4 is co-expressed with HER2 in most or all of the breast cancer cell lines studied, but not in the ovarian carcinomas. Furthermore, overexpression of HER2 in heregulin- responsive breast cancer cells leads to increased binding, whereas expression of HER2 in heregulin- unresponsive ovarian or fibroblast cells has no effect (Peles et al . , supra ) .
Northern and in situ hybridization analyses localizes HER4 to the white matter and glial cells of the central and peripheral nervous system, as well as to cardiac, skeletal, and smooth muscle. This distribution is consistent with HER4 being involved in signaling by the neurotropic factors, GGF, and ARIA. Recognition of HER4 as a primary component of the heregulin signal transduction pathway will assist in deciphering the molecular mechanisms that results in its diverse biologic effects. 13. Example: Purification of the HER4 ligand, p45 13.1 Materials and Methods
13.1.1. Cell Culture and Reagents MDA-MB 453 cells were obtained from the American Type Culture Collection (Rockville, MD) and cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum and amino acids (Life Technologies, Inc.). HepG2 cells were obtained from Dr. S. Radka and cultured in 10% fetal bovine serum containing DMEM. For large scale production of serum-free conditioned medium, HepG2 cells were propagated in Nunc cell factories. Chinese hamster ovary cells (CHO-KI) expressing high levels of either recombinant human pl85erB2 (CH0/HER2) or recombinant human pi80erbB (CHO/HER4) were generated and cultured as described in Section 8. N29 monoclonal antibody to the extracellular portion of the human HER2 receptor was a gift from Dr. Y. Yarden. Ab-3 c- neu monoclonal antibody that reacts with the human pl85erbB2 was from Oncogene Science Inc.
13.1.2. Human Breast cancer Cell Differentiation Assay
MDA-MB-453 human breast cancer cells overexpress pl85ertB2 but do not express the EGFR at their surface
(Kraus, 1987, EMBO J. 6:605-610) . A cell differentiation assay was used to monitor the chromatography fractions for their ability to induce phenotypic differentiation in MDA-MB-453 cells.
13.1.3. Purification of p45 Medium conditioned by HepG2 cells (HepG2-CM, 60 liters) was concentrated 26-fold using an Amicon ultrafiltration unit (10,000 molecular weight cutoff membranes) and then subjected to 50% ammonium sulfate ((NH4)-S04«) precipitation. After centrifugation at 25,000 x g for 1 h, the supernatant was loaded, as five separate runs, on a phenyl-Sepharose column (2.5 x 24.5 cm, Pharmacia LKB Biotechnology Inc.) equilibrated with 1.9 M (NH4)2SO, in 0.1 M Na-HPO,, pH 7.4. Bound proteins were eluted with a 240 ml linear decreasing gradient from 1.9 M to 0 M (NH4)2S04 in 0.1 M phosphate buffer, pH 7.4. The flow rate was 70 ml/h, and 5.8-ml fractions were collected. Active fractions were pooled, concentrated, dialyzed against PBS, and then applied (three separate runs) to a DEAE- Sepharose column (2.5 x 25 cm, Pharmacia) equilibrated with PBS, pH 7.3. The flow rate was 1 ml/min. The column flow-through was then loaded (two separate runs) on a CM-Sepharose Fast Flow column (2.5 x 13.5 cm, Pharmacia) pre-equilibrated with PBS, pH 7.3. Proteins were eluted at 1 ml/min. with a 330-ml gradient from PBS to 1 M NaCl in PBS. Fractions of 5 ml were collected. The active material was loaded on a TSKgel heparin-5PW HPLC column (7.5 x 75 mm, TosoHaas) equilibrated with PBS. The flow rate was 0.5 ml/min. A 50-ml linear NaCl gradient (PBS to 2 M in PBS) followed by an isocratic elution with 2 M NaCl was used to elute the bound proteins. Fractions of 1 ml were collected. Active fractions corresponding to the 1.3 M NaCl peak of protein were pooled and concentrated. A Protein Pak SW-200 size exclusion chromatography column (8 x 300 mm, Waters) equilibrated with 100 mM Na2HP04, pH7.4, 0.01% Tween 20 was used as a final step of purification. The flow rate was 0.5 ml/min., and 250-μl fractions were collected. Column fractions were then analyzed by SDS-PAGE (12.5% gel) under reducing conditions and proteins detected by silver staining. 13.1.4. Detection of Tyrosine-
Phosphorylated Proteins by Western Blotting
Aliquots of PBS-dialyzed column fractions were diluted to 200 μl in PBS, then added to individual wells of 48-well plated containing either 5 x 10s MDA- MB-453 cells, 2 x 104 CHO/HER2 cells or 5 x 104 CHO/HER2 cells. Following a 10-min. incubation at 37° C, cells were washed and then lysed in 100 μl of boiling electrophoresis sample buffer. Lysates were heated at 100° C for 5 min. , cleared by centrifugation, and then subjected to SDS-PAGE. After electrophoresis, proteins were transferred to nitrocellulose. The membrane was blocked for 2 h at room temperature with 6% hovine serum albumin in 10 mM Tria-HCl, pH 8.0, 150 mM NaCl, 0.05% Tween 20. PY20 monoclonal anti-phosphotyrosine antibody (ICN, 2 h at 22° C) and horseradish peroxidase-conjugated goat anti- mouse IgG F(ab')2 (Cappel, lh at 22° C) were used as primary and secondary probing reagents, respectively. Proteins phosphorylated on tyrosine residues were detected with a chemiluminescence reagent (Amersham Corp. ) .
13.1.5. CHO/HER2 Stimulation Assay CHO/HER2 cells were seeded in 24-well plates at 1 x 10s cells/well and cultured 24 h. Monoclonal antibody N29 specific to the extracellular domain of p185 βr,B2 (stancovski et al . , 1991, PNAS 88:8691-8695) was added at 25 μg/ml. Following a 20-min. incubation at room temperature, media were removed and cells were solubilized for 10 min. on ice in PBS-TDS (10 mM sodium phosphate, pH 7.25, 150 mM NaCl, 1% Triton, 0.5% sodium deoxycholate, 0.1% SDS, 0.2% NaN3, 1 mM NaF, 1 m M phenylmethylsulfonyl fluoride, 20 μg/ml aprotinin) with occasional vortexing. Clarified extracts were incubated for 2 h at 4° C with an antip- 185βrbB2 antibody (Ab-3 c-neu, Oncogene Science Inc.). Rabbit anti-mouse IgG (Cappel) and protein A-Sepharose were then added, and samples were incubated an additional 30 min. Immune complexes were washed 3 times with PBS-TDS, resolved on a 7% polyacrylamide gel, and electrophoretically transferred to nitrocellulose. Phosphorylation of the receptor was assessed by Western blot using a 1:1000 dilution of PY20 phosphotyrosine primary antibody (ICN
Biochemicals) and a 1:500 dilution of 125I-sheep anti- mouse F(ab')2(Amersham Corp.).
13.1.6. Covalent Cross-linking of Iodinated p45
HPLC-purified p45 (1.5 μg) was iodinated with 250 μCi of 14I-labeled Bolton-Hunter reagent obtained from
Du Pont-New England Nuclear. 125I-p45 was purified by filtration through a Pharmacia PD-10 column. The specific activity was 104 cpm/ng. 125I-p45 retained its biological activity as confirmed in a differentiation assay as well as a kinase stimulation assay (data not shown) . Binding of radiolabeled p45 was performed on
2 x 105 CHO/HER4 cells and 4 x 10s CHO-KI or CHO/HER2 cells in 12-well plates. Cell monolayers were washed twice with 1 ml of ice-cold binding buffer (DMEM supplemented with 44 mM sodium bicarbonate, 50 mM BES
[N-, N-Bis (2-hydroxyethyl) -2-aminoethan-sulfonic acid], pH 7.0, 0.1% bovine serum albumin) and then incubated on ice for 2 h with 50 ng/ml 125I-p45 in the absence or the presence of 250 ng/ml unlabeled p45.
The monolayers were washed twice with PBS and then incubated in the presence of 1 mM jbis(sulfosuccinimidyl)suberate (BS3, Pierce) in PBS for
45 min. on ice. Supernatants were discarded, and the reaction was quenched by adding 0.2 M glycine in PBS. Cells were washed and then lysed by adding 150 μl of boiling electrophoresis sample buffer containing 0.1 M dithiothreitol. Samples were boiled for 5 min. and 50 μl of each sample was loaded on 7.5% polyacrylamide gels. Dried gels were analyzed using a Molecular Dynamics Phosphorimager and then exposed to Kodak X- Omat AR films.
13.1.7. Binding Analysis of Iodinated p45 CHO/HER4 cells, CHO-KI cells (105 cells/well) , and
CHO/HER2 cells (2 x 10s cells/well) were seeded in 24- well plates. After 48 h, cells were washed with binding buffer and then incubated with increasing concentrations of 125I-p45. Nonspecific binding was determined in the presence of excess unlabeled p45. After a 2-h incubation at 4° C, the cells were washed three times with binding buffer and then lysed in 500 μl of 0.5M NaOH, 0.1% SDS. Cell-associated radioactivity was determined by using a γ-counter. Scatchard analysis was performed using the computerized LIGAND program (Munson and Rodbard, 1980, Anal. Biochem 107:220-239).
13.1.8. N-terminal Amino Acid Sequence The N-terminal sequence analysis of p45 (25 pmol) was performed as previously described (Shoyab et al . , 1990, Proc. Natl. Acad. Sci. 87:7912-7916).
13.2. Purification of the HER ligand, p45 Sixty liters of medium conditioned by HEPG2 cells was used as a starting material, and throughout the purification procedure, bioactivity was assessed by a cell differentiation assay described in Section 10.1.1., supra . After concentration (1540 mg of protein) and ammonium sulfate precipitation, the active material (1010 mg of protein) was loaded on a phenyl-Sepharose column (FIG. 19, Panel 1) . Column fractions 40-85 (348 mg of protein eluting between 1M ammonium sulfate and 0M ammonium sulfate) were found to induce morphological changes in MDA-MB-453 cells. The biologically active column flow-through (174 mg of protein) was subjected to a cation-exchange chromotography (FIG. 19, Panel 2) with activity eluting between 0.35 and 0.48 M NaCl. The active fractions were pooled (1.5 mg of protein) and applied to an analytical heparin column (FIG. 19, Panel 3). The differentiation activity eluted from the heparin column between 0.97 and 1.45 M NaCl (fractions 27-38). Size exclusion chromatography of the heparin column fractions 35-38 achieved a homogeneous preparation of the human breast cancer cell differentiation factor. A major protein peak eluted with a molecular weight greater than 70,000 (FIG. 19, Panel 4) . Fractions 30 and 32 assayed at 30 ng/ml confirmed the bioactivity of this protein with phenotypic changes being apparent after 24 hours. SDS-PAGE analysis of these column fractions followed by silver staining of the gel showed that the biologically active peak contained a single protein migrating around 45 kDA (FIG. 20) . The faint 67 kDa band corresponds to a staining artifact, as evidenced by the left lane of the gel, which contained no sample. The amount of pure protein recovered in fractions 30-33 was estimated to be 6 micrograms. The difference in the molecular weight estimated by size exclusion chromatography and SDS- PAGE indicates that this protein may form dimers or oligomers under non-denaturing conditions. 13.3. N-terminal Amino Acid Sequence of p45
Twenty-five pmol of p45 was subjected to direct amino acid sequencing, identifying the sequence Ser- Gly-X-Lys-Pro-X-X-Ala-Ala [SEQ ID No:33]. An X denotes a sequenator cycle in which a precise amino acid could not be assigned. Comparison of this partial sequence with two protein data bases (GenBank release 73, EMBL release 32) revealed a perfect homology between the identified residues and a region of the amino terminus of heregulin (Holmes et al . , supra ) The N-terminal serine residue of p45 corresponds to residue 20 of the deduced amino acid sequence of heregulins.
13.4. p45 stimulates Protein Phosphorylation
FIG. 21, Panel 1 shows the stimulatory effect of sequential fractions from the size exclusion chromatography column on tyrosine phosphorylation in MDA-MB- 53 cells. Densitometric analysis of the autoradiogram revealed that fractions 30-34 were essentially equipotent. Homogeneously purified p45 specifically stimulated tyrosine phosphorylation of pl80erbB4 (FIG. 21, Panel 2). p45 was not able to stimulate phosphorylation in CHO/HER2 cells, and the cell were found to express functional pl85erbB2 receptor as evidenced by immunoreactivity with 5 monoclonal antibodies specific to different regions of pl85erbB2. p45 has an N-terminal amino acid sequence similar to the recently isolated pl85βrbB2 ligand.
13.5. valent cross-linking of
Figure imgf000095_0001
Binding and cross-linking studies were performed in order to confirm that p45 was able to bind to pl80βrbB4. Binding studies revealed that while no specific binding of 125I-p45 to CHO-KI and CHO/HER2 cells could be measured, CHO/HER4 cells displayed a single high affinity site (Kd about 5nM) with 7 x 104 receptors/cell (FIG. 22, Panel 1). The results of iodinated p45 cross-linking to CHO-KI, CHO/HER2, or CHO/HER4 cells are presented in FIG. 22, Panel 2. Whereas no cross-linked species was observed in either CHO-KI or CHO/HER2 cells, four distinct bands were observed in CHO/HER4 cells, migrating as 45-, 100-, and 210-kDa species, and a very high molecular weight species. In the presence of unlabeled p45, 125I-p45 binding was greatly reduced. The 45 kDa band represents uncross-linked yet pl80erbB4 associated 15i- p45. The 210 kDa band corresponds to the p45-pl80erbB4 complex (assuming an equimolar stoichiometry of ligand and receptor) , whereas the high molecular weight band is presumed to be a dimerized form of the receptor- ligand complex. The 100 kDa band could represent a truncated portion of the extracellular domain of the pl80βrB4 receptor complexed to 125I-p45 or a covalently associated p45 dimer. The c-kit ligand provides precedence for cross-linked dimers (Williams et al . , 1990, Cell 63:167-174).
13.6. Results
The HER4 ligand, p45, purified from medium conditioned by HepG2, induces differentiation of breast cancer cells and activates tyrosine phosphorylation of a 185 kDa protein in MDA-MB-453 cells. p45 is not capable of directly binding to pl85erbB2 but shows specificity to HER4/pl80erB4. 14. Example: Targeted Cytotoxicity Mediated By A Chimeric Heregulin-Toxin Protein
14.1. Materials and Methods
14.1.1. Reagents and Cell Lines
Heregulin -32-Ig and the mouse monoclonal antibody directed against the Pseudomonas exotoxin (PE) was supplied by Dr. J.-M. Colusco and by Dr. Tony Siadek, respectively (Bristol-Myers-Squibb, Seattle, WA) . The cell lines BT474, MDA-MB-453, T47D, SKBR-3, and MCF-7 (all breast carcinoma) , LNCaP (prostate carcinoma) , CEM (T-cell leukemia) and SKOV3 (ovarian carcinoma) were obtained from ATCC (Rockville, MD) . The H3396 breast carcinoma cell line and the L2987 lung carcinoma cell line were established at Bristol-Myers- Squibb (Seattle, WA) . The AU565 breast carcinoma cell line was purchased from the Cell Culture laboratory. Naval Biosciences Laboratory (Naval Supply Center, Oakland, CA) . All cell lines were of human origin. BT474 and T47D cells were cultured in IMDM supplemented with 10% fetal bovine serum (FBS) and 10 μg/ml insulin. MCF-7, H3396, LNCaP and L2987 were cultured in IMDM supplemented with 10% FBS. SKBR3 and SKOV3 cells were grown in McCoys media supplemented with 10% FBS and 0.5% non-essential amino acids. AU565 cells were cultured in RPMI 1640 media supplemented with 15% FBS and CEM transfectants (see section 15.1.5., infra ) were cultured in RPMI 1640 supplemented with 10% FBS and 500 μg/ml G418.
14.1.2. Construction of HAR-TX ,92 Expression Plasmid
Rat heregulin cDNA (Wen et al . , 1994, Mol. Cell. Biol. 14:1909-1919) was isolated by RT-PCR using mRNA from rat kidney cells as template. The cDNA was prepared in chimeric form with the AR leader sequence by a two-step PCR insertional cloning protocol using cARP (Plowman et al . , 1990, Mol. Cell. Biol. 10:1969- 1981) as template to amplify the 5' end of the chimeric ligand using the oligonucleotide primers CARP5: (5'-CGGAAGCTTCTAGAGATCCCTCGAC-3' ) [SEQ ID No:34] and
ANSHLIK2: (3 'CCGCACACTTTATGTGTTGGCTTGTGTTTCTTCTATTTTTTCCA TTTTTG-5') [SEQ ID No:35].
The EGF-like domain PCR was amplified from CNDF1.6 (Plowman et al . , 1993, Nature 366:473-475) using the oligonucleotide primers ANSHLIKl:
(5'-CAAAAATGGAAAAAATAGAAGAAACAGAAGCCATCTCATAA AGTGTGCGG-3') [SEQ ID No:36] and
XNDF1053: (3 '-GTCTCTAGATTAGTAGAGTTCCTCCGCTTTTTCTTG-5' ) [SEQ ID No:37] .
The products were combined and rea plified using the oligonucleotide primers CARP5 and XNDF1053. The HAR (heregulin-amphiregulin) construct (cNANSHLIK) was PCR amplified in order to insert an Nde I restriction site on the 5' end and a Hind III restriction site on the 3' end with the oligonucleotide primers
NARP1: (5'-GTCAGAGTTCATATGGTAGTTAAGCCCCCCCAAAAC-3' ) [SEQ ID No:38] and NARP4: (3 '-GGCAGTTCTATGAACACGTTCACGGGCTTGCTTAAATGACCGCTGGCA ACGGTCTTGATACAATACCGTAGAAAAATGTTTAGCCTCCTTGAGATGTTCGAA TCTCCTAGAAAC-5') [SEQ ID No: 39]. The resulting 287 bp DNA fragment was digested with Nde I and Hind III, followed by ligation into the compatibly digested expression plasmid pBW 7.0 which contained, in frame at the 5' fusion site, the nucleotide sequence encoding for of PE40 (Friedman et al . , 1993, Cancer Res. 53:334-339). The resulting expression plasmid pSE 8.4 then contained the gene fusion encoding the chimeric heregulin-toxin protein, under the control of a IPTG-inducible T7 promoter.
14.1.3. Expression and Isolation of Recombinant HAR-TX β2 Protein
The plasmid pSE 8.4 encoding the chimeric protein HAR-TX β2 was transformed into the E. coli strain BL21 (λDE3) . Cells were grown by fermentation in T broth containing 100 μg/ml ampicillin at 37°C to a optical density of A650 = 4.8, followed by induction of protein expression with 1 mM isopropyl-i-thio-/3-D- galactopyranoside (IPTG) . After 90 minutes the cells were harvested by centrifugation. The cell pellet was frozen at -70°C, then thawed and resuspended at 4°C in solubilization buffer (50 mM Tris-HCl (pH 8.0), 10 mM EDTA, 1 ug/ml leupeptin, 2 ug/ml aprotinin, 1 ug/ml pepstatin-A, 0.5 mM PMSF) containing 1% tergitol by homogenization and sonication. The insoluble material' of the suspension, containing inclusion bodies with the HAR-TX β2 protein, was pelleted by centrifugation and washed three times with solubilization buffer containing 0.5% tergitol (first wash), 1 M NaCl (second wash) , and buffer alone (third wash) .
The resulting pellet containing pre-purified inclusion bodies was dissolved in 6.5 M guanidine-HCl, 0.1 M Tris-HCl (pH 8.0), 5 mM EDTA; sonicated; and refolded by rapid dilution (100-fold) into 0.1 M Tris- HCl (pH 8.0), 1.3 M urea, 5 mM EDTA, 1 mM glutathione, and 0.1 mM oxidized glutathione at 4°C. The addition of the denaturating agent urea at low concentration was utilized to allow slow refolding and avoid the formation of aggregates. The refolded HAR-TX β2 protein was diluted 2-fold with 50 mM sodium phosphate (pH 7.0) and applied to a cation-exchange resin (POROS 50 HS, PerSeptive Biosystems, Cambridge, MA), pre- equilibrated in the same buffer. The HAR-TX β2 protein was eluted with a 450 nM NaCl step gradient in 50 mM sodium phosphate (pH 7.0) and fractions were analyzed using SDS-PAGE and Coomassie blue staining. Final purification of pooled fractions was performed by chromatography using Source 15S cation-exchange media (Pharmacia, Uppsala, Sweden) equilibrated with 50 mM sodium phosphate (pH 6.0) . Chimeric HAR-TX β2 protein was eluted with a gradient of 0-1 M NaCl in the same buffer and analyzed by SDS-PAGE.
14.1.4. ELISA Test for Determination of Binding Activity
Membranes from 5 x 107 MDA-MB-453 cells were prepared and coated to 96 well plates as previously described for H3396 human breast carcinoma cells (Siegall et al . , 1994, J. Immunol. 152:2377-2384) . Subsequently, the membranes were incubated with titrations of either HAR-TX β2 or PE40 ranging from 0.3 - 300 ug/ml and the mouse monoclonal anti-PE antibody EXA2-1H8 as the secondary reagent (Siegall et al . , supra ) . The isolate of the toxin portion PE40 alone was used to determine unspecific binding activity to the membrane preparations, in comparison with the specific binding activity of HAR-TX β2 . 14.1.5. Phosphotyrosine Analysis of transfected CEM cell lines
"CEM cells expressing various receptors of the
EGF-R family (1-5 x 106 cells) were stimulated with 500 ng/ml HAR-TX β2 for 5 minutes at room temperature.
The cells were pelleted and resuspended in 0.1 ml lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 5 mM MgCl2, 1% NP40, 0.5% deoxycholate, 0.1% sodium dodecylsulfate, 1 mM sodium orthovanadate) at 4°C. 0 Insoluble material was pelleted by centrifugation at
10,000 x g for 30 seconds, and samples were analyzed by SDS-PAGE and subsequent Western blot analysis using the anti-phosphotyrosine antibodies 4G10 (ICN, Irvine,
CA) and PY20 (Upstate Biotechnology, Lake Placid, New 5 York) .
14.1.6. Cytotoxicity Assays For cytotoxicity assays, tumor cells (105 cells/ml) in growth medium were added to 96-well flat _ bottom tissue culture plates (0.1 ml/well) and incubated at 37°C for 16 h. Cells were incubated with HAR-TX β2 for 48 h at 37°C, washed twice with phosphate buffered saline (PBS) , followed by addition of 200 μl/well of 1.5 μM calcein-AM (Molecular Probes Inc., 5 Eugene, OR) . The plates were incubated for 40 minutes at room temperature (RT) , and the fluorescence measured using a Fluorescence Concentration Analyzer (Baxter Heathcare Corp. , Mundelein, IL) at excitation/emission wavelengths of 485/530 nm. 0 Calcein-AM is membrane permeable and virtually non- fluorescent. When it is hydrolyzed by intracellular esterases, an intensely fluorescent product, calcein is formed. The % cytotoxicity was calculated as previously described (Siegall et al . , supra ) . To _ determine the specificity of the cytotoxic effect of HAR-TX β2 competitive assays were performed on LNCaP and on MDA-MB-453 cells. Treated essentially as described above, plates were incubated with increasing concentrations of HAR-TX β2 in presence heregulin 02- Ig (0.002-5.0 μg/ml) or with HAR-TX β2 (50 ng/ml) . Isotype matched L6-Ig (Hellstro et al . , 1986, Cancer Res. 46:3917-3923) was used as negative control for the competition assay.
14.1.7. Generation of Monoclonal Antibodies to HER4
HER , expressed in baculovirus, was used as the immunogen for subcutaneous injection into 4-6 week old female BALB/c mice. Immunization was performed 4 times (approximately 1 month apart) with 20 μg of HER4 protein given each time. Spleen cells from immunized mice were removed four days after the final immunization and fused with the mouse myeloma line P2x63-Ag8.653 as previously described (Siegall et al . , supra ) . Positive hybridoma supernatants were selected by ELISA screening on plates coated with HER4 transfected CHO cells (Plowman et al . , 1993, Nature 366:473-475) and selected against parental CHO cells and human fibroblasts. Secondary screening was performed by ELISA on plates coated with baculovirus/HER4 membranes. Positive hybridomas were rescreened by two additional rounds of ELISA using CHO/HER4 and HER4 negative cells, and identified false positive were removed. Positive hybridomas were cloned in soft agar and tested for reactivity with the HER4 positive MDA-MB-453 human breast carcinoma cell line and CEM cells co-transfected with HER4 and HER2. Anti-HER4 hybridoma line 6-4-11 (IgGl) was cloned in soft agar and screened for reactivity to native and denatured HER4. A second antibody (7-142, lgG2a) was also selected and found to bind to the cytoplasmic domain of HER4.
The characteristics for both antibodies are summarized in Table VI (see section 15.2.8., infra )
14.1.8. Quantitation of HER2, HER3, and HER4 Protein in tumor cell lines
Cell-surface expression of HER2, HER3, and HER4 protein was determined by quantification of specific antibody binding, detected by the CAS Red Chromagen system (Becton Dickson Cellular Imaging System, Elmhurst, IL) . HER2 staining was performed by using mouse anti-HER2 mAb 24.7 (Stancovski et al . , 1991, Proc. Natl. Acad. Sci. USA 88:8691-8695) as primary, and biotinylated goat anti-mouse IgG (Jackson Labs, West Grove, PA) as secondary antibody as previously described (Bacus et al . , 1993, Cancer Res. 53:5251- 5261) . For detection of HER3 and HER4 the primary antibodies used were, respectively, mouse anti-HER3 mAb RTJ2 (Santa Cruz Biotech, Santa Cruz, CA) at 2.5 μg/ml concentration or mouse anti-HER4 mAb 6-4-11 at 15 μg/ml concentration followed by incubation with biotinylated rabbit anti-mouse IgG (Zymed Labs, South San Francisco, CA) .
The staining procedure was performed at RT as follows: cells were fixed in 10% neutral buffered formalin for 60 minutes, washed with H20 and rinsed with Tris buffered saline (TBS; 0.05 M Tris, 0.15 M NaCl, pH 7.6). Unspecific binding sites were blocked by incubation with 10% goat serum (for HER2) or rabbit serum (for HER3 and HER4) in 0.1% bovine serum albumin/TBS for 15 minutes. Subsequently, cells were incubated with primary and secondary antibodies for 30 and 20 minutes, respectively, followed by incubation with alkaline phosphatase conjugated streptavidin (Jackson Labs) for 15 minutes, with TBS washing between the steps. Detection of antibody binding was achieved using CAS Red Chromagen (Becton Dickinson Cellular Imaging System, supra) for 4 minutes (HER2) , 8-10 minutes (HER3) , and 10-12 minutes (HER4) . Cells were counterstained as described in the CAS DNA stain protocol (Becton Dickinson Cellular Imaging System) .
14.1.9. Image Analysis Image analysis was performed as previously described (Bacus et ai . , 1993, supra ; Bacus et al . , 1992, Cancer Res. 52:2580-2589; Peles et al . , 1992, Cell 69:205-216) . In the quantitation of HER2 , both solid state imaging channels of the CAS 200 Image Analyzer (Becton Dickinson Cellular Imaging System) , a microscope-based, two-color system were used. The two imaging channels were specifically matched to the two components of the stains used. One channel was used for quantitating the total DNA of the cells in the field following Feulgen staining as described (Bacus et al . , 1990, Mol. Carcinoσ. 3:350-362) , and the other for quantitating the level of HER2, HER3 , and HER4 proteins following immunostaining. When the total DNA amount per cell was known, the average total HER2 , HER3 , and HER4 per cell were computed. Sparsely growing AU565 cells were used for calibrating the HER2 protein. Their level of staining was defined as 100% of HER2 protein content (1.0 relative amounts = 10,000 sum of optical density) ; all other measurements of HER2, HER3, and HER4 protein were related to this value.
14.1.10. Determination of the LD!0 of HAR-TX β2 For toxicity studies, HAR-TX β2 at different concentrations was administered intravenous in 0.2 ml PBS. Per group each two mice and two rats were injected.
14.2. RESULTS
14.2.1. Construction, Expression, and
Purification of HAR-TX β2
The HAR-TX β2 expression plasmid, encoding the hydrophilic leader sequence from amphiregulin (AR) , heregulin β2 , and PE40, under control of the IPTG inducible T7 promoter, was constructed as described in Section 15.1.2., supra , and is diagrammatically shown in FIG. 23, Panel 1. The AR leader sequence was added to the N-terminus of heregulin to facilitate the purification procedure (FIG. 23, Panel 2). FIG. 24A and 24B show the nucleotide sequence and the deduced amino acid sequence of the cDNA encoding HAR-TX -52 Chimeric HAR-TX β2 protein was expressed in E. coli of inclusion bodies. Recombinant protein was denatured and refolded as described in Section 15.1.2., supra, and applied to cation-exchange chromatography on a POROS HS column. Semi-purified HAR-TX β2 protein was detected by PAGE and Coomassie blue staining as major band migrating at 51 kDa (FIG. 25, lane 2) . The column flow-through from POROS HS contained only small amounts of HAR-TX β2 (FIG. 25, lane 3) . POROS HS chromatography resulted in >50% purity of HAR-TX β2 (FIG. 25, lane 4). Further purification, to >95% purity, was done by chromatography using Source 15S cation-exchange resin (FIG. 25, lane 5). The monomeric nature of purified HAR-TX β2 was determined by non-reducing SDS-PAGE (FIG. 25, lane 6) which exhibited the same migration pattern as under reducing conditions (FIG. 25, lane 5>' 14.2.2. Binding of HAR-TX β2 to MDA-MB-453 Cell Membranes
To determine the specific binding activity of HAR-TX β2 , an ELISA assay was performed using membranes of the HER4 positive human breast carcinoma cell line MDA-MB-453 as the target for binding. HAR- TX β2 was found to bind to the immobilized cell membranes in a dose-dependent fashion up to 300 μg/ml (FIG. 26) . PE40, the toxin component of HAR-TX β2 used as negative control, was unable to bind to MDA- MB-453 membranes.
14.2.3. Tyrosine Phosphorylation of HER Forms on Transfected CEM Cells
To test the biological activity of HAR-TX β2 a
HER4 receptor phosphorylation assay was performed as previously described for heregulin (Carraway et al . ,
1994, J- Biol. Chem. 269:14303-14306). CEM cells expressing different HER family members were exposed to HAR-TX β2 and stimulation of tyrosine phosphorylation was analyzed by phosphotyrosine immunoblot analysis (Section 4, supra ; Section
15.1.5., supra ) . As shown in FIG. 27, HAR-TX β2 induced tyrosine phosphorylation in CEM cells expressing HER4 either alone or together with HER2, but not in cells expressing only HER2 or HERl. This result demonstrates that HER4 is sufficient and necessary for induction of tyrosine phosphorylation in response to HAR-TX β2 , which is not true for HERl and for HER2. The fact that HAR-TX 02 does not induce tyrosine phosphorylation in CEM cells transfected with
HERl confirms that the hydrophilic leader sequence of amphiregulin does not affect the specificity of the v i heregulin moiety in its selective interaction between receptor family members.
14.2.4. Cytotoxicity of HAR-TX β2 Against Tumor Cells
The cell killing activity of HAR-TX β2 was determined against a variety of human cancer cell lines. AU565 and SKBR3 breast carcinomas and LNCaP prostate carcinoma were sensitive to HAR-TX β2 with EC50 values of 25, 20, 4.5 ng/ml, respectively, while SKOV3 ovarian carcinoma cells were insensitive to HAR- TX β2 (ECS0 >2000 ng/ml) (FIG. 28, Panel 1). Addition of heregulin 02-Ig to LNCaP cells reduced the cytotoxic activity of HAR-TX β2 (FIG. 28, Panel 2). In contrast, L6-Ig, a chimeric mouse-human antibody with a non-related specificity but matching human Fc domains (Hellstrόm et al . , supra ) , did not inhibit the HAR-TX 02 cytotoxic activity (FIG. 28, Panel 2). Thus, the cytotoxic effect of HAR-TX 02 was due to specific heregulin-mediated binding. Similar data were obtained using MDA-MB-453 cells (not shown) .
14.2.5. HER2, HER3, and HER4 Receptor Density on Human Tumor Cells: Correlation with HAR-TX 02- Mediated Cytotoxicity
To understand why cell lines differed in their sensitivity to HAR-TX 02, their levels of HER2, HER3, and HER4 were quantitated by image analysis (see Section 15.1.8. and 15.1.9., supra ) using receptor specific monoclonal antibodies (Table IV) . The data strongly indicate that HER4 expression is required for heregulin directed cytotoxic activity. All seven of the tumor cell lines which expressed detectable levels of HER4 were found to be sensitive to HAR-TX 02- mediated killing with ECS0 values ranging from 1-125 ng/ml. Moreover, the sensitivity of the different cell lines correlates directly with the expression level of HER4 : MCF-7 cells displaying the lowest detectable levels of HER4 were found to be the least sensitive (ECS0 = 125 ng/ml) of the cells which did respond. All four cell lines which were found to be devoid of any detectable HER4 expression on their surface were found to be resistant to HAR-TX 02. Three of them, SKOV3 , L2987 and H3396, displayed both HER2 and HER3 in the absence of HER .
TABLE IV
Comparative HER2 , HER3, and HER4 cell surface receptor density and cytotoxicity of HAR-TX 02 on human tumor cell lines
RELATIVE AMOUNTS
Figure imgf000108_0001
14.2.6. HAR-TX 02 Induces Tyrosine
Phosphorylation in Tumor Cells That Do Not Express HER4
In contrast to reports that heregulin directly binds to both HER3 and HER2/HER3 in a heterodimer configuration (Carraway et al . , 1994, J. Biol. Chem. 269:14303-14306; Sliwkowski et al . , 1994, J. Biol. Chem. 269:14661-15665), tumor cells that express HER3 alone (L2987) or co-express HER2 and HER3 (H3396 and SKOV3) were insensitive to HAR-TX 02. Direct interaction of H3396 and L2987 cells with the chimeric protein was determined by phosphotyrosine immunoblots following HAR-TX 02 induction. HAR-TX 02 was found to induce tyrosine phosphorylation in both tumor cell types (FIG. 29) similar to that previously seen in COS-7 cells transfected with HER2 and HER3 (Sliwkowski et al . , supra ) . SKOV3 cells were found to exhibit the same tyrosine phosphorylation pattern in the presence or absence of heregulin and thus direct interaction between receptors and heregulin could not be established (data not shown) . However, previous studies indicate that heregulin does not bind to these cells (Peles et al . , supra ) .
14.2.7. Toxicity of HAT-TX 02 For the toxicity studies, HAR-TX 02 was administered as described in section 15.1.10. In mice, 2/2 animals died at 2 mg/kg, 2/2 died at 1 mg/kg, 1/2 died at 0.75 mg/kg, and 0/2 died at 0.5 mg/kg, thus the LD50 is about 0.75 mg/kg (Table V). In rats the determined LDS; was slightly higher, as 50% of the animals died at 1 mg/kg (Table V) . TABLE V Toxicity of HAR-TX 02
Figure imgf000110_0001
14.2.8. Characteristics of HER4 Specific Monoclonal Antibodies The characteristics of the HER4 specific monoclonal antibodies disclosed herein are summarized in Table VI.
TABLE VI Characteristics of HER4 Antibodies
Abbreviations : Cyto , cytoplasmic domain ; ECD , extracellular domain; FACS , fluorescence-activated cell sorter analysis ; f ibro , f ibroblasts ; ICC, immunocytochemistry ; RIP, receptor immunoprecipitation ;
Figure imgf000110_0002
15. Microorganism and Cell Deposits
The following microorganisms and cell lines have been deposited with the American Type Culture Collection, and have been assigned the following accession numbers:
Microorganism Plasmid Accession Number E. coli SCS-1 PBSHER4Y 69131 (containing the complete human HER4 coding sequence)
Cell Line Accession Number
CHO/HER4 21-2 CRL11205
Hybridoma Cell line 6-4-11 HB11715 Hybridoma Cell line 7-142 HB11716
The present invention is not to be limited in scope by the microorganisms and cell lines deposited or the embodiments disclosed herein, which are intended as single illustrations of one aspect of the invention, and any which are functionally equivalent are within the scope of the invention. Indeed, various modifications of the invention, in addition to those shown and described herein, will become apparent to those skilled in the art from the foregoing description. Such modifications are intended to fall within the scope of the appended claims. All base pair and amino acid residue numbers and sizes given for polynucleotides and polypeptides are approximate and used for the purpose of description.
All publications and patent applications mentioned in this specification are indicative of the level of skill of those skilled in the art to which the invention pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. SEQUENCE LISTING
(1) GENERAL INFORMATION
(l) APPLICANTS Plowman, Gregory D
Culouscou, Jean-Michel Shoyab, Mohammed Siegall , Clay B Hellstrόm, Ingegerd Hellstrόm, Karl E
(ll) TITLE OF INVENTION HER4 HUMAN RECEPTOR TYROSI S KINASE
(ill) NUMBER OF SEQUENCES 42
(lv) CORRESPONDENCE ADDRESS
(A) ADDRESSEE Pennie & Edmonds
(B) STREET 1155 Avenue of the Americas
(C) CITY New York
(D) STATE New York
(E) COUNTRY U S A
(F) ZIP 10036-2711
(v) COMPUTER READABLE FORM
(A) MEDIUM TYPE Floppy disk
(B) COMPUTER IBM PC compatible
(C) OPERATING SYSTEM PC-DOS/MS-DOS
(D) SOFTWARE Patentin Release #1 0, Version =1 25
(vi) CURRENT APPLICATION DATA
(A) APPLICATION NUMBER To be assigned
(B) FILING DATE Concurrently herewith
(vii) PRIOR APPLICATION DATA
(A) APPLICATION NUMBER US 08/150,704
(B) FILING DATE 10-NOV-1993 (C) CLASSIFICATION
(vin) ATTORNEY/AGENT INFORMATION
(A) NAME Misrock, S Leslie
(B) REGISTRATION NUMBER 18,872
(C) REFERENCE/DOCKET NUMBER 5624-230
(IX) TELECOMMUNICATION INFORMATION
(A) TELEPHONE (212) 790-9090
(B) TELEFAX (212) 869-8864/9741
(C) TELEX 66141 PENNIE
(2) INFORMATION FOR SEQ ID NO 1
(l) SEQUENCE CHARACTERISTICS
(A) LENGTH 5501 base pairs
(B) TYPE nucleic acid
(C) STRANDEDNESS single
(D) TOPOLOGY linear
(ll) MOLECULE TYPE DNA (genomic)
(ix) FEATURE
(A) NAME/KEY CDS
(B) LOCATION 34 3961 - Ill - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1 :
AATTGTCAGC ACGGGATCTG AGACTTCCAA AAA ATG AAG CCG GCG ACA GGA CTT 54
Met Lys Pro Ala Thr Gly Leu
1 5
TGG GTC TGG GTG AGC CTT CTC GTG GCG GCG GGG ACC GTC CAG CCC AGC 102 Trp Val Trp Val Ser Leu Leu Val Ala Ala Gly Thr Val Gin Pro Ser 10 15 20
GAT TCT CAG TCA GTG TGT GCA GGA ACG GAG AAT AAA CTG AGC TCT CTC ISO Asp Ser Gin Ser Val Cys Ala Gly Thr Glu Asn Lys Leu Ser Ser Leu 25 30 35
TCT GAC CTG GAA CAG CAG TAC CGA GCC TTG CGC AAG TAC TAT GAA AAC 198 Ser Asp Leu Glu Gin Gin Tyr Arg Ala Leu Arg Lys Tyr Tyr Glu Asn 40 45 50 55
TGT GAG GTT GTC ATG GGC AAC CTG GAG ATA ACC AGC ATT GAG CAC AAC 246 Cys Glu Val Val Met Gly Asn Leu Glu He Thr Ser He Glu His Asn 60 65 70
CGG GAC CTC TCC TTC CTG CGG TCT GTT CGA GAA GTC ACA GGC TAC GTG 294 Arg Asp Leu Ser Phe Leu Arg Ser Val Arg Glu Val Thr Gly Tyr Val 75 80 85
TTA GTG GCT CTT AAT CAG TTT CGT TAC CTG CCT CTG GAG AAT TTA CGC 342 Leu Val Ala Leu Asn Gin Phe Arg Tyr Leu Pro Leu Glu Asn Leu Arg 90 95 100
ATT ATT CGT GGG ACA AAA CTT TAT GAG GAT CGA TAT GCC TTG GCA ATA 390 He He Arg Gly Thr Lys Leu Tyr Glu Asp Arg Tyr Ala Leu Ala He 105 110 115
TTT TTA AAC TAC AGA AAA GAT GGA AAC TTT GGA CTT CAA GAA CTT GGA 438 Phe Leu Asn Tyr Arg Lys Asp Gly Asn Phe Gly Leu Gin Glu Leu Gly 120 125 130 135
TTA AAG AAC TTG ACA GAA ATC CTA AAT GGT GGA GTC TAT GTA GAC CAG 486 Leu Lys Asn Leu Thr Glu He Leu Asn Gly Gly Val Tyr Val Asp Gin 140 145 150
AAC AAA TTC CTT TGT TAT GCA GAC ACC ATT CAT TGG CAA GAT ATT GTT 534 Asn Lys Phe Leu Cys Tyr Ala Asp Thr He His Trp Gin Asp He Val 155 160 165
CGG AAC CCA TGG CCT TCC AAC TTG ACT CTT GTG TCA ACA AAT GGT AGT 582 Arg Asn Pro Trp Pro Ser Asn Leu Thr Leu Val Ser Thr Asn Gly Ser 170 175 180 1B5
TCA GGA TGT GGA CGT TGC CAT AAG TCC TGT ACT GGC CGT TGC TGG GGA 630 Ser Gly Cys Gly Arg Cys His Lys Ser Cys Thr Gly Arg Cys Trp Gly
190 195
CCC ACA GAA AAT CAT TGC CAG ACT TTG ACA AGG ACG GTG TGT GCA GAA 678 Pro Thr Glu Asn His Cys Gin Thr Leu Thr Arg Thr Val Cys Ala Glu 200 205 210 215
CAA TGT GAC GGC AGA TGC TAC GGA CCT TAC GTC AGT GAC TGC TGC CAT 726 Gin Cys Asp Gly Arg Cys Tyr Gly Pro Tyr Val Ser Asp Cys Cys His 220 225 230
CGA GAA TGT GCT GGA GGC TGC TCA GGA CCT AAG GAC ACA GAC TGC TTT 774 Arg-Glu Cys Ala Gly Gly Cys Ser Gly Pro Lys Asp Thr Asp Cys Phe 235 240 245 GCC TGC ATG AAT TTC AAT GAC AGT GGA GCA TGT GTT ACT CAG TGT CCC 822 Ala Cys Met Asn Phe Asn Asp Ser Gly Ala Cys Val Thr Gin Cys Pro 250 255 260
CAA ACC TTT .GTC TAC AAT CCA ACC ACC TTT CAA CTG GAG CAC AAT TTC 870 Gin Thr Phe Val Tyr Asn Pro Thr Thr Phe Gin Leu Glu His Asn Phe 265 270 275
AAT GCA AAG TAC ACA TAT GGA GCA TTC TGT GTC AAG AAA TGT CCA CAT 918 Asn Ala Lys Tyr Thr Tyr Gly Ala Phe Cys Val Lys Lys Cys Pro His 280 285 290 295
AAC TTT GTG GTA GAT TCC AGT TCT TGT GTG CGT GCC TGC CCT AGT TCC 966 Asn Phe Val Val Asp Ser Ser Ser Cys Val Arg Ala Cys Pro Ser Ser 300 305 310
AAG ATG GAA GTA GAA GAA AAT GGG ATT AAA ATG TGT AAA CCT TGC ACT 1014 Lys Met Glu Val Glu Glu Asn Gly He Lys Met Cys Lys Pro Cys Thr 315 320 325
GAC ATT TGC CCA AAA GCT TGT GAT GGC ATT GGC ACA GGA TCA TTG ATG 1062 Asp He Cys Pro Lys Ala Cys Asp Gly He Gly Thr Gly Ser Leu Met 330 335 340
TCA GCT CAG ACT GTG GAT TCC AGT AAC ATT GAC AAA TTC ATA AAC TGT 1110 Ser Ala Gin Thr Val Asp Ser Ser Asn He Asp Lys Phe He Asn Cys 345 350 355
ACC AAG ATC AAT GGG AAT TTG ATC TTT CTA GTC ACT GGT ATT CAT GGG 1158 Thr Lys He Asn Gly Asn Leu He Phe Leu Val Thr Gly He His Gly
365 370 375
GAC CCT TAC AAT GCA ATT GAA GCC ATA GAC CCA GAG AAA CTG AAC GTC 1206 Asp Pro Tyr Asn Ala He Glu Ala He Asp Pro Glu Lys Leu Asn Val 380 385 390
TTT CGG ACA GTC AGA GAG ATA ACA GGT TTC CTG AAC ATA CAG TCA TGG 1254 Phe Arg Thr Val Arg Glu He Thr Gly Phe Leu Asn He Gin Ser Trp 395 400 405
CCA CCA AAC ATG ACT GAC TTC AGT GTT TTT TCT AAC CTG GTG ACC ATT 1302 Pro Pro Asn Met Thr Asp Phe Ser Val Phe Ser Asn Leu Val Thr He 410 415 420
GGT GGA AGA GTA CTC TAT AGT GGC CTG TCC TTG CTT ATC CTC AAG CAA 1350 Gly Gly Arg Val Leu Tyr Ser Gly Leu Ser Leu Leu He Leu Lys Gin 425 430 435
CAG GGC ATC ACC TCT CTA CAG TTC CAG TCC CTG AAG GAA ATC AGC GCA 1398 Gin Gly He Thr Ser Leu Gin Phe Gin Ser Leu Lys Glu He Ser Ala 440 445 450 455
GGA AAC ATC TAT ATT ACT GAC AAC AGC AAC CTG TGT TAT TAT CAT ACC 1446 Gly Asn He Tyr He Thr Asp Asn Ser Asn Leu Cys Tyr Tyr His Thr 460 465 470
ATT AAC TGG ACA ACA CTC TTC AGC ACA ATC AAC CAG AGA ATA GTA ATC 1494 He Asn Trp Thr Thr Leu Phe Ser Thr He Asn Gin Arg He Val He 475 480 485
CGG GAC AAC AGA AAA GCT GAA AAT TGT ACT GCT GAA GGA ATG GTG TGC 1542 Arg Asp Asn Arg Lys Ala Glu Asn Cys Thr Ala Glu Gly Met Val Cys 495 500
AAC-CAT CTG TGT TCC AGT GAT GGC TGT TGG GGA CCT GGG CCA GAC CAA 1590 Asn His Leu Cys Ser Ser Asp Gly Cys Trp Gly Pro Gly Pro Asp Gin 505 510 515 . 4
- 113 -
TGT CTG TCG TGT CGC CGC TTC AGT AGA GGA AGG ATC TGC ATA GAG TCT 1638 Cys Leu Ser Cys Arg Arg Phe Ser Arg Gly Arg He Cys He Glu Ser 520 525 530 535
TGT AAC CTC TAT GAT GGT GAA TTT CGG GAG TTT GAG AAT GGC TCC ATC 1686 Cys Asn Leu Tyr Asp Gly Glu Phe Arg Glu Phe Glu Asn Gly Ser He 540 545 550
TGT GTG GAG TGT GAC CCC CAG TGT GAG AAG ATG GAA GAT GGC CTC CTC 1734 Cys Val Glu Cys Asp Pro Gin Cys Glu Lys Met Glu Asp Gly Leu Leu 555 560 565
ACA TGC CAT GGA CCG GGT CCT GAC AAC TGT ACA AAG TGC TCT CAT TTT 1782 Thr Cys His Gly Pro Gly Pro Asp Asn Cys Thr Lys Cys Ser His Phe 570 575 580
AAA GAT GGC CCA AAC TGT GTG GAA AAA TGT CCA GAT GGC TTA CAG GGG 1830 Lys Asp Gly Pro Asn Cys Val Glu Lys Cys Pro Asp Gly Leu Gin Gly 585 590 595
GCA AAC AGT TTC ATT TTC AAG TAT GCT GAT CCA GAT CGG GAG TGC CAC 1878 Ala Asn Ser Phe He Phe Lys Tyr Ala Asp Pro Asp Arg Glu Cys His 600 605 610 615
CCA TGC CAT CCA AAC TGC ACC CAA GGG TGT AAC GGT CCC ACT AGT CAT 1926 Pro Cys His Pro Asn Cys Thr Gin Gly Cys Asn Gly Pro Thr Ser His 620 625 630
GAC TGC ATT TAC TAC CCA TGG ACG GGC CAT TCC ACT TTA CCA CAA CAT 1974 Asp Cys He Tyr Tyr Pro Trp Thr Gly His Ser Thr Leu Pro Gin His 635 640 645
GCT AGA ACT CCC CTG ATT GCA GCT GGA GTA ATT GGT GGG CTC TTC ATT 2022 Ala Arg Thr Pro Leu He Ala Ala Gly Val He Gly Gly Leu Phe He 650 655 660
CTG GTC ATT GTG GGT CTG ACA TTT GCT GTT TAT GTT AGA AGG AAG AGC 2070 Leu Val He Val Gly Leu Thr Phe Ala Val Tyr Val Arg Arg Lys Ser 665 670 675
ATC AAA AAG AAA AGA GCC TTG AGA AGA TTC TTG GAA ACA GAG TTG GTG 2118 He Lys Lys Lys Arg Ala Leu Arg Arg Phe Leu Glu Thr Glu Leu Val 680 6B5 690 695
GAA CCA TTA ACT CCC AGT GGC ACA GCA CCC AAT CAA GCT CAA CTT CGT 2166 Glu Pro Leu Thr Pro Ser Gly Thr Ala Pro Asn Gin Ala Gin Leu Arg 700 705 710
ATT TTG AAA GAA ACT GAG CTG AAG AGG GTA AAA GTC CTT GGC TCA GGT 2214 He Leu Lys Glu Thr Glu Leu Lys Arg Val Lys Val Leu Gly Ser Gly 715 720 725
GCT TTT GGA ACG GTT TAT AAA GGT ATT TGG GTA CCT GAA GGA GAA ACT 2262 Ala Phe Gly Thr Val Tyr Lys Gly He Trp Val Pro Glu Gly Glu Thr 730 735 740
GTG AAG ATT CCT GTG GCT ATT AAG ATT CTT AAT GAG ACA ACT GGT CCC 2310 Val Lys He Pro Val Ala He Lys He Leu Asn Glu Thr Thr Gly Pro 745 750 755
AAG GCA AAT GTG GAG TTC ATG GAT GAA GCT CTG ATC ATG GCA AGT ATG 2358 Lys Ala Asn Val Glu Phe Met Asp Glu Ala Leu He Met Ala Ser Met
765 770 775
GAT CAT CCA CAC CTA GTC CGG TTG CTG GGT GTG TGT CTG AGC CCA ACC 2406 Asp His Pro His Leu Val Arg Leu Leu Gly Val Cys Leu Ser Pro Thr 780 785 790 ATC CAG CTG GTT ACT CAA CTT ATG CCC CAT GGC TGC CTG TTG GAG TAT 2454 He Gin Leu Val Thr Gin Leu Met Pro His Gly Cys Leu Leu Glu Tyr 795 800 805
GTC CAC GAG CAC AAG GAT AAC ATT GGA TCA CAA CTG CTG CTT AAC TGG 2502 Val His Glu His Lys Asp Asn He Gly Ser Gin Leu Leu Leu Asn Trp BIO 815 820
TGT GTC CAG ATA GCT AAG GGA ATG ATG TAC CTG GAA GAA AGA CGA CTC 2550 Cys Val Gin He Ala Lys Gly Met Met Tyr Leu Glu Glu Arg Arg Leu 825 830 835
GTT CAT CGG GAT TTG GCA GCC CGT AAT GTC TTA GTG AAA TCT CCA AAC 2598 Val His Arg Asp Leu Ala Ala Arg Asn Val Leu Val Lys Ser Pro Asn 840 845 850 855
CAT GTG AAA ATC ACA GAT TTT GGG CTA GCC AGA CTC TTG GAA GGA GAT 2646 His Val Lys He Thr Asp Phe Gly Leu Ala Arg Leu Leu Glu Gly Asp 860 865 870
GAA AAA GAG TAC AAT GCT GAT GGA GGA AAG ATG CCA ATT AAA TGG ATG 2694 Glu Lys Glu Tyr Asn Ala Asp Gly Gly Lys Met Pro He Lys Trp Met 875 880 885
GCT CTG GAG TGT ATA CAT TAC AGG AAA TTC ACC CAT CAG AGT GAC GTT 2742 Ala Leu Glu Cys He His Tyr Arg Lys Phe Thr His Gin Ser Asp Val 890 895 900
TGG AGC TAT GGA GTT ACT ATA TGG GAA CTG ATG ACC TTT GGA GGA AAA 2790 Trp Ser Tyr Gly Val Thr He Trp Glu Leu Met Thr Phe Gly Gly Lys 905 910 915
CCC TAT GAT GGA ATT CCA ACG CGA GAA ATC CCT GAT TTA TTA GAG AAA 2838 Pro Tyr Asp Gly He Pro Thr Arg Glu He Pro Asp Leu Leu Glu Lys 920 925 930 935
GGA GAA CGT TTG CCT CAG CCT CCC ATC TGC ACT ATT GAC GTT TAC ATG 2886 Gly Glu Arg Leu Pro Gin Pro Pro He Cys Thr He Asp Val Tyr Met 940 945 950
GTC ATG GTC AAA TGT TGG ATG ATT GAT GCT GAC AGT AGA CCT AAA TTT 2934 Val Met Val Lys Cys Trp Met He Asp Ala Asp Ser Arg Pro Lys Phe 955 960 965
AAG GAA CTG GCT GCT GAG TTT TCA AGG ATG GCT CGA GAC CCT CAA AGA 2982 Lys Glu Leu Ala Ala Glu Phe Ser Arg Met Ala Arg Asp Pro Gin Arg 970 975 980
TAC CTA GTT ATT CAG GGT GAT GAT CGT ATG AAG CTT CCC AGT CCA AAT 3030 Tyr Leu Val He Gin Gly Asp Asp Arg Met Lys Leu Pro Ser Pro Asn 9B5 990 995
GAC AGC AAG TTC TTT CAG AAT CTC TTG GAT GAA GAG GAT TTG GAA GAT 3078 Asp Ser Lys Phe Phe Gin Asn Leu Leu Asp Glu Glu Asp Leu Glu Asp 1000 1005 1010 1015
ATG ATG GAT GCT GAG GAG TAC TTG GTC CCT CAG GCT TTC AAC ATC CCA 3126 Met Met Asp Ala Glu Glu Tyr Leu Val Pro Gin Ala Phe Asn He Pro 1020 1025 1030
CCT CCC ATC TAT ACT TCC AGA GCA AGA ATT GAC TCG AAT AGG AGT GAA 3174 Pro Pro He Tyr Thr Ser Arg Ala Arg He Asp Ser Asn Arg Ser Glu 1035 1040 1045
ATT- GGA CAC AGC CCT CCT CCT GCC TAC ACC CCC ATG TCA GGA AAC CAG 3222 He Gly His Ser Pro Pro Pro Ala Tyr Thr Pro Met Ser Gly Asn Gin 1055 1060 TTT GTA TAC CGA GAT GGA GGT TTT GCT GCT GAA CAA GGA GTG TCT GTG 3270 Phe Val Tyr Arg Asp Gly Gly Phe Ala Ala Glu Gin Gly Val Ser Val 1070 1075
CCC TAC AGA- GCC CCA ACT AGC ACA ATT CCA GAA GCT CCT GTG GCA CAG 3318 Pro Tyr Arg Ala Pro Thr Ser Thr He Pro Glu Ala Pro Val Ala Gin 1080 1085 1090 1095
GGT GCT ACT GCT GAG ATT TTT GAT GAC TCC TGC TGT AAT GGC ACC CTA 3366 Gly Ala Thr Ala Glu He Phe Asp Asp Ser Cys Cys Asn Gly Thr Leu 1100 1105 1110
CGC AAG CCA GTG GCA CCC CAT GTC CAA GAG GAC AGT AGC ACC CAG AGG 3414 Arg Lys Pro Val Ala Pro His Val Gin Glu Asp Ser Ser Thr Gin Arg 1115 1120 1125
TAC AGT GCT GAC CCC ACC GTG TTT GCC CCA GAA CGG AGC CCA CGA GGA 3462 Tyr Ser Ala Asp Pro Thr Val Phe Ala Pro Glu Arg Ser Pro Arg Gly 1135 1140
GAG CTG GAT GAG GAA GGT TAC ATG ACT CCT ATG CGA GAC AAA CCC AAA 3510 Glu Leu Asp Glu Glu Gly Tyr Met Thr Pro Met Arg Asp Lys Pro Lys 1150 1155
CAA GAA TAC CTG AAT CCA GTG GAG GAG AAC CCT TTT GTT TCT CGG AGA 3558 Gin Glu Tyr Leu Asn Pro Val Glu Glu Asn Pro Phe Val Ser Arg Arg 1165 1170 1175
AAA AAT GGA GAC CTT CAA GCA TTG GAT AAT CCC GAA TAT CAC AAT GCA 3606 Lys Asn Gly Asp Leu Gin Ala Leu Asp Asn Pro Glu Tyr His Asn Ala 1180 1185 1190
TCC AAT GGT CCA CCC AAG GCC GAG GAT GAG TAT GTG AAT GAG CCA CTG 3654 Ser Asn Gly Pro Pro Lys Ala Glu Asp Glu Tyr Val Asn Glu Pro Leu 1195 1200 1205
TAC CTC AAC ACC TTT GCC AAC ACC TTG GGA AAA GCT GAG TAC CTG AAG 3702 Tyr Leu Asn Thr Phe Ala Asn Thr Leu Gly Lys Ala Glu Tyr Leu Lys 1215 1220
AAC AAC ATA CTG TCA ATG CCA GAG AAG GCC AAG AAA GCG TTT GAC AAC 3750 Asn Asn He Leu Ser Met Pro Glu Lys Ala Lys Lys Ala Phe Asp Asn 1230 1235
CCT GAC TAC TGG AAC CAC AGC CTG CCA CCT CGG AGC ACC CTT CAG CAC 3798 Pro Asp Tyr Trp Asn His Ser Leu Pro Pro Arg Ser Thr Leu Gin His 1245 1250 1255
CCA GAC TAC CTG CAG GAG TAC AGC ACA AAA TAT TTT TAT AAA CAG AAT 3846 Pro Asp Tyr Leu Gin Glu Tyr Ser Thr Lys Tyr Phe Tyr Lys Gin Asn 1260 1265 1270
GGG CGG ATC CGG CCT ATT GTG GCA GAG AAT CCT GAA TAC CTC TCT GAG 3894 Gly Arg He Arg Pro He Val Ala Glu Asn Pro Glu Tyr Leu Ser Glu 1275 1280 1285
TTC TCC CTG AAG CCA GGC ACT GTG CTG CCG CCT CCA CCT TAC AGA CAC 3942 Phe Ser Leu Lys Pro Gly Thr Val Leu Pro Pro Pro Pro Tyr Arg His 1295 1300
CGG AAT ACT GTG GTG TAAGCTCAGT TGTGGTTTTT TAGGTGGAGA GACACACCTG 3997 Arg Asn Thr Val Val
CTCCAATTTC CCCACCCCCC TCTCTTTCTC TGGTGGTCTT CCTTCTACCC CAAGGCCAGT 4057 AGTTTTGACA CTTCCCAGTG GAAGATACAG AGATGCAATG ATAGTTATGT GCTTACCTAA 4117 CTTGAACATT AGAGGGAAAG ACTGAAAGAG AAAGATAGGA GGAACCACAA TGTTTCTTCA 4177
TTTCTCTGCA TGGGTTGGTC AGGAGAATGA AACAGCTAGA GAAGGACCAG AAAATGTAAG 4237
GCAATGCTGC CTACTATCAA ACTAGCTGTC ACTTTTTTTC τττττcττττ TCTTTCTTTG 4297
TTTCTTTCTT CCTCTTCTTT TTTTTTTTTT TTTTAAAGCA GATGGTTGAA ACACCCATGC 4357
TATCTGTTCC TATCTGCAGG AACTGATGTG TGCATATTTA GCATCCCTGG AAATCATAAT 4417
AAAGTTTCCA TTAGAACAAA AGAATAACAT TTTCTATAAC ATATGATAGT GTCTGAAATT 4477
GAGAATCCAG TTTCTTTCCC CAGCAGTTTC TGTCCTAGCA AGTAAGAATG GCCAACTCAA 4537
CTTTCATAAT TTAAAAATCT CCATTAAAGT TATAACTAGT AATTATGTTT TCAACACTTT 4597
TTGGTTTTTT TCATTTTGTT TTGCTCTGAC CGATTCCTTT ATATTTGCTC CCCTATTTTT 4657
GGCTTTAATT TCTAATTGCA AAGATGTTTA CATCAAAGCT TCTTCACAGA ATTTAAGCAA 4717
GAAATATTTT AATATAGTGA AATGGCCACT ACTTTAAGTA TACAATCTTT AAAATAAGAA 4777
AGGGAGGCTA ATATTTTTCA TGCTATCAAA TTATCTTCAC CCTCATCCTT TACATTTTTC 4837
AACATTTTTT TTTCTCCATA AATGACACTA CTTGATAGGC CGTTGGTTGT CTGAAGAGTA 4897
GAAGGGAAAC TAAGAGACAG TTCTCTGTGG TTCAGGAAAA CTACTGATAC TTTCAGGGGT 4957
GGCCCAATGA GGGAATCCAT TGAACTGGAA GAAACACACT GGATTGGGTA TGTCTACCTG 5017
GCAGATACTC AGAAATGTAG TTTGCACTTA AGCTGTAATT TTATTTGTTC TTTTTCTGAA 5077
CTCCATTTTG GATTTTGAAT CAAGCAATAT GGAAGCAACC AGCAAATTAA CTAATTTAAG 5137
TACATTTTTA AAAAAAGAGC TAAGATAAAG ACTGTGGAAA TGCCAAACCA AGCAAATTAG 5197
GAACCTTGCA ACGGTATCCA GGGACTATGA TGAGAGGCCA GCACATTATC TTCATATGTC 5257
ACCTTTGCTA CGCAAGGAAA TTTGTTCAGT TCGTATACTT CGTAAGAAGG AATGCGAGTA 5317
AGGATTGGCT TGAATTCCAT GGAATTTCTA GTATGAGACT ATTTATATGA AGTAGAAGGT 5377
AACTCTTTGC ACATAAATTG GTATAATAAA AAGAAAAACA CAAACATTCA AAGCTTAGGG 5437
ATAGGTCCTT GGGTCAAAAG TTGTAAATAA ATGTGAAACA TCTTCTCAAA AAAAAAAAAA 5497
AAAA 5501
(2) INFORMATION FOR SEQ ID NO:2 :
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1308 amino acids
(B) TYPE: amino acid (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2 :
Met Lys Pro Ala Thr Gly Leu Trp Val Trp Val Ser Leu Leu Val Ala 1 5 10 15
Ala Gly Thr Val Gin Pro Ser Asp Ser Gin Ser Val Cys Ala Gly Thr 20 25 30
Glu Asn Lys Leu Ser Ser Leu Ser Asp Leu Glu Gin Gin Tyr Arg Ala 35 40 4 5
Leu Arg Lys Tyr Tyr Glu Asn Cys Glu Val Val Met Gly Asn Leu Glu 50 55 60
He Thr Ser He Glu His Asn Arg Asp Leu Ser Phe Leu Arg Ser Val 65 70 75 80
Arg Glu Val Thr Gly Tyr Val Leu Val Ala Leu Asn Gin Phe Arg Tyr 85 90 95
Leu Pro Leu Glu Asn Leu Arg He He Arg Gly Thr Lys Leu Tyr Glu 100 105 110
Asp Arg Tyr Ala Leu Ala He Phe Leu Asn Tyr Arg Lys Asp Gly Asn 115 120 125
Phe Gly Leu Gin Glu Leu Gly Leu Lys Asn Leu Thr Glu He Leu Asn 130 135 140
Gly Gly Val Tyr Val Asp Gin Asn Lys Phe Leu Cys Tyr Ala Asp Thr 145 150 155 160
He His Trp Gin Asp He Val Arg Asn Pro Trp Pro Ser Asn Leu Thr 165 170 175
Leu Val Ser Thr Asn Gly Ser Ser Gly Cys Gly Arg Cys His Lys Ser 180 185 190
Cys Thr Gly Arg Cys Trp Gly Pro Thr Glu Asn His Cys Gin Thr Leu 195 200 205
Thr Arg Thr Val Cys Ala Glu Gin Cys Asp Gly Arg Cys Tyr Gly Pro 210 215 220
Tyr Val Ser Asp Cys Cys His Arg Glu Cys Ala Gly Gly Cys Ser Gly 225 230 235 240
Pro Lys Asp Thr Asp Cys Phe Ala Cys Met Asn Phe Asn Asp Ser Gly 245 250 255
Ala Cys Val Thr Gin Cys Pro Gin Thr Phe Val Tyr Asn Pro Thr Thr 260 265 270
Phe Gin Leu Glu His Asn Phe Asn Ala Lys Tyr Thr Tyr Gly Ala Phe 275 280 285
Cys Val Lys Lys Cys Pro His Asn Phe Val Val Asp Ser Ser Ser Cys 290 295 300
Val Arg Ala Cys Pro Ser Ser Lys Met Glu Val Glu Glu Asn Gly He 305 310 315 320
Lys Met Cys Lys Pro Cys Thr Asp He Cys Pro Lys Ala Cys Asp Gly 325 330 335
He Gly Thr Gly Ser Leu Met Ser Ala Gin Thr Val Asp Ser Ser Asn 340 345 350
He Asp Lys Phe He Asn Cys Thr Lys He Asn Gly Asn Leu He Phe 355 360 365
Leu Val Thr Gly He His Gly Asp Pro Tyr Asn Ala He Glu Ala He 370 375 380
Asp Pro Glu Lys Leu Asn Val Phe Arg Thr Val Arg Glu He Thr Gly 3B5 390 395 400 Phe Leu Asn He Gin Ser Trp Pro Pro Asn Met Thr Asp Phe Ser Val 405 410 415
Phe Ser Asn Leu Val Thr He Gly Gly Arg Val Leu Tyr Ser Gly Leu 420 425 430
Ser Leu Leu He Leu Lys Gin Gin Gly He Thr Ser Leu Gin Phe Gin 435 440 445
Ser Leu Lys Glu He Ser Ala Gly Asn He Tyr He Thr Asp Asn Ser 450 455 460
Asn Leu Cys Tyr Tyr His Thr He Asn Trp Thr Thr Leu Phe Ser Thr 465 470 475 480
He Asn Gin Arg He Val He Arg Asp Asn Arg Lys Ala Glu Asn Cys 485 490 495
Thr Ala Glu Gly Met Val Cys Asn His Leu Cys Ser Ser Asp Gly Cys 500 505 510
Trp Gly Pro Gly Pro Asp Gin Cys Leu Ser Cys Arg Arg Phe Ser Arg 515 520 525
Gly Arg He Cys He Glu Ser Cys Asn Leu Tyr AΞD Gly Glu Phe Arg 530 535 540
Glu Phe Glu Asn Gly Ser He Cys Val Glu Cys AΞD Pro Gin Cys Glu 545 550 555 " 560
Lys Met Glu Asp Gly Leu Leu Thr Cys His Gly Pro Gly Pro Asp Asn 565 570 575
Cys Thr Lys Cys Ser His Phe Lys Asp Gly Pro Asn Cys Val Glu Lys 580 585 590
Cys Pro Asp Gly Leu Gin Gly Ala Asn Ser Phe He Phe Lys Tyr Ala 595 600 605
Asp Pro Asp Arg Glu Cys His Pro Cys His Pro Asn Cvs Thr Gin Gly 610 615 620
Cys Asn Gly Pro Thr Ser His Asp Cys He Tyr Tyr Pro Trp Thr Gly 625 630 635 ' 640
His Ser Thr Leu Pro Gin His Ala Arg Thr Pro Leu He Ala Ala Gly 645 650 655
Val He Gly Gly Leu Phe He Leu Val He Val Gly Leu Thr Phe Ala 660 665 670
Val Tyr Val Arg Arg Lys Ser He Lys Lys Lys Arg Ala Leu Arg Arg 675 680 6Θ5
Phe Leu Glu Thr Glu Leu Val Glu Pro Leu Thr Pro Ser Gly Thr Ala 690 695 700
Pro Asn Gin Ala Gin Leu Arg He Leu Lys Glu Thr Glu Leu Lys Arg 705 710 715 720
Val Lys Val Leu Gly Ser Gly Ala Phe Gly Thr Val Tyr Lys Gly He 725 730 735
Trp Val Pro Glu Gly Glu Thr Val Lys He Pro Val Ala He Lys He 740 745 750
Leu Asn Glu Thr Thr Gly Pro Lys Ala Asn Val Glu Phe Met Asp Glu 755 760 765
Ala Leu He Met Ala Ser Met Asp His Pro His Leu Val Arg Leu Leu 770 775 780
Gly Val Cys Leu Ser Pro Thr He Gin Leu Val Thr Gin Leu Met Pro 785 790 795 800
His Gly Cys Leu Leu Glu Tyr Val His Glu His Lys Asp Asn He Gly 805 810 815
Ser Gin Leu Leu Leu Asn Trp Cys Val Gin He Ala Lys Gly Met Met 820 825 830
Tyr Leu Glu Glu Arg Arg Leu Val His Arg Asp Leu Ala Ala Arg Asn 835 840 845
Val Leu Val Lys Ser Pro Asn His Val Lys He Thr Asp Phe Gly Leu 850 855 860
Ala Arg Leu Leu Glu Gly Asp Glu Lys Glu Tyr Asn Ala Asp Gly Gly 865 870 875 880
Lys Met Pro He Lys Trp Met Ala Leu Glu Cys He His Tyr Arg Lys 8B5 890 895
Phe Thr His Gin Ser Asp Val Trp Ser Tyr Gly Val Thr He Trp Glu 900 905 910
Leu Met Thr Phe Gly Gly Lys Pro Tyr Asp Gly He Pro Thr Arg Glu 915 920 925
He Pro Asp Leu Leu Glu Lys Gly Glu Arg Leu Pro Gin Pro Pro He 930 935 940
Cys Thr He Asp Val Tyr Met Val Met Val Lys Cys Trp Met He Asp 945 950 955 960
Ala Asp Ser Arg Pro Lys Phe Lys Glu Leu Ala Ala Glu Phe Ser Arg 965 970 975
Met Ala Arg Asp Pro Gin Arg Tyr Leu Val He Gin Gly Asp Asp Arg 980 985 990
Met Lys Leu Pro Ser Pro Asn Asp Ser Lys Phe Phe Gin Asn Leu Leu 995 1000 1005
Asp Glu Glu Asp Leu Glu Asp Met Met Aso Ala Glu Glu Tyr Leu Val 1010 1015 " 1020
Pro Gin Ala Phe Asn He Pro Pro Pro He Tyr Thr Ser Arg Ala Arg 1025 1030 1035 1040
He Asp Ser Asn Arg Ser Glu He Gly His Ser Pro Pro Pro Ala Tyr 1045 1050 1055
Thr Pro Met Ser Gly Asn Gin Phe Val Tyr Arg Asp Gly Gly Phe Ala 1060 1065 1070
Ala Glu Gin Gly Val Ser Val Pro Tyr Arg Ala Pro Thr Ser Thr He 1075 1080 1085
Pro Glu Ala Pro Val Ala Gin Gly Ala Thr Ala Glu He Phe Asp Asp 1090 1095 1100
Ser Cys Cys Asn Gly Thr Leu Arg Lys Pro Val Ala Pro His Val Gin 1105 1110 1115 1120 Glu Asp Ser Ser Thr Gin Arg Tyr Ser Ala Asp Pro Thr Val Phe Ala 1125 1130 1135
Pro Glu Arg Ser Pro Arg Gly Glu Leu Asp Glu Glu Gly Tyr Met Thr 1140 1145 1150
Pro Met Arg Asp Lys Pro Lys Gin Glu Tyr Leu Asn Pro Val Glu Glu 1155 1160 1165
Asn Pro Phe Val Ser Arg Arg Lys Asn Gly Asp Leu Gin Ala Leu Asp 1170 1175 1180
Asn Pro Glu Tyr His Asn Ala Ser Asn Gly Pro Pro Lys Ala Glu Asp 1185 1190 1195 1200
Glu Tyr Val Asn Glu Pro Leu Tyr Leu Asn Thr Phe Ala Asn Thr Leu 1205 1210 1215
Gly Lys Ala Glu Tyr Leu Lys Asn Asn He Leu Ser Met Pro Glu Lys 1220 1225 1230
Ala Lys Lys Ala Phe Asp Asn Pro Asp Tyr Trp Asn His Ser Leu Pro 1235 1240 1245
Pro Arg Ser Thr Leu Gin His Pro Asp Tyr Leu Gin Glu Tyr Ser Thr 1250 1255 1260
Lys Tyr Phe Tyr Lys Gin Asn Gly Arg He Arg Pro He Val Ala Glu 1265 1270 1275 1280
Asn Pro Glu Tyr Leu Ser Glu Phe Ser Leu Lys Pro Gly Thr Val Leu 1285 1290 1295
Pro Pro Pro Pro Tyr Arg His Arg Asn Thr Val Val 1300 1305
(2) INFORMATION FOR SEQ ID NO:3 :
(l) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5555 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS : single
(D) TOPOLOGY: unknown
(ll) MOLECULE TYPE: DNA (genomic)
(IX) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 34..3210
(Xl) SEQUENCE DESCRIPTION: SEQ ID NO: 3.
AATTGTCAGC ACGGGATCTG AGACTTCCAA AAA ATG AAG CCG GCG ACA GGA CTT
Met Lys Pro Ala Thr Gly Leu
TGG GTC TGG GTG AGC CTT CTC GTG GCG GCG GGG ACC GTC CAG CCC AGC 102
Trp Val Trp Val Ser Leu Leu Val Ala Ala Gly Thr Val Gin Pro Ser
15 20
GAT TCT CAG TCA GTG TGT GCA GGA ACG GAG AAT AAA CTG AGC TCT CTC 150
Asp Ser Gin Ser Val Cys Ala Gly Thr Glu Asn Lys Leu Ser Ser Leu
30 35 TCT GAC CTG GAA CAG CAG TAC CGA GCC TTG CGC AAG TAC TAT GAA AAC 198
Ser Asp Leu Glu Gin Gin Tyr Arg Ala Leu Arg Lys Tyr Tyr Glu Asn 45 50 55
TGT GAG GTT. GTC ATG GGC AAC CTG GAG ATA ACC AGC ATT GAG CAC AAC 246
Cys Glu Val Val Met Gly Asn Leu Glu He Thr Ser He Glu His Asn 60 65 70
CGG GAC CTC TCC TTC CTG CGG TCT GTT CGA GAA GTC ACA GGC TAC GTG 294
Arg Asp Leu Ser Phe Leu Arg Ser Val Arg Glu Val Thr Gly Tyr Val 75 80 85
TTA GTG GCT CTT AAT CAG TTT CGT TAC CTG CCT CTG GAG AAT TTA CGC 342
Leu Val Ala Leu Asn Gin Phe Arg Tyr Leu Pro Leu Glu Asn Leu Arg 95 100
ATT ATT CGT GGG ACA AAA CTT TAT GAG GAT CGA TAT GCC TTG GCA ATA 390
He He Arg Gly Thr Lys Leu Tyr Glu Asp Arg Tyr Ala Leu Ala He 110 115
TTT TTA AAC TAC AGA AAA GAT GGA AAC TTT GGA CTT CAA GAA CTT GGA 438
Phe Leu Asn Tyr Arg Lys Asp Gly Asn Phe Gly Leu Gin Glu Leu Gly 125 130 135
TTA AAG AAC TTG ACA GAA ATC CTA AAT GGT GGA GTC TAT GTA GAC CAG 486
Leu Lys Asn Leu Thr Glu He Leu Asn Gly Gly Val Tyr Val Asp Gin 140 145 150
AAC AAA TTC CTT TGT TAT GCA GAC ACC ATT CAT TGG CAA GAT ATT GTT 534
Asn Lys Phe Leu Cys Tyr Ala Asp Thr He His Trp Gin Asp He Val 155 160 165
CGG AAC CCA TGG CCT TCC AAC TTG ACT CTT GTG TCA ACA AAT GGT AGT 582
Arg Asn Pro Trp Pro Ser Asn Leu Thr Leu Val Ser Thr Asn Gly Ser 175 180
TCA GGA TGT GGA CGT TGC CAT AAG TCC TGT ACT GGC CGT TGC TGG GGA 630
Ser Gly Cys Gly Arg Cys His Lys Ser Cys Thr Gly Arg Cys Trp Gly 190 195
CCC ACA GAA AAT CAT TGC CAG ACT TTG ACA AGG ACG GTG TGT GCA GAA 678
Pro Thr Glu Asn His Cys Gin Thr Leu Thr Arg Thr Val Cys Ala Glu 205 210 215
CAA TGT GAC GGC AGA TGC TAC GGA CCT TAC GTC AGT GAC TGC TGC CAT 726
Gin Cys Asp Gly Arg Cys Tyr Gly Pro Tyr Val Ser Asp Cys Cys His 220 225 230
CGA GAA TGT GCT GGA GGC TGC TCA GGA CCT AAG GAC ACA GAC TGC TTT 774
Arg Glu Cys Ala Gly Gly Cys Ser Gly Pro Lys Asp Thr Asp Cys Phe 235 240 245
GCC TGC ATG AAT TTC AAT GAC AGT GGA GCA TGT GTT ACT CAG TGT CCC 822
Ala Cys Met Asn Phe Asn Asp Ser Gly Ala Cys Val Thr Gin Cys Pro 255 260
CAA ACC TTT GTC TAC AAT CCA ACC ACC TTT CAA CTG GAG CAC AAT TTC 870
Gin Thr Phe Val Tyr Asn Pro Thr Thr Phe Gin Leu Glu His Asn Phe 270 275
AAT GCA AAG TAC ACA TAT GGA GCA TTC TGT GTC AAG AAA TGT CCA CAT 918
Asn Ala Lys Tyr Thr Tyr Gly Ala Phe Cys Val Lys Lys Cys Pro His 285 290 295
AAC.TTT GTG GTA GAT TCC AGT TCT TGT GTG CGT GCC TGC CCT AGT TCC 966
Asn Phe Val Val Asp Ser Ser Ser Cys Val Arg Ala Cys Pro Ser Ser 300 305 310 AAG ATG GAA GTA GAA GAA AAT GGG ATT AAA ATG TGT AAA CCT TGC ACT 1014 Lys Met Glu Val Glu Glu Asn Gly He Lys Met Cys Lys Pro Cys Thr 315 320 325
GAC ATT TGC, CCA AAA GCT TGT GAT GGC ATT GGC ACA GGA TCA TTG ATG 1062 Asp He Cys Pro Lys Ala Cys Asp Gly He Gly Thr Gly Ser Leu Met 335 340
TCA GCT CAG ACT GTG GAT TCC AGT AAC ATT GAC AAA TTC ATA AAC TGT 1110 Ser Ala Gin Thr Val Asp Ser Ser Asn He Asp Lys Phe He Asn Cys 350 355
ACC AAG ATC AAT GGG AAT TTG ATC TTT CTA GTC ACT GGT ATT CAT GGG 1158 Thr Lys He Asn Gly Asn Leu He Phe Leu Val Thr Gly He His Gly 365 370 375
GAC CCT TAC AAT GCA ATT GAA GCC ATA GAC CCA GAG AAA CTG AAC GTC 1206 Asp Pro Tyr Asn Ala He Glu Ala He Asp Pro Glu Lys Leu Asn Val 380 385 390
TTT CGG ACA GTC AGA GAG ATA ACA GGT TTC CTG AAC ATA CAG TCA TGG 1254 Phe Arg Thr Val Arg Glu He Thr Gly Phe Leu Asn He Gin Ser Trp 395 400 405
CCA CCA AAC ATG ACT GAC TTC AGT GTT TTT TCT AAC CTG GTG ACC ATT 1302 Pro Pro Asn Met Thr Asp Phe Ser Val Phe Ser Asn Leu Val Thr He 415 420
GGT GGA AGA GTA CTC TAT AGT GGC CTG TCC TTG CTT ATC CTC AAG CAA 1350 Gly Gly Arg Val Leu Tyr Ser Gly Leu Ser Leu Leu He Leu Lys Gin 430 435
CAG GGC ATC ACC TCT CTA CAG TTC CAG TCC CTG AAG GAA ATC AGC GCA 1398 Gin Gly He Thr Ser Leu Gin Phe Gin Ser Leu Lys Glu He Ser Ala 445 450 455
GGA AAC ATC TAT ATT ACT GAC AAC AGC AAC CTG TGT TAT TAT CAT ACC 1446 Gly Asn He Tyr He Thr Asp Asn Ser Asn Leu Cys Tyr Tyr His Thr 460 465 470
ATT AAC TGG ACA ACA CTC TTC AGC ACA ATC AAC CAG AGA ATA GTA ATC 1494 He Asn Trp Thr Thr Leu Phe Ser Thr He Asn Gin Arg He Val He 475 480 485
CGG GAC AAC AGA AAA GCT GAA AAT TGT ACT GCT GAA GGA ATG GTG TGC 1542 Arg Asp Asn Arg Lys Ala Glu Asn Cys Thr Ala Glu Gly Met Val Cys 495 500
AAC CAT CTG TGT TCC AGT GAT GGC TGT TGG GGA CCT GGG CCA GAC CAA 1590 Asn His Leu Cys Ser Ser Asp Gly Cys Trp Gly Pro Gly Pro Asp Gin 510 515
TGT CTG TCG TGT CGC CGC TTC AGT AGA GGA AGG ATC TGC ATA GAG TCT 1638 Cys Leu Ser Cys Arg Arg Phe Ser Arg Gly Arg He Cys He Glu Ser 525 530 535
TGT AAC CTC TAT GAT GGT GAA TTT CGG GAG TTT GAG AAT GGC TCC ATC 1686 Cys Asn Leu Tyr Asp Gly Glu Phe Arg Glu Phe Glu Asn Gly Ser He 540 545 550
TGT GTG GAG TGT GAC CCC CAG TGT GAG AAG ATG GAA GAT GGC CTC CTC 1734 Cys Val Glu Cys Asp Pro Gin Cys Glu Lys Met Glu Asp Gly Leu Leu 555 560 565
ACA TGC CAT GGA CCG GGT CCT GAC AAC TGT ACA AAG TGC TCT CAT TTT 1782 Thr Cys His Gly Pro Gly Pro Asp Asn Cys Thr Lys Cys Ser His Phe 575 580 AAA GAT GGC CCA AAC TGT GTG GAA AAA TGT CCA GAT GGC TTA CAG GGG 1830 Lys Asp Gly Pro Asn Cys Val Glu Lys Cys Pro Asp Gly Leu Gin Gly 590 595
GCA AAC AGT .TTC ATT TTC AAG TAT GCT GAT CCA GAT CGG GAG TGC CAC 1878 Ala Asn Ser Phe He Phe Lys Tyr Ala Asp Pro Asp Arg Glu Cys His 605 610 615
CCA TGC CAT CCA AAC TGC ACC CAA GGG TGT AAC GGT CCC ACT AGT CAT 1926 Pro Cys His Pro Asn Cys Thr Gin Gly Cys Asn Gly Pro Thr Ser His 620 625 630
GAC TGC ATT TAC TAC CCA TGG ACG GGC CAT TCC ACT TTA CCA CAA CAT 1974 Asp Cys He Tyr Tyr Pro Trp Thr Gly His Ser Thr Leu Pro Gin His 635 640 645
GCT AGA ACT CCC CTG ATT GCA GCT GGA GTA ATT GGT GGG CTC TTC ATT 2022 Ala Arg Thr Pro Leu He Ala Ala Gly Val He Gly Gly Leu Phe He 655 660
CTG GTC ATT GTG GGT CTG ACA TTT GCT GTT TAT GTT AGA AGG AAG AGC 2070 Leu Val He Val Gly Leu Thr Phe Ala Val Tyr Val Arg Arg Lys Ser 670 675
ATC AAA AAG AAA AGA GCC TTG AGA AGA TTC TTG GAA ACA GAG TTG GTG 2118 He Lys Lys Lys Arg Ala Leu Arg Arg Phe Leu Glu Thr Glu Leu Val 685 690 695
GAA CCA TTA ACT CCC AGT GGC ACA GCA CCC AAT CAA GCT CAA CTT CGT 2166 Glu Pro Leu Thr Pro Ser Gly Thr Ala Pro Asn Gin Ala Gin Leu Arg 700 705 710
ATT TTG AAA GAA ACT GAG CTG AAG AGG GTA AAA GTC CTT GGC TCA GGT 2214 He Leu Lys Glu Thr Glu Leu Lys Arg Val Lys Val Leu Gly Ser Gly 715 720 725
GCT TTT GGA ACG GTT TAT AAA GGT ATT TGG GTA CCT GAA GGA GAA ACT 2262 Ala Phe Gly Thr Val Tyr Lys Gly He Trp Val Pro Glu Gly Glu Thr 735 740
GTG AAG ATT CCT GTG GCT ATT AAG ATT CTT AAT GAG ACA ACT GGT CCC 2310 Val Lys He Pro Val Ala He Lys He Leu Asn Glu Thr Thr Gly Pro 750 755
AAG GCA AAT GTG GAG TTC ATG GAT GAA GCT CTG ATC ATG GCA AGT ATG 2358 Lys Ala Asn Val Glu Phe Met Asp Glu Ala Leu He Met Ala Ser Met 765 770 775
GAT CAT CCA CAC CTA GTC CGG TTG CTG GGT GTG TGT CTG AGC CCA ACC 2406 Asp His Pro His Leu Val Arg Leu Leu Gly Val Cys Leu Ser Pro Thr 780 785 790
ATC CAG CTG GTT ACT CAA CTT ATG CCC CAT GGC TGC CTG TTG GAG TAT 2454 He Gin Leu Val Thr Gin Leu Met Pro His Gly Cys Leu Leu Glu Tyr 795 800 805
GTC CAC GAG CAC AAG GAT AAC ATT GGA TCA CAA CTG CTG CTT AAC TGG 2502 Val His Glu His Lys Asp Asn He Gly Ser Gin Leu Leu Leu Asn Trp 815 820
TGT GTC CAG ATA GCT AAG GGA ATG ATG TAC CTG GAA GAA AGA CGA CTC 2550 Cys Val Gin He Ala Lys Gly Met Met Tyr Leu Glu Glu Arg Arg Leu 830 835
GTT-CAT CGG GAT TTG GCA GCC CGT AAT GTC TTA GTG AAA TCT CCA AAC 2598 Val His Arg Asp Leu Ala Ala Arg Asn Val Leu Val Lys Ser Pro Asn B45 850 855 CAT GTG AAA ATC ACA GAT TTT GGG CTA GCC AGA CTC TTG GAA GGA GAT 2646 His Val Lys He Thr Asp Phe Gly Leu Ala Arg Leu Leu Glu Gly Asp
865 870
GAA AAA GAG TAC AAT GCT GAT GGA GGA AAG ATG CCA ATT AAA TGG ATG 2694 Glu Lys Glu Tyr Asn Ala Asp Gly Gly Lys Met Pro He Lys Trp Met 875 880 885
GCT CTG GAG TGT ATA CAT TAC AGG AAA TTC ACC CAT CAG AGT GAC GTT 2742 Ala Leu Glu Cys He His Tyr Arg Lys Phe Thr His Gin Ser Asp Val 895 900
TGG AGC TAT GGA GTT ACT ATA TGG GAA CTG ATG ACC TTT GGA GGA AAA 2790 Trp Ser Tyr Gly Val Thr He Trp Glu Leu Met Thr Phe Gly Gly Lys 910 915
CCC TAT GAT GGA ATT CCA ACG CGA GAA ATC CCT GAT TTA TTA GAG AAA 2838 Pro Tyr Asp Gly He Pro Thr Arg Glu He Pro Asp Leu Leu Glu Lys 925 930 935
GGA GAA CGT TTG CCT CAG CCT CCC ATC TGC ACT ATT GAC GTT TAC ATG 2886 Gly Glu Arg Leu Pro Gin Pro Pro He Cys Thr He Asp Val Tyr Met 940 945 950
GTC ATG GTC AAA TGT TGG ATG ATT GAT GCT GAC AGT AGA CCT AAA TTT 2934 Val Met Val Lys Cys Trp Met He Asp Ala Asp Ser Arg Pro Lys Phe 955 960 965
AAG GAA CTG GCT GCT GAG TTT TCA AGG ATG GCT CGA GAC CCT CAA AGA 2982 Lys Glu Leu Ala Ala Glu Phe Ser Arg Met Ala Arg Asp Pro Gin Arg 975 980
TAC CTA GTT ATT CAG GGT GAT GAT CGT ATG AAG CTT CCC AGT CCA AAT 3030 Tyr Leu Val He Gin Gly Asp Asp Arg Met Lys Leu Pro Ser Pro Asn 990 995
GAC AGC AAG TTC TTT CAG AAT CTC TTG GAT GAA GAG GAT TTG GAA GAT 3078 Asp Ser Lys Phe Phe Gin Asn Leu Leu Asp Glu Glu Asp Leu Glu Asp 1005 1010 1015
ATG ATG GAT GCT GAG GAG TAC TTG GTC CCT CAG GCT TTC AAC ATC CCA 3126 Met Met Asp Ala Glu Glu Tyr Leu Val Pro Gin Ala Phe Asn He Pro 1020 1025 1030
CCT CCC ATC TAT ACT TCC AGA GCA AGA ATT GAC TCG AAT AGG AGT GTA 3174 Pro Pro He Tyr Thr Ser Arg Ala Arg He Asp Ser Asn Arg Ser Val 1035 1040 1045
AGA AAT AAT TAT ATA CAC ATA TCA TAT TCT TTC TGAGATATAA AATCATGTAA 3227 Arg Asn Asn Tyr He His He Ser Tyr Ser Phe 1055
TAGTTCATAA GCACTAACAT TTCAAAATAA TTATATAGCT CAAATCAATG TGATGCCTAG 3287
ATTAAAAATA TACCATACCC ACAAAAGATG TGCCAATCTT GCTATATGTA GTTAATTTTG 3347
GAAGACAAGC ATGGACAATA CAACATGTAC TCTGAAATAC CTTCAAGATT TCAGAAGCAA 3407
AACATTTTCC TCATCTTAAT TTATTTAAAA CAAATCTTAA CTTTAAAAAA CAATTCCAAC 3467
TAATAAAACC ATTATGTGTA TATAAATAAA TGAAAATTCC TACCAAGTAG GCTTTCTACT 3527
TTTCTTTCTT AAAAAGATAT TATGATATAT TAGTCAAGAA GTAATACAAG TATAAATCTC 3587
TTTCACTTAT TTAAGAAAAA TTAAATATTT TCTGTCAAGT TGAAGTAGAA ACACAGAAAA 3647
CCGTGCAGTC CTTTGAACCT AATCACATCG AAAAGGCTGC TGAGAAGTAG ATTTTTGTTT 3707 TTAAGAAGTA GATTTAAGTT TTGAAGGAAG TTTCTGAAAA CACTTTACAT TTTAAATGTT 3767
AAACCTACTC TATATGAATT CCATTCTTTC TTTGAAAGCT GTCAAATCCA TGCATTTATT 3827
TTTATAAATT CATTCCTCAT ACATTCAACA TATATTGAGT ACCACTGTAT GTGAAGCATT 3887
AGTATACATT TAAGACTCAA AGAATTTTGA TACAACTTCT GCTTTCAAGA AGTGAAAACC 3947
TTAATCAAAG AATCATACAG ATAGAGGGAC TGCATAGTAA GTGCTGTAAT CCAGTATTCA 4007
CTGACCAGTA CGGAGCATGA AGAAGTAGTA AATTTGTGTC TGTAATCAGT TTCTTCCATT 4067
GATAAGATAT AAACATGATG CTTAATTTTT TCTAGAAGAT AATTCTTTTC TCTTAATCTA 4127
AGAACATTAT CATAGCTAGT AGAACCGACA GCATCCGATT TCTCTTGACC ATAGCCATAA 4187
GAATATCTTC AACTTGCTGC TCATTATCTA ACAAACATAA TTTTCTTTAT TTCATATTGA 4247
TTGTAATAAG TAATATCCCC CTGGAAGTTT ACTATTCAAC ACATATATGT TAACCTCCTT 4307
AATTCCTTAA ACAAACTTCA TGAGGTTCTA TTATTATCAT CCCCTTCTTT CAAAGGAAGA 4367
AACTTGCCAC AGAGAAGTCA GGTGATATGA CTGGTGTCAC ACAGCTAGTC AGTGGAAGAG 4427
AGGAATAAGT AATCTAGATA TCTGCCTACT ACACTGTAGG TTTGCTTCAA AGTTACTGAA 4487
GYCATGT AT TTCCATGATG TGATTAGAGT CTGGGACTTG TCTTGTTTGG GAAATTTCCC 4547
AGGTGGTTTT CTTATAAAAT GCATCTCAAA TCTGCTCTAC ACCTTTTACT CATCTACCTC 4607
CATTTAGAAG ATCTGATATG GAAAGAGACA AAGATGGAGA CCTCAATTAT TTTTTCTTTT 4667
CTGTTAAAAA TATTATAGTA CAACTGAAAC TTATCACATG CCAATGGGGA ATAGATAACT 4727
AAAAGTTTAA AATTAGATCA ATGGATAGGT AAATGAATAA TCNTTCTTTT GCTTGTGAGA 4787
GGGGAAGGAA AAGCGGTTAA GGTGGTATAA AGGAGGCTCC TCTGTACACT TGCAAAATGA 4847
TCAAATTATA TACCCTTGTA TTTATAATTT TAAGTGACAA ATTCAT ACT TCTGGTTACA 4907
ACAGTGAAAT TTAAAAAAAA ATAGTTTTTC TTTCTTAGCT TGCAATGCTA TAAATCTTTT 4967
TCTTTTTATA AGAATTCTTA CATTTCAGCT TTTTGTTCAT TTTAATTTAT AATTCTCAGT 5027
GCAAGAAATT CTTAATAAAG GTTTGAGCTA GCTAGATGGA ATTATTGAGA CAAAGTCTAA 5087
ATCACCCGTG GACTTATTTG ACCTTTAGCC ATCATTTCTT ATTCCACATT ATAAAACAAT 5147
GTTACCTGTA GATTTCTTTT TACTTTTTCA GTCCTTGGAA AAGAAATGGT GATTAAATAT 5207
CATTATATCA TTTTATGTTC AGGCATTTAA AAAGCTTTAT TTGTCATCTA TATTGTCCTA 5267
ATAGTTTTCA GTCTGGCTTT ACGTAACTTT TACGGAAATT TCTAACATGT ACAAATGCCA 5327
TGTTCCTCCT TTCTTTCCTA CATGGCTGAA TTAGAAAACA AATTACTTCC ATTTTAAGTT 5387
TGGCTAAATT AGAAAACAAA TTACTACCAT TTTAAGTTTG GTGGCTAAAT AACGTGCTAA 5447
GGGAACATCT TAAAAAGTGA ATTTTGATCA AATATTTCTT AAGCATATGT GATAGACTTT 5507
GAAACCAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAA 5555
( 2 ) INFORMATION FOR SEQ ID NO : 4 :
( i ) SEQUENCE CHARACTERISTICS :
(A ) LENGTH : 1058 amino ac ids
( B ) TYPE : amino acid (D ) TOPOLOGY : l inear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4 :
Met Lys Pro .Ala Thr Gly Leu Trp Val Trp Val Ser Leu Leu Val Ala
1 5 10 15
Ala Gly Thr Val Gin Pro Ser Asp Ser Gin Ser Val Cys Ala Gly Thr 20 25 30
Glu Asn Lys Leu Ser Ser Leu Ser Asp Leu Glu Gin Gin Tyr Arg Ala 35 40 45
Leu Arg Lys Tyr Tyr Glu Asn Cys Glu Val Val Met Gly Asn Leu Glu 50 55 60
He Thr Ser He Glu His Asn Arg Asp Leu Ser Phe Leu Arg Ser Val 65 70 75 80
Arg Glu Val Thr Gly Tyr Val Leu Val Ala Leu Asn Gin Phe Arg Tyr 85 90 95
Leu Pro Leu Glu Asn Leu Arg He He Arg Gly Thr Lys Leu Tyr Glu 100 105 110
Asp Arg Tyr Ala Leu Ala He Phe Leu Asn Tyr Arg Lys Asp Gly Asn 115 120 125
Phe Gly Leu Gin Glu Leu Gly Leu Lys Asn Leu Thr Glu He Leu Asn 130 135 140
Gly Gly Val Tyr Val Asp Gin Asn Lys Phe Leu Cys Tyr Ala Asp Thr 145 150 155 160
He His Trp Gin Asp He Val Arg Asn Pro Trp Pro Ser Asn Leu Thr 165 170 175
Leu Val Ser Thr Asn Gly Ser Ser Gly Cys Gly Arg Cys His Lys Ser 180 185 190
Cys Thr Gly Arg Cys Trp Gly Pro Thr Glu Asn His Cys Gin Thr Leu 195 200 205
Thr Arg Thr Val Cys Ala Glu Gin Cys Asp Gly Arg Cys Tyr Gly Pro 210 215 220
Tyr Val Ser Asp Cys Cys His Arg Glu Cys Ala Gly Gly Cys Ser Gly 225 230 235 240
Pro Lys Asp Thr Asp Cys Phe Ala Cys Met Asn Phe Asn Asp Ser Gly 245 250 255
Ala Cys Val Thr Gin Cys Pro Gin Thr Phe Val Tyr Asn Pro Thr Thr 260 265 270
Phe Gin Leu Glu His Asn Phe Asn Ala Lys Tyr Thr Tyr Gly Ala Phe 275 280 285
Cys Val Lys Lys Cys Pro His Asn Phe Val Val Asp Ser Ser Ser Cys 290 295 300
Val Arg Ala Cys Pro Ser Ser Lys Met Glu Val Glu Glu Asn Gly He 305 310 315 320
Lys .Met Cys Lys Pro Cys Thr Asp He Cys Pro Lys Ala Cys Asp Gly 325 330 335 He Gly Thr Gly Ser Leu Met Ser Ala Gin Thr Val Asp Ser Ser Asn 340 345 350
He Asp Lys Phe He Asn Cys Thr Lys He Asn Gly Asn Leu He Phe 355 . 360 365
Leu Val Thr Gly He His Gly Asp Pro Tyr Asn Ala He Glu Ala He 370 375 ' 380
Asp Pro Glu Lys Leu Asn Val Phe Arg Thr Val Arg Glu He Thr Gly 385 390 395 400
Phe Leu Asn He Gin Ser Trp Pro Pro Asn Met Thr Asp Phe Ser Val 405 410 415
Phe Ser Asn Leu Val Thr He Gly Gly Arg Val Leu Tyr Ser Gly Leu 420 425 430
Ser Leu Leu He Leu Lys Gin Gin Gly He Thr Ser Leu Gin Phe Gin 435 440 445
Ser Leu Lys Glu He Ser Ala Gly Asn He Tyr He Thr Asp Asn Ser 450 455 460
Asn Leu Cys Tyr Tyr His Thr He Asn Trp Thr Thr Leu Phe Ser Thr 465 470 475 480
He Asn Gin Arg He Val He Arg Asp Asn Arg Lys Ala Glu Asn Cys 485 490 495
Thr Ala Glu Gly Met Val Cys Asn His Leu Cys Ser Ser Asp Gly Cys 500 505 510
Trp Gly Pro Gly Pro Asp Gin Cys Leu Ser Cys Arg Arg Phe Ser Arg 515 520 525
Gly Arg He Cys He Glu Ser Cys Asn Leu Tyr Asp Gly Glu Phe Arg 530 535 540
Glu Phe Glu Asn Gly Ser He Cys Val Glu Cys Asp Pro Gin Cys Glu 545 550 555 560
Lys Met Glu Asp Gly Leu Leu Thr Cys His Gly Pro Gly Pro Asp Asn 565 570 575
Cys Thr Lys Cys Ser His Phe Lys Asp Gly Pro Asn Cys Val Glu Lys 580 585 590
Cys Pro Asp Gly Leu Gin Gly Ala Asn Ser Phe He Phe Lys Tyr Ala 595 600 605
Asp Pro Asp Arg Glu Cys His Pro Cys His Pro Asn Cys Thr Gin Gly 610 615 620
Cys Asn Gly Pro Thr Ser His Asp Cys He Tyr Tyr Pro Trp Thr Gly 625 630 635 640
His Ser Thr Leu Pro Gin His Ala Arg Thr Pro Leu He Ala Ala Gly 645 650 655
Val He Gly Gly Leu Phe He Leu Val He Val Gly Leu Thr Phe Ala 660 665 670
Val Tyr Val Arg Arg Lys Ser He Lys Lys Lys Arg Ala Leu Arg Arg 675 680 685
Phe Leu Glu Thr Glu Leu Val Glu Pro Leu Thr Pro Ser Gly Thr Ala 6 90 695 700
Pro Asn Gin Ala Gin Leu Arg He Leu Lys Glu Thr Glu Leu Lys Arg 705 710 715 720
Val Lys Va! Leu Gly Ser Gly Ala Phe Gly Thr Val Tyr Lys Gly He 725 730 735
Trp Val Pro Glu Gly Glu Thr Val Lys He Pro Val Ala He Lys He 740 745 750
Leu Asn Glu Thr Thr Gly Pro Lys Ala Asn Val Glu Phe Met Asp Glu 755 760 765
Ala Leu He Met Ala Ser Met Asp His Pro His Leu Val Arg Leu Leu 770 775 780
Gly Val Cys Leu Ser Pro Thr He Gin Leu Val Thr Gin Leu Met Pro 785 790 795 800
His Gly Cys Leu Leu Glu Tyr Val His Glu His Lys Asp Asn He Gly 805 810 815
Ser Gin Leu Leu Leu Asn Trp Cys Val Gin He Ala Lys Gly Met Met 820 825 ' 830
Tyr Leu Glu Glu Arg Arg Leu Val His Arg Asp Leu Ala Ala Arg Asn 835 840 845
Val Leu Val Lys Ser Pro Asn His Val Lys He Thr Asp Phe Gly Leu 850 855 860
Ala Arg Leu Leu Glu Gly Asp Glu Lys Glu Tyr Asn Ala Asp Gly Gly 865 870 875 880
Lys Met Pro He Lys Trp Met Ala Leu Glu Cys He His Tyr Arg Lys 885 890 895
Phe Thr His Gin Ser Asp Val Trp Ser Tyr Gly Val Thr He Trp Glu 900 905 910
Leu Met Thr Phe Gly Gly Lys Pro Tyr Asp Gly He Pro Thr Arg Glu 915 920 925
He Pro Asp Leu Leu Glu Lys Gly Glu Arg Leu Pro Gin Pro Pro He 930 935 940
Cys Thr He Asp Val Tyr Met Val Met Val Lys Cys Trp Met He Asp 945 950 955 960
Ala Asp Ser Arg Pro Lys Phe Lys Glu Leu Ala Ala Glu Phe Ser Arg 965 970 975
Met Ala Arg Asp Pro Gin Arg Tyr Leu Val He Gin Gly Asp Asp Arg 980 985 990
Met Lys Leu Pro Ser Pro Asn Asp Ser Lys Phe Phe Gin Asn Leu Leu 995 1000 1005
Asp Glu Glu Asp Leu Glu Asp Met Met Asp Ala Glu Glu Tyr Leu Val 1010 1015 1020
Pro Gin Ala Phe Asn He Pro Pro Pro He Tyr Thr Ser Arg Ala Arg 1025 1030 1035 1040
He Asp Ser Asn Arg Ser Val Arg Asn Asn Tyr He His He Ser Tyr 1045 1050 1055 Ser Phe
(2) INFORMATION FOR SEQ ID NO: 5 :
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 3321 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS : single
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 156..1782
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5 :
CATTAGCTGC AATTGATCAA GTGACTGAGA GAAGGGCAAC ATTCCATGCA ACAGTATAGT 60
GGTATGGAAA GCCCTGGATG TTGAAATCTA GCTTCAAAAA GCCTGTCTGG AAATGTAGTT 120
AATTGGATGA AGTGAGAAGA GATAAAACCA GAGAG GAA GCT CTG ATC ATG GCA 173
Glu Ala Leu He Met Ala 1 5
AGT ATG GAT CAT CCA CAC CTA GTC CGG TTG CTG GGT GTG TGT CTG AGC 221 Ser Met Asp His Pro His Leu Val Arg Leu Leu Gly Val Cys Leu Ser 10 15 20
CCA ACC ATC CAG CTG GTT ACT CAA CTT ATG CCC CAT GGC TGC CTG TTG 269 ro Thr He Gin Leu Val Thr Gin Leu Met Pro His Gly Cys Leu Leu 25 30 35
GAG TAT GTC CAC GAG CAC AAG GAT AAC ATT GGA TCA CAA CTG CTG CTT 317 Glu Tyr Val His Glu His Lys Asp Asn He Gly Ser Gin Leu Leu Leu 45 50
AAC TGG TGT GTC CAG ATA GCT AAG GGA ATG ATG TAC CTG GAA GAA AGA 365 Asn Trp Cys Val Gin He Ala Lys Gly Met Met Tyr Leu Glu Glu Arg 60 65 70
CGA CTC GTT CAT CGG GAT TTG GCA GCC CGT AAT GTC TTA GTG AAA TCT 413 Arg Leu Val His Arg Asp Leu Ala Ala Arg Asn Val Leu Val Lys Ser 75 80 85
CCA AAC CAT GTG AAA ATC ACA GAT TTT GGG CTA GCC AGA CTC TTG GAA 461 Pro Asn His Val Lys He Thr Asp Phe Gly Leu Ala Arg Leu Leu Glu 90 95 100
GGA GAT GAA AAA GAG TAC AAT GCT GAT GGA GGA AAG ATG CCA ATT AAA 509 Gly Asp Glu Lys Glu Tyr Asn Ala Asp Gly Gly Lys Met Pro He Lys 110 115
TGG ATG GCT CTG GAG TGT ATA CAT TAC AGG AAA TTC ACC CAT CAG AGT 557 Trp Met Ala Leu Glu Cys He His Tyr Arg Lys Phe Thr His Gin Ser 125 130
GAC GTT TGG AGC TAT GGA GTT ACT ATA TGG GAA CTG ATG ACC TTT GGA 605 Asp Val Trp Ser Tyr Gly Val Thr He Trp Glu Leu Met Thr Phe Gly 140 145 150 GGA AAA CCC TAT GAT GGA ATT CCA ACG CGA GAA ATC CCT GAT TTA TTA 653G1*/ Lys Pro Tyr Asp Gly He Pro Thr Arg Glu He Pro Asp Leu Leu 160 165
GAG AAA GGA. GAA CGT TTG CCT CAG CCT CCC ATC TGC ACT ATT GAC GTT 701 Glu Lys Gly Glu Arg Leu Pro Gin Pro Pro He Cys Thr He Asp Val 170 175 180
TAC ATG GTC ATG GTC AAA TGT TGG ATG ATT GAT GCT GAC AGT AGA CCT 749 Tyr Met Val Met Val Lys Cys Trp Met He Asp Ala Asp Ser Arg Pro 190 195
AAA TTT AAG GAA CTG GCT GCT GAG TTT TCA AGG ATG GCT CGA GAC CCT 797 Lys Phe Lys Glu Leu Ala Ala Glu Phe Ser Arg Met Ala Arg Asp Pro 205 210
CAA AGA TAC CTA GTT ATT CAG GGT GAT GAT CGT ATG AAG CTT CCC AGT 845 Gin Arg Tyr Leu Val He Gin Gly Asp Asp Arg Met Lys Leu Pro Ser 220 225 230
CCA AAT GAC AGC AAG TTC TTT CAG AAT CTC TTG GAT GAA GAG GAT TTG 893 Pro Asn Asp Ser Lys Phe Phe Gin Asn Leu Leu Asp Glu Glu Asp Leu 235 ' 240 245
GAA GAT ATG ATG GAT GCT GAG GAG TAC TTG GTC CCT CAG GCT TTC AAC 9 1 Glu Asp Met Met Asp Ala Glu Glu Tyr Leu Val Pro Gin Ala Phe Asn 250 255 260
ATC CCA CCT CCC ATC TAT ACT TCC AGA GCA AGA ATT GAC TCG AAT AGG 989 He Pro Pro Pro He Tyr Thr Ser Arg Ala Arg He Asp Ser Asn Arg 270 275
AGT GAA ATT GGA CAC AGC CCT CCT CCT GCC TAC ACC CCC ATG TCA GGA 1037 Ser Glu He Gly His Ser Pro Pro Pro Ala Tyr Thr Pro Met Ser Gly 285 290
AAC CAG TTT GTA TAC CGA GAT GGA GGT TTT GCT GCT GAA CAA GGA GTG 1085 Asn Gin Phe Val Tyr Arg Asp Gly Gly Phe Ala Ala Glu Gin Gly Val 300 305 310
TCT GTG CCC TAC AGA GCC CCA ACT AGC ACA ATT CCA GAA GCT CCT GTG 1133 Ser Val Pro Tyr Arg Ala Pro Thr Ser Thr He Pro Glu Ala Pro Val 315 320 325
GCA CAG GGT GCT ACT GCT GAG ATT TTT GAT GAC TCC TGC TGT AAT GGC 1181 Ala Gin Gly Ala Thr Ala Glu He Phe Asp Asp Ser Cys Cys Asn Gly 330 335 340
ACC CTA CGC AAG CCA GTG GCA CCC CAT GTC CAA GAG GAC AGT AGC ACC 1229 Thr Leu Arg Lys Pro Val Ala Pro His Val Gin Glu Asp Ser Ser Thr 350 355
CAG AGG TAC AGT GCT GAC CCC ACC GTG TTT GCC CCA GAA CGG AGC CCA 1277 Gin Arg Tyr Ser Ala Asp Pro Thr Val Phe Ala Pro Glu Arg Ser Pro 365 370
CGA GGA GAG CTG GAT GAG GAA GGT TAC ATG ACT CCT ATG CGA GAC AAA 1325 Arg Gly Glu Leu Asp Glu Glu Gly Tyr Met Thr Pro Met Arg Asp Lys 380 385 390
CCC AAA CAA GAA TAC CTG AAT CCA GTG GAG GAG AAC CCT TTT GTT TCT 1373 Pro Lys Gin Glu Tyr Leu Asn Pro Val Glu Glu Asn Pro Phe Val Ser 395 400 405
CGG AGA AAA AAT GGA GAC CTT CAA GCA TTG GAT AAT CCC GAA TAT CAC 1421 Arg Arg Lys Asn Gly Asp Leu Gin Ala Leu Asp Asn Pro Glu Tyr His 410 415 420
AAT GCA TCC AAT GGT CCA CCC AAG GCC GAG GAT GAG TAT GTG AAT GAG 1469 Asn Ala Ser Asn Gly Pro Pro Lys Ala Glu Asp Glu Tyr Val Asn Glu 430 435
CCA CTG TAC CTC AAC ACC TTT GCC AAC ACC TTG GGA AAA GCT GAG TAC 1517 Pro Leu Tyr Leu Asn Thr Phe Ala Asn Thr Leu Gly Lys Ala Glu Tyr 445 450
CTG AAG AAC AAC ATA CTG TCA ATG CCA GAG AAG GCC AAG AAA GCG TTT 1565 Leu Lys Asn Asn He Leu Ser Met Pro Glu Lys Ala Lys Lys Ala Phe 460 465 470
GAC AAC CCT GAC TAC TGG AAC CAC AGC CTG CCA CCT CGG AGC ACC CTT 1613 Asp Asn Pro Asp Tyr Trp Asn His Ser Leu Pro Pro Arg Ser Thr Leu 475 480 485
CAG CAC CCA GAC TAC CTG CAG GAG TAC AGC ACA AAA TAT TTT TAT AAA 1661 Gin His Pro Asp Tyr Leu Gin Glu Tyr Ser Thr Lys Tyr Phe Tyr Lys 490 495 500
CAG AAT GGG CGG ATC CGG CCT ATT GTG GCA GAG AAT CCT GAA TAC CTC 1709 Gin Asn Gly Arg He Arg Pro He Val Ala Glu Asn Pro Glu Tyr Leu 510 515
TCT GAG TTC TCC CTG AAG CCA GGC ACT GTG CTG CCG CCT CCA CCT TAC 1757 Ser Glu Phe Ser Leu Lys Pro Gly Thr Val Leu Pro Pro Pro Pro Tyr 525 530
AGA CAC CGG AAT ACT GTG GTG TAAGCTCAGT TGTGGTTTTT TAGGTGGAGA 1808
Val
535 540
GACACACCTG CTCCAATTTC CCCACCCCCC TCTCTTTCTC TGGTGGTCTT CCTTCTACCC
CCAGT AGTTTTGACA CTTCCCAGTG GAAGATACAG AGATGCAATG ATAGTTATGT 1928
GCTTACCTAA CTTGAACATT AGAGGGAAAG ACTGAAAGAG AAAGATAGGA GGAACCACAA 1988
TGTTTCTTCA TTTCTCTGCA TGGGTTGGTC AGGAGAATGA AACAGCTAGA GAAGGACCAG 2048
AAAATGTAAG GCAATGCTGC CTACTATCAA ACTAGCTGTC ACTTTTTTTC TTTTTCTTTT 2108
TCTTTCTTTG TTTCTτTCTT CCTCTTCTTT ττττττττττ TTTTAAAGCA GATGGTTGAA 2168
ACACCCATGC TATCTGTTCC TATCTGCAGG AACTGATGTG TGCATATTTA GCATCCCTGG 2228
AAATCATAAT AAAGTTTCCA TTAGAACAAA AGAATAACAT TTTCTATAAC ATATGATAGT 2288
GTCTGAAATT GAGAATCCAG TTTCTTTCCC CAGCAGTTTC TGTCCTAGCA AGTAAGAATG 2348
GCCAACTCAA CTTTCATAAT TTAAAAATCT CCATTAAAGT TATAACTAGT AATTATGTTT 2408
TCAACACTTT TTGGTTTTTT TCATTTTGTT TTGCTCTGAC CGATTCCTTT ATATTTGCTC 2468
CCCTATTTTT GGCTTTAATT TCTAATTGCA AAGATGTTTA CATCAAAGCT TCTTCACAGA 2528
ATTTAAGCAA GAAATATTTT AATATAGTGA AATGGCCACT ACTTTAAGTA TACAATCTTT 2588
AAAATAAGAA AGGGAGGCTA ATATTTTTCA TGCTATCAAA TTATCTTCAC CCTCATCCTT 2648
TACATTTTTC AACATTTTTT TTTCTCCATA AATGACACTA CTTGATAGGC CGTTGGTTGT 2708 CTGAAGAGTA GAAGGGAAAC TAAGAGACAG TTCTCTGTGG TTCAGGAAAA CTACTGATAC 2768
TTTCAGGGGT GGCCCAATGA GGGAATCCAT TGAACTGGAA GAAACACACT GGATTGGGTA 2828
TGTCTACCTG GCAGATACTC AGAAATGTAG TTTGCACTTA AGCTGTAATT TTATTTGTTC 2888
TTTTTCTGAA CTCCATTTTG GATTTTGAAT CAAGCAATAT GGAAGCAACC AGCAAATTAA 2948
CTAATTTAAG TACATTTTTA AAAAAAGAGC TAAGATAAAG ACTGTGGAAA TGCCAAACCA 3008
AGCAAATTAG GAACCTTGCA ACGGTATCCA GGGACTATGA TGAGAGGCCA GCACATTATC 3068
TTCATATGTC ACCTTTGCTA CGCAAGGAAA TTTGTTCAGT TCGTATACTT CGTAAGAAGG 3128
AATGCGAGTA AGGATTGGCT TGAATTCCAT GGAATTTCTA GTATGAGACT ATTTATATGA 3188
AGTAGAAGGT AACTCTTTGC ACATAAATTG GTATAATAAA AAGAAAAACA CAAACATTCA 3248
AAGCTTAGGG ATAGGTCCTT GGGTCAAAAG TTGTAAATAA ATGTGAAACA TCTTCTCAAA 3308
AAAAAAAAAA AAA 3321 (2) INFORMATION FOR SEQ ID NO:6 :
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 541 amino acids
(B) TYPE: amino acid (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6 :
Glu Ala Leu He Met Ala Ser Met Asp His Pro His Leu Val Arg Leu 1 5 10 15
Leu Gly Val Cys Leu Ser Pro Thr He Gin Leu Val Thr Gin Leu Met 20 25 30
Pro His Gly Cys Leu Leu Glu Tyr Val His Glu His Lys Asp Asn He 35 40 45
Gly Ser Gin Leu Leu Leu Asn Trp Cys Val Gin He Ala Lys Gly Met 50 55 60
Met Tyr Leu Glu Glu Arg Arg Leu Val His Arg Asp Leu Ala Ala Arg 65 70 75 80
Asn Val Leu Val Lys Ser Pro Asn His Val Lys He Thr Asp Phe Gly 85 90 95
Leu Ala Arg Leu Leu Glu Gly Asp Glu Lys Glu Tyr Asn Ala Asp Gly 100 105 110
Gly Lys Met Pro He Lys Trp Met Ala Leu Glu Cys He His Tyr Arg 115 120 125
Lys Phe Thr His Gin Ser Asp Val Trp Ser Tyr Gly Val Thr He Trp 130 135 140
Glu Leu Met Thr Phe Gly Gly Lys Pro Tyr Asp Gly He Pro Thr Arg 145 150 155 160
Glu He Pro Asp Leu Leu Glu Lys Gly Glu Arg Leu Pro Gin Pro Pro 165 170 175
He Cys Thr He Asp Val Tyr Met Val Met Val Lys Cys Trp Met He 180 185 190
Asp Ala Asp Ser Arg Pro Lys Phe Lys Glu Leu Ala Ala Glu Phe Ser 195 200 205
Arg Met Ala Arg Asp Pro Gin Arg Tyr Leu Val He Gin Gly Asp Asp 210 215 220
Arg Met Lys Leu Pro Ser Pro Asn Asp Ser Lys Phe Phe Gin Asn Leu 225 230 235 240
Leu Asp Glu Glu Asp Leu Glu Asp Met Met Asp Ala Glu Glu Tyr Leu 245 250 255
Val Pro Gin Ala Phe Asn He Pro Pro Pro He Tyr Thr Ser Arg Ala 260 265 270
Arg He Asp Ser Asn Arg Ser Glu He Gly His Ser Pro Pro Pro Ala 275 280 285
Tyr Thr Pro Met Ser Gly Asn Gin Phe Val Tyr Arg Asp Gly Gly Phe
2 29900 229955 330000
Ala A Allaa GGlluu GGiinn GGllyy VVaall SSeerr VVaall PPrroo TTyyrr AArrgg AAllaa Pro Thr Ser Thr
330055 331100 331155 332200
He Pro Glu Ala Asp
Figure imgf000135_0001
Asp Ser Cys Cys Asn Gly Thr Leu Arg Lys Pro Val Ala Pro His Val 340 345 350
Gin Glu Asp Ser Ser Thr Gin Arg Tyr Ser Ala Asp Pro Thr Val Phe 355 360 365
Ala Pro Glu Arg Ser Pro Arg Gly Glu Leu Asp Glu Glu Gly Tyr Met 370 375 380
Thr Pro Met Arg Asp Lys Pro Lys Gin Glu Tyr Leu Asn Pro Val Glu 385 390 395 400
Glu Asn Pro Phe Val Ser Arg Arg Lys Asn Gly Asp Leu Gin Ala Leu 405 410 415
Asp Asn Pro Glu Tyr His Asn Ala Ser Asn Gly Pro Pro Lys Ala Glu 420 425 430
Asp Glu Tyr Val Asn Glu Pro Leu Tyr Leu Asn Thr Phe Ala Asn Thr 435 440 445
Leu Gly Lys Ala Glu Tyr Leu Lys Asn Asn He Leu Ser Met Pro Glu 450 455 460
Lys Ala Lys Lys Ala Phe Asp Asn Pro Asp Tyr Trp Asn His Ser Leu 465 470 475 480
Pro Pro Arg Ser Thr Leu Gin His Pro Asp Tyr Leu Gin Glu Tyr Ser 485 490 495
Thr Lys Tyr Phe Tyr Lys Gin Asn Gly Arg He Arg Pro He Val Ala 500 505 510
Glu Asn Pro Glu Tyr Leu Ser Glu Phe Ser Leu Lys Pro Gly Thr Val 515 520 525
Leu Pro Pro Pro Pro Tyr Arg His Arg Asn Thr Val Val 530 535 540 (2) INFORMATION FOR SEQ ID NO:7 •
(l) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1210 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS : unknown
(D) TOPOLOGY: unknown
(n) MOLECULE TYPE: protein
(Xl) SEQUENCE DESCRIPTION SEQ ID NO: 7
Met Arg Pro Ser Gly Thr Ala Gly Ala Ala Leu Leu Ala Leu Leu Ala 1 5 10 15
Ala Leu Cys Pro Ala Ser Arg Ala Leu Glu Glu Lys Lys Val Cys Gin 20 25 30
Gly Thr Ser Asn Lys Leu Thr Gin Leu Gly Thr Phe Glu Asp His Phe 35 40 45
Leu Ser Leu Gin Arg Met Phe Asn Asn Cys Glu Val Val Leu Gly Asn 50 55 60
Leu Glu He Thr Tyr Val Gin Arg Asn Tyr Asp Leu Ser Phe Leu Lys 65 70 75 80
Thr He Gin Glu Val Ala Gly Tyr Val Leu He Ala Leu Asn Thr Val 85 90 95
Glu Arg He Pro Leu Glu Asn Leu Gin He He Arg Gly Asn Met Tyr 100 105 110
Tyr Glu Asn Ser Tyr Ala Leu Ala Val Leu Ser Asn Tyr Asp Ala Asn 115 120 125
Lys Thr Gly Leu Lys Glu Leu Pro Met Arg Asn Leu Gin Glu He Leu 130 135 140
His Gly Ala Val Arg Phe Ser Asn Asn Pro Ala Leu Cys Asn Val Glu 145 150 155 160
Ser He Gin Trp Arg Asp He Val Ser Ser Asp Phe Leu Ser Asn Met 165 170 175
Ser Met Asp Phe Gin Asn His Leu Gly Ser Cys Gin Lys Cys Asp Pro 180 185 190
Ser Cys Pro Asn Gly Ser Cys Trp Gly Ala Gly Glu Glu Asn Cys Gin 195 200 205
Lys Leu Thr Lys He He Cys Ala Gin Gin Cys Ser Gly Arg Cys Arg 210 215 ' 220
Gly Lys Ser Pro Ser Asp Cys Cys His Asn Gin Cys Ala Ala Gly Cys 225 230 235 240
Thr Gly Pro Arg Glu Ser Asp Cys Leu Val Cys Arg Lys Phe Arg Asp 245 250 " 255
Glu Ala Thr Cys Lys Asp Thr Cys Pro Pro Leu Met Leu Tyr Asn Pro 260 265 270
Thr Thr Tyr Gin Met Asp Val Asn Pro Glu Gly Lys Tyr Ser Phe Gly 275 280 285
Ala Thr Cys Val Lys Lys Cys Pro Arg Asn Tyr Val Val Thr Asp His 290 295 300
Gly Ser Cys Val Arg Ala Cys Gly Ala Asp Ser Tyr Glu Met Glu Glu 305 310 315 320
Asp Gly Val Arg Lys Cys Lys Lys Cys Glu Gly Pro Cys Arg Lys Val 325 330 335
Cys Asn Gly He Gly He Gly Glu Phe Lys Asp Ser Leu Ser He Asn 340 345 350
Ala Thr Asn He Lys His Phe Lys Asn Cys Thr Ser He Ser Gly Asp 355 360 365
Leu His He Leu Pro Val Ala Phe Arg Gly Asp Ser Phe Thr His Thr 370 375 380
Pro Pro Leu Asp Pro Gin Glu Leu Asp He Leu Lys Thr Val Lys Glu 385 390 395 400
He Thr Gly Phe Leu Leu He Gin Ala Trp Pro Glu Asn Arg Thr Asp 405 410 415
Leu His Ala Phe Glu Asn Leu Glu He He Arg Gly Arg Thr Lys Gin 420 425 430
His Gly Gin Phe Ser Leu Ala Val Val Ser Leu Asn He Thr Ser Leu 435 440 445
Gly Leu Arg Ser Leu Lys Glu He Ser Asp Gly Asp Val He He Ser 450 455 460
Gly Asn Lys Asn Leu Cys Tyr Ala Asn Thr He Asn Trp Lys Lys Leu 465 470 475 480
Phe Gly Thr Ser Gly Gin Lys Thr Lys He He Ser Asn Arg Gly Glu 485 490 495
Asn Ser Cys Lys Ala Thr Gly Gin Val Cys His Ala Leu Cys Ser Pro 500 505 510
Glu Gly Cys Trp Gly Pro Glu Pro Arg Asp Cys Val Ser Cys Arg 515 520 525
Ser Arg Gly Arg Glu Cys Val Asp Lys Cys Lys Leu Leu Glu Gly 530 535 540
Glu Pro Arg Glu Phe Val Glu Asn Ser Glu Cys He Gin Cys His Pro 545 550 555 560
Glu Cys Leu Pro Gin Ala Met Asn He Thr Cys Thr Gly Arg Gly Pro
565 570 575
Asp Asn Cys He Gin Cys Ala His Tyr He Asp Gly Pro His Cys Val 580 585 590
Lys Thr Cys Pro Ala Gly Val Met Gly Glu Asn Asn Thr Leu Val Trp 595 600 605
Lys Tyr Ala Asp Ala Gly His Val Cys His Leu Cys His Pro Asn Cys 610 615 620 Thr Tyr Gly Cys Thr Gly Pro Gly Leu Glu Gly Cys Pro Thr Asn Gly
625 630 635 640
Pro Lys He Pro Ser He Ala Thr Gly Met Val Gly Ala Leu Leu Leu
645 650 655
Leu Leu Val Val Ala Leu Gly He Gly Leu Phe Met Arg Arg Arg His 660 665 670
He Val Arg Lys Arg Thr Leu Arg Arg Leu Leu Gin Glu Arg Glu Leu 675 680 685
Val Glu Pro Leu Thr Pro Ser Gly Glu Ala Pro Asn Gin Ala Leu Leu 690 695 700
Arg He Leu Lys Glu Thr Glu Phe Lys Lys He Lys Val Leu Gly Ser 705 710 715 720
Gly Ala Phe Gly Thr Val Tyr Lys Gly Leu Trp He Pro Glu Gly Glu
725 730 735
Lys Val Lys He Pro Val Ala He Lys Glu Leu Arg Glu Ala Thr Ser 740 745 750
Pro Lys Ala Asn Lys Glu He Leu Asp Glu Ala Tyr Val Met Ala Ser 755 760 765
Val Asp Asn Pro His Val Cys Arg Leu Leu Gly He Cys Leu Thr Ser 770 775 780
Thr Val Gin Leu He Thr Gin Leu Met Pro Phe Gly Cys Leu Leu Asp 785 790 795 800
Tyr Val Arg Glu His Lys Asp Asn He Gly Ser Gin Tyr Leu Leu Asn
805 810 815
Trp Cys Val Gin He Ala Lys Gly Met Met Tyr Leu Glu Asp Arg Arg 820 825 830
Leu Val His Arg Asp Leu Ala Ala Arg Asn Val Leu Val Lys Thr Pro 835 840 845
Gin His Val Lys He Thr Asp Phe Gly Leu Ala Lys Leu Leu Gly Ala 850 855 860
Glu Glu Lys Glu Tyr His Ala Glu Gly Gly Lys Val Pro He Lys Trp 865 870 875 880
Met Ala Leu Glu Ser He Leu His Arg He Tyr Thr His Gin Ser 885 890 895
Val Trp Ser Tyr Gly Val Thr Val Trp Glu Leu Met Thr Phe Gly 900 905 910
Lys Pro Tyr Asp Gly He Pro Ala Ser Glu He Ser Ser He Leu Glu 915 920 925 Lys Gly Glu Arg Leu Pro Gin Pro Pro He Cys Thr He Asp Val Tyr 930 935 940
Met He Met Val Lys Cys Trp Met He Asp Ala Asp Ser Arg Pro Lys 945 950 955 960
Arg Glu Leu He He Glu Phe Ser Lys Met Ala Arg Asp Pro Gin
965 970 975
Tyr Leu Val He Gin Gly Asp Glu Arg Met His Leu Pro Ser Pro
980 985 990
Thr Asp Ser Asn Phe Tyr Arg Ala Leu Met Asp Glu Glu Asp Met Asp 995 1000 1005
Asp Val Val Asp Ala Asp Glu Tyr Leu He Pro Gin Gin Gly Phe Phe 1010 1015 1020
Ser Ser Pro Ser Thr Ser Arg Thr Pro Leu Leu Ser Ser Leu Ser Ala 1025 1030 1035 1040
Thr Ser Asn Asn Ser Thr Val Ala Cys He Asp Arg Asn Gly Leu Gin
1045 1050 1055
Ser Cys Pro He Lys Glu Asp Ser Phe Leu Gin Arg Tyr Ser Ser Asp 1060 1065 1070
Pro Thr Gly Ala Leu Thr Glu Asp Ser He Asp Asp Thr Phe Leu Pro 1075 1080 1085
Val Pro Glu Tyr He Asn Gin Ser Val Pro Lys Arg Pro Ala Gly Ser 1090 1095 1100
Val Gin Asn Pro Val Tyr His Asn Gin Pro Leu Asn Pro Ala Pro Ser 1105 1110 1115 1120
Arg Asp Pro His Tyr Gin Asp Pro His Ser Thr Ala Val Gly Asn Pro
1125 1130 1135
Glu Tyr Leu Asn Thr Val Gin Pro Thr Cys Val Asn Ser Thr Phe Asp 1140 1145 1150
Ser Pro Ala His Trp Ala Gin Lys Gly Ser His Gin He Ser Leu Asp 1155 1160 1165
Asn Pro Asp Tyr Gin Gin Asp Phe Phe Pro Lys Glu Ala Lys Pro Asn 1170 1175 1180
Gly He Phe Lys Gly Ser Thr Ala Glu Asn Ala Glu Tyr Leu Arg Val 1185 1190 1195 1200
Ala Pro Gin Ser Ser Glu Phe He Gly Ala 1205 1210
(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1255 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS : unknown (D) TOPOLOGY: unknown (11) MOLECULE TYPE, protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8 :
Met Glu Leu Ala Ala Leu Cys Arg Trp Gly Leu Leu Leu Ala Leu Leu 1 5 10 15
Pro Pro Gly Ala Ala Ser Thr Gin Val Cys Thr Gly Thr Asp Met Lys 20 25 30
Leu Arg Leu Pro Ala Ser Pro Glu Thr His Leu Asp Met Leu Arg His 35 40 45
Leu Tyr Gin Gly Cys Gin Val Val Gin Gly Asn Leu Glu Leu Thr Tyr 50 55 60
Leu Pro Thr Asn Ala Ser Leu Ser Phe Leu Gin Asp He Gin Glu Val 65 70 75 80
Gin Gly Tyr Val Leu He Ala His Asn Gin Val Arg Gin Val Pro Leu
85 90 95
Gin Arg Leu Arg He Val Arg Gly Thr Gin Leu Phe Glu Asp Asn Tyr 100 105 110
Ala Leu Ala Val Leu Asp Asn Gly Asp Pro Leu Asn Asn Thr Thr Pro 115 120 125
Val Thr Gly Ala Ser Pro Gly Gly Leu Arg Glu Leu Gin Leu Arg Ser 130 135 140
Leu Thr Glu He Leu Lys Gly Gly Val Leu He Gin Arg Asn Pro Gin 145 150 155 160
Leu Cys Tyr Gin Asp Thr He Leu Trp Lys Asp He Phe His Lys Asn
165 170 175
Asn Gin Leu Ala Leu Thr Leu He Asp Thr Asn Arg Ser Arg Ala Cys 180 185 190
His Pro Cys Ser Pro Met Cys Lys Gly Ser Arg Cys Trp Gly Glu Ser 195 200 205
Ser Glu Asp Cys Gin Ser Leu Thr Arg Thr Val Cys Ala Gly Gly Cys 210 215 220
Ala Arg Cys Lys Gly Pro Leu Pro Thr Asp Cys Cys His Glu Gin Cys 225 230 235 240
Ala Ala Gly Cys Thr Gly Pro Lys His Ser Asp Cys Leu Ala Cys Leu
245 250 255
His Phe Asn His Ser Gly He Cys Glu Leu His Cys Pro Ala Leu Val 260 265 270
Thr Tyr Asn Thr Asp Thr Phe Glu Ser Met Pro Asn Pro Glu Gly Arg 275 280 285 Tyr Thr Phe Gly Ala Ser Cys Val Thr Ala Cys Pro Tyr Asn Tyr Leu 290 295 300
Ser Thr Asp Val Gly Ser Cys Thr Leu Val Cys Pro Leu His Asn Gin 305 310 315 320
Glu Val Thr Ala Glu Asp Gly Thr Gin Arg Cys Glu Lys Cys Ser Lys
325 330 335
Pro Cys Ala Arg Val Cys Tyr Gly Leu Gly Met Glu His Leu Arg Glu 340 345 350
Val Arg Ala Val Thr Ser Ala Asn He Gin Glu Phe Ala Gly Cys Lys 355 360 365
Lys He Phe Gly Ser Leu Ala Phe Leu Pro Glu Ser Phe Asp Gly Asp 370 375 3B0
Pro Ala Ser Asn Thr Ala Pro Leu Gin Pro Glu Gin Leu Gin Val Phe 385 390 395 400
Glu Thr Leu Glu Glu He Thr Gly Tyr Leu Tyr He Ser Ala Trp Pro
405 410 415
Asp Ser Leu Pro Asp Leu Ser Val Phe Gin Asn Leu Gin Val He Arg 420 425 430
Gly Arg He Leu His Asn Gly Ala Tyr Ser Leu Thr Leu Gin Gly Leu 435 440 445
Gly He Ser Trp Leu Gly Leu Arg Ser Leu Arg Glu Leu Gly Ser Gly 450 455 460
Leu Ala Leu He His His Asn Thr His Leu Cys Phe Val His Thr Val 465 470 475 480
Pro Trp Asp Gin Leu Phe Arg Asn Pro His Gin Ala Leu Leu His Thr
485 490 495
Ala Asn Arg Pro Glu Asp Glu Cys Val Gly Glu Gly Leu Ala Cys His 500 505 510
Gin Leu Cys Ala Arg Arg Ala Leu Leu Gly Ser Gly Pro Thr Gin Cys 515 S20 525
Val Asn Cys Ser Gin Phe Leu Arg Gly Gin Glu Cys Val Glu Glu Cys 530 535 540
Arg Val Leu Gin Gly Leu Pro Arg Glu Tyr Val Asn Ala Arg His Cys 545 550 555 560
Leu Pro Cys His Pro Glu Cys Gin Pro Gin Asn Gly Ser Val Thr Cys
565 570 575
Phe Gly Pro Glu Ala Asp Gin Cys Val Ala Cys Ala His Tyr Lys Asp 580 585 590
Pro Pro Phe Cys Val Ala Arg Cys Pro Ser Gly Val Lys Pro Asp Leu 595 600 605
Ser Tyr Met Pro He Trp Lys Phe Pro Asp Glu Glu Gly Ala Cys Gin 610 615 620
Pro Cys Pro He Asn Cys Thr His Ser Cys Val Asp Leu Asp Asp Lys 625 630 635 640
Gly Cys Pro Ala Glu Gin Arg Ala Ser Pro Leu Thr Ser He Val Ser
645 650 655
Ala Val Val Gly He Leu Leu Val Val Val Leu Gly Val Val Phe Gly
660 665 670
He Leu He Lys Arg Arg Gin Gin Lys He Arg Lys Tyr Thr Met Arg
675 680 685
Arg Leu Leu Gin Glu Thr Glu Leu Val Glu Pro Leu Thr Pro Ser Gly
690 695 700
Ala Met Pro Asn Gin Ala Gin Met Arg He Leu Lys Glu Thr Glu Leu
705 710 715 720
Arg Lys Val Lys Val Leu Gly Ser Gly Ala Phe Gly Thr Val Tyr Lys
725 730 735
Gly He Trp He Pro Asp Gly Glu Asn Val Lys He Pro Val Ala He
740 745 750
Lys Val Leu Arg Glu Asn Thr Ser Pro Lys Ala Asn Lys Glu He Leu
755 760 765
Asp Glu Ala Tyr Val Met Ala Gly Val Gly Ser Pro Tyr Val Ser Arg
770 775 780
Leu Leu Gly He Cys Leu Thr Ser Thr Val Gin Leu Val Thr Gin Leu
785 790 795 800
Met Pro Tyr Gly Cys Leu Leu Asp His Val Arg Glu Asn Arg Gly Arg
805 810 815
Leu Gly Ser Gin Asp Leu Leu Asn Trp Cys Met Gin He Ala Lys Gly
820 825 830
Met Ser Tyr Leu Glu Asp Val Arg Leu Val His Arg Asp Leu Ala Ala
835 840 845
Arg Asn Val Leu Val Lys Ser Pro Asn His Val Lys He Thr Asp Phe
850 855 860
Gly Leu Ala Arg Leu Leu Asp He Asp Glu Thr Glu Tyr His Ala Asp
865 870 875 880
Gly Gly Lys Val Pro He Lys Trp Met Ala Leu Glu Ser He Leu Arg
885 890 895
Arg Arg Phe Thr His Gin Ser Asp Val Trp Ser Tyr Gly Val Thr Val
900 905 910
Trp Glu Leu Met Thr Phe Gly Ala Lys Pro Tyr Asp Gly He Pro Ala
915 920 925
Arg Glu He Pro Asp Leu Leu Glu Lys Gly Glu Arg Leu Pro Gin Pro
930 935 940
Pro He Cys Thr He Asp Val Tyr Met He Met Val Lys Cys Trp Met
945 950 955 960
He Asp Ser Glu Cys Arg Pro Arg Phe Arg Glu Leu Val Ser Glu Phe
965 970 975
Ser Arg Met Ala Arg Asp Pro Gin Arg Phe Val Val He Gin Asn Glu 980 985 990
Asp Leu Gly Pro Ala Ser Pro Leu Asp Ser Thr Phe Tyr Arg Ser Leu 995 1000 1005
Leu Glu Asp Asp Asp Met Gly Asp Leu Val Asp Ala Glu Glu Tyr Leu 1010 1015 1020
Val Pro Gin Gin Gly Phe Phe Cys Pro Asp Pro Ala Pro Gly Ala Gly 1025 1030 1035 1040
Gly Met Val His His Arg His Arg Ser Ser Ser Thr Arg Ser Gly Gly
1045 1050 1055
Gly Asp Leu Thr Leu Gly Leu Glu Pro Ser Glu Glu Glu Ala Pro Arg 1060 1065 1070
Ser Pro Leu Ala Pro Ser Glu Gly Ala Gly Ser Asp Val Phe Asp Gly 1075 1080 1085
Asp Leu Gly Met Gly Ala Ala Lys Gly Leu Gin Ser Leu Pro Thr His 1090 1095 1100
Asp Pro Ser Pro Leu Gin Arg Tyr Ser Glu Asp Pro Thr Val Pro Leu 1105 1110 1115 1120
Pro Ser Glu Thr Asp Gly Tyr Val Ala Pro Leu Thr Cys Ser Pro Gin
1125 1130 1135
Pro Glu Tyr Val Asn Gin Pro Asp Val Arg Pro Gin Pro Pro Ser Pro 1140 1145 1150
Arg Glu Gly Pro Leu Pro Ala Ala Arg Pro Ala Gly Ala Thr Leu Glu 1155 1160 1165
Arg Ala Lys Thr Leu Ser Pro Gly Lys Asn Gly Val Val Lys Asp Val 1170 1175 1180
Phe Ala Phe Gly Gly Ala Val Glu Asn Pro Glu Tyr Leu Thr Pro Gin 1185 1190 1195 1200
Gly Gly Ala Ala Pro Gin Pro His Pro Pro Pro Ala Phe Ser Pro Ala
1205 1210 1215
Phe Asp Asn Leu Tyr Tyr Trp Asp Gin Asp Pro Pro Glu Arg Gly Ala 1220 1225 1230
Pro Pro Ser Thr Phe Lys Gly Thr Pro Thr Val Ala Glu Asn Pro Glu 1235 1240 1245
Tyr Gly Leu Asp Val Pro Val
1250 1255
(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1342 amino acids
(B) TYPE: ammo acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: protein
(XI) SEQUENCE DESCRIPTION: SEQ ID NO: 9 : Met Arg Ala Asn Asp Ala Leu Gin Val Leu Gly Leu Leu Phe Ser Leu 1 5 10 15
la Arg Gly Ser Glu Val Gly Asn Ser Gin Ala Val Cys Pro Gly Thr 20 25 30
Leu Asn Gly Leu Ser Val Thr Gly Asp Ala Glu Asn Gin Tyr Gin Thr 35 40 45
Leu Tyr Lys Leu Tyr Glu Arg Cys Glu Val Val Met Gly Asn Leu Glu 50 55 60
He Val Leu Thr Gly His Asn Ala Asp Leu Ser Phe Leu Gin Trp He
65 70 75 80
Arg Glu Val Thr Gly Tyr Val Leu Val Ala Met Asn Glu Phe Ser Thr
85 90 95
Leu Pro Leu Pro Asn Leu Arg Val Val Arg Gly Thr Gin Val Tyr Asp
100 105 110
Gly Lys Phe Ala He Phe Val Met Leu Asn Tyr Asn Thr Asn Ser Ser 115 120 125
His Ala Leu Arg Gin Leu Arg Leu Thr Gin Leu Thr Glu He Leu Ser
130 135 140
Gly Gly Val Tyr He Glu Lys Asn Asp Lys Leu Cys His Met Asp Thr
145 150 155 160
He Asp Trp Arg Asp He Val Arg Asp Arg Asp Ala Glu He Val Val
165 170 175
Lys Asp Asn Gly Arg Ser Cys Pro Pro Cys His Glu Val Cys Lys Gly 180 185 190
Arg Cys Trp Gly Pro Gly Ser Glu Asp Cys Gin Thr Leu Thr Lys Thr
195 200 205
He Cys Ala Pro Gin Cys Asn Gly His Cys Phe Gly Pro Asn Pro Asn
210 215 ' 220
Gin Cys Cys His Asp Glu Cys Ala Gly Gly Cys Ser Gly Pro Gin Asp
225 230 235 240
Thr Asp Cys Phe Ala Cys Arg His Phe Asn Asp Ser Gly Ala Cys Val
245 250 255
Pro Arg Cys Pro Gin Pro Leu Val Tyr Asn Lys Leu Thr Phe Gin Leu
260 265 270
Glu Pro Asn Pro His Thr Lys Tyr Gin Tyr Gly Gly Val Cys Val Ala
275 280 285
Ser Cys Pro His Asn Phe Val Val Asp Gin Thr Ser Cys Val Arg Ala
290 295 300
Cys Pro Pro Asp Lys Met Glu Val Asp Lys Asn Gly Leu Lys Met Cys
305 310 315 320
Glu Pro Cys Gly Gly Leu Cys Pro Lys Ala Cys Glu Gly Thr Gly Ser
325 330 335 Gly Ser Arg Phe Gin Thr Val Asp Ser Ser Asn He Asp Gly Phe Val
340 345 350
Asn Cys Thr Lys He Leu Gly Asn Leu Asp Phe Leu He Thr Gly Leu
355 360 365
Asn Gly Asp Pro Trp His Lys He Pro Ala Leu Asp Pro Glu Lys Leu
370 375 380
Asn Val Phe Arg Thr Val Arg Glu He Thr Gly Tyr Leu Asn He Gin
385 390 395 400
Ser Trp Pro Pro His Met His Asn Phe Ser Val Phe Ser Asn Leu Thr
405 410 415
Thr He Gly Gly Arg Ser Leu Tyr Asn Arg Gly Phe Ser Leu Leu He
420 425 430
Met Lys Asn Leu Asn Val Thr Ser Leu Gly Phe Arg Ser Leu Lys Glu 435 440 445
He Ser Ala Gly Arg He Tyr He Ser Ala Asn Arg Gin Leu Cys Tyr 450 455 460
His His Ser Leu Asn Trp Thr Lys Val Leu Arg Gly Pro Thr Glu Glu
465 470 475 480
Arg Leu Asp He Lys His Asn Arg Pro Arg Arg Asp Cys Val Ala Glu
485 490 495
Gly Lys Val Cys Asp Pro Leu Cys Ser Ser Gly Gly Cys Trp Gly Pro
500 505 510
Gly Pro Gly Gin Cys Leu Ser Cys Arg Asn Tyr Ser Arg Gly Gly Val 515 520 525
Cys Val Thr His Cys Asn Phe Leu Asn Gly Glu Pro Arg Glu Phe Ala 530 535 540
His Glu Ala Glu Cys Phe Ser Cys His Pro Glu Cys Gin Pro Met Gly 545 550 555 560
Gly Thr Ala Thr Cys Asn Gly Ser Gly Ser ASD Thr Cys Ala Gin Cys
565 570 575
Ala His Phe Arg Asp Gly Pro His Cys Val Ser Ser Cys Pro His Gly 580 585 590
Val Leu Gly Ala Lys Gly Pro He Tyr Lys Tyr Pro Asp Val Gin Asn 595 600 605
Glu Cys Arg Pro Cys His Glu Asn Cys Thr Gin Gly Cys Lys Gly Pro 610 615 620
Glu Leu Gin Asp Cys Leu Gly Gin Thr Leu Val Leu He Gly Lys Thr 625 630 635 640
His Leu Thr Met Ala Leu Thr Val He Ala Gly Leu Val Val He Phe
645 650 655
Met. Met Leu Gly Gly Thr Phe Leu Tyr Trp Arg Gly Arg Arg He Gin 660 665 670 Asn Lys Arg Ala Met Arg Arg Tyr Leu Glu Arg Gly Glu Ser He Glu 675 680 685
Pro Leu Asp Pro Ser Glu Lys Ala Asn Lys Val Leu Ala Arg He Phe 690. 695 700
Lys Glu Thr Glu Leu Arg Lys Leu Lys Val Leu Gly Ser Gly Val Phe 705 710 715 720
Gly Thr Val His Lys Gly Val Trp He Pro Glu Gly Glu Ser He Lys
725 730 735 le Pro Val Cys He Lys Val He Glu Asp Lys Ser Gly Arg Gin Ser 740 745 750
Phe Gin Ala Val Thr Asp His Met Leu Ala He Gly Ser Leu Asp His 755 760 765
Ala His He Val Arg Leu Leu Gly Leu Cys Pro Gly Ser Ser Leu Gin
770 775 780
Leu Val Thr Gin Tyr Leu Pro Leu Gly Ser Leu Leu Asp His Val Arg 785 790 795 800
Gin His Arg Gly Ala Leu Gly Pro Gin Leu Leu Leu Asn Trp Gly Val
805 810 815
Gin He Ala Lys Gly Met Tyr Tyr Leu Glu Glu His Gly Met Val His 820 825 830
Arg Asn Leu Ala Ala Arg Asn Val Leu Leu Lys Ser Pro Ser Gin Val 835 840 845
Gin Val Ala Asp Phe Gly Val Ala Asp Leu Leu Pro Pro Asp Asp Lys
850 855 860
Gin Leu Leu Tyr Ser Glu Ala Lys Thr Pro He Lys Trp Met Ala Leu 865 870 875 8B0
Glu Ser He His Phe Gly Lys Tyr Thr His Gin Ser Asp Val Trp Ser
885 890 895
Tyr Gly Val Thr Val Trp Glu Leu Met Thr Phe Gly Ala Glu Pro Tyr
900 905 910
Ala Gly Leu Arg Leu Ala Glu Val Pro Asp Leu Leu Glu Lys Gly Glu
915 920 925
Arg Leu Ala Gin Pro Gin He Cys Thr He Asp Val Tyr Met Val Met
930 935 940
Val Lys Cys Trp Met He Asp Glu Asn He Arg Pro Thr Phe Lys Glu
945 950 955 960
Leu Ala Asn Glu Phe Thr Arg Met Ala Arg Asp Pro Pro Arg Tyr Leu
965 970 975
Val He Lys Arg Glu Ser Gly Pro Gly He Ala Pro Gly Pro Glu Pro
980 985 990
His Gly Leu Thr Asn Lys Lys Leu Glu Glu Val Glu Leu Glu Pro Glu
995 1000 1005
Leu Asp Leu Asp Leu Asp Leu Glu Ala Glu Glu Asp Asn Leu Ala Thr
1010 * * 1015 1020 Thr Thr Leu Gly Ser Ala Leu Ser Leu Pro Val Gly Thr Leu Asn Arg 1025 1030 1035 1040
Pro Arg Gly Ser Gin Ser Leu Leu Ser Pro Ser Ser Gly Tyr Met Pro
1045 1050 1055
Met Asn Gin Gly Asn Leu Gly Gly Ser Cys Gin Glu Ser Ala Val Ser 1060 1065 1070
Gly Ser Ser Glu Arg Cys Pro Arg Pro Val Ser Leu His Pro Met Pro 1075 1080 1085
Arg Gly Cys Leu Ala Ser Glu Ser Ser Glu Gly His Val Thr Gly Ser 1090 1095 1100
Glu Ala Glu Leu Gin Glu Lys Val Ser Met Cys Arg Ser Arg Ser Arg 1105 1110 HIS 1120
Ser Arg Ser Pro Arg Pro Arg Gly Asp Ser Ala Tyr His Ser Gin Arg
1125 1130 1135
His Ser Leu Leu Thr Pro Val Thr Pro Leu Ser Pro Pro Gly Leu Glu 1140 1145 1150
Glu Glu Asp Val Asn Gly Tyr Val Met Pro Asp Thr His Leu Lys Gly 1155 1160 1165
Thr Pro Ser Ser Arg Glu Gly Thr Leu Ser Ser Val Gly Leu Ser Ser 1170 1175 1180
Val Leu Gly Thr Glu Glu Glu Asp Glu Asp Glu Glu Tyr Glu Tyr Met 1185 1190 1195 1200
Asn Arg Arg Arg Arg His Ser Pro Pro His Pro Pro Arg Pro Ser Ser
1205 1210 1215
Leu Glu Glu Leu Gly Tyr Glu Tyr Met Asp Val Gly Ser Asp Leu Ser 1220 1225 1230
Ala Ser Leu Gly Ser Thr Gin Ser Cys Pro Leu His Pro Val Pro He 1235 1240 1245
Met Pro Thr Ala Gly Thr Thr Pro Asp Glu Asp Tyr Glu Tyr Met Asn 1250 1255 1260
Arg Gin Arg Asp Gly Gly Gly Pro Gly Gly Asp Tyr Ala Ala Met Gly 1265 1270 1275 1280
Ala Cys Pro Ala Ser Glu Gin Gly Tyr Glu Glu Met Arg Ala Phe Gin
1285 1290 1295
Gly Pro Gly His Gin Ala Pro His Val His Tyr Ala Arg Leu Lys Thr 1300 1305 1310
Leu Arg Ser Leu Glu Ala Thr Asp Ser Ala Phe Asp Asn Pro Asp Tyr 1315 1320 1325
Trp His Ser Arg Leu Phe Pro Lys Ala Asn Ala Gin Arg Thr 1330
1335 1340
(2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 911 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10:
Met Lys Pro Ala Thr Gly Leu Trp Val Trp Val Ser Leu Leu Val Ala 1 5 10 15
Ala Gly Thr Val Gin Pro Ser Asp Ser Gin Ser Val Cys Ala Gly Thr 20 25 30
Glu Asn Lys Leu Ser Ser Leu Ser Asp Leu Glu Gin Gin Tyr Arg Ala 35 40 45
Leu Arg Lys Tyr Tyr Glu Asn Cys Glu Val Val Met Gly Asn Leu Glu 50 55 60
He Thr Ser He Glu His Asn Arg Asp Leu Ser Phe Leu Arg Ser Val 65 70 75 80
Arg Glu Val Thr Gly Tyr Val Leu Val Ala Leu Asn Gin Phe Arg Tyr
85 90 95
Leu Pro Leu Glu Asn Leu Arg He He Arg Gly Thr Lys Leu Tyr Glu 100 105 110
Asp Arg Tyr Ala Leu Ala He Phe Leu Asn Tyr Arg Lys Asp Gly Asn 115 120 125
Figure imgf000148_0001
305 310 315 320
Lys Met Cys Lys Pro Cys Thr Asp He Cys Pro Lys Ala Cys Asp Gly
325 330 335
le Gly Thr Gly Ser Leu Met Ser Ala Gin Thr Val Asp Ser Ser Asn 340 345 350
He Asp Lys Phe He Asn Cys Thr Lys He Asn Gly Asn Leu He Phe 355 360 365
Leu Val Thr Gly He His Gly Asp Pro Tyr Asn Ala He Glu Ala He 370 375 380
Asp Pro Glu Lys Leu Asn Val Phe Arg Thr Val Arg Glu He Thr Gly 385 390 395 400
Phe Leu Asn He Gin Ser Trp Pro Pro Asn Met Thr Asp Phe Ser Val
405 410 415
Phe Ser Asn Leu Val Thr He Gly Gly Arg Val Leu Tyr Ser Gly Leu 420 425 430
Ser Leu Leu He Leu Lys Gin Gin Gly He Thr Ser Leu Gin Phe Gin 435 440 445
Ser Leu Lys Glu He Ser Ala Gly Asn He Tyr He Thr Asp Asn Ser 450 455 460
Asn Leu Cys Tyr Tyr His Thr He Asn Trp Thr Thr Leu Phe Ser Thr 465 470 475 480
He Asn Gin Arg He Val He Arg Asp Asn Arg Lys Ala Glu Asn Cys
485 490 495
Thr Ala Glu Gly Met Val Cys Asn His Leu Cys Ser Ser Asp Gly Cys 500 505 510
Trp Gly Pro Gly Pro Asp Gin Cys Leu Ser Cys Arg Arg Phe Ser Arg 515 520 525
Gly Arg He Cys He Glu Ser Cys Asn Leu Tyr Asp Gly Glu Phe Arg 530 535 540
Glu Phe Glu Asn Gly Ser He Cys Val Glu Cys Asp Pro Gin Cys Glu 545 550 555 560
Lys Met Glu Asp Gly Leu Leu Thr Cys His Gly Pro Gly Pro Asp Asn
565 570 575
Cys Thr Lys Cys Ser His Phe Lys Asp Gly Pro Asn Cys Val Glu Lys 580 585 590
Cys Pro Asp Gly Leu Gin Gly Ala Asn Ser Phe He Phe Lys Tyr Ala 595 600 605
Asp Pro Asp Arg Glu Cys His Pro Cys His Pro Asn Cys Thr Gin Gly 610 615 620
Cys Asn Gly Pro Thr Ser His Asp Cys He Tyr Tyr Pro Trp Thr Gly 625 630 635 640
His _Ser Thr Leu Pro Gin Asp Pro Val Lys Val Lys Ala Leu Glu Gly
645 650 655 Phe Pro Arg Leu Val Gly Pro Asp Phe Phe Gly Cys Ala Glu Pro Ala 660 665 670
Asn Thr Phe Leu Asp Pro Glu Glu Pro Lys Ser Cys Asp Lys Thr His 675 680 685
Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val 690 695 700
Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met He Ser Arg Thr 705 710 715 720
Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu
725 730 735
Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Val Ala Lys 740 745 750
Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr Tyr Arg Val Val Ser 755 760 765
Val Leu Thr Val Leu His Gin Asp Trp Leu Asn Gly Lys Glu Tyr Lys 770 775 780
Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro He Glu Lys Thr He 785 790 795 800
Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin Val Tyr Thr Leu Pro
805 810 815
Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val Ser Leu Thr Cys Leu 820 825 830
Val Lys Gly Phe Tyr Pro Ser Asp He Ala Val Glu Trp Glu Ser Asn 835 840 845
Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser 850 855 860
Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg 865 870 875 " 880
Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu
885 890 895
His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu Ser Pro Gly Lys 900 905 910
(2) INFORMATION FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 ammo acids
(B) TYPE: amino acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: peptide
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:11
Gly Xaa Gly Xaa Xaa Gly
1 5
(2) INFORMATION FOR SEQ ID NO: 12: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:
Asp Leu Ala Ala Arg Asn 1 5
(2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:
Pro He Lys Trp Met Ala 1 5
(2) INFORMATION FOR SEQ ID NO:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14: ACNGTNTGGG ARYTNAYHAC 20
(2) INFORMATION FOR SEQ ID NO:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 15: CAYGTNAARA THACNGAYTT YGG ~ ~
(2) INFORMATION FOR SEQ ID NO:16: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY- unknown
(ii) MOLECULE TYPE: DNA (genomic)
(Xl) SEQUENCE DESCRIPTION: SEQ ID NO:16 GACGAATTCC NATHAARTGG ATGGC 25
(2) INFORMATION FOR SEQ ID NO: 17:
(l) SEQUENCE CHARACTERISTICS.
(A) LENGTH. 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: unknown
(ll) MOLECULE TYPE: DNA (genomic)
(Xl) SEQUENCE DESCRIPTION: SEQ ID NO: 17 ACAYTTNARD ATDATCATRT ANAC 24
(2) INFORMATION FOR SEQ ID NO:18:
(l) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(Xl) SEQUENCE DESCRIPTION. SEQ ID NO.18 AANGTCATNA RYTCCCA 17
(2) INFORMATION FOR SEQ ID NO:19:
(l) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION- SEQ ID NO:19 TCCAGNGCGA TCCAYTTDAT NGG 23
(2) INFORMATION FOR SEQ ID NO:20:
(l) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 18 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20: GGRTCDATCA TCCARCCT IB
(2) INFORMATION FOR SEQ ID NO: 21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: Single
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21: CTGCTGTCAG CATCGATCAT 20
(2) INFORMATION FOR SEQ ID NO:22:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:
Thr Val Trp Glu Leu Met Thr 1 5
(2) INFORMATION FOR SEQ ID NO:23:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino acids
(B) TYPE: amino acid
<C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:
His Val Lys He Thr Asp Phe Gly 1 5
(2) INFORMATION FOR SEQ ID NO:24:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown (11) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION- SEQ ID NO:24
Val Tyr Met He He Leu Lys
1 5
(2) INFORMATION FOR SEQ ID NO:25:
(l) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids
(B) TYPE: ammo acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY unknown
(n) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 25
Trp Glu Leu Met Thr Phe 1 5
(2) INFORMATION FOR SEQ ID NO:26:
(l) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino acids
(B) TYPE: ammo acid
(C) STRANDEDNESS unknown
(D) TOPOLOGY: unknown
(ll) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION SEQ ID NO:26
Pro He Lys Trp Met Ala Leu Glu
1 5
(2) INFORMATION FOR SEQ ID NO.27:
(l) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION. SEQ ID NO:27
Cys Trp Met He Asp Pro
1 5
(2) INFORMATION FOR SEQ ID NO:28:
(l) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 35 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY unknown (ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:28: GACTCGAGTC GACATCGATT TTTTTTTTTT TTTTT 35
(2) INFORMATION FOR SEQ ID NO:29:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:29 : GAAGAAAGAC GACTCGTTCA TCGG 24
(2) INFORMATION FOR SEQ ID NO: 30:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 30: GACCATGACC ATGTAAACGT CAATA 25
(2) INFORMATION FOR SEQ ID NO: 31:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:
Leu Ala Arg Leu Leu Glu Gly Asp Glu Lys Glu Tyr Asn Ala Asp Gly 1 5 10 15
Gly
(2) INFORMATION FOR SEQ ID NO: 32:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 13 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 32-
Glu Glu Asp Leu Glu Asp Met Met Asp Ala Glu Glu Tyr 1 5 10
(2) INFORMATION FOR SEQ ID NO:33:
(l) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: peptide
(ix) FEATURE:
(A) NAME/KEY: Xaa
(B) LOCATION: 3
(D) OTHER INFORMATION: "Xaa = Any amino acid"
(ix) FEATURE:
(A) NAME/KEY: Xaa
(B) LOCATION: 6
(D) OTHER INFORMATION: "Xaa = Any amino acid"
(ix) FEATURE:
(A) NAME/KEY: Xaa
(B) LOCATION: 7
(D) OTHER INFORMATION: "Xaa = Any amino acid"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 33:
Ser Gly Xaa Lys Pro Xaa Xaa Ala Ala
1 5
(2) INFORMATION FOR SEQ ID NO:34:
(l) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 34: CGGAAGCTTC TAGAGATCCC TCGAC 25
(2) INFORMATION FOR SEQ ID NO:35 :
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 50 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:35: GTTTTTACC TTTTTATCTT CTTTGTGTTC GGTTGTGTAT TTCACACGCC 50
(2) INFORMATION FOR SEQ ID NO:36:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 49 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:36: CAAAAATGGA AAAAATAGAA GAAACAGAAG CCATCTCATAA AGTGTGCGG 50
(2) INFORMATION FOR SEQ ID NO:37:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 37: GTTCTTTTTC GCCTCCTTGA GATGATTAGA TCTCTG 36
(2) INFORMATION FOR SEQ ID NO:38:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:38: GTCAGAGTTC ATATGGTAGT TAAGCCCCCC CAAAAC 36
(2) INFORMATION FOR SEQ ID NO:39:
(i) SEQUENCE CHARACTE ISTICS :
(A) LENGTH: 94 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:39: CAAAGATCCT CTAAGCTTGT AGAGTTCCTC CGATTTGTAA AAAGATGCCA TAACATAGTT 60 CTGGCAACGG TCGCCAGTAA ATTCGTTCGG GCACTTGCAC AAGTATCTTG ACGG 94
(2) INFORMATION FOR SEQ ID NO:40:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 95 ammo acids
(B) TYPE: am o acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:40:
Met Val Val Lys Pro Pro Gin Asn Lys Thr Glu Ser Glu Asn Thr Ser
1 5 10 15
Asp Lys Pro Lys Arg Lys Lys Lys Gly Gly Lys Asn Gly Lys Asn Arg 20 25 30
Arg Asn Arg Ser His Leu He Lys Cys Ala Glu Lys Glu Lys Thr Phe 35 40 45
Cys Val Asn Gly Gly Glu Cys Phe Thr Val Lys ASD Leu Ser Asn Pro 50 55 " 60
Ser Arg Tyr Leu Cys Lys Cys Pro Asn Glu Phe Thr Gly Asp Arg Cys 65 70 75 80
Gin Asn Tyr Val Met Ala Ser Phe Tyr Lys Ala Glu Glu Leu Tyr 85 90 95
INFORMATION FOR SEQ ID NO: 41:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1389 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..1386
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:41:
ATG GTA GTT AAG CCC CCC CAA AAC AAG ACG GAA AGT GAA AAT ACT TCA 48 Met Val Val Lys Pro Pro Gin Asn Lys Thr Glu Ser Glu Asn Thr Ser 1 5 10 15
GAT AAA CCC AAA AGA AAG AAA AAG GGA GGC AAA AAT GGA AAA AAT AGA 96 Asp Lys Pro Lys Arg Lys Lys Lys Gly Gly Lys Asn Gly Lys Asn Arg 20 25 30
AGA AAC AGA AGC CAT CTC ATA AAG TGT GCG GAG AAG GAG AAA ACT TTC 144 Arg Asn Arg Ser His Leu He Lys Cys Ala Glu Lys Glu Lys Thr Phe 35 40 45
TGT GTG AAT GGG GGC GAG TGC TTC ACG GTG AAG GAC CTG TCA AAC CCG 192 Cys Val Asn Gly Gly Glu Cys Phe Thr Val Lys Asp Leu Ser Asn Pro 50 55 60
TCA AGA TAC TTG TGC AAG TGC CCG AAC GAA TTT ACT GGC GAC CGT TGC 240 Ser Arg Tyr Leu Cys Lys Cys Pro Asn Glu Phe Thr Gly Asp Arg Cys 65 70 75 80
CAG AAC TAT GTT ATG GCA TCT TTT TAC AAA GCG GAG GAA CTC TAC AAG 288 Gin Asn Tyr Val Met Ala Ser Phe Tyr Lys Ala Glu Glu Leu Tyr Lys 85 90 95
CTT ATG GCC GAG GAA GGC GGC AGC CTG GCC GCG CTG ACC GCG CAC CAG 336 Leu Met Ala Glu Glu Gly Gly Ser Leu Ala Ala Leu Thr Ala His Gin 100 105 110
GCT TGC CAC CTG CCG CTG GAG ACT TTC ACC CGT CAT CGC CAG CCG CGC 384 Ala Cys His Leu Pro Leu Glu Thr Phe Thr Arg His Arg Gin Pro Arg 115 120 125
GGC TGG GAA CAA CTG GAG CAG TGC GGC TAT CCG GTG CAG CGG CTG GTC 432 Gly Trp Glu Gin Leu Glu Gin Cys Gly Tyr Pro Val Gin Arg Leu Val 130 135 140
GCC CTC TAC CTG GCG GCG CGG CTG TCG TGG AAC CAG GTC GAC CAG GTG 480 Ala Leu Tyr Leu Ala Ala Arg Leu Ser Trp Asn Gin Val Asp Gin Val 145 150 155 160
ATC CGC AAC GCC CTG GCC AGC CCC GGC AGC GGC GGC GAC CTG GGC GAA 528 He Arg Asn Ala Leu Ala Ser Pro Gly Ser Gly Gly Asp Leu Gly Glu 165 170 175
GCG ATC CGC GAG CAG CCG GAG CAG GCC CGT CTG GCC CTG ACC CTG GCC 576 Ala He Arg Glu Gin Pro Glu Gin Ala Arg Leu Ala Leu Thr Leu Ala 180 185 190
GCC GCC GAG AGC GAG CGC TTC GTC CGG CAG GGC ACC GGC AAC GAC GAG 624 Ala Ala Glu Ser Glu Arg Phe Val Arg Gin Gly Thr Gly Asn Asp Glu 195 200 205
GCC GGC GCG GCC AAC GCC GAC GTG GTG AGC CTG ACC TGC CCG GTC GCC 672 Ala Gly Ala Ala Asn Ala Asp Val Val Ser Leu Thr Cys Pro Val Ala 210 215 220
GCC GGT GAA TGC GCG GGC CCG GCG GAC AGC GGC GAC GCC CTG CTG GAG 720 Ala Gly Glu Cys Ala Gly Pro Ala Asp Ser Gly Asp Ala Leu Leu Glu 225 230 235 240
CGC AAC TAT CCC ACT GGC GCG GAG TTC CTC GGC GAC GGC GGC GAC GTC 768 Arg Asn Tyr Pro Thr Gly Ala Glu Phe Leu Gly Asp Gly Gly Asp Val 245 250 255
AGC TTC AGC ACC CGC GGC ACG CAG AAC TGG ACG GTG GAG CGG CTG CTC 816 Ser Phe Ser Thr Arg Gly Thr Gin Asn Trp Thr Val Glu Arg Leu Leu 260 265 270
CAG GCG CAC CGC CAA CTG GAG GAG CGC GGC TAT GTG TTC GTC GGC TAC 864 Gin Ala His Arg Gin Leu Glu Glu Arg Gly Tyr Val Phe Val Gly Tyr 275 280 285
CAC GGC ACC TTC CTC GAA GCG GCG CAA AGC ATC GTC TTC GGC GGG GTG 912 His Gly Thr Phe Leu Glu Ala Ala Gin Ser He Val Phe Gly Gly Val 290 295 300
CGC GCG CGC AGC CAG GAC CTC GAC GCG ATC TGG CGC GGT TTC TAT ATC 960 Arg Ala Arg Ser Gin Asp Leu Asp Ala He Trp Arg Gly Phe Tyr He 305 310 315 320 GCC GGC GAT CCG GCG CTG GCC TAC GGC TAC GCC CAG GAC CAG GAA CCC 1006 Ala Gly Asp Pro Ala Leu Ala Tyr Gly Tyr Ala Gin Asp Gin Glu Pro 325 330 335
GAC GCA CGC GGC CGG ATC CGC AAC GGT GCC CTG CTG CGG GTC TAT GTG 1056 Asp Ala Arg Gly Arg He Arg Asn Gly Ala Leu Leu Arg Val Tyr Val 340 345 350
CCG CGC TCG AGC CTG CCG GGC TTC TAC CGC ACC AGC CTG ACC CTG GCC 1104 Pro Arg Ser Ser Leu Pro Gly Phe Tyr Arg Thr Ser Leu Thr Leu Ala 355 360 365
GGC GGC GAG GCG GCG GGC GAG GTC GAA CGG CTG ATC GGC CAT CCG CTG 1152 Gly Gly Glu Ala Ala Gly Glu Val Glu Arg Leu He Gly His Pro Leu 370 375 380
CCG CTG CGC CTG GAC GCC ATC ACC GGC CCC GAG GAG GAA GGC GGG CGC 1200 Pro Leu Arg Leu Asp Ala He Thr Gly Pro Glu Glu Glu Gly Gly Arg 385 390 395 400
CTG GAG ACC ATT CTC GGC TGG CCG CTG GCC GAG CGC ACC GTG GTG ATT 1248 Leu Glu Thr He Leu Gly Trp Pro Leu Ala Glu Arg Thr Val Val He 405 410 415
CCC TCG GCG ATC CCC ACC GAC CCG CGC AAC GTC GGC GGC GAC CTC GAC 1296 Pro Ser Ala He Pro Thr Asp Pro Arg Asn Val Gly Gly Asp Leu Asp 420 425 430
CCG TCC AGC ATC CCC GAC AAG GAA CAG GCG ATC AGC GCC CTG CCG GAC 1344 Pro Ser Ser He Pro Asp Lys Glu Gin Ala He Ser Ala Leu Pro Asp 435 440 445
TAC GCC AGC CAG CCC GGC AAA CCG CCG CGC GAG GAC CTG AAG 1386
Tyr Ala Ser Gin Pro Gly Lys Pro Pro Arg Glu Asp Leu Lys 450 455 460
TAA
(2) INFORMATION FOR SEQ ID NO: 2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 462 amino acids
(B) TYPE: amino acid (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:42:
Met Val Val Lys Pro Pro Gin Asn Lys Thr Glu Ser Glu Asn Thr Ser 1 5 10 15
Asp Lys Pro Lys Arg Lys Lys Lys Gly Gly Lys Asn Gly Lys Asn Arg 20 25 30
Arg Asn Arg Ser His Leu He Lys Cys Ala Glu Lys Glu Lys Thr Phe 35 40 45
Cys Val Asn Gly Gly Glu Cys Phe Thr Val Lys Asp Leu Ser Asn Pro 50 55 60
Ser Arg Tyr Leu Cys Lys Cys Pro Asn Glu Phe Thr Gly Asp Arg Cys 65 70 75 B0
Gin Asn Tyr Val Met Ala Ser Phe Tyr Lys Ala Glu Glu Leu Tyr Lys 85 90 95
Leu Met Ala Glu Glu Gly Gly Ser Leu Ala Ala Leu Thr Ala His Gin 100 105 110
Ala Cys His Leu Pro Leu Glu Thr Phe Thr Arg His Arg Gin Pro Arg 115 120 125
Gly Trp Glu Gin Leu Glu Gin Cys Gly Tyr Pro Val Gin Arg Leu Val 130 135 140
Ala Leu Tyr Leu Ala Ala Arg Leu Ser Trp Asn Gin Val Asp Gin Val 145 150 155 160
He Arg Asn Ala Leu Ala Ser Pro Gly Ser Gly Gly Asp Leu Gly Glu 165 170 175
Ala He Arg Glu Gin Pro Glu Gin Ala Arg Leu Ala Leu Thr Leu Ala 180 185 190
Ala Ala Glu Ser Glu Arg Phe Val Arg Gin Gly Thr Gly Asn Asp Glu 195 200 205
Ala Gly Ala Ala Asn Ala Asp Val Val Ser Leu Thr Cys Pro Val Ala 210 215 220
Ala Gly Glu Cys Ala Gly Pro Ala Asp Ser Gly Asp Ala Leu Leu Glu 225 230 235 240
Arg Asn Tyr Pro Thr Gly Ala Glu Phe Leu Gly Asp Gly Gly Asp Val 245 250 255
Ser Phe Ser Thr Arg Gly Thr Gin Asn Trp Thr Val Glu Arg Leu Leu 260 265 270
Gin Ala His Arg Gin Leu Glu Glu Arg Gly Tyr Val Phe Val Gly Tyr 275 280 285
His Gly Thr Phe Leu Glu Ala Ala Gin Ser He Val Phe Gly Gly Val 290 295 300
Arg Ala Arg Ser Gin Asp Leu Asp Ala He Trp Arg Gly Phe Tyr He 305 310 315 320
Ala Gly Asp Pro Ala Leu Ala Tyr Gly Tyr Ala Gin Asp Gin Glu Pro 325 330 335
Asp Ala Arg Gly Arg He Arg Asn Gly Ala Leu Leu Arg Val Tyr Val 340 345 350
Pro Arg Ser Ser Leu Pro Gly Phe Tyr Arg Thr Ser Leu Thr Leu Ala 355 360 365
Gly Gly Glu Ala Ala Gly Glu Val Glu Arg Leu He Gly His Pro Leu 370 375 380
Pro Leu Arg Leu Asp Ala He Thr Gly Pro Glu Glu Glu Gly Gly Arg 385 390 395 400
Leu Glu Thr He Leu Gly Trp Pro Leu Ala Glu Arg Thr Val Val He 405 410 415
Pro Ser Ala He Pro Thr Asp Pro Arg Asn Val Gly Gly Asp Leu Asp 420 425 430
Pro Ser Ser He Pro Asp Lys Glu Gin Ala He Ser Ala Leu Pro Asp 435 440 445
Tyr Ala Ser Gin Pro Gly Lys Pro Pro Arg Glu Asp Leu Lys 450 455 460

Claims

WHAT IS CLAIMED 18:
.1. A recombinant polynucleotide comprising a sequence of at least about 200 nucleotides having greater than 80% homology to a contiguous portion of the HER4 nucleotide sequence depicted in FIG. IA and IB or its complement.
2. A recombinant polynucleotide comprising a sequence of nucleotides encoding at least about 70 contiguous amino acids within the HER4 amino acid sequence depicted in FIG. IA and IB.
3. A recombinant polynucleotide comprising a contiguous sequence of at least about 200 nucleotides within the HER4 nucleotide coding sequence depicted in FIG. IA and IB or its complement.
4. A recombinant polynucleotide comprising the
HER4 nucleotide coding sequence depicted in FIG. IA and IB or its complement.
5. A recombinant polynucleotide according to claim 1, 2, 3, or 4 which is a DNA polynucleotide.
6. A recombinant polynucleotide according to claim 1, 2 , 3, or 4 which is a RNA polynucleotide.
7. An assay kit comprising a recombinant polynucleotide according to claim 1, 2, 3, or 4 to which a detectable label has been added.
8. A polymerase chain reaction kit (PCR) comprising a pair of primers capable of priming cDNA synthesis in a PCR reaction, wherein each primer is a polynucleotide according to claim 5.
9. The PCR kit according to claim 8 further comprising a polynucleotide probe capable of hybridizing to a region of the HER4 gene between and not including the nucleotide sequences to which the primers hybridize.
10. A polypeptide comprising a sequence of at least about 80 amino acids having greater than 90% identity to a contiguous portion of the HER4 amino acid sequence depicted in FIG. IA and IB.
11. A HER4 polypeptide comprising the amino acid sequence depicted in FIG. IA and IB from amino acid residues 1 through 1308.
12. A HER4 polypeptide comprising the amino acid sequence depicted in FIG. IA and IB from amino acid residues 26 through 1308.
13. A HER4 polypeptide comprising the amino acid sequence depicted in FIG. IA and IB from amino acid residues 1 through 1045.
14. A HER4 polypeptide comprising the amino acid sequence depicted in FIG. IA and IB from amino acid residues 26 through 1045.
15. A HER4 polypeptide comprising the amino acid sequence depicted in FIG. 2A and 2B.
16. A HER4 polypeptide comprising the amino acid sequence depicted in FIG. IA and IB from amino acid residues 772 through 1308.
17. A HER4 polypeptide comprising the amino acid sequence depicted in FIG. 3.
18. An antibody capable of inhibiting the interaction of a soluble polypeptide and human HER4.
19. An antibody according to claim 18 wherein the soluble polypeptide is a heregulin.
20. An antibody capable of stimulating HER4 tyrosine autophosphorylation.
21. An antibody capable of inducing a HER4- mediated signal in a cell, which signal results in modulation of growth or differentiation of the cell.
22. An antibody capable of inhibiting HepG2 fraction 17-stimulated tyrosine phosphorylation of HER4 expressed in CHO/HER4 21-2 cells as deposited with the ATCC.
23. An antibody which immunospecifically binds to human HER4.
24. An antibody according to claim 23 which resides on the cell surface after binding to HER4.
25. An antibody according to claim 23 which is internalized into the cell after binding to HER4.
26. An antibody which immunospecifically binds to human HER4 expressed in CHO/HER4 21-2 cells as deposited with the ATCC.
27. An antibody according to claim 23 which neutralizes HER4 biological activity.
28. An antibody according to claim 23 which is conjugated to a drug or toxin.
29. An antibody according to claim 23 which is radiolabeled.
30. Plasmid pBSHER4Y as deposited with the ATCC.
31. A recombinant vector comprising a nucleotide sequence encoding a polypeptide according to claim 10, 11, 12, 13, 14, 15, 16, or 17.
32. A host cell transfected with a recombinant vector according to claim 31.
33. A recombinant vector comprising a nucleotide sequence encoding a polypeptide according to claim 10,
11, 12, 13, 14, 15, 16, or 17, wherein the coding sequence is operably linked to a control sequence which is capable of directing the expression of the coding sequence in a host cell transfected therewith.
34. A host cell transfected with a recombinant vector according to claim 33.
35. Cell line CHO/HER4 21-2 as deposited with the ATCC.
36. An assay for detecting the presence of a HER4 ligand in a sample comprising:
(a) applying the sample to cells which have been engineered to overexpress HER4 ; and (b) detecting an ability of the ligand to affect an activity mediated by HER4.
37. The assay according to claim 36, wherein the cells are CHO/HER4 21-2 cells as deposited with the ATCC.
38. The assay according to claim 36, wherein the activity detected is HER4 tyrosine phosphorylation.
39. The assay according to claim 36, wherein the activity detected is morphologic differentiation.
40. A ligand for HER4 comprising a polypeptide which binds to HER4 , stimulates tyrosine phosphorylation of HER4 , and affects a biological activity mediated by HER4.
41. A ligand according to claim 40 which is capable of inducing morphological differentiation when added to cultured MDA-MB-453 cells.
42. A ligand according to claim 40 obtained from cultured HepG2 cell conditioned media.
43. An immunoassay for detecting HER4 comprising:
(a) providing an antibody according to claim 23 or 26; (b) incubating a biological sample with the antibody under conditions which allow for the binding of the antibody to HER4; and
(c) determining the amount of antibody present as a HER4-antibody complex.
44. A method for the in vivo delivery of a drug or toxin to cells expressing HER4 comprising conjugating an antibody according to claim 23 or 26, or an active fragment thereof, to the drug or toxin, and delivering the resulting conjugate to an individual by using a formulation, dose, and route of administration such that the conjugate binds to HER4.
45. A HER4 ligand comprising a polypeptide which is capable of binding to HER4 and activating protein kinase activity.
46. The ligand of claim 40 or claim 45 which is heregulin.
47. The ligand of claim 45 which is p45.
48. An isolated polypeptide of molecular weight 45 kDa as determined by SDS-Page analysis having an N- terminal amino acid sequence Ser-Gly-X-Lys-Pro-X-X- Ala-Ala, wherein said polypeptide is capable of binding to HER4 as expressed in MDA-MB-453 cells.
49. A chimeric polypeptide comprising a HER4 ligand fused to a cytotoxin.
50. A chimeric polypeptide according to claim 49 wherein the HER4 ligand is a heregulin, a functional derivative of a heregulin, or a homolog of a heregulin, which is capable of binding to and activating HER4.
51. A chimeric polypeptide according to claim 49 or 50 wherein the heregulin is heregulin-α (HRG-α) .
52. A chimeric polypeptide according to claim 49 or 50 wherein the heregulin is heregulin-βl (HRG-B1) .
53. A chimeric polypeptide according to claim 49 or 50 wherein the heregulin is heregulin-B2 (HRG-B2) .
54. A chimeric polypeptide according to claim 53 further comprising the amphiregulin leader peptide at the amino terminus.
55. A chimeric polypeptide according to claim 49 or 50 wherein the heregulin is heregulin-B3 (HRG-63) .
56. A chimeric polypeptide according to claim 49, 50, or 54 wherein the cytotoxin is PE40 or a functionally equivalent Pseudomonas arabinosa exotoxin derivative.
57. HAR-TX B2 having the amino acid sequence depicted in SEQ ID No:42.
58. A recombinant polynucleotide comprising a sequence of nucleotides encoding a chimeric polypeptide according to claim 49.
59. A recombinant polynucleotide comprising a sequence of nucleotides encoding HAR-TX &2 .
60. A recombinant vector comprising the polynucleotide according to claim 59 under the control of an IPTG-inducible T7-promoter.
61. A monoclonal antibody which competitively inhibits the immunospecific binding of the monoclonal antibody produced by hybridoma cell line 6-4-11 as deposited with the ATCC to its epitope.
62. A monoclonal antibody which competitively inhibits the immunospecific binding of the monoclonal antibody produced by hybridoma cell line 7-142 as deposited with the ATCC to its epitope.
63. Hybridoma cell line 6-4-11 as deposited with the ATCC and assigned accession number HB11715.
64. Hybridoma cell line 7-142 as deposited with the ATCC and assigned accession number HB11716.
65. A method of delivering a molecule to a cell expressing HER4, comprising:
(a) generating a conjugate or a fusion of the molecule and a HER4 ligand; and
(b) contacting the cell with the conjugate or fusion such that it binds to HER4 and is thereby internalized into the cell.
66. A method of delivering a molecule to a cell which expresses HER4, comprising contacting the cell with a conjugate or a fusion of a HER4 ligand and the molecule.
67. The method according to claim 65 or 66 wherein the molecule is a polypeptide.
68. The method according to claim 65 or 66 wherein the molecule is a polynucleotide.
69. The method according to claim 65 or 66 wherein the molecule is a radionuclide.
70. The method according to claim 65 or 66 wherein the molecule is an imaging label.
71. A method of delivering a cytotoxin to the cytoplasm of a cell which expresses HER4 , comprising contacting the cell with a conjugate of the cytotoxin and a HER4 ligand, such that the conjugate binds to, activates, and is internalized via HER4.
72. A method of delivering a cytotoxin to the cytoplasm of a cell which expresses HER4, comprising contacting the cell with a chimeric polypeptide comprising a HER4 ligand fused to the cytotoxin, such that the chimeric polypeptide binds to, activates, and is internalized via HER4.
73. The method according to claim 72 wherein the chimeric polypeptide is HAR-TX B2.
PCT/US1995/013524 1994-10-14 1995-10-10 Her4 human receptor tyrosine kinase or the epidermal growth factor receptor family WO1996012019A2 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
AU39632/95A AU3963295A (en) 1994-10-14 1995-10-10 Her4 human receptor tyrosine kinase
JP8513469A JPH10507362A (en) 1994-10-14 1995-10-10 HER4 human receptor tyrosine kinase
EP95937555A EP0787187A1 (en) 1994-10-14 1995-10-10 Her4 human receptor tyrosine kinase
MX9702664A MX9702664A (en) 1994-10-14 1995-10-10 Her4 human receptor tyrosine kinase.
FI971532A FI971532A (en) 1994-10-14 1997-04-11 HER4, human receptor tyrosine kinase belonging to the skin growth factor receptor group
NO971686A NO971686L (en) 1994-10-14 1997-04-11 HER4-humanreseptortyrosinkinase

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US32344294A 1994-10-14 1994-10-14
US08/323,442 1994-10-14

Publications (3)

Publication Number Publication Date
WO1996012019A2 WO1996012019A2 (en) 1996-04-25
WO1996012019A9 true WO1996012019A9 (en) 1996-07-11
WO1996012019A3 WO1996012019A3 (en) 1996-08-15

Family

ID=23259216

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1995/013524 WO1996012019A2 (en) 1994-10-14 1995-10-10 Her4 human receptor tyrosine kinase or the epidermal growth factor receptor family

Country Status (9)

Country Link
EP (1) EP0787187A1 (en)
JP (1) JPH10507362A (en)
AU (1) AU3963295A (en)
CA (1) CA2202533A1 (en)
FI (1) FI971532A (en)
IL (1) IL115642A0 (en)
MX (1) MX9702664A (en)
NO (1) NO971686L (en)
WO (1) WO1996012019A2 (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU9805398A (en) * 1997-10-15 1999-05-03 Children's Medical Center Corporation Novel human egf receptors and use thereof
EP1025221A2 (en) * 1997-10-31 2000-08-09 Georgetown University Medical Center ErbB-4 TARGETED RIBOZYMES
US7223393B2 (en) 2003-02-07 2007-05-29 Pdl Biopharma, Inc Amphiregulin antibodies and their use to treat cancer and psoriasis
US8652787B2 (en) 2008-11-12 2014-02-18 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Use of ERBB4 as a prognostic and therapeutic marker for melanoma

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2103323A1 (en) * 1992-11-24 1994-05-25 Gregory D. Plowman Her4 human receptor tyrosine kinase

Similar Documents

Publication Publication Date Title
US5811098A (en) Antibodies to HER4, human receptor tyrosine kinase
AU676502B2 (en) HER4 human receptor tyrosine kinase
US5916755A (en) Methods of characterizing ligands for the erbB-3 receptor, methods of influencing erbB-3 activities and methods of diagnosing erbB-3-related neoplasm
Modjtahedi et al. The receptor for EGF and its ligands-expression, prognostic value and target for therapy in cancer
US6696290B2 (en) ErbB2 and ErbB4 Chimeric Heteromultimeric Adhesins
US8226935B2 (en) ErbB2 and ErbB3 chimeric heteromultimer receptors
Jeschke et al. Targeted inhibition of tumor‐cell growth by recombinant heregulin‐toxin fusion proteins
Schmidt et al. Targeted inhibition of tumour cell growth by a bispecific single-chain toxin containing an antibody domain and TGF α
WO1993022424A1 (en) RECOMBINANT STIMULATING FACTOR OF THE neu RECEPTOR
US20020002276A1 (en) Chimeric heteromultimer adhesins
US8703917B2 (en) Epidermal growth factor receptor variants and pharmaceutical compositions thereof
EP0828843A1 (en) Recombinant heregulins and their biological functions upon receptor activation
WO1996012019A9 (en) Her4 human receptor tyrosine kinase or the epidermal growth factor receptor family
EP0787187A1 (en) Her4 human receptor tyrosine kinase
QIAN et al. Identification of pl85neu sequences required for monoclonal antibody-or ligand-mediated receptor signal attenuation
Peles The NEU oncogene—Biochemistry of transformation