WO1996012019A2 - Her4 human receptor tyrosine kinase or the epidermal growth factor receptor family - Google Patents

Her4 human receptor tyrosine kinase or the epidermal growth factor receptor family Download PDF

Info

Publication number
WO1996012019A2
WO1996012019A2 PCT/US1995/013524 US9513524W WO9612019A2 WO 1996012019 A2 WO1996012019 A2 WO 1996012019A2 US 9513524 W US9513524 W US 9513524W WO 9612019 A2 WO9612019 A2 WO 9612019A2
Authority
WO
WIPO (PCT)
Prior art keywords
her4
cells
cell
her2
heregulin
Prior art date
Application number
PCT/US1995/013524
Other languages
French (fr)
Other versions
WO1996012019A9 (en
WO1996012019A3 (en
Inventor
Gregory D. Plowman
Mohammed Shoyab
Clay Siegall
Jean-Michel Culouscou
Ingegerd Hellstrom
Karl E. Hellstrom
Original Assignee
Bristol-Myers Squibb Company
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bristol-Myers Squibb Company filed Critical Bristol-Myers Squibb Company
Priority to JP8513469A priority Critical patent/JPH10507362A/en
Priority to AU39632/95A priority patent/AU3963295A/en
Priority to MX9702664A priority patent/MX9702664A/en
Priority to EP95937555A priority patent/EP0787187A1/en
Publication of WO1996012019A2 publication Critical patent/WO1996012019A2/en
Publication of WO1996012019A9 publication Critical patent/WO1996012019A9/en
Publication of WO1996012019A3 publication Critical patent/WO1996012019A3/en
Priority to NO971686A priority patent/NO971686L/en
Priority to FI971532A priority patent/FI971532A/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/71—Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/6425—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent the peptide or protein in the drug conjugate being a receptor, e.g. CD4, a cell surface antigen, i.e. not a peptide ligand targeting the antigen, or a cell surface determinant, i.e. a part of the surface of a cell
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6849—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a receptor, a cell surface antigen or a cell surface determinant
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • C07K14/4756—Neuregulins, i.e. p185erbB2 ligands, glial growth factor, heregulin, ARIA, neu differentiation factor
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • C07K14/485—Epidermal growth factor [EGF], i.e. urogastrone
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2863—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for growth factors, growth regulators
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/475—Assays involving growth factors
    • G01N2333/4756—Neuregulins, i.e. p185erbB2 ligands, glial growth factor, heregulin, ARIA, neu differentiation factor

Definitions

  • the present invention is generally directed to a novel receptor tyrosine kinase related to the
  • HER4/p180 erbB4 epidermal growth factor receptor
  • novel diagnostic and therapeutic compositions comprising HER4-derived or HER4-related biological components.
  • the invention is based in part upon applicants discovery of human HER4, its complete nucleotide coding sequence, and functional properties of the HER4 receptor protein. More specifically, the invention is directed to HER4 biologies comprising, for example, polynucleotide molecules encoding HER4, HER4 polypeptides, anti-HER4 antibodies which
  • the present invention provides a framework upon which effective biological therapies may be designed.
  • the invention is
  • RTKs receptor tyrosine kinases
  • EGF epidermal growth factor
  • PDGF platelet-derived growth factor
  • NGF neurotrophins
  • FGF fibroblast growth factor
  • hepatocyte growth factor met (hepatocyte growth factor), trk (nerve growth factor) (see, respectively, Zsebo et al., 1990, Cell 63:195-201; Bottardo et al., 1991, Science
  • soluble factor NDF or heregulinalpha (HRG- ⁇ )
  • HRG- ⁇ soluble factor NDF
  • HRG- ⁇ heregulinalpha
  • the heregulins are a family of molecules that were first isolated as specific ligands for HER2 (Wen, et al., 1992, Cell. 69:559-572; Holmes et al., 1992, Science 256:1205-1210; Falls et al., 1993, Cell
  • a rat homologue was termed Neu
  • NDF differentiation factor
  • Heregulin also appears to play an important role in development and maintenance of the nervous system based on its abundant expression in cells of neuronal origin and on the recognition that alternatively spliced forms of the heregulin gene encode for two recently characterized neurotrophic activities.
  • One neural-derived factor is termed acetylcholine receptor inducing activity (ARIA) (Falls et al., supra).
  • ARIA acetylcholine receptor inducing activity
  • GGF glial growth factor reflecting the proliferative affect this molecule has on glial cells in the central and peripheral nervous system
  • HER2 phosphorylation of HER2 in cells of breast, colon, and neuronal origin, and not in fibroblasts or ovarian cell lines that overexpress recombinant HER2 (Peles et al., 1993, EMBO J. 12:961-971).
  • EGFR EGF receptor
  • HER2/p185 erbB2 HER3/p160 erbB3
  • EGFR-family members The complete nucleotide coding sequence of other EGFR-family members has also been determined from other organisms including: the drosophila EGFR ("DER”: Livneh et al., 1985, Cell 40:599-607), nematode EGFR ("let-23”: Aroian et al., 1990, Nature 348:693-698), chicken EGFR ("CER”: Lax et al., 1988, Mol. Cell.
  • EGFR-family receptors Overexpression of EGFR-family receptors is frequently observed in a variety of aggressive human epithelial carcinomas. In particular, increased' expression of EGFR is associated with more aggressive carcinomas of the breast, bladder, lung and stomach
  • HER2 has been associated with a wide variety of human malignancies, particularly breast and ovarian carcinomas, for which a strong correlation between HER2 overexpression and poor clinical prognosis and/or increased relapse
  • HER2 has also been correlated with other human carcinomas, including carcinoma of the stomach, endometrium, salivary gland, bladder, and lung (Yokota et al., 1986, Lancet 1:765-67; Fukushigi et al., 1986, Mol. Cell. Biol. 6:955-58; Yonemura et al., 1991, Cancer Res. 51:1034; Weiner et al., 1990, Cancer Res. 50:421-25; Geurin et al., 1988, Oncogene Res. 3:21-31; Semba et al., 1985, Proc. Natl. Acad. Sci. U.S.A. 82:6497-6501; Zhau et al., 1990,
  • TGF- ⁇ transforming growth factor-alpha
  • AR amphiregulin
  • HB-EGF heparin-binding EGF
  • VVF vaccinia virus growth factor
  • NDF neu differentiation factor
  • Rat1-EJ cells ras-transformed Rat1-EJ cells
  • HRG- ⁇ , - ⁇ 1, -ß2, -ß3 the heregulins
  • HRG- ⁇ the heregulins
  • human MDA-MB-231 cells Holmes et al., supra.
  • NDF and HRG- ⁇ share 93% sequence identity and appear to be the rat and human homologs of the same protein.
  • Both of these proteins are similar size (44-45 kDa), increase tyrosine phosphorylation of HER2 in MDA-MB-453 cells and not the EGF-receptor, and have been reported to bind to HER2 in cross-linking studies on human breast cancer cells.
  • NDF has been shown to induce differentiation of human mammary tumor cells to milk-producing, growth-arrested cells, whereas the heregulin family have been reported to stimulate proliferation of cultured human breast cancers cell monolayers.
  • phosphorylation of and by cell surface receptors hold fundamental roles in signal transduction.
  • the intracellular phenomena of receptor dimerization and receptor crosstalk function as primary components of the circuit through which ligand binding triggers a resulting cellular response.
  • Receptor crosstalk refers to intracellular communication between two or more proximate receptor molecules mediated by, for example, activation of one receptor through a
  • HER4 is the fourth member of the EGFR-family of receptor tyrosine kinases and is likely to be involved not only in regulating normal cellular function but also in the loss of normal growth control associated with certain human cancers. In this connection, HER4 appears to be closely connected with certain
  • carcinomas of epithelial origin such as
  • the invention includes embodiments directly involving the production and use of HER4 polynucleotide molecules.
  • the invention provides HER4 polypeptides, such as the prototype HER4 polypeptide disclosed and characterized in the
  • HER4 HER4 molecule are also included within the scope of this invention. Furthermore, the invention includes polypeptides which interact with HER4
  • the invention is also directed to anti-HER4 antibodies, which have a variety of uses including but not limited to their use as components of novel biological
  • the invention also relates to the identification of HER4 ligands and methods for their purification.
  • the invention also relates to the discovery of an apparent functional relationship between HER4 and HER2, and the therapeutic aspects of the invention include those which are based on applicants'
  • HER4 interacts with HER2 either by heterodimer formation or receptor crosstalk, and that such interaction appears to be one mechanism by which the HER4 receptor mediates effects on cell behavior.
  • the reciprocal consequence is that HER2 activation is in some circumstances mediated through HER4.
  • HER4 as a primary component of the heregulin signal transduction pathway opens a number of novel approaches to the diagnosis and treatment of human cancers in which the aberrant expression and/or function of heregulin and/or HER4 are involved.
  • the therapeutic aspects of this invention thus include mediating a ligand's affect on HER4 and HER2 through antagonists, agonists or antibodies to HER4 ligands or HER4 receptor itself.
  • the invention also relates to chimeric proteins that specifically target and kill HER4 expressing tumor cells, polynucleotides encoding such chimeric proteins, and methods cf using both in the therapeutic treatment of cancer and other human malignancies.
  • the invention further relates to a method
  • FIG. 1A and 1B Nucleotide sequence [SEQ ID No:1] and deduced amino acid sequence of HER4 of the coding sequence from position 34 to 3961 (1308 amino acid residues) [SEQ ID No:2]. Nucleotides are
  • FIG. 2A and 2B Nucleotide sequence [SEQ ID No:3] and deduced amino acid sequence ([SEQ ID No:4] of cDNAs encoding HER4 with alternate 3' end and without autophosphorylation domain. This sequence is identical with that of HER4 shown in FIG. 1A and 1B up to nucleotide 3168, where the sequence diverges and the open reading frame stops after 13 amino acids. followed by an extended, unique 3'-untranslated region.
  • FIG. 3 Nucleotide sequence [SEQ ID No: 5] and deduced amino acid sequence [SEQ ID No: 6] of cDNA encoding HER4 with a N-terminal truncation. This sequence contains the 3'-portion of the HER4 sequence where nucleotide position 156 of the truncated sequence aligns with position 2335 of the complete HER4
  • the first 155 nucleotides of the truncated sequence are unique from HER4 and may represent the 5'-untranslated region of a transcript derived from a cryptic promoter within an intron of the HER4 gene. (Section 6.2.2., infra).
  • FIGS. 4 and 5 The deduced amino acid sequence of two variant forms of human HER4 aligned with the full length HER4 receptor as represented in FIG. 1A and 1B. Sequences are displayed using the single-letter code and are numbered on the right with the complete HER4 sequence on top and the variant sequences below.
  • FIG. 4 HER4 with alternate 3'-end, lacking an autophosphorylation domain [SEQ ID No. 4]. This sequence is identical with that of HER4, shown in FIG. 1A and 1B, up to amino acid 1045, where the sequence diverges and continues for 13 amino acids before reaching a stop codon.
  • FIG. 5 HER4 with N-terminal truncation [SEQ ID No. 6]. This sequence is identical to the 3'-portion of the HER4 shown in FIG. 1A and 1B beginning at amino acid 768. (Section 6.2.2., infra).
  • FIG. 6A and 6B Deduced amino acid sequence of human HER4 and alignment with other human EGFR-family members (EGFR [SEQ ID No:7]; HER2 [SEQ ID No: 8]; HER3 [SEQ ID No:9]). Sequences are displayed using the single-letter code and are numbered on the left.
  • glycosylation sites are denoted with a plus (+).
  • HER4 amino acid positions 679, 685, and 699 Potential protein kinase C phosphorylation sites are indicated by arrows (HER4 amino acid positions 679, 685, and 699).
  • the predicted ATP-binding site is shown with 4 circled crosses, C-terminal tyrosines are denoted with open triangles, and tyrosines in HER4 that are conserved with the major autophosphorylation sites in the EGFR are indicated with black triangles.
  • the predicted extracellular domain extends from the boundary of the signal sequence marked by an arrow at position 25, to the hydrophobic transmembrane domain which is overlined from amino acid positions 650 through 675.
  • TK tyrosine kinase domain. Domains I, III, TK are boxed.
  • FIG. 7 Hydropathy profile of HER4, aligned with a comparison of protein domains for HER4 (1308 amino acids), EGFR (1210 amino acids), HER2 (1255 amino acids), and HER3 (1342 amino acids).
  • the signal peptide is represented by a stippled box, the
  • cysteine-rich extracellular subdomains are hatched, the transmembrane domain is filled, and the
  • cytoplasmic tyrosine kinase domain is stippled. The percent amino acid sequence identities between HER4 and other EGFR-family members are indicated. Sig, signal peptide; I, II, III, and IV, extracellular domains; TM, transmembrane domain; JM, juxtamembrane domain; CaIn, calcium influx and internalization domain; 3'UTR, 3' untranslated region.
  • FIG. 8 Northern blot analysis from human tissues hybridized to HER4 probes. RNA size markers (in kilobases) are shown on the left. Lanes 1 through 8 represent 2 ⁇ g of poly(A)+ mRNA from pancreas, kidney, skeletal muscle, liver, lung, placenta, brain, and heart, respectively.
  • FIG. 8 (Panel 1), Northern blot analysis of mRNA from human tissues hybridized to HER4 probes from the 3'-autophosphorylation domain;
  • FIG. 8 (Panel 2), Northern blot analysis from human tissues hybridized to HER4 probes from the 5'- extracellular domain (see Section 6.2.3., infra).
  • FIG. 9 Immunoblot analysis of recombinant HER4 stably expressed in CHO-KI cells, according to
  • Lane 1 parental CHO-KI cells; lanes 2 - 4, CHO-KI/HER4 cell clones 6, 21, and 3,
  • FIG. 10 Specific activation of HER4 tyrosine kinase by a breast cancer differentiation factor (see Section 8., infra).
  • Four recombinant cell lines each of which was engineered to overexpress a single member of EGFR-family of tyrosine kinase receptors (EGFR, HER2, HER3, and HER4), were prepared according to the methods described in Sections 7.1.2 and 8.1., infra. Cells from each of the four recombinant cell lines were stimulated with various ligand preparations and assayed for receptor tyrosine phosphorylation using the assay described in Section 8.2., infra.
  • FIG. 10 (Panell), CHO/HER4 #3 cells; FIG.
  • FIG. 10 (Panel 2), CHO/HER2 cells; FIG. 10 (Panel 3), NRHER5 cells; and FIG. 10 (Panel 4), 293/HER3 cells.
  • the size (in
  • kilodaltons of the prestained molecular weight markers are labeled on the left of each panel.
  • the phosphorylated receptor in each series migrates just below the 221 kDa marker. Bands at the bottom of the gels are extraneous and are due to the reaction of secondary antibodies with the antibodies used in the immunoprecipitation.
  • FIG. 11 Biological and biochemical properties of the MDA-MB-453-cell differentiation activity purified from the conditioned media of HepG2 cells (Section 9., infra).
  • FIG. 11 (Panel 1 and 2) show induction of morphologic differentiation. Conditioned media from HepG2 cells was subjected to ammonium sulfate fractionation, followed by dialysis against PBS. Dilutions of this material were added to MDA-MB-453 monolayer at the indicated protein concentrations.
  • FIG. 11 Panel 1, control;
  • FIG. 11 Panel 2
  • FIG. 11 (Panel 3) 2.0 ⁇ g per well;
  • FIG. 11 Phenyl-5PW column elution profile monitored at 230 nm absorbance
  • FIG. 11 Panel 5
  • FIG. 11 Panel 6
  • FIG. 12 NDF-induced tyrosine phosphorylation.
  • FIG. 12 Panel 1
  • MDA-MB-453 cells lane 1, mock transfected COS cell supernatant; lane 2, NDF
  • FIG. 12 Panel 2
  • CHO/HER4 21-2 cells lanes 1 and 2, mock transfected COS cell supernatant; lanes 3 and 4, NDF transfected COS cell supernatant. See Section 10., infra.
  • FIG. 13 Regional location of the HER4 gene to human chromosome 2 band q33.
  • FIG. 13 Panel 1
  • FIG. 13 Peak 2 Distribution of autoradiographic grains on diagram of chromosome 2.
  • FIG. 14 Amino acid sequence of HER4-Ig fusion protein [SEQ ID No: 10] (Section 5.4., infra).
  • FIG. 15 Recombinant heregulin induces tyrosine phosphorylation of HER4. Tyrosine phosphorylated receptors were detected by Western blotting with an anti-phosphotyrosine Mab. Arrows indicate the HER2 and HER4 proteins.
  • FIG. 15 (Panel 1), Monolayers of MDA-MB453 or FIG. 15 (Panel 2), CHO/HER4 cells were incubated with media from COS-1 cells transfected with a rat heregulin expression plasmid (HRG), or with a cDM8 vector control (-). The media was either applied directly (1x) or after concentrating 20-fold (20x, and vector control). Solubilized cells were immunoprecipitated with anti-phosphotyrosine Mab.
  • HRG rat heregulin expression plasmid
  • - cDM8 vector control
  • FIG. 15 (Panel 3), Monolayers of CHO/HER2 cells were incubated as above with transfected Cos-1 cell
  • FIG. 16 Expression of recombinant HER2 and HER4 in human CEM cells. Transfected CEM cells were selected that stably express either HER2, HER4, or both recombinant receptors.
  • FIG. 16 Panel 1
  • recombinant HER2 was detected by immunmoprecipitation of cell lysates with anti-HER2 Mab (Ab-2) and Western blotting with another anti-HER2 Mab (Ab-3).
  • FIG. 16 Panel 2
  • Recombinant HER4 was detected by
  • FIG. 16 Panel 3
  • Three CEM cell lines were selected that express one or both recombinant receptors and aliquots of each were incubated with media control (-), with two HER2-stimulatory Mabs (Mab 28 and 29), or with an isotype matched control Mab (18.4).
  • Solubilized cells were immunoprecipitated with anti-HER2 Mab (Ab-2) and tyrosine phosphorylated HER2 was detected by Western blotting with an anti-phosphotyrosine Mab.
  • the size in kilodaltons of prestained high molecular weight markers (Bio-Rad) is shown on the left and arrows indicate the HER2 and HER4 proteins.
  • FIG. 17 Heregulin induces tyrosine
  • CEM cells expressing HER4 Three CEM cell lines that express either HER2 or HER4 alone (CEM 1-3 and CEM 3-13) or together (CEM 2-9) were incubated with 7x concentrated supernatants from mock-(-) or heregulin-transfected (+) COS-1 cells.
  • Solubilized cells were immunoprecipitated (IP) with anti-phosphotyrosine Mab (PY20); in FIG. 17 (Panel 1), HER2-specific anti-HER2 Mab (Ab-2); in FIG. 17 (Panel 2), HER4-specific Mab (6-4); in FIG. 17 (Panel 3), in each case tyrosine phosphorylated receptors were detected by Western blotting with anti-phosphotyrosine Mab.
  • the size in kilodaltons of prestained molecular weight markers (BioRad) is shown on the left and arrows indicate the HER2 and HER4 proteins.
  • HRG recombinant rat heregulin.
  • FIG. 18 Covalent cross-linking of iodinated heregulin to HER4. 125 I-heregulin was added to
  • CHO/HER4 or CHO/HER2 cells for 2 h at 4° C. Washed cells were cross-linked with BS 3 , lysed, and the proteins separated using 7% PAGE. Labeled bands were detected on the phosphorimager. Molecular weight markers are shown on the left.
  • FIG. 19 Purification of p45 from HepG2
  • FIG. 19 (Panel 1), Concentrated HepG2 conditioned medium was subjected to 50% ammonium sulfate precipitation. Supernatant resulting from this step was subjected to hydrophobic interaction chromatography using phenyl-Sepharose. Pooled
  • FIG. 19 Panel 2
  • the DEAE-Sepharose column flow-through was subjected to CM-Sepharose chromatography.
  • FIG. 19 Panel 3
  • Affinity Chromatography of the MDA-MB-453 differentiation factor using heparin-5PW column Fractions 35-38 eluting around 1.3M NaCl were pooled.
  • FIG. 19 Panel 4
  • Size Exclusion
  • FIG. 20 Aliguots (25 microliter) of the active size exclusion column fractions (30 and 32) were
  • polyacrylamide gel The gel was silver-stained.
  • FIG. 21 Stimulation of tyrosine phosphorylation by p45.
  • FIG. 21 Panel 1
  • FIG. 21 Panel 2
  • FIG. 21 Panel
  • FIG. 22 Binding and cross-linking of 125 I-p45 to
  • FIG. 22 Panel
  • FIG. 22 (Panel 2), Covalent cross-linking.
  • 125 I-p45 was added to the cells in the presence or absence of an excess of unlabeled p45 for 2 h at 4° C.
  • the cross-linking reagent bis- (sulfosuccinimidyl)-suberate was added to the cells for 45 min. at 4° C. Cells were lysed and proteins separated by electrophoresis on a 7.5% polyacrylamide gel. Molecular masses of protein standards are indicated in kilodaltons. A Molecular Dynamics
  • Phospholmager was used to visualize the radioactive species.
  • FIG. 23 Construction of the HAR-TX ⁇ 2
  • FIG. 23 (Panel A), schematic diagram of the expression plasmid pSE 8.4, encoding HAR-TX ⁇ 2;
  • FIG. 23 (Panel B), amino acid sequence of HAR ⁇ 2 , the ligand portion of HAR-TX ⁇ 2, composed of the AR leader sequence and rat heregulin ⁇ 2 [SEQ ID No:40].
  • FIG. 24A and 24B cDNA sequence [SEQ ID No:41] and deduced amino acid sequence [SEQ ID No:42] of the chimera HAR-TX ⁇ 2, comprising the amphiregulin (AR) leader sequence and the coding sequences of rat heregulin Pseudomonas exotoxin PE40.
  • the linker sequence between the two portions is indicated by a bar above the sequence, the ligand portion is located at the 5' (N-terminal), the PE40 exotoxin portion is located at the 3' (C-terminal) part of the sequence. Nucleotides are numbered on the right side, and amino acids are numbered below the sequence.
  • FIG. 25 Purification of the chimeric HAR-TX ⁇ 2 protein: shown is a Coomassie brilliant blue stained SDS-PAGE (4-20%) of the different purification steps. Lanes 1 - 5 have been loaded under reducing
  • Lane 1 MW standards; lane 2 , refolded HAR-TX ⁇ 2, 20x concentrated; lane 3, POROS HS flow-through, 20x concentrated; lane 4, POROS HS eluate; lane 5, Source 15S eluate (pure HAR-TX ⁇ 2, 2 ⁇ g); lane 6, 2 ⁇ g HAR-TX ⁇ 2, loaded under non-reducing
  • FIG. 26 Membrane-based ELISA binding analysis, performed to determine the binding activity of the purified HAR-TX ⁇ 2 protein. Binding of HAR-TX ⁇ 2 (O) and PE40 ( ⁇ ) to membranes prepared from the HER4 expressing human breast carcinoma cell line.
  • FIG. 27 HAR-TX ⁇ 2 induced tyrosine
  • the arrow indicates the phosphorylated receptor band, the molecular weight is indicated in kDA.
  • FIG. 28 Cytotoxic effect of HAR-TX ⁇ 2 on tumor cell lines.
  • FIG. 28 Panel 1
  • FIG. 28 (Panel 2), following 48 hours incubation with HAR-TX ⁇ 2, the cell killing effect of HAR-TX ⁇ 2 on the tumor cell lines LNCaP ( ⁇ ), AU565 (O), SKBR3 ( ⁇ ), and SKOV3 ( ⁇ ) by quantification of fluorescent calcein cleaved from calcein-AM.
  • FIG. 28 (Panel 2), Competitive cytotoxicity of HAR-TX ⁇ 2 with heregulin ⁇ 2-Ig.
  • LNCaP cells were co-incubated with 50 ng/ml HAR-TX ⁇ 2 and increasing concentrations (2-5000 ng/ml) of either heregulin ⁇ 2-Ig ( ⁇ ) or L6-Ig ( ⁇ ).
  • the data represent the mean of triplicate assays.
  • FIG. 29 HAR-TX ⁇ 2 induced tyrosine
  • Phosphorylated receptors are indicated by an arrow, the molecular weight is indicated in kDa.
  • the present invention is directed to HER4/p180 erbB4 ("HER4"), a closely related yet distinct member of the Human EGF Receptor (HER)/neu subfamily of receptor tyrosine kinases, as well as HER4-encoding
  • polynucleotides e.g., cDNAs, genomic DNAs, RNAs, anti-sense RNAs, etc.
  • HER4 polynucleotide coding sequence e.g., a HER4 polynucleotide coding sequence
  • HER4 analogues and derivatives e.g., HER4 analogues and derivatives
  • anti-HER4 antibodies e.g., anti-sense RNAs, etc.
  • HER2 has been reported to be associated with a wide variety of human malignancies, thus the understanding of its activation mechanisms as well as the identification of molecules involved are of particular clinical interest.
  • This invention uncovers an apparent functional relationship between the HER4 and HER2 receptors involving HER4-mediated phosphorylation of HER2, potentially via intracellular receptor crosstalk or receptor
  • the invention also provides HER4 ligands capable of inducing cellular differentiation in breast carcinoma cells that appears to involve HER4-mediated phosphorylation of HER2.
  • HER3 has been reported to bind heregulin (see Section 2, supra).
  • various observations indicate that the heregulin-mediated activation of HER3 varies considerably, depending on the context of expression, suggesting that other cellular components may be involved in the modulation of HER3 activity (reviewed in: Carraway and Cantley, 1994, Cell 78:5-8).
  • the practice of the present invention utilizes standard techniques of molecular biology and molecular cloning, microbiology, immunology, and recombinant DNA known in the art.
  • One aspect of the present invention is directed to HER4 polynucleotides, including recombinant
  • polynucleotides encoding the prototype HER4 polypeptide shown in FIG. 1A and 1B, polynucleotides which are related or are complementary thereto, and recombinant vectors and cell lines incorporating such recombinant polynucleotides.
  • recombinant polynucleotide refers to a
  • ribonucleotides deoxyribonucleotides, nucleotide analogs, or combinations thereof.
  • the term also includes various modifications known in the art, including but not limited to radioactive and chemical labels, methylation, caps, internucleotide
  • polynucleotides are those having a contiguous stretch of about 200 or more nucleotides and sharing at least about 80% homology to a corresponding
  • HER4 polynucleotides may be obtained using a variety of general techniques known in the art, including molecular cloning and chemical synthetic methods.
  • One method by which the molecular cloning of cDNAs encoding the prototype HER4 polypeptide of the invention (FIG. 1A and 1 B), as well as several HER4 polypeptide variants, is described by way of example in Section 6., infra. conserveed regions of the sequences of EGFR, HER2, HER3, and Xmrk are used for selection of the degenerate oligonucleotide primers which are then used to isolate HER4.
  • HER4 polynucleotides may be obtained from a variety of cell sources which produce HER4-like activities and/or which express HER4-encoding mRNA.
  • HER4-like activities and/or which express HER4-encoding mRNA.
  • applicants have identified a number of suitable human cell sources for HER4
  • polynucleotides including but not limited to brain, cerebellum, pituitary, heart, skeletal muscle, and a variety of breast carcinoma cell lines (see Section 6., infra).
  • polynucleotides encoding HER4 polypeptides may be obtained by cDNA cloning from RNA isolated and purified from such cell sources or by genomic cloning. Either cDNA or genomic libraries of clones may be prepared using techniques well known in the art and may be screened for particular HER4-encoding DNAs with nucleotide probes which are
  • telomere sequence substantially complementary to any portion of the HER4 gene.
  • Various PCR cloning techniques may also be used to obtain the HER4 polynucleotides of the invention.
  • a number of PCR cloning protocols suitable for the isolation of HER4 polynucleotides have been reported in the literature (see, for example, PCR protocols: A Guide to Methods and Applications. Eds. Inis et al., Academic Press, 1990).
  • polynucleotides containing the entire coding region of the desired HER4 may be isolated as full length clones or prepared by splicing two or more polynucleotides together.
  • HER4-encoding DNAs may be synthesized in whole or in part by chemical synthesis using techniques standard in the art. Due to the inherent degeneracy of nucleotide coding sequences, any polynucleotide encoding the desired HER4
  • polypeptide may be used for recombinant expression.
  • the nucleotide sequence encoding the prototype HER4 of the invention provided in FIG. 1A and 1B may be altered by substituting nucleotides such that the same HER4 product is obtained.
  • the invention also provides a number of useful applications of the HER4 polynucleotides of the invention, including but not limited to their use in the preparation of HER4 expression vectors, primers and probes to detect and/or clone HER4, and diagnostic reagents. Diagnostics based upon HER4 polynucleotides include various hybridization and PCR assays known in the art, utilizing HER4 polynucleotides as primers or probes, as appropriate.
  • One particular aspect of the invention relates to a PCR kit comprising a pair of primers capable of priming cDNA synthesis in a PCR reaction, wherein each of the primers is a HER4 polynucleotide of the invention.
  • Such a kit may be useful in the diagnosis of certain human cancers which are characterized by aberrant HER4 expression.
  • certain human carcinomas may overexpress HER4 relative to their normal cell counterparts, such as human carcinomas of the breast.
  • detection of HER4 overexpression mRNA in breast tissue may be an indication of neoplasia.
  • human carcinomas characterized by
  • overexpression of HER4 may be diagnosed by a
  • polynucleotide-based assay kit capable of detecting both HER2 and HER4 mRNAs, such a kit comprising, for example, a set of PCR primer pairs derived from divergent sequences in the HER2 and HER4 genes, respectively.
  • HER4 polypeptides including the prototype HER4 polypeptide provided herein, as well as polypeptides derived from or having substantial homology to the amino acid sequence of the prototype HER4 molecule.
  • polypeptide in this context refers to a polypeptide prepared by synthetic or recombinant means, or which is isolated from natural sources.
  • substantially homologous in this context refers to polypeptides of about 80 or more amino acids sharing greater than about 90% amino acid homology to a corresponding contiguous amino acid sequence in the prototype HER4 primary structure (FIG. 1A and 1B).
  • prototype HER4" refers to a polypeptide having the amino acid sequence of precursor or mature HER4 as provided in FIG. 1A and 1B, which is encoded by the consensus cDNA nucleotide sequence also
  • HER4 polypeptides of the invention may contain deletions, additions or substitutions of amino acid residues relative to the sequence of the prototype HER4 depicted in FIG. 1A and 1B which result in silent changes thus producing a bioactive product.
  • amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility,
  • hydrophobicity, hydrophilicity and/or the amphipathic nature of the resides involved For example,
  • negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; amino acids with
  • uncharged polar head groups or nonpolar head groups having similar hydrophilicity values include the following: leucine, isoleucine, valine; glycine, alanine; asparagine, glutamine; serine, threonine;
  • the HER4 polypeptide depicted in FIG. 1A and 1B has all of the fundamental structural features characterizing the EGFR-family of receptor tyrosine kinases (Hanks et al., 1988, Science 241:42-52).
  • the precursor contains a single hydrophobic stretch of 26 amino acids characteristic of a transmembrane region that bisects the protein into a 625 amino acid
  • the extracellular ligand binding domain can be further divided into 4
  • subdomains I - IV
  • II cysteine-rich regions
  • IV residues 496-633
  • flanking domains I, residues 29-185; and III, residues 335-495
  • the extracellular domain of HER4 is most similar to HER3, where domains II-IV of HER4 share 56-67% identity to the respective domains of HER3.
  • the same regions of EGFR and HER2 exhibit 43-51% and 34-46% homology to HER4, respectively (FIG. 6A and 6B).
  • HER4 also conserves all 50 cysteines present in the extracellular portion of EGFR, HER2, and HER3, except that the HER2 protein lacks the fourth cysteine in domain IV.
  • HER4 Following the transmembrane domain of HER4 is a cytoplasmic juxtamembrane region of 37 amino acids. This region shares the highest degree of homology with EGFR (73% amino acid identity) and contains two consensus protein kinase C phosphorylation sites at amino acid residue numbers 679 (Serine) and 699
  • HER4 (Threonine) in the FIG. 1A and 1B sequence, the latter of which is present in EGFR and HER2.
  • HER4 lacks a site analogous to Thr654 of EGFR. Phosphorylation of this residue in the EGFR appears to block ligand-induced internalization and plays an important role in its transmembrane signaling (Livneh et al., 1988, Mol. Cell. Biol. 8:2302-08).
  • HER4 also contains Thr692 analogous to Thr694 of HER2.
  • This threonine is absent in EGFR and HER3 and has been proposed to impart cell-type specificity to the mitogenic and transforming activity of the HER2 kinase (DiFiore et al. 1992, EMBO J. 11:3927-33).
  • the juxtamembrane region of HER4 also contains a MAP kinase consensus phosphorylation site at amino acid number 699 (Threonine), in a position homologous to Thr699 of EGFR which is phosphorylated by MAP kinase in response to EGF stimulation (Takishima et al., 1991, Proc. Natl. Acad. Sci. U.S.A. 88:2520-25).
  • tyrosine kinase domain conserves all the diagnostic structural motifs of a tyrosine kinase, and is most related to the catalytic domains of EGFR (79%
  • GXGXXG ATP-binding motif [SEQ ID No: 11] with a distal lysine residue that is predicted to be involved in the phosphotransfer reaction (Hanks et al., 198, Science 241:42-52; Hunter and Cooper, in The Enzymes Vol. 17 (eds. Boyer and Krebs) pp.
  • the C-terminal 282 amino acids of HER4 has limited homology with HER2 (27%) and EGFR (19%).
  • the C-terminal domain of each EGFR-family receptor is proline-rich and conserves stretches of 2-7 amino acids that are generally centered around a tyrosine residue. These residues include the major tyrosine autophosphorylation sites of EGFR at Tyr1068, Tyr1086, Tyrll48, and Tyrll73 (FIG. 6A and 6B, filled
  • HER4 polypeptides of the invention may be produced by the cloning and expression of DNA encoding the desired HER4 polypeptide. Such DNA may be ligated into a number of expression vectors well known in the art and suitable for use in a number of acceptable host organisms, in fused or mature form, and may contain a signal sequence to permit secretion. Both prokaryotic and eukaryotic host expression systems may be employed in the production of recombinant HER4 polypeptides. For example, the prototype HER4
  • precursor coding sequence or its functional equivalent may be used in a host cell capable of processing the precursor correctly.
  • the coding sequence for mature HER4 may be used to directly express the mature HER4 molecule.
  • HER4 precursor coding sequence include any DNA sequence which, when expressed inside the appropriate host cell, is capable of directing the synthesis, processing and/or export of HER4.
  • recombinant DNA technology may be divided into a four-step process for the purposes of description: (1) isolation or generation of DNA encoding the desired HER4 polypeptide; (2) construction of an expression vector capable of directing the synthesis of the desired HER4 polypeptide; (3) transfection or
  • HER4-encoding DNA may be used to construct recombinant
  • polypeptide (FIG. 1A and 1B), or fragments or
  • HER4-encoding nucleotide sequences may be obtained from a variety of cell sources which produce HER4-like activities and/or which express HER4-encoding mRNA.
  • HER4-encoding cDNAs may be obtained from the breast
  • adenocarcinoma cell line MDA-MB-453 ATCC HTB131
  • a number of human cell sources are suitable for obtaining HER4 cDNAs, including but not limited to various epidermoid and breast carcinoma cells, and normal heart, kidney, and brain cells (see Section 6.2.3., infra).
  • the HER4 coding sequence may be obtained by molecular cloning from RNA isolated and purified from such cell sources or by genomic cloning. Either cDNA or genomic libraries of clones may be prepared using techniques well known in the art and may be screened for particular HER4-encoding DNAs with nucleotide probes which are substantially complementary to any portion of the HER4 gene. Alternatively, cDNA or genomic DNA may be used as templates for PCR cloning with suitable oligonucleotide primers. Full length clones, i.e., those containing the entire coding region of the desired HER4 may be selected for
  • HER4-encoding DNAs may be synthesized in whole or in part by chemical synthesis using techniques standard in the art.
  • HER4 polypeptides may be utilized equally well by those skilled in the art for the recombinant expression of HER4 polypeptides.
  • Such systems include but are not limited to microorganisms such as bacteria transformed with recombinant
  • yeast transformed with recombinant yeast expression vectors containing the desired HER4 coding sequence yeast transformed with recombinant yeast expression vectors containing the desired HER4 coding sequence
  • recombinant virus expression vectors e.g., baculovirus containing the desired HER4 coding sequence
  • plant cell systems infected with recombinant virus expression vectors e.g., cauliflower mosaic virus CaMV; tobacco mosaic virus, TMV
  • recombinant plasmid expression vectors e.g., Ti plasmid
  • animal cell systems infected with recombinant virus expression vectors e.g., adenovirus, vaccinia virus
  • the expression elements of these vectors vary in their strength and specificities. Depending on the host/vector system utilized, any one of a number of suitable transcription and translation elements may be used. For instance, when cloning in mammalian cell systems, promoters isolated from the genome of
  • mammalian cells e.g., mouse metallothionein
  • vaccinia virus 7.5K promoter or Moloney murine sarcoma virus long terminal repeat
  • vaccinia virus 7.5K promoter or Moloney murine sarcoma virus long terminal repeat
  • Promoters produced by recombinant DNA or synthetic techniques may also be used to provide for
  • Specific initiation signals are also required for sufficient translation of inserted protein coding sequences. These signals include the ATG initiation codon and adjacent sequences. In cases where the entire HER4 gene including its own initiation codon and adjacent sequences are inserted into the
  • translational control signals may be needed. However, in cases where only a portion of the coding sequence is inserted, exogenous translational control signals, including the ATG initiation codon must be provided. Furthermore, the initiation codon must be in phase with the reading frame of the HER4 coding sequences to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of transcription attenuation sequences, enhancer elements, etc.
  • the desired HER4 coding sequence may be ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader
  • This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo
  • HER4 HER4 in infected hosts.
  • a non-essential region of the viral genome e.g., region E3 or E4
  • the vaccinia 7.5K promoter may be used.
  • An alternative expression system which could be used to express HER4 is an insect system. In one such system, Autographa californica nuclear polyhidrosis virus (AcNPV) is used as a vector to express foreign genes. The virus grows in Spodoptera frugiperda cells.
  • AcNPV Autographa californica nuclear polyhidrosis virus
  • the HER4 coding sequence may be cloned into non-essential regions (for example the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (for example the polyhedrin promoter). Successful insertion of the HER4 coding sequence will result in inactivation of the polyhedrin gene and production of non-occluded recombinant virus (i.e., virus lacking the
  • a host cell strain may be chosen which modulates the expression of the inserted
  • HER4 polypeptide may be controlled. This is important if the protein product of the cloned foreign gene is lethal to host cells. Furthermore, modifications (e.g., phosphorylation) and processing (e.g., cleavage) of protein products are important for the function of the protein. Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of protein. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed.
  • the host cells which contain the recombinant coding sequence and which express the desired HER4 polypeptide product may be identified by at least four general approaches (a) DNA-DNA, DNA-RNA or RNA-antisense RNA hybridization; (b) the presence or absence of "marker" gene functions; (c) assessing the level of transcription as measured by the expression of HER4 mRNA transcripts in the host cell; and (d) detection of the HER4 product as measured by
  • the presence of HER4 coding sequences inserted into expression vectors can be detected by DNA-DNA hybridization using hybridization probes and/or primers for PCR reactions comprising polynucleotides that are homologous to the HER4 coding sequence.
  • expression vector/host system can be identified and selected based upon the presence or absence of certain "marker” gene functions (e.g., thymidine kinase activity, resistance to antibiotics, resistance to methotrexate (MTX), resistance to methionine
  • marker e.g., thymidine kinase activity, resistance to antibiotics, resistance to methotrexate (MTX), resistance to methionine
  • HER4 coding sequence is inserted within a marker gene sequence of the vector, recombinants containing that coding sequence can be identified by the absence of the marker gene function.
  • a marker gene can be placed in tandem with the HER4 sequence under the control of the same or different promoter used to control the expression of the HER4 coding sequence. Expression of the marker in response to induction or selection indicates expression of the HER4 coding sequence.
  • selectable marker is constructed, used to transfect CHO cells, and amplified expression of HER4 in CHO cells is obtained by selection with increasing
  • transcriptional activity for the HER4 coding region can be assessed by
  • polyadenylated RNA can be isolated and analyzed by Northern blot using a probe homologous to the HER4 coding sequence or particular portions thereof.
  • total nucleic acids of the host cell may be extracted and assayed for hybridization to such probes.
  • the expression of HER4 can be assessed immunologically, for example by
  • HER4 may be assessed by detecting a biologically active
  • the cell free media obtained from the cultured transfectant host cell may be assayed for HER4
  • cell lysates may be assayed for such activity. In either case, assays which measure ligand binding to
  • HER4 may be used.
  • anti-HER4 antibodies are expected to have a variety of useful applications in the field of oncology, several of which are described generally below. More detailed and specific descriptions of various uses for anti-HER4 antibodies are provided in the sections and subsections which follow. Briefly, anti-HER4 antibodies may be used for the detection and quantification of HER4 polypeptide expression in cultured cells, tissue samples, and in vivo. Such immunological detection of HER4 may be used, for example, to identify, monitor, and assist in the prognosis of neoplasms characterized by aberrant or attenuated HER4 expression and/or function.
  • monoclonal antibodies recognizing epitopes from different parts of the HER4 structure may be used to detect and/or distinguish between native HER4 and various subcomponent and/or mutant forms of the molecule.
  • biomodulatory agents capable of effectively treating particular human cancers.
  • anti-HER4 antibodies In addition to the various diagnostic and therapeutic utilities of anti-HER4 antibodies, a number of industrial and research applications will be obvious to those skilled in the art, including, for example, the use of anti-HER4 antibodies as affinity reagents for the purification of HER4 polypeptides, and as immunological probes for elucidating the biosynthesis, metabolism and
  • Anti-HER4 antibodies may be useful for anti-HER4 antibodies.
  • HER4 HER4 biological activity
  • anti-HER4 antibodies may influence HER2 activation and, as a consequence, modulate intracellular signals generated by HER2.
  • anti-HER4 anti-HER4
  • antibodies may be useful to effectively block ligand-induced, HER4-mediated activation of HER2, thereby affecting HER2 biological activity.
  • anti-HER4 antibodies capable of acting as HER4 ligands may be used to trigger HER4 biological activity and/or initiate a ligand-induced, HER4-mediated effect on HER2 biological activity, resulting in a cellular response such as differentiation, growth inhibition, etc.
  • anti-HER4 antibodies conjugated to cytotoxic compounds may be used to selectively target such compounds to tumor cells expressing HER4,
  • toxin-conjugated antibodies having the capacity to bind to HER4 and internalize into such cells are administered systemically for targeted cytotoxic effect.
  • the preparation and use of radionuclide and toxin conjugated anti-HER4 antibodies are further described in Section 5.5., infra.
  • HER4 is expressed in certain human carcinomas in which HER2 overexpression is present. Therefore, anti-HER4 antibodies may have growth and differentiation
  • this invention includes antibodies capable of binding to the HER4 receptor and modulating HER2 or HER2-HER4 functionality, thereby affecting a response in the target cell.
  • agents capable of selectively and specifically capable of selectively and specifically
  • HER2 and HER4 antibodies may be conjugated to internalizing anti-HER4 antibodies.
  • the specificity of such agents may result in biological effects only in cells which co-express HER2 and HER4, such as breast cancer cells.
  • HER4 polypeptide preparation including but not limited to rabbits, mice, rats, etc.
  • adjuvants may be used to increase the immunological response in the host animal, depending on the host species, including but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, oil emulsions, keyhole lympet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum.
  • BCG Bacille Calmette-Guerin
  • a monoclonal antibody to an epitope of HER4 may be prepared by using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include but are not limited to the hybridoma technique originally
  • Humanized antibodies may be prepared according to procedures in the
  • anti-HER4 monoclonal antibodies may be generated by immunization of mice with cells selectively overexpressing HER4 (e.g., CHO/HER4 21-2 cells as deposited with the ATCC) or with partially purified recombinant HER4 polypeptides.
  • the full length HER4 polypeptide (FIG. 1A and 1B) may be expressed in Baculovirus systems, and membrane fractions of the recombinant cells used to immunize mice. Hybridomas are then screened on
  • CHO/HER4 cells e.g., CHO HER4 21-2 cells as deposited with the ATCC
  • monoclonal antibodies may be evaluated for their ability to block NDF, or HepG2-differentiating factor, binding to HER4; for their ability to bind and stay resident on the cell surface, or to internalize into cells expressing HER4; and for their ability to directly upregulate or downregulate HER4 tyrosine autophosphorylation and/or to directly induce a HER4-mediated signal resulting in modulation of cell growth or differentiation.
  • monoclonal antibodies N28 and N29 directed to HER2, specifically bind HER2 with high affinity.
  • monoclonal N29 binding results in receptor internalization and downregulation, morphologic differentiation, and inhibition of HER2 expressing tumor cells in athymic mice.
  • monoclonal N28 binding to HER2 expressing cells results in stimulation of
  • HER4-Ig soluble recombinant HER4-Immunoglobulin fusion protein is expressed and purified on a Protein A affinity column.
  • the amino acid sequence of one such HER4-Ig fusion protein is provided in FIG. 14.
  • the soluble HER4-Ig fusion protein may then be used to screen phage libraries designed so that all available combinations of a variable domain of the antibody binding site are presented on the surfaces of the phages in the library.
  • Recombinant anti-HER4 antibodies may be propagated from phage which
  • Antibody fragments which contain the idiotype of the molecule may be generated by known techniques.
  • such fragments include but are not limited to: the F(ab) 'E2 fragment which can be produced by pepsin digestion of the intact antibody molecule; the Fab' fragments which can be generated by reducing the disulfide bridges of the F(ab')2
  • Fab expression libraries may be constructed (Huse et al., 1989, Science. 246:1275-1281) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity to HER4 protein.
  • HER4 ligands are capable of binding to the 180K transmembrane protein, HER4/p180 erbB4 or functional analogues thereof, and activating tyrosine kinase activity.
  • Functional analogues of HER4/p180 erbB4 -ligands are capable of activating HER4 tyrosine kinase activity. Activation of the tyrosine kinase activity may stimulate
  • the HER4 ligands of the present invention include NDF, a 44 kDa glycoprotein isolated from ras-transformed rat fibroblasts (Wen et al., 1992, Cell 69:559-572); heregulin, its human homologue, which exists as multiple isoforms (Peles et al., 1992, Cell 69:205-218 and Holmes et al., 1992, Science 256:1205-1210) including p45, a 45K heparin-binding
  • glycoprotein that shares several features with the heregulin-family of proteins including molecular weight, ability to induce differentiation of breast cancer cells, activation of tyrosine phosphorylation in MDA-MB453 cells, and N-terminal amino acid sequence (Section 13, infra), gp30, and p75 (Lupu et al., 1990, Science 249:1552-1555 and Lupu et al., 1992, Proc. Natl. Acad. Sci. USA 89:2287-2291).
  • HER4 ligands of the present invention can be prepared by synthetic or recombinant means, or can be isolated from natural sources.
  • the HER4 ligand of the present invention may contain deletions, additions or substitutions of amino acid residues relative to the sequence of NDF, p45 or other heregulins or any HER4 ligand known in the art as long as the ligand
  • amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or the amphipathic nature of the resides involved.
  • negatively charged amino acids include aspartic acid and glutamic acid
  • positively charged amino acids include lysine and arginine
  • amino acids with uncharged polar head groups or nonpolar head groups having similar hydrophilicity values include the following: leucine, isoleucine, valine; glycine, alanine; asparagine, glutamine; serine, threonine;
  • the HER4 ligands of the present invention may be produced by the cloning and expression of DNA encoding the desired HER4 ligand.
  • DNA may be ligated into a number of expression vectors well known in the art and suitable for use in a number of acceptable host organisms, in fused or mature form, and may contain a signal sequence to permit secretion.
  • Both prokaryotic and eukaryotic host expression systems may be employed in the production of recombinant HER4 ligands.
  • a HER4 ligand precursor coding sequence or its functional equivalent may be used in a host cell capable of processing the precursor correctly.
  • the coding sequence for a mature HER4 ligand may be used to directly express the mature HER4 ligand molecule.
  • Functional equivalents of the HER4 ligand precursor coding sequence include any DNA sequence which, when expressed inside the appropriate host cell, is capable of directing the synthesis, processing and/or export of the HER4 ligand.
  • Production of a HER4 ligand using recombinant DNA technology may be divided into a four-step process for the purposes of description: (1) isolation or
  • HER4 ligand-encoding nucleic acid sequences may be obtained from human hepatocellular carcinoma cell lines, specifically the HepG2 cells available from the ATCC, accession number HB 8065.
  • a number of human cell sources are suitable for obtaining HER4 ligand nucleic acids, including MDA-MB-231 cells available from the ATCC, accession number HTB 26, brain tissue (Falls et al., 1993, Cell 72:801-815 and Marchionni et al., 1993 Nature 362:312-318), and any cell source capable of producing an activity capable of binding to the 180K transmembrane protein,
  • HER4/p180 erbB4 encoded by the HER4/ERBB4 gene and activating tyrosine kinase activity.
  • Methods useful in assaying for the identification of HER4 ligands is disclosed in Section 5.8., infra.
  • Anti-HER4 ligand antibodies are expected to have a variety of useful applications in the field of oncology.
  • anti-HER4 ligand antibodies may be used for the detection and quantification of HER4 ligand polypeptide expression in cultured cells, tissue samples, and in vivo.
  • monoclonal antibodies may be used for the detection and quantification of HER4 ligand polypeptide expression in cultured cells, tissue samples, and in vivo.
  • monoclonal antibodies may be used for the detection and quantification of HER4 ligand polypeptide expression in cultured cells, tissue samples, and in vivo.
  • Anti-HER4 ligand antibody preparations are also envisioned as useful biomodulatory agents capable of effectively treating particular human cancers.
  • An anti-HER4 ligand antibody could be used to block signal transduction mediated through HER4, thereby inhibiting undesirable biological responses.
  • anti-HER4 ligand antibodies a number of industrial and research applications will be obvious to those skilled in the art, including, for example, the use of anti-HER4 ligand antibodies as affinity reagents for the purification of HER4 ligand
  • Anti-HER4 ligand antibodies may be useful for influencing cell functions and behaviors which are directly or indirectly mediated by HER4.
  • modulation of HER4 biological activity with anti-HER4 ligand antibodies may influence HER2 activation and, as a consequence, modulate
  • anti-HER4 ligand antibodies may be useful to effectively block ligand-induced, HER4-mediated activation of HER2, thereby affecting HER2 biological activity.
  • anti-HER4 ligand antibodies capable of acting as HER4 ligands may be used to trigger HER4 biological activity and/or initiate a ligand-induced, HER4-mediated effect on HER2
  • anti-HER4 ligand antibodies conjugated to cytotoxic compounds may be used to selectively target such compounds to tumor cells expressing HER4, resulting in tumor cell death and reduction or eradication of the tumor.
  • the invention also relates to the detection of human neoplastic conditions, particularly carcinomas of epithelial origin, and more particularly human breast carcinomas.
  • oligomers corresponding to portions of the consensus HER4 cDNA sequence provided in FIG. 1A and 1B are used for the quantitative detection of HER4 mRNA levels in a human biological sample, such as blood, serum, or tissue biopsy samples, using a suitable hybridization or PCR format assay, in order to detect cells or tissues expressing abnormally high levels of HER4 as an indication of neoplasia.
  • detection of HER4 mRNA may be combined with the detection HER2 mRNA overexpression, using appropriate HER2 sequences, to identify neoplasias in which a functional relationship between HER2 and HER4 may exist.
  • antibodies or antibody derivatives are used to detect the presence of HER4 in biological samples, using a variety of immunoassay formats well known in the art, and may be used for in situ diagnostic
  • radioimmunoimaging Current diagnostic and staging techniques do not routinely provide a comprehensive scan of the body for metastatic tumors. Accordingly, anti-HER4 antibodies labeled with, for example, fluorescent, chemiluminescent, and radioactive
  • a gamma-emitting diagnostic radionuclide is attached to a monoclonal antibody which is specific for an epitope of HER4, but not significantly cross-reactive with other EGFR-family members.
  • the labeled antibody is then injected into a patient systemically, and total body imaging for the distribution and density of HER4 molecules is
  • radionuclides include but are not limited to
  • Ab-MTs Recombinant antibody-metallothionein chimeras
  • Abs-MTs Recombinant antibody-metallothionein chimeras
  • Such Ab-MTs can be loaded with technitium-99m by virtue of the metallothionein chelating function, and may offer advantages over chemically conjugated chelators.
  • the highly conserved metallothionein structure may result in minimal immunogenicity.
  • EGFR-family can be generated by transfection of a variety of parental cell types with an appropriate expression vector as described in Section 7., infra.
  • Candidate ligands, or partially purified preparations may be applied to such cells and assayed for receptor binding and/or activation.
  • a CHO-KI cell line transfected with a HER4 expression plasmid and lacking detectable EGFR, HER2, or HER3 may be used to screen for HER4-specific ligands.
  • a particular embodiment of such a cell line is described in Section 7., infra, and has been deposited with the ATCC
  • Ligands may be identified by
  • the invention also relates to a bioassay for testing potential analogs of HER4 ligands based on a capacity to affect a
  • the invention is also directed to methods for the treatment of human cancers involving abnormal
  • HER4 proximate expression of HER4, including but not limited to human breast carcinomas and other neoplasms overexpressing HER4 or overexpressing HER2 in
  • the cancer therapy methods of the invention are generally based on treatments with unconjugated, toxin- or
  • radionuclide- conjugated HER4 antibodies, ligands, and derivatives or fragments thereof may be used for systemic and targeted therapy of certain cancers overexpressing HER2 and/or HER4, such as metastatic breast cancer, with minimal toxicity to normal tissues and organs.
  • HER4 antibodies or ligands may be used for systemic and targeted therapy of certain cancers overexpressing HER2 and/or HER4, such as metastatic breast cancer, with minimal toxicity to normal tissues and organs.
  • an anti-HER2 monoclonal antibody has been shown to inhibit the growth of human tumor cells overexpressing HER2 (Bacus et al., 1992, Cancer Res. 52:2580-89).
  • modulation of heregulin signaling through HER4 provides a means to affect the growth and
  • HER4-neutralizing monoclonal antibodies such as certain breast cancer cells
  • HER4 antibodies or ligands which act as super-agonists for HER4 activation, or agents which block the interaction between HER2 and HER4, either by disrupting heterodimer formation or by blocking HER-mediated phosphorylation of the HER2 substrate.
  • various drugs or toxins may be conjugated to anti-HER4 antibodies and fragments thereof, such as plant and bacterial toxins.
  • ricin a cytotoxin from the Ricinis communis plant may be conjugated to an anti-HER4 antibody using methods known in the art (e.g., Blakey et al., 1988, Prog. Allergy 45:50-90;Marsh and Neville, 1988, J. Immunol. 140:3674-78).
  • ricin Once ricin is inside the cell cytoplasm, its A chain inhibits protein synthesis by inactivating the 60S ribosomal subunit (May et al., 1989, EMBO J. 8:301-08). Immunotoxins of ricin are therefore extremely cytotoxic. However, ricin immunotoxins are not ideally specific because the B chain can bind to virtually all cell surface receptors, and immunotoxins made with ricin A chain alone have increased
  • ricin A chain may result in improved survival (i.e., slower clearance from circulation) of the immunotoxins.
  • Methods for conjugating ricin A chain to antibodies are known (e.g., Vitella and Thorpe, in: Seminars in Cell Biology, pp 47-58; Saunders,
  • immunotoxins which may be used in the formulation of immunotoxins include but are not limited to daunorubicin, methotrexate,
  • ribosome inhibitors e.g., trichosanthin, trichokirin, gelonin, saporin, mormordin, and pokeweed antiviral protein
  • various bacterial toxins e.g.,
  • Immunotoxins for targeted cancer therapy may be administered by any route which will result in antibody interaction with the target cancer cells, including systemic administration and injection directly to the site of tumor.
  • Another therapeutic strategy may be the administration of immunotoxins by sustained-release systems, such as semipermeable matrices of solid hydrophobic polymers containing the therapeutic agent.
  • sustained-release materials have been established and are well known by those skilled in the art.
  • Sustained-release capsules may, depending on their chemical nature, release immunotoxic molecules for a few weeks up to over 100 days. Depending on the chemical nature and the biological stability of the therapeutic reagent, additional strategies for protein stabilization may be employed.
  • preferred radionuclides for labeling include alpha, beta, and Auger electron emitters.
  • alpha emitters include astatine 211 and bismuth 212; beta emitters include iodine 131, rhenium 188, copper 67 and yttrium 90; and iodine 125 is an example of an Auger electron emitter.
  • purified ligand molecules may be chemically conjugated to cytotoxic substances.
  • ligand-toxins may be used to
  • HER4 expressing tumor cells may be specifically targeted and killed by contacting such tumor cells with a fusion protein comprising a cytotoxic
  • polypeptide covalently linked to a polypeptide which is capable of activating HER4 expressed on such cells.
  • a fusion protein In a specific embodiment described by way of example in Section 15, infra, a fusion protein
  • PE40 is a derivative of the Pseudomonas exotoxin PE, a potent cell killing agent made by Pseudomonas aeruginosa (Fitzgerald et al., 1980, Cell 21:867-873).
  • the wildtype protein PE contains three domains whose functions are cell recognition, membrane
  • the derivative PE40 lacks the cell binding
  • AR amphiregulin
  • heregulin-toxin recombinant heregulin-toxin.
  • Related embodiments include, for example, PE40 linked to other members of the heregulin family, like heregulin-01 and heregulin- ⁇ , and other molecules capable of activating HER4.
  • the applicants demonstrate specificity of the cytotoxic effect of the chimeric heregulin-PE40 protein to HER4 expressing cancer cells; they include but are not limited to prostate carcinoma, bladder carcinoma, and a considerable number of different breast cancer types, including breast carcinoma cells with amplified HER2 expression.
  • the bifunctional retention of both the specificity of the cell binding portion of the molecule and the cytotoxic potential of PE40 provides a very potent and targeted reagent.
  • An effective therapeutic amount of heregulin-toxin will depend upon the therapeutic objectives, the route of administration, and the condition of the patient. Accordingly, dosages should be titrated and the route of administration modified as required to obtain the optimal therapeutic effect.
  • a typical daily dosage may be in the range of 0.1 mg/kg - 1 mg/kg, preferably between 0.1 and 0.5 mg/kg, with intravenous administration. For regression of solid tumors, it may take 3-5 doses, with schedules such as 3 doses, each four days apart. Also the use of sustained-release preparations (see Section 5.8.1., supra) may be considered for administration of the reagent.
  • the therapeutic efficacy of heregulin-toxin may be between 2 and 10, which means that a tumor regression effect would be expected between 2- and 10- fold below the toxic dose (see Section 15, infra).
  • the heregulin-toxin will be administered at a dose and frequency that achieves the desired
  • Cancer therapy with heregulin-toxins of the invention may be combined with chemotherapy, surgery, and radiation therapy, depending on the type of tumor.
  • One advantage of using a low molecular weight toxin drug is that they are capable of targeting metastatic lesions that cannot be located and removed by surgery.
  • Heregulin-toxins may also be particularly useful on patients that are MDR (Multi Drug Resistance) positive since their mechanism of action is not inhibited by the p-glycoprotein pump of MDR positive cells as are many standard cancer therapeutic drugs. 5.9. Other Therapeutic Use Of HER4 Ligands
  • HER4 ligands may include other diseases caused by deficient HER4 receptor tyrosine kinase activation rather than by hyperactivation.
  • type II diabetes mellitus is the consequence of deficient insulin-mediated signal transduction, caused by mutations in the insulin-receptor, including mutations in the ligand-binding domain (Taira et al., 1889, Science
  • Such diseases might be treated by administration of modified ligands or ligand-analogues which re-establish a functional ligand-receptor interaction. 5.10. HER4 Analogues
  • HER4 derivatives, analogues and peptides may be used to compete with native HER4 for binding of HER4 specific ligand, thereby inhibiting HER4 signal transduction and function.
  • the inhibition of HER4 function may be utilized in several applications, including but not limited to the treatment of cancers in which HER4 biological activity is involved.
  • a series of deletion mutants in the HER4 nucleotide coding sequence depicted in FIG. 1A and 1B may be constructed and analyzed to determine the minimum amino acid sequence requirements for binding of a HER4 ligand.
  • Deletion mutants of the HER4 coding sequence may be constructed using methods known in the art which include but are not limited to use of nucleases and/or restriction enzymes; site-directed mutagenesis techniques, PCR, etc. The mutated polypeptides expressed may be assayed for their ability to bind HER4 ligand.
  • the DNA sequence encoding the desired HER4 analogue may then be cloned into an appropriate expression vector for overexpression in either
  • polypeptides may be synthesized by solid phase techniques followed by cleavage from resin and purification by high
  • EGFR and the related proteins, HER2, HER3, and Xmrk exhibit extensive amino acid homology in their tyrosine kinase domains (Kaplan et al., 1991, Nature 350:158-160; Wen et al., 1992, Cell 69:559-72; Holmes et al., 1992, Science 256:1205-10; Hirai et al.,
  • oligonucleotide primers were designed based on conserved amino acids encoded by a single exon or adjacent exons from the kinase domains of these four proteins. These primers were used in a polymerase chain reaction (PCR) to isolate genomic fragments corresponding to murine EGFR, erbB2 and erbB3. In addition, a highly related DNA fragment (designated MER4) was identified as distinct from these other genes. A similar strategy was used to obtain a cDNA clone corresponding to the human
  • MER4 from the breast cancer cell line, MDA-MB-453.
  • MDA-MB-453 breast cancer cell line
  • cDNA libraries were constructed using RNA from human heart and MDA-MB-453 cells, and overlapping clones were isolated spanning the complete open reading frame of HER4/erbB4.
  • PCR products were resolved on agarose gels and hybridized to 32P-labeled probes from the kinase domain of human EGFR and HER2. Distinct DNA bands were isolated and subcloned for sequence
  • H4VWELM and H4VYMIIL as primers in a PCR amplification
  • a PCR amplification Plowman et al., 1990, Proc. Natl. Acad. Sci. U.S.A. 87:4905-09
  • MER4-85 one clone was identified that contained a 144 nucleotide insert corresponding to murine erbB4.
  • This 32P-labeled insert was used to isolate a 17-kilobase fragment from a murine T-cell genomic library (Stratagene, La Jolla, CA) that was found to contain two exons of the murine erbB4 gene.
  • a specific oligonucleotide (4M3070) was synthesized based on the DNA sequence of an erbB4 exon, and used in a PCR protocol with a degenerate 5'-oligonucleotide (H4PIKWMA) on a template of single stranded MDA-MB-453 cDNA. This reaction generated a 260 nucleotide fragment (pMDAPIK) corresponding to human HER4.
  • cDNA libraries were constructed in lambda ZAP II
  • HER4-specific clones were isolated by probing the libraries with the 32 P-labeled insert from pMDAPIK. To complete the cloning of the 5'-portion of HER4, we used a PCR strategy to allow for rapid amplification of cDNA ends (Plowman et al., supra ; Frohman et al., 1988, Proc. Natl. Acad. Sci. U.S.A. 85:8998-9002).
  • the Northern blot (Clontech, Palo Alto, CA) contained 2 Mg poly(A) + mRNA per lane from 8 human tissue samples immobilized on a nylon membrane.
  • the filter was prehybridized at 60° C for several hours in RNA hybridization mixture (50% formamide, 5x SSC, 0.5% SDS, 10x Denhardt's solution, 100 ⁇ g/ml denatured herring sperm DNA, 100 ⁇ g/ml tRNA, and 10 ⁇ g/ml polyadenosine) and hybridized in the same buffer at 60° C, overnight with 1-1.5 ⁇ 106 cpm/ml of 32P-labeled antisense RNA probe.
  • the filters were washed in 0.1XSSC/0.1% SDS, 65° C, and exposed overnight on a Phospholmager (Molecular Dynamics, Sunnyvale, CA).
  • Single stranded cDNA was synthesized from 10 ⁇ g of each RNA by priming with an oligonucleotide containing a T17 track on its 3'-end
  • cDNA clones encoding parts of the HER4 coding and non-coding nucleotide sequences were isolated by PCR cloning according to the method outlined in Section 6.1.1., supra.
  • the complete HER4 nucleotide sequence assembled from these cDNAs is shown in FIG. 1A and 1B and contains a single open reading frame encoding a polypeptide of 1308 amino acids.
  • the HER4 coding region is flanked by a 33 nucleotide 5'-untranslated region and a 1517 nucleotide 3'-untranslated region ending with a poly(A) tail.
  • hydrophobic signal sequence follows a consensus initiating methionine at position number 1 in the amino acid sequence depicted in FIG. 1A and 1B.
  • the mature HER4 polypeptide would be predicted to begin at amino acid residue number 26 in the sequence depicted in FIG. 1A and 1B (Gln), followed by the next 1283 amino acids in the sequence.
  • the prototype mature HER4 of the invention is a polypeptide of 1284 amino acids, having a calculated Mr of 144,260 daltons and an amino acid sequence corresponding to residues 26 through 1309 in FIG. 1A and 1B.
  • HER4 nucleotide sequence is unique, and revealed a 60/64 amino acid identity with HER2 and a 54/54 amino acid identity to a fragment of a rat EGFR homolog, tyro-2.
  • the first alternative type of cDNA was identical to the consensus HER4 nucleotide sequence up to nucleotide 3168 (encoding Arg at amino acid position 1045 in the FIG. 1A and 1B) and then abruptly diverges into an apparently unrelated sequence (FIG. 2A and 2B, FIG. 4). Downstream from this residue the open reading frame continues for another 13 amino acids before reaching a stop codon followed by a 2 kb 3'-untranslated sequence and poly(A) tail. This cDNA would be predicted to result in a HER4 variant having the C-terminal autophosphorylation domain of the prototype HER4 deleted.
  • nucleotide 2335 is the precise location of an intron-exon junction in the HER2 gene (Coussens et al., 1985, Science 230:1132-39; Semba et al., 1985, Proc. Natl. Acad. Sci. U.S.A. 82:6497-6501),
  • cDNAs could be derived from mRNAs that have initiated from a cryptic promoter within the flanking intron. These 5'-truncated transcripts contain an open reading frame identical to that of the HER4 cDNA sequence of FIG. 1A and 1B, beginning with the codon for Met at amino acid position 772 in FIG. 1A and 1B. These cDNAs would be predicted to encode a cytoplasmic HER4 variant polypeptide that initiates just downstream from the ATP-binding domain of the HER4 kinase. 6.2.3. Human Tissue Distribution of HER4
  • Northern blots of poly (A)+ mRNA from human tissue samples were hybridized with antisense RNA probes to the 3'-end of HER4, encoding the autophosphorylation domain, as described in Section 6.1.2., supra.
  • a HER4 mRNA transcript of approximately 6kb was identified, and was found to be most abundant in the heart and skeletal muscle (FIG. 8, Panel 1).
  • An mRNA of greater than approximately 15 kb was detected in the brain, with lower levels also detected in heart, skeletal muscle, kidney, and pancreas tissue samples.
  • RNA transcripts were also detected in pancreas, lung, brain, and skeletal muscle tissue samples. The significance of the different sized RNA transcripts is not known.
  • HER4 mRNA samples were also examined for the presence of HER4 mRNA using the semi-quantitative PCR assay described in Section 6.1.3., supra. The results are shown in Table II, together with results of the assay on primary tumor samples and neoplastic cell lines (Section 6.2.4., immediately below). These results correlate well with the Northern and solution hybridization analysis results on the selected RNA samples.
  • the highest levels of HER4 transcript expression were found in heart, kidney, and brain tissue samples.
  • high levels of HER4 mRNA expression were found in parathyroid, cerebellum, pituitary, spleen, testis, and breast tissue samples. Lower expression levels were found in thymus, lung, salivary gland, and pancreas tissue samples.
  • low or negative expression was observed in liver, prostate, ovary, adrenal, colon, duodenum, epidermis, and bone marrow samples.
  • neoplastic origin were determined with the semi-quantitative PCR assay (Section 6.1.3, supra) using primers from sequences in the HER4 kinase domain. The results are included in Table II. This analysis detected the highest expression of HER4 RNA in 4 human mammary adenocarcinoma cell lines (T-47D, MDA-MB-453, BT-474, and H3396), and in neuroblastoma (SK-N-MC), and pancreatic carcinoma (Hs766T) cell lines.
  • HER4 The complete 4 kilobase coding sequence of prototype HER4 was reconstructed and inserted into a glutamine synthetase expression vector, pEE14, under the control of the cytomegalovirus immediate-early promoter (Bebbington, supra) to generate the HER4 expression vector pEEHER4.
  • This construct (pEEHER4) was linearized with Mlul and transfected into CHO-KI cells by calcium phosphate precipitation using
  • HER4 was detected from solubilized cell extracts by immunoblot analysis with PY20 anti-phosphotyrosine antibody (ICN Biochemicals), presumably reflecting autoactivation and autophosphorylation of HER4 due to receptor aggregation resulting from abberantly high receptor density. More specifically, expression'was detected by immunobloting with a primary murine monoclonal antibody to HER2 (Neu-Ab3, Oncogene
  • CHO-KI cells transfected with a vector encoding the complete human prototype HER4 polypeptide were selected for amplified expression in media containing increasing concentrations of methionine sulfoximine as outlined in Section 7.1., et seq., supra. Expression of HER4 was evaluated using the immunoassay described in Section 7.1.3., supra.
  • Several transfected CHO-KI cell clones stably expressing HER4 were isolated.
  • One particular clone, CHO/HER4 21-2 was selected in media supplemented with 250 ⁇ M MSX, and expresses high levels of HER4.
  • CHO/HER4 21-2 cells have been
  • HER4 expressed in CHO/HER4 cells migrated with an apparent Mr of 180,000, slightly less than HER2, whereas the parental CHO cells showed no cross-reactive bands (FIG. 9).
  • a 130 kDa band was also detected in the CHO/HER4 cells, and presumably represents a degradation product of the 180 kDa mature protein.
  • CHO/HER4 cells were used to identify ligand specific binding and
  • CHO/HER4 3 was generated as described in Section 7.1.2, supra.
  • CHO/HER2 cells (clone 1-2500) were selected to express high levels of recombinant human p185 erbB2 by dihydrofolate reductase-induced gene amplification in dhfr-deficient CHO cells.
  • the HER2 expression was selected to express high levels of recombinant human p185 erbB2 by dihydrofolate reductase-induced gene amplification in dhfr-deficient CHO cells. The HER2 expression
  • plasmid, cDNeu was generated by insertion of a full length HER2 coding sequence into a modified pCDM8 (Invitrogen, San Diego, CA) expression vector (Seed and Aruffo, 1987, Proc. Natl. Adad. Sci. U.S.A.
  • NRHER5 cells (Velu et al., 1987, Science 1408-10) were obtained from Dr. Hsing-Jien Kung (Case Western Reserve University, Cleveland, OH). This murine cell line was clonally isolated from NR6 cells infected with a retrovirus stock carrying the human EGFR, and was found to have approximately 10 6 human EGFRs per cell.
  • the cell line 293/HER3 was selected for high level expression of p160 erbB3 .
  • the parental cell line 293 human embryonic kidney cells, constitutively expresses adenovirus Ela and have low levels of EGFR expression. This line was established by
  • Cells were plated in 6-well tissue culture plates (Falcon), and allowed to attach at 37° C for 18-24 hr. Prior to the assay, the cells were changed to serum-free media for at least 1 hour. Cell monolayers were then incubated with the amounts of ligand preparations indicated in Section 7.3., below for 5 min at 37° C.
  • PBSTDS phosphatase inhibitors
  • phosphatase inhibitors 10 mM NaHPO4, 7.25, 150 mM NaCl, 1% Triton X-100, 0.5% deoxycholate, 0.1% SDS, 0.2% sodium azide, 1 mM NaF, 1 mM EGTA, 4 mM sodium orthovanadate, 1%
  • aprotinin 5 mg/ml leupeptin.
  • Cell debris was removed by centrifugation (12000 ⁇ g, 15 min, 4° C) and the cleared supernatant reacted with 1 mg murine monoclonal antibody to phosphotyrosine (PY20, ICN Biochemicals, Cleveland, Ohio) for CHO/HER4 and
  • 293/HER3 cells or 1 mg murine monoclonal antibody to HER2 (Neu-Ab3, Oncogene Sciences) for CHO/HER2 cells, or 1 mg murine monoclonal antibody EGFR-1 to human EGFR (Amersham) for NRHER5 cells.
  • HER2 Neurogene-Ab3, Oncogene Sciences
  • EGFR-1 human EGFR
  • NRHER5 cells 1 mg murine monoclonal antibody EGFR-1 to human EGFR
  • the beads were washed 3 times in PBSTDS and the complexes resolved by electrophoresis on reducing 7% SDS-polyacrylamide gels.
  • the gels were transferred to nitrocellulose and blocked in TNET (10 mM Tris pH7.4, 75 mM NaCl, 0.1% Tween-20, 1 mM EDTA).
  • PY20 antiphosphotyrosine antibody diluted 1:1000 in TNET was used as the primary antibody followed by 125 I-goat anti-mouse Ig F(ab')2 diluted 1:500 in TNET. Blots were washed with TNET and exposed on a phosphorimager (Molecular Dynamics).
  • EGF, AR, TGF- ⁇ , and HB-EGF four related ligands which mediate their growth regulatory signals in part through interaction with EGFR, were able to stimulate tyrosine phosphorylation of EGFR expressed in recombinant NIH3T3 cells (for EGF, see FIG. 10, Panel 3, lane 2), but not HER4, HER2, or HER3 expressed in recombinant CHO or 293 cells (FIG. 10, Panel 1, 2, 4, lanes 2 and 3).
  • the assay identified a HepG2-derived preparation (fraction 17) as a HER4 ligand capable of specifically
  • HER2, HER3 or HER4 the receptor expression profile of MDA-MB-453 cells offers an excellent indicator for morphologic differentiation inducing activity.
  • This cell line is known to express HER2 and HER3, but contains no detectable EGFR.
  • the results of the semi-quantitative PCR assays indicated high level expression of HER4 in MDA-MB-453 cells.
  • cDNA encoding the prototype HER4 polypeptide of the invention was first isolated from this cell line (Section 6., supra).
  • MDA-MB-453 cells (7500/well) were grown in 50 ml DMEM supplemented with 5% FBS and 1x essential amino acids. Cells were allowed to adhere to 96-well plates for 24 hr. Samples were diluted in the above medium, added to the cell monolayer in 50 ml final volume, and the incubation continued for an additional 3 days. Cells were then examined by inverted light microscopy for morphologic changes. 9.1.2. Source Cells
  • Serum free media from a panel of cultures of human cancer cells were screened for growth regulatory activity on MDA-MB-453 cells.
  • a human hepatocarcinoma cell line, HepG2 was identified as a source of a factor which induced dramatic morphologic
  • Section 10.1.1., supra was used throughout the purification procedure to monitor the column fractions that induce morphological changes in MDA-MB-453 cells.
  • HepG2 cells were cultured in DMEM containing 10% fetal bovine serum using Nunc cell factories. At about 70% confluence, cells were washed then incubated with serum-free DMEM.
  • Conditioned medium HepG2-CM was collected 3 days later, and fresh serum-free medium added to the cells. Two additional harvests of HepG2-CM were collected per cell factory. The medium was centrifuged and stored at -20° C in the presence of 500 mM PMSF.
  • HepG2-CM Ten litres of HepG2-CM were concentrated 16-fold using an Amicon ultrafiltration unit (10,000 molecular weight cutoff membrane), and subjected to sequential precipitation with 20% and 60% ammonium sulfate.
  • Dialyzed fractions were assayed for tyrosine phosphorylation of MDA-MB-453 cells, essentially as described (Wen et al., 1992, Cell 69:559-72), except PY20 was used as the primary antibody and horseradish peroxidase-conjugated goat F(ab')2 anti-mouse Ig (Cappell) and chemiluminescence were used for detection. Phosphorylation signals were analyzed using the Molecular Dynamics personal
  • FIG. 11, Panel 1-3 untreated MDA-MB-453 cells are moderately adherent and show a rounded morphology (FIG. 11, Panel 1).
  • the addition of semi-purified HepG2-derived factor induces these cells to display a noticeably flattened morphology with larger nuclei and increased cytoplasm (FIG. 11, Panel 2 and 3).
  • This HepG2-derived factor preparation also binds to heparin, a property which was utilized for purifying the activity.
  • the HepG2-derived factor was found to elute from a phenyl hydrophobic
  • FIG. 11 Panel 4 shows the phenyl column elution profile.
  • fraction 16 phosphorylation assays of the phenyl column fractions revealed that the same fractions found to induce differentiation of the human breast carcinoma cells are also able to stimulate tyrosine phosphorylation of a 185 kDa protein in MDA-MB-453 cells (FIG. 11, Panel 5).
  • fraction 16 induced a 4.5-fold increase in the phosphorylation signal compared to the baseline signal observed in unstimulated cells, as determined by densitometry analysis (FIG. 11, Panel 6).
  • FIG. 10, Panel 1, lane 4 activation of the HER4 kinase without directly affecting the phosphorylation of HER2, EGFR, or HER3 (FIG. 10, Panel 1-4, lane 4).
  • Adjacent fraction 14 was used as a control and had no effect on the phosphorylation of any of the EGFR- family receptors (FIG. 10, Panel 1-4, lane 5).
  • fraction 17 Further purification and analysis of the factor present in fraction 17 indicates that it is a
  • the HepG2-derived factor also has functional properties similar to NDF and HRG, inasmuch as it stimulates tyrosine phosphorylation of HER2/p185 in MDA-MB-453 cells, but not EGFR in NR5 cells, and induces morphologic differentiation of HER2 overexpressing human breast cancer cells.
  • Recombinant NDF was expressed in COS cells and tested for its activity on HER4 in an assay system essentially devoid of other known members of the EGFR- family, notably EGFR and HER2.
  • a full length rat NDF cDNA was isolated from normal rat kidney RNA and inserted into a cDM8-based expression vector to generate cNDF1.6. This construct was transiently expressed in COS cells, and
  • the crude NDF supernatants were also tested for the ability to phosphorylate EGFR (NR5 cells), HER2
  • transmembrane receptors or by intracellular
  • a HER4 cDNA probe corresponding to the 5' portion of the gene was used for in situ hybridization mapping of the HER4 gene.
  • in situ hybridization to metaphase chromosomes from lymphocytes of two normal male donors was conducted using the HER4 probe labeled with 3 H to a specific activity of 2.6 ⁇ 10 7 cpm/ ⁇ g as described (Marth et al., 1986, Proc. Natl. Acad. Sci. U.S.A. 83:7400-04). The final probe concentration was 0.05 ⁇ g/ ⁇ l of hybridization mixture. Slides were exposed for one month. Chromosomes were identified by Q banding.
  • CHO cells expressing recombinant HER4 or HER2 were generated as previously described in Section 8.
  • MDA-MB453 were seeded in 24 well plates and cultured
  • Biochemicals or anti-HER2 Mab (c-neu Ab-2, Oncogene
  • Clarified conditioned medium was either used directly or was dialyzed against 0.1 M acetic acid for 2 days, dried, and resuspended as a 20-fold concentrate in DMEM.
  • recombinant heregulin induces tyrosine phosphorylation of HER4.
  • Tyrosine phosphorylated receptors were detected by Western blotting with an anti-phosphotyrosine Mab a,
  • CNHER2 and CNHER4 expression plasmids were generated by insertion of the complete coding
  • HER2 immunoprecipitations were as described in FIG. 15, using 5 ⁇ 10 6 cells per reaction, and the HER2 Western blots were performed with a second anti-HER2 Mab (c-neu Ab-3, Oncogence Sciences).
  • a second anti-HER2 Mab c-neu Ab-3, Oncogence Sciences.
  • 5 ⁇ 10 6 cells were incubated for 4-6 h in methionine and cysteine-free Minimal Essential Medium (MEM) supplemented with 2% FBS and 250 ⁇ Ci/ml [ 35 S]Express protein labeling mix (New England
  • FIG. 16 Transfected CEM cells were selected that stably express either HER2, HER4, or both recombinant receptors.
  • Panel 1. recombinant HER2 was detected by immunmoprecipitation of cell lysates with anti-HER2 Mab (Ab-2) and Western blotting with another anti-HER2 Mab (Ab-3).
  • Panel 2 recombinant HER4 was detected by
  • Example 12 support the earlier observation that HER2 alone is not sufficient to transduce the heregulin signal.
  • a panel of human CEM cells that express the recombinant receptors either alone or in combination was established.
  • the desired model system was of human origin, since many of the reagents against erbB family members are specific to the human homologues.
  • CEM cells are a human T lymphoblastoid cell line and were found to lack expression of EGF receptor, HER2, HER3, or HER4, by a variety of
  • FIG. 16 demonstrates the selection of three CEM cell lines that express only HER2 (CEM 1-3), only HER4 (CEM 3-13), or both HER2 and HER4 (CEM 2-9).
  • CEM 1-3 CEM 1-3
  • CEM 3-13 CEM 3-13
  • CEM 2-9 CEM 2-9
  • the presence of a functionally and structurally intact HER2 in the appropriate cells was confirmed by the induction of HER2 tyrosine phosphorylation by each of the two antibodies specific to the extracellular domain of HER2, but not by an isotype matched control antibody (FIG. 16, Panel 3).
  • Recombinant rat heregulin was prepared as in FIG. 15, and diluted to 7x in RPMI.
  • the HER4-specific Mab was prepared by immunization of mice with recombinant HER4 (manuscript in preparation). CEM cells (5 ⁇ 10 6 ) were treated with the concentrated supernatants for 10 min, room temperature and precipitated with PY20 or anti-HER2 Mab (Ab-2) as described in FIG. 15.
  • Immunoprecipitation with anti-HER4 Mab was performed by incubation of cells lysates with a 1:5 dilution of hybridoma supernatent for several hours followed by 2 ⁇ g rabbit anti-mouse Ig (cappel) and Protein A
  • heregulin induces tyrosine phosphorylation in CEM cells expressing HER4.
  • CEM cell lines that express either HER2 or HER4 alone (CEM 1-3 and CEM 3-13) or together (CEM 2-9) were incubated with 7x concentrated supernatants from mock-(-) or heregulin-transfected (+) COS-1 cells.
  • Solubilized cells were immunoprecipitated (IP) with anti-phosphotyrosine Mab (PY20) (FIG. 17, Panel 1); HER2-specific anti-HER2 Mab (Ab-2) (FIG. 17, Panel 2); or HER4-specific Mab (6-4) (FIG. 17, Panel 3).
  • tyrosine phosphorylated receptors were detected by Western blotting with anti-phosphotyrosine Mab.
  • the size in kilodaltons of prestained molecular weight markers (BioRad) is shown on the left and arrows indicate the HER2 and HER4 proteins.
  • the panel of CEM cells were then analyzed by phosphotyrosine Western blots of cells lysates
  • heregulin in cells that co-express HER4 (FIG. 17, Panel 2). Furthermore, precipitation with a HER4-specific Mab confirms that heregulin induces tyrosine phosphorylation of HER4 irrespective of HER2
  • recombinant heregulin was produced as an epitope-tagged fusion with
  • amphiregulin The 63 amino acid EGF-structural motif of rat heregulin (Wen et al., supra) from serine 177 to tyrosine 239 was fused to the N-terminal 141 amino acids of the human amphiregulin precursor (Plowman et al., supra). This truncated portion of heregulin has previously been shown to be active when expressed in E. coli (Holmes et al., supra), and the N-terminal residues of amphiregulin provide an epitope for immunologic detection and purification of the
  • This cDNA fragment was spliced into a cDM8 based expression vector for transient expression in COS-1 cells. Recombinant heregulin was purified by anion exchange and reverse phase
  • HER4 tyrosine phosphorylation Purified heregulin was iodinated with 250 ⁇ Ci of 125 I-labeled Bolton-Hunter reagent (NEN). CHO/HER4 or CHO/HER2 cells were incubated with 125 I-heregulin (10 5 -cpm) for 2 h at 4° C. Monolayers were washed in PBS and 3 mM Bis(sulfosuccinimidyl) suberate (BS 3 , Pierce) was added for 30 min on ice. The cells were washed in tris-buffered saline, dissolved in SDS sample buffer, run on a 7% polyacrylamide gel, and visualized on the phosphorimager.
  • HER4 is the receptor for heregulin.
  • HER2 in heregulin-responsive breast cancer cells leads to increased binding, whereas expression of HER2 in heregulin-unresponsive ovarian or fibroblast cells has no effect (Peles et al., supra).
  • Northern and in situ hybridization analyses localizes HER4 to the white matter and glial cells of the central and peripheral nervous system, as well as to cardiac, skeletal, and smooth muscle. This
  • MDA-MB 453 cells were obtained from the American Type Culture Collection (Rockville, MD) and cultured in Dulbecco's modified Eagle's medium (DMEM)
  • HepG2 cells were obtained from Dr. S. Radka and cultured in 10% fetal bovine serum containing DMEM. For large scale
  • HepG2 cells were propagated in Nunc cell factories.
  • Chinese hamster ovary cells (CHO-KI) expressing high levels of either recombinant human p185 erbB2 (CHO/HER2) or
  • recombinant human p180 erbB4 (CHO/HER4) were generated and cultured as described in Section 8.
  • N29 monoclonal antibody to the extracellular portion of the human HER2 receptor was a gift from Dr. Y. Yarden.
  • Ab-3 c-neu monoclonal antibody that reacts with the human p185 erbB2 was from Oncogene Science Inc.
  • MDA-MB-453 human breast cancer cells overexpress p185 erbB2 but do not express the EGFR at their surface
  • HepG2 cells Medium conditioned by HepG2 cells (HepG2-CM, 60 liters) was concentrated 26-fold using an Amicon ultrafiltration unit (10,000 molecular weight cutoff membranes) and then subjected to 50% ammonium sulfate ((NH 4 ) 2 SO4 4 ) precipitation. After centrifugation at 25,000 ⁇ g for 1 h, the supernatant was loaded, as five separate runs, on a phenyl-Sepharose column (2.5 ⁇ 24.5 cm, Pharmacia LKB Biotechnology Inc.)
  • Proteins were eluted at 1 ml/min. with a 330-ml gradient from PBS to 1 M NaCl in PBS. Fractions of 5 ml were collected. The active material was loaded on a TSKgel heparin-5PW HPLC column (7.5 x 75 mm,
  • CHO/HER2 cells Following a 10-min. incubation at 37° C, cells were washed and then lysed in 100 ⁇ l of boiling electrophoresis sample buffer. Lysates were heated at 100° C for 5 min., cleared by centrifugation, and then subjected to SDS-PAGE. After
  • nitrocellulose nitrocellulose.
  • the membrane was blocked for 2 h at room temperature with 6% hovine serum albumin in 10 mM Tria-HCl, pH 8.0, 150 mM NaCl, 0.05% Tween 20.
  • PY20 monoclonal anti-phosphotyrosine antibody (ICN, 2 h at 22° C) and horseradish peroxidase-conjugated goat anti-mouse IgG F(ab') 3 (Cappel, 1h at 22° C) were used as primary and secondary probing reagents, respectively. Proteins phosphorylated on tyrosine residues were detected with a chemiluminescence reagent (Amersham Corp.).
  • CHO/HER2 stimulation Assay CHO/HER2 cells were seeded in 24-well plates at 1 ⁇ 10 5 cells/well and cultured 24 h. Monoclonal
  • Clarified extracts were incubated for 2 h at 4° C with an antip- 185 erbB2 antibody (Ab-3 c-neu, Oncogene Science Inc.). Rabbit anti-mouse IgG (Cappel) and protein A-Sepharose were then added, and samples were incubated an antip- 185 erbB2 antibody (Ab-3 c-neu, Oncogene Science Inc.). Rabbit anti-mouse IgG (Cappel) and protein A-Sepharose were then added, and samples were incubated an
  • Immune complexes were washed 3 times with PBS-TDS, resolved on a 7% polyacrylamide gel, and electrophoretically transferred to
  • HPLC-purified p45 (1.5 ⁇ g) was iodinated with 250 ⁇ Ci of 124 I-labeled Bolton-Hunter reagent obtained from Du Pont-New England Nuclear. 125 I-p45 was purified by filtration through a Pharmacia PD-10 column. The specific activity was 10 4 cpm/ng. 125 I-p45 retained its biological activity as confirmed in a differentiation assay as well as a kinase stimulation assay (data not shown). Binding of radiolabeled p45 was performed on 2 ⁇ 10 5 CHO/HER4 cells and 4 ⁇ 10 5 CHO-KI or CHO/HER2 cells in 12-well plates.
  • Cell monolayers were washed twice with 1 ml of ice-cold binding buffer (DMEM supplemented with 44 mM sodium bicarbonate, 50 mM BES [N-, N-Bis (2-hydroxyethyl) -2-aminoethan-sulfonic acid], pH 7.0, 0.1% bovine serum albumin) and then incubated on ice for 2 h with 50 ng/ml 125 I-p45 in the absence or the presence of 250 ng/ml unlabeled p45. The monolayers were washed twice with PBS and then incubated in the presence of 1 mM
  • radioactivity was determined by using a ⁇ -counter.
  • N-terminal Amino Acid Sequence The N-terminal sequence analysis of p45 (25 pmol) was performed as previously described (Shoyab et al., 1990, Proc. Natl. Acad. Sci. 87:7912-7916).
  • FIG. 21 Panel 1 shows the stimulatory effect of sequential fractions from the size exclusion
  • p45 specifically stimulated tyrosine phosphorylation of p180 erbB4 (FIG. 21, Panel 2).
  • p45 was not able to stimulate phosphorylation in CHO/HER2 cells, and the cell were found to express functional p185 erbB2 receptor as evidenced by immunoreactivity with 5 monoclonal antibodies specific to different regions of p185 erbB2 .
  • p45 has an N-terminal amino acid sequence similar to the recently isolated p185 erbB2 ligand.
  • Binding and cross-linking studies were performed in order to confirm that p45 was able to bind to p180 erbB4 . Binding studies revealed that while no specific binding of 125 I-p45 to CHO-KI and CHO/HER2 cells could be measured, CHO/HER4 cells displayed a single high affinity site (Kd about 5nM) with 7 ⁇ 104 receptors/cell (FIG. 22, Panel 1). The results of iodinated p45 cross-linking to CHO-KI, CHO/HER2, or CHO/HER4 cells are presented in FIG. 22, Panel 2.
  • the 210 kDa band corresponds to the p45-p180 erbB4 complex (assuming an equimolar stoichiometry of ligand and receptor), whereas the high molecular weight band is presumed to be a dimerized form of the receptor-ligand complex.
  • the 100 kDa band could represent a truncated portion of the extracellular domain of the p180 erbB4 receptor complexed to 125 I-p45 or a covalently associated p45 dimer.
  • the c-kit ligand provides precedence for cross-linked dimers (Williams et al., 1990, Cell 63:167-174). 13.6. Results
  • the HER4 ligand, p45 purified from medium conditioned by HepG2, induces differentiation of breast cancer cells and activates tyrosine
  • ⁇ 2-Ig and the mouse monoclonal antibody directed against the Pseudomonas exotoxin (PE) was supplied by Dr. J.-M. Colusco and by Dr. Tony Siadek, respectively (Bristol-Myers-Squibb, Seattle, WA).
  • the cell lines BT474, MDA-MB-453, T47D, SKBR-3, and MCF-7 (all breast carcinoma), LNCaP (prostate carcinoma), CEM (T-cell leukemia) and SKOV3 (ovarian carcinoma) were obtained from ATCC (Rockville, MD).
  • carcinoma cell line were established at Bristol-Myers-Squibb (Seattle, WA).
  • the AU565 breast carcinoma cell line was purchased from the Cell Culture laboratory.
  • Naval Biosciences Laboratory (Naval Supply Center, Oakland, CA). All cell lines were of human origin.
  • BT474 and T47D cells were cultured in IMDM
  • fetal bovine serum FBS
  • 10 ⁇ g/ml insulin 10 ⁇ g/ml insulin.
  • MCF-7, H3396, LNCaP and L2987 were cultured in IMDM supplemented with 10% FBS.
  • SKBR3 and SKOV3 cells were grown in McCoys media supplemented with 10% FBS and 0.5% non-essential amino acids.
  • AU565 cells were cultured in RPMI 1640 media
  • Rat heregulin cDNA (Wen et al., 1994, Mol. Cell. Biol. 14:1909-1919) was isolated by RT-PCR using mRNA from rat kidney cells as template.
  • the cDNA was prepared in chimeric form with the AR leader sequence by a two-step PCR insertional cloning protocol using cARP (Plowman et al., 1990, Mol. Cell. Biol. 10:1969-1981) as template to amplify the 5' end of the chimeric ligand using the oligonucleotide primers
  • the EGF-like domain PCR was amplified from cNDFl.6 (Plowman et al., 1993, Nature 366:473-475) using the oligonucleotide primers
  • the products were combined and reamplified using the oligonucleotide primers CARP5 and XNDF1053.
  • the HAR (heregulin-amphiregulin) construct (cNANSHLIK) was PCR amplified in order to insert an Nde I restriction site on the 5' end and a Hind III restriction site on the 3' end with the oligonucleotide primers
  • the resulting expression plasmid pSE 8.4 then contained the gene fusion encoding the chimeric heregulin-toxin protein, under the control of a IPTG-inducible T7 promoter.
  • IPTG isopropyl-1-thio- ⁇ -D-galactopyranoside
  • solubilization buffer 50 mM Tris-HCl (pH 8.0), 10 mM EDTA, 1 ug/ml leupeptin, 2 ug/ml aprotinin, 1 ug/ml pepstatin-A, 0.5 mM PMSF
  • solubilization buffer 50 mM Tris-HCl (pH 8.0), 10 mM EDTA, 1 ug/ml leupeptin, 2 ug/ml aprotinin, 1 ug/ml pepstatin-A, 0.5 mM PMSF
  • the resulting pellet containing pre-purifled inclusion bodies was dissolved in 6.5 M guanidine-HCl, 0.1 M Tris-HCl (pH 8.0), 5 mM EDTA; sonicated; and refolded by rapid dilution (100-fold) into 0.1 M Tris-HCl (pH 8.0), 1.3 M urea, 5 mM EDTA, 1 mM glutathione, and 0.1 mM oxidized glutathione at 4°C.
  • the addition of the denaturating agent urea at low concentration was utilized to allow slow refolding and avoid the
  • the refolded HAR-TX ⁇ 2 protein was diluted 2-fold with 50 mM sodium phosphate (pH 7.0) and applied to a cation-exchange resin (POROS 50 HS, PerSeptive Biosystems, Cambridge, MA), pre-equilibrated in the same buffer.
  • the HAR-TX ⁇ 2 protein was eluted with a 450 nM NaCl step gradient in 50 mM sodium phosphate (pH 7.0) and fractions were analyzed using SDS-PAGE and Coomassie blue staining.
  • Membranes from 5 ⁇ 10 7 MDA-MB-453 cells were prepared and coated to 96 well plates as previously described for H3396 human breast carcinoma cells
  • EGF-R family (1-5 ⁇ 10 6 cells) were stimulated with 500 ng/ml HAR-TX ⁇ 2 for 5 minutes at room temperature.
  • the cells were pelleted and resuspended in 0.1 ml lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 5 mM MgCl 2 , 1% NP40, 0.5% deoxycholate, 0.1% sodium dodecylsulfate, 1 mM sodium orthovanadate) at 4°C.
  • 0.1 ml lysis buffer 50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 5 mM MgCl 2 , 1% NP40, 0.5% deoxycholate, 0.1% sodium dodecylsulfate, 1 mM sodium orthovanadate
  • tumor cells (10 5
  • Calcein-AM is membrane permeable and virtually non-fluorescent. When it is hydrolyzed by intracellular esterases, an intensely fluorescent product, calcein is formed. The % cytotoxicity was calculated as previously described (Siegall et al., supra). To determine the specificity of the cytotoxic effect of HAR-TX ⁇ 2 competitive assays were performed on LNCaP and on MDA-MB-453 cells. Treated essentially as described above, plates were incubated with increasing concentrations of HAR-TX ⁇ 2 in presence heregulin ⁇ 2-Ig (0.002-5.0 ⁇ g/ml) or with HAR-TX ⁇ 2 (50 ng/ml). Isotype matched L6-Ig (Hellström et al., 1986, Cancer Res. 46:3917-3923) was used as negative control for the competition assay.
  • HER4 expressed in baculovirus, was used as the immunogen for subcutaneous injection into 4-6 week old female BALB/c mice. Immunization was performed 4 times (approximately 1 month apart) with 20 ⁇ g of HER4 protein given each time. Spleen cells from immunized mice were removed four days after the final
  • transfected CHO cells (Plowman et al., 1993, Nature 366:473-475) and selected against parental CHO cells and human fibroblasts. Secondary screening was performed by ELISA on plates coated with
  • baculovirus/HER4 membranes Positive hybridomas were rescreened by two additional rounds of ELISA using CHO/HER4 and HER4 negative cells, and identified false positive were removed. Positive hybridomas were cloned in soft agar and tested for reactivity with the HER4 positive MDA-MB-453 human breast carcinoma cell line and CEM cells co-transfected with HER4 and HER2.
  • Anti-HER4 hybridoma line 6-4-11 (IgG1) was cloned in soft agar and screened for reactivity to native and denatured HER4.
  • a second antibody (7-142, IgG2a) was also selected and found to bind to the cytoplasmic domain of HER4.
  • HER2, HER3, and HER4 protein were determined by quantification of specific antibody binding, detected by the CAS Red Chromagen system (Becton Dickson Cellular Imaging System,
  • HER2 staining was performed by using mouse anti-HER2 mAb 24.7 (Stancovski et al., 1991, Proc. Natl. Acad. Sci. USA 88:8691-8695) as primary, and biotinylated goat anti-mouse IgG (Jackson Labs, West Grove, PA) as secondary antibody as previously described (Bacus et al., 1993, Cancer Res. 53:5251-5261).
  • the primary antibodies used were, respectively, mouse anti-HER3 mAb RTJ2 (Santa Cruz Biotech, Santa Cruz, CA) at 2.5 ⁇ g/ml concentration or mouse anti-HER4 mAb 6-4-11 at 15 ⁇ g/ml concentration followed by incubation with biotinylated rabbit anti-mouse IgG (Zymed Labs, South San Francisco, CA).
  • the staining procedure was performed at RT as follows: cells were fixed in 10% neutral buffered formalin for 60 minutes, washed with H 2 O and rinsed with Tris buffered saline (TBS; 0.05 M Tris, 0.15 M NaCl, pH 7.6). Unspecific binding sites were blocked by incubation with 10% goat serum (for HER2) or rabbit serum (for HER3 and HER4) in 0.1% bovine serum
  • the HAR-TX ⁇ 2 expression plasmid encoding the hydrophilic leader sequence from amphiregulin (AR), heregulin ⁇ 2 , and PE40, under control of the IPTG inducible T7 promoter, was constructed as described in Section 15.1.2., supra , and is diagrammatically shown in FIG. 23, Panel 1.
  • the AR leader sequence was added to the N-terminus of heregulin to facilitate the purification procedure (FIG. 23, Panel 2).
  • FIG. 24A and 24B show the nucleotide sequence and the deduced amino acid sequence of the cDNA encoding HAR-TX ⁇ 2
  • Chimeric HAR-TX ⁇ 2 protein was expressed in E. coli of inclusion bodies. Recombinant protein was denatured and refolded as described in Section
  • HAR-TX ⁇ 2 was found to bind to the immobilized cell membranes in a dose-dependent fashion up to 300 ⁇ g/ml (FIG. 26).
  • PE40 the toxin component of HAR-TX ⁇ 2 used as negative control, was unable to bind to MDA-MB-453 membranes.
  • HER4 receptor phosphorylation assay was performed as previously described for heregulin (Carraway et al., 1994, J. Biol. Chem. 269:14303-14306). CEM cells expressing different HER family members were exposed to HAR-TX ⁇ 2 and stimulation of tyrosine
  • HER4 is sufficient and necessary for induction of tyrosine phosphorylation in response to HAR-TX ⁇ 2 , which is not true for HERl and for HER2.
  • HAR-TX ⁇ 2 does not induce tyrosine phosphorylation in CEM cells transfected with HERl confirms that the hydrophilic leader sequence of amphiregulin does not affect the specificity of the heregulin moiety in its selective interaction between receptor family members.
  • the cell killing activity of HAR-TX ⁇ 2 was determined against a variety of human cancer cell lines.
  • AU565 and SKBR3 breast carcinomas and LNCaP prostate carcinoma were sensitive to HAR-TX ⁇ 2 with EC 50 values of 25, 20, 4.5 ng/ml, respectively, while SKOV3 ovarian carcinoma cells were insensitive to HAR-TX ⁇ 2 (EC 50 >2000 ng/ml) (FIG. 28, Panel 1).
  • Addition of heregulin ⁇ 2-Ig to LNCaP cells reduced the
  • SKOV3, L2987 and H3396 displayed both HER2 and HER3 in the absence of HER4.
  • H3396 and L2987 cells were determined by phosphotyrosine immunoblots following HAR-TX ⁇ 2 induction.
  • HAR-TX ⁇ 2 was found to induce tyrosine phosphorylation in both tumor cell types (FIG. 29) similar to that previously seen in COS-7 cells transfected with HER2 and HER3 (Sliwkowski et al., supra).
  • SKOV3 cells were found to exhibit the same tyrosine phosphorylation pattern in the presence or absence of heregulin and thus direct interaction between receptors and heregulin could not be
  • mice 2/2 animals died at 2 mg/kg, 2/2 died at 1 mg/kg, 1/2 died at 0.75 mg/kg, and 0/2 died at 0.5 mg/kg, thus the LD 50 is about 0.75 mg/kg (Table V).
  • rats the determined LD 50 was slightly higher, as 50% of the animals died at 1 mg/kg (Table V).
  • the present invention is not to be limited in scope by the microorganisms and cell lines deposited or the embodiments disclosed herein, which are

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Cell Biology (AREA)
  • Biotechnology (AREA)
  • Public Health (AREA)
  • General Engineering & Computer Science (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Wood Science & Technology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biomedical Technology (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The molecular cloning, expression, and biological characteristics of a novel receptor tyrosine kinase related to the epidermal growth factor receptor, termed HER4/p180?erbB4¿, are described. An HER4 ligand capable of inducing cellular differentiation of breast cancer cells is also disclosed. In view of the expression of HER4 in several human cancers and in certain tissues of neuronal and muscular origin, various diagnostic and therapeutic uses of HER4-derived and HER4-related biological compositions are provided.

Description

HER4 HUMAN RECEPTOR TYROSINE KINASE
This application is a continuation-in-part of United States Application Serial No. 08/150,704, filed November 10, 1993, which is a continuation-in-part of United States Application Serial No. 07/981,165, filed November 24, 1992, each of which applications are incorporated herein in their entireties. 1. Introduction
The present invention is generally directed to a novel receptor tyrosine kinase related to the
epidermal growth factor receptor, termed HER4/p180erbB4 ("HER4"), and to novel diagnostic and therapeutic compositions comprising HER4-derived or HER4-related biological components. The invention is based in part upon applicants discovery of human HER4, its complete nucleotide coding sequence, and functional properties of the HER4 receptor protein. More specifically, the invention is directed to HER4 biologies comprising, for example, polynucleotide molecules encoding HER4, HER4 polypeptides, anti-HER4 antibodies which
recognize epitopes of HER4 polypeptides, ligands' which interact with HER4, and diagnostic and therapeutic compositions and methods based fundamentally upon such molecules. In view of the expression of HER4 in several human cancers and in certain tissues of neuronal and muscular origin, the present invention provides a framework upon which effective biological therapies may be designed. The invention is
hereinafter described in detail, in part by way of experimental examples specifically illustrating various aspects of the invention and particular embodiments thereof. 2. Background of the Invention
Cells of virtually all tissue types express transmembrane receptor molecules with intrinsic tyrosine kinase activity through which various growth and differentiation factors mediate a range of
biological effects (reviewed in Aaronson, 1991,
Science 254:1146-52). Included in this group of receptor tyrosine kinases (RTKs) are the receptors for polypeptide growth factors such as epidermal growth factor (EGF), insulin, platelet-derived growth factor (PDGF), neurotrophins (i.e., NGF), and fibroblast growth factor (FGF). Recently, the ligands for several previously-characterized receptors have been identified, including ligands for c-kit (steel
factor), met (hepatocyte growth factor), trk (nerve growth factor) (see, respectively, Zsebo et al., 1990, Cell 63:195-201; Bottardo et al., 1991, Science
251:802-04; Kaplan et al., 1991, Nature 350:158-160). In addition, the soluble factor NDF, or heregulinalpha (HRG-α), has been identified as the ligand for HER2, a receptor which is highly related to HER4 (Hen et al., 1992, Cell 69:559-72; Holmes et al., 1992,
Science 256:1205-10).
The heregulins are a family of molecules that were first isolated as specific ligands for HER2 (Wen, et al., 1992, Cell. 69:559-572; Holmes et al., 1992, Science 256:1205-1210; Falls et al., 1993, Cell
72:801-815; and Marchionni et al., 1993, Nature
362:312-318). A rat homologue was termed Neu
differentiation factor (NDF) based on its ability to induce differentiation of breast cancer cells through its interaction with HER2/Neu (Wen et al., supra).
Heregulin also appears to play an important role in development and maintenance of the nervous system based on its abundant expression in cells of neuronal origin and on the recognition that alternatively spliced forms of the heregulin gene encode for two recently characterized neurotrophic activities. One neural-derived factor is termed acetylcholine receptor inducing activity (ARIA) (Falls et al., supra). This heregulin isoform is responsible for stimulation of neurotransmitter receptor synthesis during formation of the neuromuscular junction. A second factor is called glial growth factor (GGF) reflecting the proliferative affect this molecule has on glial cells in the central and peripheral nervous system
(Marchionni et al., supra). Additional, less well characterized molecules that appear to be isoforms of heregulin, include p45, gp30, and p75 (Lupu et al., 1990, Science 249:1552-1555; and Lupu et al., 1992, Proc. Natl. Acad. Sci. U.S.A. 89:2287-2291).
Several HER2-neutralizing antibodies fail to block heregulin activation of human breast cancer cells. Heregulin only activates tyrosine
phosphorylation of HER2 in cells of breast, colon, and neuronal origin, and not in fibroblasts or ovarian cell lines that overexpress recombinant HER2 (Peles et al., 1993, EMBO J. 12:961-971).
Biological relationships between various human malignancies and genetic aberrations in growth factor-receptor tyrosine kinase signal pathways are known to exist. Among the most notable such relationships involve the EGF receptor (EGFR) family of receptor tyrosine kinases (see Aaronson, supra). Three human EGFR-family members have been identified and are known to those skilled in the art: EGFR, HER2/p185erbB2 and HER3/p160erbB3 (see, respectively, Ullrich et al., 1984, Nature 309:418-25; Coussens at al., 1985, Science
230:1132-39; Plowman et al., 1990, Proc. Natl. Acad. Sci. U.S.A. 87:4905-09). EGFR-related molecules from other species have also been identified.
The complete nucleotide coding sequence of other EGFR-family members has also been determined from other organisms including: the drosophila EGFR ("DER": Livneh et al., 1985, Cell 40:599-607), nematode EGFR ("let-23": Aroian et al., 1990, Nature 348:693-698), chicken EGFR ("CER": Lax et al., 1988, Mol. Cell.
Biol. 8:1970-1978), rat EGFR (Petch et al., 1990, Mol. Cell. Biol. 10:2973-2982), rat HER2/Neu (Bargmann et al., 1986, Nature. 319:226-230) and a novel member isolated from the fish and termed Xiphophorus melanoma related kinase ("Xmrk": Wittbrodt et al., 1989, Nature 342:415-421). In addition, PCR technology has led to the isolation of other short DNA fragments that may encode novel receptors or may represent species-specific homologs of known receptors. One recent example is the isolation tyro-2 (Lai, C. and Lemke, G., 1991, Neuron 6:691-704) a fragment encoding 54 amino acids that is most related to the EGFR family.
Overexpression of EGFR-family receptors is frequently observed in a variety of aggressive human epithelial carcinomas. In particular, increased' expression of EGFR is associated with more aggressive carcinomas of the breast, bladder, lung and stomach
(see, for example, Neal et al., 1985, Lancet 1:366-68; Sainsbury et al., 1987, Lancet 1:1398-1402; Yasui et al., 1988, Int. J. Cancer 41:211-17; Veale et al., 1987, Cancer 55:513-16). In addition, amplification and overexpression of HER2 has been associated with a wide variety of human malignancies, particularly breast and ovarian carcinomas, for which a strong correlation between HER2 overexpression and poor clinical prognosis and/or increased relapse
probability have been established (see, for example. Slamon et al., 1987, Science 235:177-82, and 1989, Science 244:707-12). Overexpression of HER2 has also been correlated with other human carcinomas, including carcinoma of the stomach, endometrium, salivary gland, bladder, and lung (Yokota et al., 1986, Lancet 1:765-67; Fukushigi et al., 1986, Mol. Cell. Biol. 6:955-58; Yonemura et al., 1991, Cancer Res. 51:1034; Weiner et al., 1990, Cancer Res. 50:421-25; Geurin et al., 1988, Oncogene Res. 3:21-31; Semba et al., 1985, Proc. Natl. Acad. Sci. U.S.A. 82:6497-6501; Zhau et al., 1990,
Mol. Carcinog. 3:354-57; McCann et al., 1990, Cancer 65:88-92). Most recently, a potential link between HER2 overexpression and gastric carcinoma has been reported (Jaehne et al., 1992, J. Cancer Res. Clin. Oncol. 118:474-79). Finally, amplified expression of the recently described HER3 receptor has been observed in a wide variety of human adenocarcinomas (Poller et al., 1992, J. Path 168:275-280; Krause et al., 1989, Proc. Natl. Acad. Sci. U.S.A. 86:9193-97; European Patent Application No. 91301737, published 9.4.91, EP 444 961).
Several structurally related soluble polypeptides capable of specifically binding to EGFR have been identified and characterized, including EGF,
transforming growth factor-alpha (TGF-α), amphiregulin (AR), heparin-binding EGF (HB-EGF), and vaccinia virus growth factor (VGF) (see, respectively. Savage et al., 1972, J. Biol. Chem. 247:7612-21; Marquardt et al., 1984, Science 223:1079-82; Shoyab et al., 1989,
Science 243:1074-76; Higashiyama et al., 1991, Science 251:936-39; Twardzik et al., 1985, Proc. Natl. Acad. Sci. U.S.A. 82:5300-04). Despite the close structural relationships among receptors of the EGFR-family, none of these ligands has been conclusively shown to interact with HER2 or HER3. Recently, several groups have reported the identification of specific ligands for HER2. Some of these ligands, such as gp30 (Lupu et al., 1990,
Science 249:1552-55; Bacus et al., 1992, Cell Growth and Differentiation 3:401-11) interact with both EGFR and HER2, while others are reported to bind
specifically to HER2 (Wen et al., 1992, Cell 69:559- 72; Peles et al., 1992, Cell 69:205-16; Holmes et al., 1992, Science 256:1205-10; Lupu et al., 1992, Proc. Natl. Acad. Sci. U.S.A. 89:2287-91; Huang et al., 1992, J. Biol. Chem. 276:11508-121). The best
characterized of these ligands are neu differentiation factor (NDF) purified and cloned from ras-transformed Rat1-EJ cells (Wen et al., Peles et al., supra), and the heregulins (HRG-α, -β1, -ß2, -ß3), purified and cloned from human MDA-MB-231 cells (Holmes et al., supra). NDF and HRG-α share 93% sequence identity and appear to be the rat and human homologs of the same protein. Both of these proteins are similar size (44-45 kDa), increase tyrosine phosphorylation of HER2 in MDA-MB-453 cells and not the EGF-receptor, and have been reported to bind to HER2 in cross-linking studies on human breast cancer cells. In addition, NDF has been shown to induce differentiation of human mammary tumor cells to milk-producing, growth-arrested cells, whereas the heregulin family have been reported to stimulate proliferation of cultured human breast cancers cell monolayers.
Interestingly, although members of the heregulin family are capable of stimulating tyrosine
phosphorylation of HER2 in many mammary carcinoma cell lines, they are not able to act on this receptor in the ovarian carcinoma cell line SKOV3 or in HER2 transfected fibroblasts (Peles et al., 1993, EMBO J. 12:961-971). These observations indicated the existence of other receptors for heregulin responsible for the activation of HER2. Such cross-activation between members of the receptor tyrosine kinase family has been already reported and is believed to arise from a ligand induced receptor heterodimerization event (Wada et al., 1990, Cell 61:1339-1347).
Recently, it has been reported that HER3 binds
heregulin (Carraway et al., 1994, J. Biol. Chem.
269:14303-14306), and in fact, this receptor seems to be involved in the heregulin-mediated tyrosine kinase activation of HER2 (Carraway et al., supra ;
Sliwkowski et al., 1994, J. Biol. Chem. 269:14661-14665).
The means by which receptor polypeptides
transduce regulatory signals in response to ligand binding is not fully understood, and continues to be the subject of intensive investigation. However, important components of the process have been
uncovered, including the understanding that
phosphorylation of and by cell surface receptors hold fundamental roles in signal transduction. In addition to the involvement of phosphorylation in the signal process, the intracellular phenomena of receptor dimerization and receptor crosstalk function as primary components of the circuit through which ligand binding triggers a resulting cellular response.
Ligand binding to transmembrane receptor tyrosine kinases induces receptor dimerization, leading to activation of kinase function through the interaction of adjacent cytoplasmic domains. Receptor crosstalk refers to intracellular communication between two or more proximate receptor molecules mediated by, for example, activation of one receptor through a
mechanism involving the kinase activity of the other. One particularly relevant example of such a phenomenon is the binding of EGF to the EGFR, resulting in activation of the EGFR kinase domain and cross-phosphorylation of HER2 (Kokai et al., 1989, Cell
58:287-92; Stern et al., 1988, EMBO J. 7:995-1001; King et al., 1989, Oncoαene 4:13-18).
3. summary of the Invention
HER4 is the fourth member of the EGFR-family of receptor tyrosine kinases and is likely to be involved not only in regulating normal cellular function but also in the loss of normal growth control associated with certain human cancers. In this connection, HER4 appears to be closely connected with certain
carcinomas of epithelial origin, such as
adenocarcinoma of the breast. As such, its discovery, and the elucidation of the HER4 coding sequence, open a number of novel approaches to the diagnosis and treatment of human cancers in which the aberrant expression and/or function of this cell surface receptor is involved.
The complete nucleotide sequence encoding the prototype HER4 polypeptide of the invention is
disclosed herein, and provides the basis for several general aspects of the invention hereinafter
described. Thus, the invention includes embodiments directly involving the production and use of HER4 polynucleotide molecules. In addition, the invention provides HER4 polypeptides, such as the prototype HER4 polypeptide disclosed and characterized in the
sections which follow. Polypeptides sharing nearly equivalent structural characteristics with the
prototype HER4 molecule are also included within the scope of this invention. Furthermore, the invention includes polypeptides which interact with HER4
expressed on the surface of certain cells thereby affecting their growth and/or differentiation. The invention is also directed to anti-HER4 antibodies, which have a variety of uses including but not limited to their use as components of novel biological
approaches to human cancer diagnosis and therapy provided by the invention.
The invention also relates to the identification of HER4 ligands and methods for their purification.
The invention also relates to the discovery of an apparent functional relationship between HER4 and HER2, and the therapeutic aspects of the invention include those which are based on applicants'
preliminary understanding of this relationship.
Applicants' data strongly suggests that HER4 interacts with HER2 either by heterodimer formation or receptor crosstalk, and that such interaction appears to be one mechanism by which the HER4 receptor mediates effects on cell behavior. The reciprocal consequence is that HER2 activation is in some circumstances mediated through HER4.
In this connection, it appears that although heregulin induces phosphorylation of HER2 in cells expressing HER2 and HER4. Heregulin does not directly stimulate HER2 but acts by stimulating tyrosine phosphorylation of HER4.
Recognition of HER4 as a primary component of the heregulin signal transduction pathway opens a number of novel approaches to the diagnosis and treatment of human cancers in which the aberrant expression and/or function of heregulin and/or HER4 are involved. The therapeutic aspects of this invention thus include mediating a ligand's affect on HER4 and HER2 through antagonists, agonists or antibodies to HER4 ligands or HER4 receptor itself. The invention also relates to chimeric proteins that specifically target and kill HER4 expressing tumor cells, polynucleotides encoding such chimeric proteins, and methods cf using both in the therapeutic treatment of cancer and other human malignancies.
Applicants' data demonstrate that such recombinant chimeric proteins specifically bind to the HER4 receptor and are cytotoxic against tumor cells that express HER4 on their surface. The bifunctional retention of both the specificity of the cell-binding portion of the molecule and the cytotoxic potential of the toxin portion makes for a very potent and targeted reagent.
The invention further relates to a method
allowing determination of the cytotoxic activity of HER4 directed cytotoxic substances on cancer cells, thereby providing a powerful diagnostic tool; this will be of particular interest for prognosis of the effectiveness of these substances on an individual malignancy prior their therapeutic use.
4. Brief Description of the Figures
FIG. 1A and 1B. Nucleotide sequence [SEQ ID No:1] and deduced amino acid sequence of HER4 of the coding sequence from position 34 to 3961 (1308 amino acid residues) [SEQ ID No:2]. Nucleotides are
numbered on the left, and amino acids are numbered above the sequence.
FIG. 2A and 2B. Nucleotide sequence [SEQ ID No:3] and deduced amino acid sequence ([SEQ ID No:4] of cDNAs encoding HER4 with alternate 3' end and without autophosphorylation domain. This sequence is identical with that of HER4 shown in FIG. 1A and 1B up to nucleotide 3168, where the sequence diverges and the open reading frame stops after 13 amino acids. followed by an extended, unique 3'-untranslated region.
FIG. 3. Nucleotide sequence [SEQ ID No: 5] and deduced amino acid sequence [SEQ ID No: 6] of cDNA encoding HER4 with a N-terminal truncation. This sequence contains the 3'-portion of the HER4 sequence where nucleotide position 156 of the truncated sequence aligns with position 2335 of the complete HER4
sequence shown in FIG. 1A and 1B (just downstream from the region encoding the ATP-binding site of the HER4 kinase). The first 155 nucleotides of the truncated sequence are unique from HER4 and may represent the 5'-untranslated region of a transcript derived from a cryptic promoter within an intron of the HER4 gene. (Section 6.2.2., infra).
FIGS. 4 and 5. The deduced amino acid sequence of two variant forms of human HER4 aligned with the full length HER4 receptor as represented in FIG. 1A and 1B. Sequences are displayed using the single-letter code and are numbered on the right with the complete HER4 sequence on top and the variant sequences below.
Identical residues are indicated by a colon between the aligned residues.
FIG. 4. HER4 with alternate 3'-end, lacking an autophosphorylation domain [SEQ ID No. 4]. This sequence is identical with that of HER4, shown in FIG. 1A and 1B, up to amino acid 1045, where the sequence diverges and continues for 13 amino acids before reaching a stop codon.
FIG. 5. HER4 with N-terminal truncation [SEQ ID No. 6]. This sequence is identical to the 3'-portion of the HER4 shown in FIG. 1A and 1B beginning at amino acid 768. (Section 6.2.2., infra).
FIG. 6A and 6B. Deduced amino acid sequence of human HER4 and alignment with other human EGFR-family members (EGFR [SEQ ID No:7]; HER2 [SEQ ID No: 8]; HER3 [SEQ ID No:9]). Sequences are displayed using the single-letter code and are numbered on the left.
Identical residues are denoted with dots, gaps are introduced for optimal alignment, cysteine residues are marked with an asterisk, and N-linked
glycosylation sites are denoted with a plus (+).
Potential protein kinase C phosphorylation sites are indicated by arrows (HER4 amino acid positions 679, 685, and 699). The predicted ATP-binding site is shown with 4 circled crosses, C-terminal tyrosines are denoted with open triangles, and tyrosines in HER4 that are conserved with the major autophosphorylation sites in the EGFR are indicated with black triangles. The predicted extracellular domain extends from the boundary of the signal sequence marked by an arrow at position 25, to the hydrophobic transmembrane domain which is overlined from amino acid positions 650 through 675. Various subdomains are labeled on the right: I, II, III, and IV = extracellular subdomains (domains II and IV are cysteine-rich); TM=
transmembrane domain; TK = tyrosine kinase domain. Domains I, III, TK are boxed.
FIG. 7. Hydropathy profile of HER4, aligned with a comparison of protein domains for HER4 (1308 amino acids), EGFR (1210 amino acids), HER2 (1255 amino acids), and HER3 (1342 amino acids). The signal peptide is represented by a stippled box, the
cysteine-rich extracellular subdomains are hatched, the transmembrane domain is filled, and the
cytoplasmic tyrosine kinase domain is stippled. The percent amino acid sequence identities between HER4 and other EGFR-family members are indicated. Sig, signal peptide; I, II, III, and IV, extracellular domains; TM, transmembrane domain; JM, juxtamembrane domain; CaIn, calcium influx and internalization domain; 3'UTR, 3' untranslated region.
FIG. 8. Northern blot analysis from human tissues hybridized to HER4 probes. RNA size markers (in kilobases) are shown on the left. Lanes 1 through 8 represent 2 μg of poly(A)+ mRNA from pancreas, kidney, skeletal muscle, liver, lung, placenta, brain, and heart, respectively. FIG. 8 (Panel 1), Northern blot analysis of mRNA from human tissues hybridized to HER4 probes from the 3'-autophosphorylation domain; FIG. 8 (Panel 2), Northern blot analysis from human tissues hybridized to HER4 probes from the 5'- extracellular domain (see Section 6.2.3., infra).
FIG. 9. Immunoblot analysis of recombinant HER4 stably expressed in CHO-KI cells, according to
procedure outlined in Section 7.1.3, infra. Membrane preparations from CHO-KI cells expressing recombinant HER4 were separated on 7% SDS-polyacrylamide gels and transferred to nitrocellulose. In FIG. 9 (Panel 1), blots were hybridized with a monoclonal antibody to the C-terminus of HER2 (Ab3, Oncogene Science,
Uniondale, NY) that cross-reacts with HER4. In FIG. 9 (Panel 2), blots were hybridized with a sheep
antipeptide polyclonal antibody to a common epitope of HER2 and HER4. Lane 1, parental CHO-KI cells; lanes 2 - 4, CHO-KI/HER4 cell clones 6, 21, and 3,
respectively. Note the 180 kDa HER4 protein and the 130 kDa cross-reactive species. The size in
kilodaltons of prestained high molecular weight markers (BioRad, Richmond, CA) is shown on the left.
FIG. 10. Specific activation of HER4 tyrosine kinase by a breast cancer differentiation factor (see Section 8., infra). Four recombinant cell lines, each of which was engineered to overexpress a single member of EGFR-family of tyrosine kinase receptors (EGFR, HER2, HER3, and HER4), were prepared according to the methods described in Sections 7.1.2 and 8.1., infra. Cells from each of the four recombinant cell lines were stimulated with various ligand preparations and assayed for receptor tyrosine phosphorylation using the assay described in Section 8.2., infra. FIG. 10 (Panell), CHO/HER4 #3 cells; FIG. 10 (Panel 2), CHO/HER2 cells; FIG. 10 (Panel 3), NRHER5 cells; and FIG. 10 (Panel 4), 293/HER3 cells. Cells stimulated with: lane 1, buffer control; lane 2, 100 ng/ml EGF; lane 3, 200 ng/ml amphiregulin; lane 4, 10 μl phenyl, column fraction 17 (Section 9, infra); lane 5, 10 μl phenyl column fraction 14 (Section 9., infra, and see description of FIG. 9 below). The size (in
kilodaltons) of the prestained molecular weight markers are labeled on the left of each panel. The phosphorylated receptor in each series migrates just below the 221 kDa marker. Bands at the bottom of the gels are extraneous and are due to the reaction of secondary antibodies with the antibodies used in the immunoprecipitation.
FIG. 11. Biological and biochemical properties of the MDA-MB-453-cell differentiation activity purified from the conditioned media of HepG2 cells (Section 9., infra). FIG. 11 (Panel 1 and 2) show induction of morphologic differentiation. Conditioned media from HepG2 cells was subjected to ammonium sulfate fractionation, followed by dialysis against PBS. Dilutions of this material were added to MDA-MB-453 monolayer at the indicated protein concentrations. FIG. 11 (Panel 1), control; FIG. 11 (Panel 2), 80 ng per well; FIG. 11 (Panel 3), 2.0 μg per well; FIG. 11 (Panel 4), Phenyl-5PW column elution profile monitored at 230 nm absorbance; FIG. 11 (Panel 5), Stimulation of MDA-MB-453 tyrosine autophosphorylation with the following ligand preparations: None (control with no factor added); TGF-α (50 ng/ml); CM (16-fold concentrated HepG2 conditioned medium tested at 2 μl and 10 μl per well); fraction (phenyl column fractions 13 to 20, 10 μl per well). FIG. 11 (Panel 6),
Densitometry analysis of the phosphorylation signals shown in FIG. 11 (Panel 5)
FIG. 12. NDF-induced tyrosine phosphorylation. FIG. 12 (Panel 1), MDA-MB-453 cells (lane 1, mock transfected COS cell supernatant; lane 2, NDF
transfected COS cell supernatant); FIG. 12 (Panel 2), CHO/HER4 21-2 cells (lanes 1 and 2, mock transfected COS cell supernatant; lanes 3 and 4, NDF transfected COS cell supernatant). See Section 10., infra.
Tyrosine phosphorylation was determined by the
tyrosine kinase stimulation assay described in Section 8.2., infra.
FIG. 13. Regional location of the HER4 gene to human chromosome 2 band q33. FIG. 13 (Panel 1),
Distribution of 124 sites of hybridization on human chromosomes; FIG. 13 (Panel 2), Distribution of autoradiographic grains on diagram of chromosome 2.
FIG. 14. Amino acid sequence of HER4-Ig fusion protein [SEQ ID No: 10] (Section 5.4., infra).
FIG. 15. Recombinant heregulin induces tyrosine phosphorylation of HER4. Tyrosine phosphorylated receptors were detected by Western blotting with an anti-phosphotyrosine Mab. Arrows indicate the HER2 and HER4 proteins. FIG. 15 (Panel 1), Monolayers of MDA-MB453 or FIG. 15 (Panel 2), CHO/HER4 cells were incubated with media from COS-1 cells transfected with a rat heregulin expression plasmid (HRG), or with a cDM8 vector control (-). The media was either applied directly (1x) or after concentrating 20-fold (20x, and vector control). Solubilized cells were immunoprecipitated with anti-phosphotyrosine Mab.
FIG. 15 (Panel 3), Monolayers of CHO/HER2 cells were incubated as above with transfected Cos-1 cell
supernatants or with two stimulatory Mabs to HER2 (Mab 28 and 29). Solubilized cells were immunoprecipitated with anti-HER2 Mab.
FIG. 16. Expression of recombinant HER2 and HER4 in human CEM cells. Transfected CEM cells were selected that stably express either HER2, HER4, or both recombinant receptors. In FIG. 16 (Panel 1), recombinant HER2 was detected by immunmoprecipitation of cell lysates with anti-HER2 Mab (Ab-2) and Western blotting with another anti-HER2 Mab (Ab-3). In FIG. 16 (Panel 2), Recombinant HER4 was detected by
immunoprecipitation of 35S-labeled cell lysates with HER4-specific rabbit anti-peptide antisera. In FIG. 16 (Panel 3), Three CEM cell lines were selected that express one or both recombinant receptors and aliquots of each were incubated with media control (-), with two HER2-stimulatory Mabs (Mab 28 and 29), or with an isotype matched control Mab (18.4). Solubilized cells were immunoprecipitated with anti-HER2 Mab (Ab-2) and tyrosine phosphorylated HER2 was detected by Western blotting with an anti-phosphotyrosine Mab. The size in kilodaltons of prestained high molecular weight markers (Bio-Rad) is shown on the left and arrows indicate the HER2 and HER4 proteins.
FIG. 17. Heregulin induces tyrosine
phosphorylation in CEM cells expressing HER4. Three CEM cell lines that express either HER2 or HER4 alone (CEM 1-3 and CEM 3-13) or together (CEM 2-9) were incubated with 7x concentrated supernatants from mock-(-) or heregulin-transfected (+) COS-1 cells.
Solubilized cells were immunoprecipitated (IP) with anti-phosphotyrosine Mab (PY20); in FIG. 17 (Panel 1), HER2-specific anti-HER2 Mab (Ab-2); in FIG. 17 (Panel 2), HER4-specific Mab (6-4); in FIG. 17 (Panel 3), in each case tyrosine phosphorylated receptors were detected by Western blotting with anti-phosphotyrosine Mab. The size in kilodaltons of prestained molecular weight markers (BioRad) is shown on the left and arrows indicate the HER2 and HER4 proteins. HRG, recombinant rat heregulin.
FIG. 18. Covalent cross-linking of iodinated heregulin to HER4. 125I-heregulin was added to
CHO/HER4 or CHO/HER2 cells for 2 h at 4° C. Washed cells were cross-linked with BS3, lysed, and the proteins separated using 7% PAGE. Labeled bands were detected on the phosphorimager. Molecular weight markers are shown on the left.
FIG. 19. Purification of p45 from HepG2
conditioned media. Column fractions were tested for their potential to induce differentiation of MDA-MB-453 cells. Active fractions were pooled as indicated by an horizontal bar. FIG. 19 (Panel 1), Concentrated HepG2 conditioned medium was subjected to 50% ammonium sulfate precipitation. Supernatant resulting from this step was subjected to hydrophobic interaction chromatography using phenyl-Sepharose. Pooled
fractions were then loaded on a DEAE-Sepharose column. FIG. 19 (Panel 2), the DEAE-Sepharose column flow-through was subjected to CM-Sepharose chromatography. FIG. 19 (Panel 3), Affinity Chromatography of the MDA-MB-453 differentiation factor using heparin-5PW column. Fractions 35-38 eluting around 1.3M NaCl were pooled. FIG. 19 (Panel 4), Size Exclusion
chromatography of the differentiation factor. The molecular masses of calibration standards are
indicated in kilodaltons. FIG. 20. Aliguots (25 microliter) of the active size exclusion column fractions (30 and 32) were
electrophoresed under reducing conditions on a 12.5%
polyacrylamide gel. The gel was silver-stained.
Molecular masses of Bio-Rad silver stain standards are indicated in kilodaltons.
FIG. 21. Stimulation of tyrosine phosphorylation by p45. FIG. 21 (Panel 1), Size exclusion column
fractions were tested on MDA-MB-453 cells for the
induction of tyrosine phosphorylation. Cell lysates
were then electrophoresed on a 4-15% polyacrylamide
gel. After transfer to nitrocellulose, proteins were probed with a phosphotyrosine antibody and
phosphoproteins detected by chemiluminescence. The
molecular mass of the predominantly phosphorylated
protein is indicated. FIG. 21 (Panel 2), the
experiments were performed on cells that had been
transfected with expression plasmids for either HER4
(CHO/HER4) or HER2 (CHO/HER2). Cell monolayers were
incubated in the absence or the presence of p45 (size exclusion column fraction 32, 100 ng/ml). Samples
were then processed as indicated in FIG. 21 (Panel 1) except that a 7.5% polyacrylamide gel was used to
separate the CHO/HER2 cell lysates. FIG. 21 (Panel
3), CHO/HER2 cells were incubated in the presence or
the absence of N29 monoclonal antibody to the
extracellular domain of p185erbB2. Cell lysates were
immunoprecipitated with the Ab-3 monoclonal antibody
to p185erbB2. Precipitated proteins were subjected to
SDS-PAGE, and phosphoproteins were detected as
indicated under Section 13.4., supra.
FIG. 22. Binding and cross-linking of 125I-p45 to
CHO-KI, CHO-HER2 and CHO/HER4 cells. FIG. 22 (Panel
1), Scatchard analysis of the binding of 135I-p45 to
CHO/HER4 cells. Increasing concentrations of 125I-p45 1 were incubated with cell monolayers for 2 h at 4° C. Nonspecific binding was subtracted from all cell-associated radioactivity data values. A Scatchard plot as well as a saturation curve of the binding data are shown. FIG. 22 (Panel 2), Covalent cross-linking. 125I-p45 was added to the cells in the presence or absence of an excess of unlabeled p45 for 2 h at 4° C. After washing of the cells to remove unbound iodinated material, the cross-linking reagent bis- (sulfosuccinimidyl)-suberate was added to the cells for 45 min. at 4° C. Cells were lysed and proteins separated by electrophoresis on a 7.5% polyacrylamide gel. Molecular masses of protein standards are indicated in kilodaltons. A Molecular Dynamics
Phospholmager was used to visualize the radioactive species.
FIG. 23. Construction of the HAR-TX β2
expression plasmid, encoding the hydrophilic leader sequence of amphiregulin (AR), heregulin β2, and PE40, under control of the IPTG inducible T7 promoter; FIG. 23 (Panel A), schematic diagram of the expression plasmid pSE 8.4, encoding HAR-TX β2; FIG. 23 (Panel B), amino acid sequence of HAR β2 , the ligand portion of HAR-TX β2, composed of the AR leader sequence and rat heregulin β2 [SEQ ID No:40].
FIG. 24A and 24B. cDNA sequence [SEQ ID No:41] and deduced amino acid sequence [SEQ ID No:42] of the chimera HAR-TX β2, comprising the amphiregulin (AR) leader sequence and the coding sequences of rat heregulin Pseudomonas exotoxin PE40. The linker sequence between the two portions is indicated by a bar above the sequence, the ligand portion is located at the 5' (N-terminal), the PE40 exotoxin portion is located at the 3' (C-terminal) part of the sequence. Nucleotides are numbered on the right side, and amino acids are numbered below the sequence.
FIG. 25. Purification of the chimeric HAR-TX β2 protein: shown is a Coomassie brilliant blue stained SDS-PAGE (4-20%) of the different purification steps. Lanes 1 - 5 have been loaded under reducing
conditions. Lane 1, MW standards; lane 2 , refolded HAR-TX β2, 20x concentrated; lane 3, POROS HS flow-through, 20x concentrated; lane 4, POROS HS eluate; lane 5, Source 15S eluate (pure HAR-TX β2, 2 μg); lane 6, 2 μg HAR-TX β2, loaded under non-reducing
conditions.
FIG. 26. Membrane-based ELISA binding analysis, performed to determine the binding activity of the purified HAR-TX β2 protein. Binding of HAR-TX β2 (O) and PE40 (●) to membranes prepared from the HER4 expressing human breast carcinoma cell line.
FIG. 27. HAR-TX β2 induced tyrosine
phosphorylation in transfected CEM cells. CEM cells co-expressing HER4 and HER2 (H2,4), or expressing HER4 (H4), HER2 (H2), HER1 (HI) alone, respectively, were incubated in the presence (+) or absence (-) of HAR-TX β2, then solubilized, and immunoblotted with the monoclonal anti-phosphotyrosine antibody PY20. The arrow indicates the phosphorylated receptor band, the molecular weight is indicated in kDA.
FIG. 28. Cytotoxic effect of HAR-TX β2 on tumor cell lines. FIG. 28 (Panel 1), following 48 hours incubation with HAR-TX β2, the cell killing effect of HAR-TX β2 on the tumor cell lines LNCaP (■), AU565 (O), SKBR3 (●), and SKOV3 (□) by quantification of fluorescent calcein cleaved from calcein-AM. FIG. 28 (Panel 2), Competitive cytotoxicity of HAR-TX β2 with heregulin β2-Ig. LNCaP cells were co-incubated with 50 ng/ml HAR-TX β2 and increasing concentrations (2-5000 ng/ml) of either heregulin β2-Ig (□) or L6-Ig (■). The data represent the mean of triplicate assays.
FIG. 29. HAR-TX β2 induced tyrosine
phosphorylation in tumor cells expressing HER3 (L2987) or co-expressing HER2 and HER3 (H3396). Cells were incubated in the presence (+) or in the absence (-) of HAR-TX β2, solubilized, and immunoblotted with the monoclonal anti-phosphotyrosine antibody PY20.
Phosphorylated receptors are indicated by an arrow, the molecular weight is indicated in kDa.
5. Detailed Description of the Invention
The present invention is directed to HER4/p180erbB4 ("HER4"), a closely related yet distinct member of the Human EGF Receptor (HER)/neu subfamily of receptor tyrosine kinases, as well as HER4-encoding
polynucleotides (e.g., cDNAs, genomic DNAs, RNAs, anti-sense RNAs, etc.), the production of mature and precursor forms of HER4 from a HER4 polynucleotide coding sequence, recombinant HER4 expression vectors, HER4 analogues and derivatives, anti-HER4 antibodies, HER4 ligands, and diagnostic and therapeutic uses of HER4 polynucleotides, polypeptides, ligands, and antibodies in the field of human oncology and
neurobiology.
As discussed in Section 2, supra, HER2 has been reported to be associated with a wide variety of human malignancies, thus the understanding of its activation mechanisms as well as the identification of molecules involved are of particular clinical interest. This invention uncovers an apparent functional relationship between the HER4 and HER2 receptors involving HER4-mediated phosphorylation of HER2, potentially via intracellular receptor crosstalk or receptor
dimerization. In this connection, the invention also provides HER4 ligands capable of inducing cellular differentiation in breast carcinoma cells that appears to involve HER4-mediated phosphorylation of HER2.
Furthermore, applicants' data provide evidence that heregulin mediates biological effects on such cells not directly through HER2, as has been reported (Peles et al., 1992, Cell 69:205-216), but instead by means of a direct interaction with HER4, and/or through an interaction with a HER2/ HER4 complex. In cell lines expressing both HER2 and HER4, binding of heregulin to HER4 may stimulate HER2 either by heterodimer
formation of these two related receptors or by
intracellular receptor crosstalk.
Recently, also HER3 has been reported to bind heregulin (see Section 2, supra). However, various observations indicate that the heregulin-mediated activation of HER3 varies considerably, depending on the context of expression, suggesting that other cellular components may be involved in the modulation of HER3 activity (reviewed in: Carraway and Cantley, 1994, Cell 78:5-8).
Unless otherwise indicated, the practice of the present invention utilizes standard techniques of molecular biology and molecular cloning, microbiology, immunology, and recombinant DNA known in the art.
Such techniques are described and explained throughout the literature, and can be found in a number of more comprehensive publications such as, for example,
Sambrook et al., Molecular Cloning; A Laboratory
Manual (Second Edition, 1989).
5.1. HER4 Polynucleotides
One aspect of the present invention is directed to HER4 polynucleotides, including recombinant
polynucleotides encoding the prototype HER4 polypeptide shown in FIG. 1A and 1B, polynucleotides which are related or are complementary thereto, and recombinant vectors and cell lines incorporating such recombinant polynucleotides. The term "recombinant polynucleotide" as used herein refers to a
polynucleotide of genomic, cDNA, synthetic or
semisynthetic origin which, by virtue of its origin or manipulation, is not associated with any portion of the polynucleotide with which it is associated in nature, and may be linked to a polynucleotide other than that to which it is linked in nature, and
includes single or double stranded polymers of
ribonucleotides, deoxyribonucleotides, nucleotide analogs, or combinations thereof. The term also includes various modifications known in the art, including but not limited to radioactive and chemical labels, methylation, caps, internucleotide
modifications such as those with charged linkages (e.g., phosphorothothioates, phosphorodithothioates, etc.) and uncharged linkages (e.g., methyl
phosphonates, phosphotriesters, phosphoamidites, carbamites, etc.), as well as those containing pendant moeties, intercalcators, chelators, alkylators, etc. Related polynucleotides are those having a contiguous stretch of about 200 or more nucleotides and sharing at least about 80% homology to a corresponding
sequence of nucleotides within the nucleotide sequence disclosed in FIG. 1A and 1B. Several particular embodiments of such HER4 polynucleotides and vectors are provided in example Sections 6 and 7, infra.
HER4 polynucleotides may be obtained using a variety of general techniques known in the art, including molecular cloning and chemical synthetic methods. One method by which the molecular cloning of cDNAs encoding the prototype HER4 polypeptide of the invention (FIG. 1A and 1 B), as well as several HER4 polypeptide variants, is described by way of example in Section 6., infra. Conserved regions of the sequences of EGFR, HER2, HER3, and Xmrk are used for selection of the degenerate oligonucleotide primers which are then used to isolate HER4. Since many of these sequences have extended regions of amino acid identity, it is difficult to determine if a short PCR fragment represents a unique molecule or merely the species-specific counterpart of EGFR, HER2, or HER3. Often the species differences for one protein are as great as the differences within species for two distinct proteins. For example, fish Xmrk has regions of 47/55 (85%) amino acid identity to human EGFR, suggesting it might be the fish EGFR, however
isolation of another clone that has an amino acid sequence identical to Xmrk in this region (57/57) shows a much higher homology to human EGFR in its flanking sequence (92% amino acid homology) thereby suggesting that it, and not Xmrk, is the fish EGFR (Wittbrodt et al., 1989, Nature 342:415-421). As described in Section 6., infra, it was necessary to confirm that a murine HER4/erbB4 PCR fragment was indeed a unique gene, and not the murine homolog of EGFR, HER2, or HER3, by isolating genomic fragments corresponding to murine EGFR, erbB2 and erbB3.
Sequence analysis of these clones confirmed that this fragment was a novel member of the EGFR family.
Notably a region of the murine clone had a stretch of 60/64 amino acid identity to human HER2, but
comparison with the amino acid and DNA sequences of the other EGFR homologs from the same species (mouse) firmly established it encoded a novel transcript.
HER4 polynucleotides may be obtained from a variety of cell sources which produce HER4-like activities and/or which express HER4-encoding mRNA. In this connection, applicants have identified a number of suitable human cell sources for HER4
polynucleotides, including but not limited to brain, cerebellum, pituitary, heart, skeletal muscle, and a variety of breast carcinoma cell lines (see Section 6., infra).
For example, polynucleotides encoding HER4 polypeptides may be obtained by cDNA cloning from RNA isolated and purified from such cell sources or by genomic cloning. Either cDNA or genomic libraries of clones may be prepared using techniques well known in the art and may be screened for particular HER4-encoding DNAs with nucleotide probes which are
substantially complementary to any portion of the HER4 gene. Various PCR cloning techniques may also be used to obtain the HER4 polynucleotides of the invention. A number of PCR cloning protocols suitable for the isolation of HER4 polynucleotides have been reported in the literature (see, for example, PCR protocols: A Guide to Methods and Applications. Eds. Inis et al., Academic Press, 1990).
For the construction of expression vectors, polynucleotides containing the entire coding region of the desired HER4 may be isolated as full length clones or prepared by splicing two or more polynucleotides together. Alternatively, HER4-encoding DNAs may be synthesized in whole or in part by chemical synthesis using techniques standard in the art. Due to the inherent degeneracy of nucleotide coding sequences, any polynucleotide encoding the desired HER4
polypeptide may be used for recombinant expression. Thus, for example, the nucleotide sequence encoding the prototype HER4 of the invention provided in FIG. 1A and 1B may be altered by substituting nucleotides such that the same HER4 product is obtained.
The invention also provides a number of useful applications of the HER4 polynucleotides of the invention, including but not limited to their use in the preparation of HER4 expression vectors, primers and probes to detect and/or clone HER4, and diagnostic reagents. Diagnostics based upon HER4 polynucleotides include various hybridization and PCR assays known in the art, utilizing HER4 polynucleotides as primers or probes, as appropriate. One particular aspect of the invention relates to a PCR kit comprising a pair of primers capable of priming cDNA synthesis in a PCR reaction, wherein each of the primers is a HER4 polynucleotide of the invention. Such a kit may be useful in the diagnosis of certain human cancers which are characterized by aberrant HER4 expression. For example, certain human carcinomas may overexpress HER4 relative to their normal cell counterparts, such as human carcinomas of the breast. Thus, detection of HER4 overexpression mRNA in breast tissue may be an indication of neoplasia. In another, related
embodiment, human carcinomas characterized by
overexpression of HER2 and expression or
overexpression of HER4 may be diagnosed by a
polynucleotide-based assay kit capable of detecting both HER2 and HER4 mRNAs, such a kit comprising, for example, a set of PCR primer pairs derived from divergent sequences in the HER2 and HER4 genes, respectively.
5.2. HER4 Polypeptides
Another aspect of the invention is directed to HER4 polypeptides, including the prototype HER4 polypeptide provided herein, as well as polypeptides derived from or having substantial homology to the amino acid sequence of the prototype HER4 molecule. The term "polypeptide" in this context refers to a polypeptide prepared by synthetic or recombinant means, or which is isolated from natural sources. The term "substantially homologous" in this context refers to polypeptides of about 80 or more amino acids sharing greater than about 90% amino acid homology to a corresponding contiguous amino acid sequence in the prototype HER4 primary structure (FIG. 1A and 1B). The term "prototype HER4" refers to a polypeptide having the amino acid sequence of precursor or mature HER4 as provided in FIG. 1A and 1B, which is encoded by the consensus cDNA nucleotide sequence also
provided therein, or by any polynucleotide sequence which encodes the same amino acid sequence.
HER4 polypeptides of the invention may contain deletions, additions or substitutions of amino acid residues relative to the sequence of the prototype HER4 depicted in FIG. 1A and 1B which result in silent changes thus producing a bioactive product. Such amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility,
hydrophobicity, hydrophilicity and/or the amphipathic nature of the resides involved. For example,
negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; amino acids with
uncharged polar head groups or nonpolar head groups having similar hydrophilicity values include the following: leucine, isoleucine, valine; glycine, alanine; asparagine, glutamine; serine, threonine;
phenylalanine, tyrosine.
The HER4 polypeptide depicted in FIG. 1A and 1B has all of the fundamental structural features characterizing the EGFR-family of receptor tyrosine kinases (Hanks et al., 1988, Science 241:42-52). The precursor contains a single hydrophobic stretch of 26 amino acids characteristic of a transmembrane region that bisects the protein into a 625 amino acid
extracellular ligand binding domain, and a 633 amino acid C-terminal cytoplasmic domain. The ligand binding domain can be further divided into 4
subdomains (I - IV), including two cysteine-rich regions (II, residues 186-334; and IV, residues 496-633), and two flanking domains (I, residues 29-185; and III, residues 335-495) that may define specificity for ligand binding (Lax et al., 1988, Mol. Cell. Biol. 8:1970-78). The extracellular domain of HER4 is most similar to HER3, where domains II-IV of HER4 share 56-67% identity to the respective domains of HER3. In contrast, the same regions of EGFR and HER2 exhibit 43-51% and 34-46% homology to HER4, respectively (FIG. 6A and 6B). The 4 extracellular subdomains of EGFR and HER2 share 39-50% identity. HER4 also conserves all 50 cysteines present in the extracellular portion of EGFR, HER2, and HER3, except that the HER2 protein lacks the fourth cysteine in domain IV. There are 11 potential N-linked glycosylation sites in HER4, conserving 4 of 12 potential sites in EGFR, 3 of 8 sites in HER2, and 4 of 10 sites in HER3.
Following the transmembrane domain of HER4 is a cytoplasmic juxtamembrane region of 37 amino acids. This region shares the highest degree of homology with EGFR (73% amino acid identity) and contains two consensus protein kinase C phosphorylation sites at amino acid residue numbers 679 (Serine) and 699
(Threonine) in the FIG. 1A and 1B sequence, the latter of which is present in EGFR and HER2. Notably, HER4 lacks a site analogous to Thr654 of EGFR. Phosphorylation of this residue in the EGFR appears to block ligand-induced internalization and plays an important role in its transmembrane signaling (Livneh et al., 1988, Mol. Cell. Biol. 8:2302-08). HER4 also contains Thr692 analogous to Thr694 of HER2. This threonine is absent in EGFR and HER3 and has been proposed to impart cell-type specificity to the mitogenic and transforming activity of the HER2 kinase (DiFiore et al. 1992, EMBO J. 11:3927-33). The juxtamembrane region of HER4 also contains a MAP kinase consensus phosphorylation site at amino acid number 699 (Threonine), in a position homologous to Thr699 of EGFR which is phosphorylated by MAP kinase in response to EGF stimulation (Takishima et al., 1991, Proc. Natl. Acad. Sci. U.S.A. 88:2520-25).
The remaining cytoplasmic portion of HER4
consists of a 276 amino acid tyrosine kinase domain, an acidic helical structure of 38 amino acids that is homologous to a domain required for ligand-induced internalization of the EGFR (Chen et al., 1989, Cell 59:33-43), and a 282 amino acid region containing 18 tyrosine residues characteristic of the
autophosphorylation domains of other EGFR-related proteins (FIG. 6A and 6B). The 276 amino acid
tyrosine kinase domain conserves all the diagnostic structural motifs of a tyrosine kinase, and is most related to the catalytic domains of EGFR (79%
identity) and HER2 (77% identity), and to a lesser degree, HER3 (63% identity). In this same region, EGFR and HER2 share 83% identity. Examples of the various conserved structural motifs include the following: the ATP-binding motif (GXGXXG) [SEQ ID No: 11] with a distal lysine residue that is predicted to be involved in the phosphotransfer reaction (Hanks et al., 198, Science 241:42-52; Hunter and Cooper, in The Enzymes Vol. 17 (eds. Boyer and Krebs) pp. 191-246 (Academic Press 1986)); tyrosine-kinase specific signature sequences (DLAARN [SEQ ID No: 12] and PIKWMA [SEQ ID No:13]) and Tyr875 (FIG. 6A and 6B), a residue that frequently serves as an autophosphorylation site in many tyrosine kinases (Hunter and Cooper, supra); and approximately 15 residues that are either highly or completely conserved among all known protein kinases (Plowman et al., 1990, Proc. Natl. Acad. Sci. U.S.A. 87:4905-09; Hanks et al., supra). The C-terminal 282 amino acids of HER4 has limited homology with HER2 (27%) and EGFR (19%). However, the C-terminal domain of each EGFR-family receptor is proline-rich and conserves stretches of 2-7 amino acids that are generally centered around a tyrosine residue. These residues include the major tyrosine autophosphorylation sites of EGFR at Tyr1068, Tyr1086, Tyrll48, and Tyrll73 (FIG. 6A and 6B, filled
triangles; Margolis et al., 1989, J. Biol. Chem.
264:10667-71).
5.3. Recombinant synthesis of HER4 Polypeptides The HER4 polypeptides of the invention may be produced by the cloning and expression of DNA encoding the desired HER4 polypeptide. Such DNA may be ligated into a number of expression vectors well known in the art and suitable for use in a number of acceptable host organisms, in fused or mature form, and may contain a signal sequence to permit secretion. Both prokaryotic and eukaryotic host expression systems may be employed in the production of recombinant HER4 polypeptides. For example, the prototype HER4
precursor coding sequence or its functional equivalent may be used in a host cell capable of processing the precursor correctly. Alternatively, the coding sequence for mature HER4 may be used to directly express the mature HER4 molecule. Functional
equivalents of the HER4 precursor coding sequence include any DNA sequence which, when expressed inside the appropriate host cell, is capable of directing the synthesis, processing and/or export of HER4.
Production of a HER4 polypeptide using
recombinant DNA technology may be divided into a four-step process for the purposes of description: (1) isolation or generation of DNA encoding the desired HER4 polypeptide; (2) construction of an expression vector capable of directing the synthesis of the desired HER4 polypeptide; (3) transfection or
transformation of appropriate host cells capable of replicating and expressing the HER4 coding sequence and/or processing the initial product to produce the desired HER4 polypeptide; and (4) identification and purification of the desired HER4 product. 5.3.1. Isolation or Generation of HER4
Encoding DNA
HER4-encoding DNA, or functional equivalents thereof, may be used to construct recombinant
expression vectors which will direct the expression of the desired HER4 polypeptide product. In a specific embodiment, DNA encoding the prototype HER4
polypeptide (FIG. 1A and 1B), or fragments or
functional equivalents thereof, may be used to
generate the recombinant molecules which will direct the expression of the recombinant HER4 product in appropriate host cells. HER4-encoding nucleotide sequences may be obtained from a variety of cell sources which produce HER4-like activities and/or which express HER4-encoding mRNA. For example, HER4-encoding cDNAs may be obtained from the breast
adenocarcinoma cell line MDA-MB-453 (ATCC HTB131) as described in Section 6., infra. In addition, a number of human cell sources are suitable for obtaining HER4 cDNAs, including but not limited to various epidermoid and breast carcinoma cells, and normal heart, kidney, and brain cells (see Section 6.2.3., infra).
The HER4 coding sequence may be obtained by molecular cloning from RNA isolated and purified from such cell sources or by genomic cloning. Either cDNA or genomic libraries of clones may be prepared using techniques well known in the art and may be screened for particular HER4-encoding DNAs with nucleotide probes which are substantially complementary to any portion of the HER4 gene. Alternatively, cDNA or genomic DNA may be used as templates for PCR cloning with suitable oligonucleotide primers. Full length clones, i.e., those containing the entire coding region of the desired HER4 may be selected for
constructing expression vectors, or overlapping cDNAs can be ligated together to form a complete coding sequence. Alternatively, HER4-encoding DNAs may be synthesized in whole or in part by chemical synthesis using techniques standard in the art.
5.3.2. Construction of HER4 Expression
Vectors
Various expression vector/host systems may be utilized equally well by those skilled in the art for the recombinant expression of HER4 polypeptides. Such systems include but are not limited to microorganisms such as bacteria transformed with recombinant
bacteriophage DNA, plasmid DNA or cosmid DNA
expression vectors containing the desired HER4 coding sequence; yeast transformed with recombinant yeast expression vectors containing the desired HER4 coding sequence; insect cell systems infected with
recombinant virus expression vectors (e.g., baculovirus) containing the desired HER4 coding sequence; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing the desired HER4 coding sequence; or animal cell systems infected with recombinant virus expression vectors (e.g., adenovirus, vaccinia virus) including cell lines engineered to contain multiple copies of the HER4 DNA either stably amplified (e.g., CHO/dhfr, CHO/glutamine synthetase) or unstably amplified in double-minute chromosomes (e.g., murine cell lines).
The expression elements of these vectors vary in their strength and specificities. Depending on the host/vector system utilized, any one of a number of suitable transcription and translation elements may be used. For instance, when cloning in mammalian cell systems, promoters isolated from the genome of
mammalian cells, (e.g., mouse metallothionein
promoter) or from viruses that grow in these cells, (e.g., vaccinia virus 7.5K promoter or Moloney murine sarcoma virus long terminal repeat) may be used.
Promoters produced by recombinant DNA or synthetic techniques may also be used to provide for
transcription of the inserted sequences.
Specific initiation signals are also required for sufficient translation of inserted protein coding sequences. These signals include the ATG initiation codon and adjacent sequences. In cases where the entire HER4 gene including its own initiation codon and adjacent sequences are inserted into the
appropriate expression vectors, no additional
translational control signals may be needed. However, in cases where only a portion of the coding sequence is inserted, exogenous translational control signals, including the ATG initiation codon must be provided. Furthermore, the initiation codon must be in phase with the reading frame of the HER4 coding sequences to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of transcription attenuation sequences, enhancer elements, etc.
For example, in cases where an adenovirus is used as a vector for driving expression in infected cells, the desired HER4 coding sequence may be ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader
sequence. This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo
recombination. Insertion in a non-essential region of the viral genome (e.g., region E3 or E4) will result in a recombinant virus that is viable and capable of expressing HER4 in infected hosts. Similarly, the vaccinia 7.5K promoter may be used. An alternative expression system which could be used to express HER4 is an insect system. In one such system, Autographa californica nuclear polyhidrosis virus (AcNPV) is used as a vector to express foreign genes. The virus grows in Spodoptera frugiperda cells. The HER4 coding sequence may be cloned into non-essential regions (for example the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (for example the polyhedrin promoter). Successful insertion of the HER4 coding sequence will result in inactivation of the polyhedrin gene and production of non-occluded recombinant virus (i.e., virus lacking the
proteinaceous coat encoded by the polyhedrin gene). These recombinant viruses are then used to infect Spodoptera frugiperda cells in which the inserted gene is expressed. Yet another approach uses retroviral vectors prepared in amphotropic packaging cell lines, which permit high efficiency expression in numerous cells types. This method allows one to assess cell-type specific processing, regulation or function of the inserted protein coding sequence.
In addition, a host cell strain may be chosen which modulates the expression of the inserted
sequences, or modifies and processes the gene product in the specific fashion desired. Expression from certain promoters can be elevated in the presence of certain inducers (e.g., zinc and cadmium ions for metallothionein promoters). Therefore, expression of the recombinant HER4 polypeptide may be controlled. This is important if the protein product of the cloned foreign gene is lethal to host cells. Furthermore, modifications (e.g., phosphorylation) and processing (e.g., cleavage) of protein products are important for the function of the protein. Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of protein. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed.
5.3.3. Transformants Expressing HER4 Gene
Products
The host cells which contain the recombinant coding sequence and which express the desired HER4 polypeptide product may be identified by at least four general approaches (a) DNA-DNA, DNA-RNA or RNA-antisense RNA hybridization; (b) the presence or absence of "marker" gene functions; (c) assessing the level of transcription as measured by the expression of HER4 mRNA transcripts in the host cell; and (d) detection of the HER4 product as measured by
immunoassay and, ultimately, by its biological activities.
In the first approach, for example, the presence of HER4 coding sequences inserted into expression vectors can be detected by DNA-DNA hybridization using hybridization probes and/or primers for PCR reactions comprising polynucleotides that are homologous to the HER4 coding sequence.
In the second approach, the recombinant
expression vector/host system can be identified and selected based upon the presence or absence of certain "marker" gene functions (e.g., thymidine kinase activity, resistance to antibiotics, resistance to methotrexate (MTX), resistance to methionine
sulfoximine (MSX), transformation phenotype, occlusion body formation in baculovirus, etc.). For example, if the HER4 coding sequence is inserted within a marker gene sequence of the vector, recombinants containing that coding sequence can be identified by the absence of the marker gene function. Alternatively, a marker gene can be placed in tandem with the HER4 sequence under the control of the same or different promoter used to control the expression of the HER4 coding sequence. Expression of the marker in response to induction or selection indicates expression of the HER4 coding sequence. In a particular embodiment described by way of example herein, a HER4 expression vector incorporating glutamine synthetase as a
selectable marker is constructed, used to transfect CHO cells, and amplified expression of HER4 in CHO cells is obtained by selection with increasing
concentration of MSX. In the third approach, transcriptional activity for the HER4 coding region can be assessed by
hybridization assays. For example, polyadenylated RNA can be isolated and analyzed by Northern blot using a probe homologous to the HER4 coding sequence or particular portions thereof. Alternatively, total nucleic acids of the host cell may be extracted and assayed for hybridization to such probes.
In the fourth approach, the expression of HER4 can be assessed immunologically, for example by
Western blots, immunoassays such as
radioimmunoprecipitation, enzyme-linked immunoassays and the like. Alternatively, expression of HER4 may be assessed by detecting a biologically active
product. Where the host cell secretes the gene product the cell free media obtained from the cultured transfectant host cell may be assayed for HER4
activity. Where the gene product is not secreted, cell lysates may be assayed for such activity. In either case, assays which measure ligand binding to
HER4, HER4 phosphorylation, or other bioactivities of
HER4 may be used.
5.4. Anti-HER4 Antibodies
The invention is also directed to polyclonal and monoclonal antibodies which recognize epitopes of HER4 polypeptides. Anti-HER4 antibodies are expected to have a variety of useful applications in the field of oncology, several of which are described generally below. More detailed and specific descriptions of various uses for anti-HER4 antibodies are provided in the sections and subsections which follow. Briefly, anti-HER4 antibodies may be used for the detection and quantification of HER4 polypeptide expression in cultured cells, tissue samples, and in vivo. Such immunological detection of HER4 may be used, for example, to identify, monitor, and assist in the prognosis of neoplasms characterized by aberrant or attenuated HER4 expression and/or function.
Additionally, monoclonal antibodies recognizing epitopes from different parts of the HER4 structure may be used to detect and/or distinguish between native HER4 and various subcomponent and/or mutant forms of the molecule. Anti-HER4 antibody
preparations are also envisioned as useful
biomodulatory agents capable of effectively treating particular human cancers. In addition to the various diagnostic and therapeutic utilities of anti-HER4 antibodies, a number of industrial and research applications will be obvious to those skilled in the art, including, for example, the use of anti-HER4 antibodies as affinity reagents for the purification of HER4 polypeptides, and as immunological probes for elucidating the biosynthesis, metabolism and
biological functions of HER4.
Anti-HER4 antibodies may be useful for
influencing cell functions and behaviors which are directly or indirectly mediated by HER4. As an example, modulation of HER4 biological activity with anti-HER4 antibodies may influence HER2 activation and, as a consequence, modulate intracellular signals generated by HER2. In this regard, anti-HER4
antibodies may be useful to effectively block ligand-induced, HER4-mediated activation of HER2, thereby affecting HER2 biological activity. Conversely, anti-HER4 antibodies capable of acting as HER4 ligands may be used to trigger HER4 biological activity and/or initiate a ligand-induced, HER4-mediated effect on HER2 biological activity, resulting in a cellular response such as differentiation, growth inhibition, etc.
Additionally, anti-HER4 antibodies conjugated to cytotoxic compounds may be used to selectively target such compounds to tumor cells expressing HER4,
resulting in tumor cell death and reduction or
eradication of the tumor. In a particular embodiment, toxin-conjugated antibodies having the capacity to bind to HER4 and internalize into such cells are administered systemically for targeted cytotoxic effect. The preparation and use of radionuclide and toxin conjugated anti-HER4 antibodies are further described in Section 5.5., infra.
Overexpression of HER2 is associated with several human cancers. Applicants' data indicate that HER4 is expressed in certain human carcinomas in which HER2 overexpression is present. Therefore, anti-HER4 antibodies may have growth and differentiation
regulatory effects on cells which overexpress HER2 in combination with HER4 expression, including but not limited to breast adenocarcinoma cells. Accordingly, this invention includes antibodies capable of binding to the HER4 receptor and modulating HER2 or HER2-HER4 functionality, thereby affecting a response in the target cell. For the treatment of cancers involving HER4-mediated regulation of HER2 biological activity, agents capable of selectively and specifically
affecting the intracellular molecular interaction between these two receptors may be conjugated to internalizing anti-HER4 antibodies. The specificity of such agents may result in biological effects only in cells which co-express HER2 and HER4, such as breast cancer cells.
Various procedures known in the art may be used for the production of polyclonal antibodies to epitopes of HER4. For the production of polyclonal antibodies, a number of host animals are acceptable for the generation of anti-HER4 antibodies by
immunization with one or more injections of a HER4 polypeptide preparation, including but not limited to rabbits, mice, rats, etc. Various adjuvants may be used to increase the immunological response in the host animal, depending on the host species, including but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, oil emulsions, keyhole lympet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum.
A monoclonal antibody to an epitope of HER4 may be prepared by using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include but are not limited to the hybridoma technique originally
described by Kohler and Milstein (1975, Nature 256, 495-497), and the more recent human B-cell hybridoma technique (Kosbor et al., 1983, Immunology Today 4:72) and EBV-hybridoma technique (Cole et al., 1985,
Monoclonal Antibodies and Cancer Therapy, Alan R.
Liss, Inc., pp. 77-96). In addition, techniques developed for the production of "chimeric antibodies" by splicing the genes from a mouse antibody molecule of appropriate antigen specificity together with genes from a human antibody molecule of appropriate
biological activity may be used (Morrison et al.,
1984, Proc. Natl. Acad. Sci., 81:6851-6855; Neuberger et al., 1984, Nature. 312:604-608; Takeda et al.,
1985, Nature. 314:452-454). Alternatively, techniques described for the production of single chain antibodies (U.S. Patent 4,946,778) can be adapted to produce HER4-specific single chain antibodies.
Recombinant human or humanized versions of anti-HER4 monoclonal antibodies are a preferred embodiment for human therapeutic applications. Humanized antibodies may be prepared according to procedures in the
literature (e.g., Jones et al., 1986, Nature 321:522- 25; Reichman et al., 1988, Nature 332:323-27;
Verhoeyen et al., 1988, Science 239:1534-36). The recently described "gene conversion mutagenesis" strategy for the production of humanized anti-HER2 monoclonal antibody may also be employed in the production of humanized anti-HER4 antibodies (Carter et al., 1992, Proc. Natl. Acad. Sci. U.S.A. 89:4285-89). Alternatively, techniques for generating a recombinant phage library of random combinations of heavy and light regions may be used to prepare
recombinant anti-HER4 antibodies (e.g., Huse et al., 1989, Science 246:1275-81).
As an example, anti-HER4 monoclonal antibodies may be generated by immunization of mice with cells selectively overexpressing HER4 (e.g., CHO/HER4 21-2 cells as deposited with the ATCC) or with partially purified recombinant HER4 polypeptides. In one embodiment, the full length HER4 polypeptide (FIG. 1A and 1B) may be expressed in Baculovirus systems, and membrane fractions of the recombinant cells used to immunize mice. Hybridomas are then screened on
CHO/HER4 cells (e.g., CHO HER4 21-2 cells as deposited with the ATCC) to identify monoclonal antibodies reactive with the extracellular domain of HER4. Such monoclonal antibodies may be evaluated for their ability to block NDF, or HepG2-differentiating factor, binding to HER4; for their ability to bind and stay resident on the cell surface, or to internalize into cells expressing HER4; and for their ability to directly upregulate or downregulate HER4 tyrosine autophosphorylation and/or to directly induce a HER4-mediated signal resulting in modulation of cell growth or differentiation. In this connection, monoclonal antibodies N28 and N29, directed to HER2, specifically bind HER2 with high affinity. However, monoclonal N29 binding results in receptor internalization and downregulation, morphologic differentiation, and inhibition of HER2 expressing tumor cells in athymic mice. In contrast, monoclonal N28 binding to HER2 expressing cells results in stimulation of
autophosphorylation, and an acceleration of tumor cell growth both in vitro and in vivo (Bacus et al., 1992, Cancer Res. 52:2580-89; Stancovski et al., 1991, Proc. Natl. Acad. Sci. U.S.A. 88:8691-95). In yet another embodiment, a soluble recombinant HER4-Immunoglobulin (HER4-Ig) fusion protein is expressed and purified on a Protein A affinity column. The amino acid sequence of one such HER4-Ig fusion protein is provided in FIG. 14. The soluble HER4-Ig fusion protein may then be used to screen phage libraries designed so that all available combinations of a variable domain of the antibody binding site are presented on the surfaces of the phages in the library. Recombinant anti-HER4 antibodies may be propagated from phage which
specifically recognize the HER4-Ig fusion protein.
Antibody fragments which contain the idiotype of the molecule may be generated by known techniques.
For example, such fragments include but are not limited to: the F(ab) 'E2 fragment which can be produced by pepsin digestion of the intact antibody molecule; the Fab' fragments which can be generated by reducing the disulfide bridges of the F(ab')2
fragment, and the two Fab fragments which can be generated by treating the antibody molecule with papain and a reducing agent. Alternatively, Fab expression libraries may be constructed (Huse et al., 1989, Science. 246:1275-1281) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity to HER4 protein.
5.5. HER4 Ligands
One aspect of the present invention is directed to HER4 ligands. As defined herein, HER4 ligands are capable of binding to the 180K transmembrane protein, HER4/p180erbB4 or functional analogues thereof, and activating tyrosine kinase activity. Functional analogues of HER4/p180erbB4-ligands are capable of activating HER4 tyrosine kinase activity. Activation of the tyrosine kinase activity may stimulate
autophosphorylation and may affect a biological activity mediated by HER4. It has been observed in systems described in Section 12 and 13 that binding of HER4 ligands to HER4 triggers tyrosine phosphorylation and affects differentiation of breast cancer cells.
The HER4 ligands of the present invention include NDF, a 44 kDa glycoprotein isolated from ras-transformed rat fibroblasts (Wen et al., 1992, Cell 69:559-572); heregulin, its human homologue, which exists as multiple isoforms (Peles et al., 1992, Cell 69:205-218 and Holmes et al., 1992, Science 256:1205-1210) including p45, a 45K heparin-binding
glycoprotein that shares several features with the heregulin-family of proteins including molecular weight, ability to induce differentiation of breast cancer cells, activation of tyrosine phosphorylation in MDA-MB453 cells, and N-terminal amino acid sequence (Section 13, infra), gp30, and p75 (Lupu et al., 1990, Science 249:1552-1555 and Lupu et al., 1992, Proc. Natl. Acad. Sci. USA 89:2287-2291).
HER4 ligands of the present invention can be prepared by synthetic or recombinant means, or can be isolated from natural sources. The HER4 ligand of the present invention may contain deletions, additions or substitutions of amino acid residues relative to the sequence of NDF, p45 or other heregulins or any HER4 ligand known in the art as long as the ligand
maintains HER4 receptor binding and tyrosine kinase activation capacity. Such amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or the amphipathic nature of the resides involved. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; amino acids with uncharged polar head groups or nonpolar head groups having similar hydrophilicity values include the following: leucine, isoleucine, valine; glycine, alanine; asparagine, glutamine; serine, threonine;
phenylalanine, tyrosine.
5.5.1. Recombinant Expression of HER4
Ligands
The HER4 ligands of the present invention may be produced by the cloning and expression of DNA encoding the desired HER4 ligand. Such DNA may be ligated into a number of expression vectors well known in the art and suitable for use in a number of acceptable host organisms, in fused or mature form, and may contain a signal sequence to permit secretion. Both prokaryotic and eukaryotic host expression systems may be employed in the production of recombinant HER4 ligands. For example, a HER4 ligand precursor coding sequence or its functional equivalent may be used in a host cell capable of processing the precursor correctly.
Alternatively, the coding sequence for a mature HER4 ligand may be used to directly express the mature HER4 ligand molecule. Functional equivalents of the HER4 ligand precursor coding sequence include any DNA sequence which, when expressed inside the appropriate host cell, is capable of directing the synthesis, processing and/or export of the HER4 ligand.
Production of a HER4 ligand using recombinant DNA technology may be divided into a four-step process for the purposes of description: (1) isolation or
generation of DNA encoding the desired HER4 ligand; (2) construction of an expression vector capable of directing the synthesis of the desired HER4 ligand; (3) transfection or transformation of appropriate host cells capable of replicating and expressing the HER4 ligand coding sequence and/or processing the initial product to produce the desired HER4 ligand; and (4) identification and purification of the desired HER4 ligand product.
5.5.2. isolation of HER4 Encoding DMA
HER4 ligand-encoding nucleic acid sequences may be obtained from human hepatocellular carcinoma cell lines, specifically the HepG2 cells available from the ATCC, accession number HB 8065. In addition, a number of human cell sources are suitable for obtaining HER4 ligand nucleic acids, including MDA-MB-231 cells available from the ATCC, accession number HTB 26, brain tissue (Falls et al., 1993, Cell 72:801-815 and Marchionni et al., 1993 Nature 362:312-318), and any cell source capable of producing an activity capable of binding to the 180K transmembrane protein,
HER4/p180erbB4, encoded by the HER4/ERBB4 gene and activating tyrosine kinase activity. Methods useful in assaying for the identification of HER4 ligands is disclosed in Section 5.8., infra.
The techniques disclosed in Sections 5.3.2. and 5.3.3., infra apply to the construction of HER4 ligand expression vectors and identification of recombinant transformants expressing HER4 ligand gene products.
5.5.3. Anti-HER4 Ligand Antibodies The present invention is also directed to
polyclonal and monoclonal antibodies which recognize eptitopes of HER4 ligand polypeptides. Anti-HER4 ligand antibodies are expected to have a variety of useful applications in the field of oncology.
Briefly, anti-HER4 ligand antibodies may be used for the detection and quantification of HER4 ligand polypeptide expression in cultured cells, tissue samples, and in vivo. For example, monoclonal
antibodies recognizing epitopes from different parts of the HER4 ligand structure may be used to detect and/or distinguish binding from non-binding regions of the ligand. Anti-HER4 ligand antibody preparations are also envisioned as useful biomodulatory agents capable of effectively treating particular human cancers. An anti-HER4 ligand antibody could be used to block signal transduction mediated through HER4, thereby inhibiting undesirable biological responses. In addition to the various diagnostic and therapeutic utilities of anti-HER4 ligand antibodies, a number of industrial and research applications will be obvious to those skilled in the art, including, for example, the use of anti-HER4 ligand antibodies as affinity reagents for the purification of HER4 ligand
polypeptides, and as immunological probes for
elucidating the biosynthesis, metabolism and
biological functions of HER4 ligands. Anti-HER4 ligand antibodies may be useful for influencing cell functions and behaviors which are directly or indirectly mediated by HER4. As an example, modulation of HER4 biological activity with anti-HER4 ligand antibodies may influence HER2 activation and, as a consequence, modulate
intracellular signals generated by HER2. In this regard, anti-HER4 ligand antibodies may be useful to effectively block ligand-induced, HER4-mediated activation of HER2, thereby affecting HER2 biological activity. Conversely, anti-HER4 ligand antibodies capable of acting as HER4 ligands may be used to trigger HER4 biological activity and/or initiate a ligand-induced, HER4-mediated effect on HER2
biological activity, resulting in a cellular response such as differentiation, growth inhibition, etc.
Additionally, anti-HER4 ligand antibodies conjugated to cytotoxic compounds may be used to selectively target such compounds to tumor cells expressing HER4, resulting in tumor cell death and reduction or eradication of the tumor.
Various procedures known in the art may be used for the production of antibodies to epitopes of HER4 ligand (see Section 5.4, supra).
5.6. Diagnostic Methods
The invention also relates to the detection of human neoplastic conditions, particularly carcinomas of epithelial origin, and more particularly human breast carcinomas. In one embodiment, oligomers corresponding to portions of the consensus HER4 cDNA sequence provided in FIG. 1A and 1B are used for the quantitative detection of HER4 mRNA levels in a human biological sample, such as blood, serum, or tissue biopsy samples, using a suitable hybridization or PCR format assay, in order to detect cells or tissues expressing abnormally high levels of HER4 as an indication of neoplasia. In a related embodiment, detection of HER4 mRNA may be combined with the detection HER2 mRNA overexpression, using appropriate HER2 sequences, to identify neoplasias in which a functional relationship between HER2 and HER4 may exist.
In another embodiment, labeled anti-HER4
antibodies or antibody derivatives are used to detect the presence of HER4 in biological samples, using a variety of immunoassay formats well known in the art, and may be used for in situ diagnostic
radioimmunoimaging. Current diagnostic and staging techniques do not routinely provide a comprehensive scan of the body for metastatic tumors. Accordingly, anti-HER4 antibodies labeled with, for example, fluorescent, chemiluminescent, and radioactive
molecules may overcome this limitation. In a
preferred embodiment, a gamma-emitting diagnostic radionuclide is attached to a monoclonal antibody which is specific for an epitope of HER4, but not significantly cross-reactive with other EGFR-family members. The labeled antibody is then injected into a patient systemically, and total body imaging for the distribution and density of HER4 molecules is
performed using gamma cameras, followed by localized imaging using computerized tomography or magnetic resonance imaging to confirm and/or evaluate the condition, if necessary. Preferred diagnostic
radionuclides include but are not limited to
technetium-99m, indium-111, iodine-123, and iodine-131.
Recombinant antibody-metallothionein chimeras (Ab-MTs) may be generated as recently described (Das et al., 1992, Proc. Natl. Acad. Sci. U.S.A. 89:9749-53). Such Ab-MTs can be loaded with technitium-99m by virtue of the metallothionein chelating function, and may offer advantages over chemically conjugated chelators. In particular, the highly conserved metallothionein structure may result in minimal immunogenicity.
5.7. Assays for the Identification of HER4
Ligands
Cell lines overexpressing a single member of the
EGFR-family can be generated by transfection of a variety of parental cell types with an appropriate expression vector as described in Section 7., infra.
Candidate ligands, or partially purified preparations, may be applied to such cells and assayed for receptor binding and/or activation. For example, a CHO-KI cell line transfected with a HER4 expression plasmid and lacking detectable EGFR, HER2, or HER3 may be used to screen for HER4-specific ligands. A particular embodiment of such a cell line is described in Section 7., infra, and has been deposited with the ATCC
(CHO/HER4 21-2). Ligands may be identified by
detection of HER4 autophosphorylation, stimulation of DNA synthesis, induction of morphologic
differentiation, relief from serum or growth factor requirements in the culture media, and direct binding of labeled purified growth factor. The invention also relates to a bioassay for testing potential analogs of HER4 ligands based on a capacity to affect a
biological activity mediated by the HER4 receptor. 5.8. Use Of The Invention in Cancer Therapy
5.8.1. Targeted Cancer Therapy
The invention is also directed to methods for the treatment of human cancers involving abnormal
expression and/or function of HER4 and cancers in which HER2 overexpression is combined with the
proximate expression of HER4, including but not limited to human breast carcinomas and other neoplasms overexpressing HER4 or overexpressing HER2 in
combination with expression of HER4. The cancer therapy methods of the invention are generally based on treatments with unconjugated, toxin- or
radionuclide- conjugated HER4 antibodies, ligands, and derivatives or fragments thereof. In one specific embodiment, such HER4 antibodies or ligands may be used for systemic and targeted therapy of certain cancers overexpressing HER2 and/or HER4, such as metastatic breast cancer, with minimal toxicity to normal tissues and organs. Importantly, in this connection, an anti-HER2 monoclonal antibody has been shown to inhibit the growth of human tumor cells overexpressing HER2 (Bacus et al., 1992, Cancer Res. 52:2580-89). In addition to conjugated antibody therapy, modulation of heregulin signaling through HER4 provides a means to affect the growth and
differentiation of cells overexpressing HER2, such as certain breast cancer cells, using HER4-neutralizing monoclonal antibodies, NDF/HER4 antagonists,
monoclonal antibodies or ligands which act as super-agonists for HER4 activation, or agents which block the interaction between HER2 and HER4, either by disrupting heterodimer formation or by blocking HER-mediated phosphorylation of the HER2 substrate. For targeted immunotoxin-mediated cancer therapy, various drugs or toxins may be conjugated to anti-HER4 antibodies and fragments thereof, such as plant and bacterial toxins. For example, ricin, a cytotoxin from the Ricinis communis plant may be conjugated to an anti-HER4 antibody using methods known in the art (e.g., Blakey et al., 1988, Prog. Allergy 45:50-90;Marsh and Neville, 1988, J. Immunol. 140:3674-78).
Once ricin is inside the cell cytoplasm, its A chain inhibits protein synthesis by inactivating the 60S ribosomal subunit (May et al., 1989, EMBO J. 8:301-08). Immunotoxins of ricin are therefore extremely cytotoxic. However, ricin immunotoxins are not ideally specific because the B chain can bind to virtually all cell surface receptors, and immunotoxins made with ricin A chain alone have increased
specificity. Recombinant or deglycosylated forms of the ricin A chain may result in improved survival (i.e., slower clearance from circulation) of the immunotoxins. Methods for conjugating ricin A chain to antibodies are known (e.g., Vitella and Thorpe, in: Seminars in Cell Biology, pp 47-58; Saunders,
Philadelphia 1991). Additional toxins which may be used in the formulation of immunotoxins include but are not limited to daunorubicin, methotrexate,
ribosome inhibitors (e.g., trichosanthin, trichokirin, gelonin, saporin, mormordin, and pokeweed antiviral protein) and various bacterial toxins (e.g.,
Pseudomonas exotoxin). Immunotoxins for targeted cancer therapy may be administered by any route which will result in antibody interaction with the target cancer cells, including systemic administration and injection directly to the site of tumor. Another therapeutic strategy may be the administration of immunotoxins by sustained-release systems, such as semipermeable matrices of solid hydrophobic polymers containing the therapeutic agent. Various of
sustained-release materials have been established and are well known by those skilled in the art.
Sustained-release capsules may, depending on their chemical nature, release immunotoxic molecules for a few weeks up to over 100 days. Depending on the chemical nature and the biological stability of the therapeutic reagent, additional strategies for protein stabilization may be employed.
For targeted radiotherapy using anti-HER4
antibodies, preferred radionuclides for labeling include alpha, beta, and Auger electron emitters.
Examples of alpha emitters include astatine 211 and bismuth 212; beta emitters include iodine 131, rhenium 188, copper 67 and yttrium 90; and iodine 125 is an example of an Auger electron emitter.
Similarly as suggested for the use of toxin-conjugated antibodies as therapeutic agents for targeted cancer therapy, purified ligand molecules may be chemically conjugated to cytotoxic substances. In addition, recombinant chimeric polypeptides comprising a HER4 binding (=ligand) portion fused to all or part of a cytotoxin may be engineered by constructing vectors comprising DNA encoding the ligand in reading frame with DNA encoding the toxin or part thereof. Such recombinant ligand-toxins may be used to
specifically target HER4 expressing cancer cells. A particular embodiment of such a ligand-toxin is disclosed herein and described in more detail in
Sections 5.8.2., infra, and Section 15, infra. 5.8.2. The Generation Of A Heregulin-toxin
Specifically Targeting HER4 Expressing Tumor Cells
Another aspect of the invention relates to the development of a strategy to selectively target and kill HER4 expressing tumor cells. More particularly, HER4 expressing tumor cells may be specifically targeted and killed by contacting such tumor cells with a fusion protein comprising a cytotoxic
polypeptide covalently linked to a polypeptide which is capable of activating HER4 expressed on such cells.
In a specific embodiment described by way of example in Section 15, infra, a fusion protein
comprising a chimeric heregulin β2 ligand and the cytotoxic substance PE40 is generated by expression of the corresponding chimeric coding sequence. PE40 is a derivative of the Pseudomonas exotoxin PE, a potent cell killing agent made by Pseudomonas aeruginosa (Fitzgerald et al., 1980, Cell 21:867-873). The wildtype protein PE contains three domains whose functions are cell recognition, membrane
translocation, and ADP ribosylation of elongation factor 2. It kills cells by binding to a cell surface receptor, entering the cell via an endocytotic vesicle and catalyzing ADP-ribosylation of elongation factor 2. The derivative PE40 lacks the cell binding
function of the wildtype protein, but still exhibits strong cytotoxic activity. Generation of PE40 fusion proteins with specific cell targeting molecules have been described (Kondo et al., 1988, J. Biol. Chem.
263:9470-9475 (PE40 fusions with different monoclonal antibodies); Friedman et al., 1993, Cancer Res.
53:334-339 (BR96/PE40 fusions); U.S. Pat. No. 5206353 (CD4/PE40 fusions); U.S. Pat. No. 5082927 (IL-4/PE40 fusions) and U.S. Pat. No. 4892827 (TGF-α/PE40 and IL-2/PE40 fusions)). The chimeric heregulin-toxin protein HAR-TX β2 described in Section 15, infra , contains the
amphiregulin (AR) leader sequence thereby facilitating the purification of the recombinant protein. As confirmed by applicants' data, the AR leader has no influence on the binding specificity of the
recombinant heregulin-toxin. Related embodiments include, for example, PE40 linked to other members of the heregulin family, like heregulin-01 and heregulin-α, and other molecules capable of activating HER4.
In a cytotoxicity assay with cultured tumor cell lines, the applicants demonstrate specificity of the cytotoxic effect of the chimeric heregulin-PE40 protein to HER4 expressing cancer cells; they include but are not limited to prostate carcinoma, bladder carcinoma, and a considerable number of different breast cancer types, including breast carcinoma cells with amplified HER2 expression. The bifunctional retention of both the specificity of the cell binding portion of the molecule and the cytotoxic potential of PE40 provides a very potent and targeted reagent.
An effective therapeutic amount of heregulin-toxin will depend upon the therapeutic objectives, the route of administration, and the condition of the patient. Accordingly, dosages should be titrated and the route of administration modified as required to obtain the optimal therapeutic effect. A typical daily dosage may be in the range of 0.1 mg/kg - 1 mg/kg, preferably between 0.1 and 0.5 mg/kg, with intravenous administration. For regression of solid tumors, it may take 3-5 doses, with schedules such as 3 doses, each four days apart. Also the use of sustained-release preparations (see Section 5.8.1., supra) may be considered for administration of the reagent. The therapeutic efficacy of heregulin-toxin may be between 2 and 10, which means that a tumor regression effect would be expected between 2- and 10- fold below the toxic dose (see Section 15, infra). Desirably, the heregulin-toxin will be administered at a dose and frequency that achieves the desired
therapeutic effect, which can be monitored using conventional assays.
Cancer therapy with heregulin-toxins of the invention may be combined with chemotherapy, surgery, and radiation therapy, depending on the type of tumor. One advantage of using a low molecular weight toxin drug is that they are capable of targeting metastatic lesions that cannot be located and removed by surgery. Heregulin-toxins may also be particularly useful on patients that are MDR (Multi Drug Resistance) positive since their mechanism of action is not inhibited by the p-glycoprotein pump of MDR positive cells as are many standard cancer therapeutic drugs. 5.9. Other Therapeutic Use Of HER4 Ligands
Additional therapeutic uses of HER4 ligands may include other diseases caused by deficient HER4 receptor tyrosine kinase activation rather than by hyperactivation. In this regard, type II diabetes mellitus is the consequence of deficient insulin-mediated signal transduction, caused by mutations in the insulin-receptor, including mutations in the ligand-binding domain (Taira et al., 1889, Science
245:63-66; Odawara et al., 1989, Science 245:66-68; Obermeier-Kusser et al., 1989, J. Biol. Chem.
264:9497-9504). Such diseases might be treated by administration of modified ligands or ligand-analogues which re-establish a functional ligand-receptor interaction. 5.10. HER4 Analogues
The production and use of derivatives, analogues and peptides related to HER4 are also envisioned and are within the scope of the invention. Such
derivatives, analogues and peptides may be used to compete with native HER4 for binding of HER4 specific ligand, thereby inhibiting HER4 signal transduction and function. The inhibition of HER4 function may be utilized in several applications, including but not limited to the treatment of cancers in which HER4 biological activity is involved.
In a specific embodiment, a series of deletion mutants in the HER4 nucleotide coding sequence depicted in FIG. 1A and 1B may be constructed and analyzed to determine the minimum amino acid sequence requirements for binding of a HER4 ligand. Deletion mutants of the HER4 coding sequence may be constructed using methods known in the art which include but are not limited to use of nucleases and/or restriction enzymes; site-directed mutagenesis techniques, PCR, etc. The mutated polypeptides expressed may be assayed for their ability to bind HER4 ligand.
The DNA sequence encoding the desired HER4 analogue may then be cloned into an appropriate expression vector for overexpression in either
bacteria or eukaryotic cells. Peptides may be
purified from cell extracts in a number of ways including but not limited to ion-exchange
chromatography or affinity chromatography using HER4 ligand or antibody. Alternatively, polypeptides may be synthesized by solid phase techniques followed by cleavage from resin and purification by high
performance liquid chromatography. 6. Example: Isolation of cDNAs Encoding HER4
EGFR and the related proteins, HER2, HER3, and Xmrk exhibit extensive amino acid homology in their tyrosine kinase domains (Kaplan et al., 1991, Nature 350:158-160; Wen et al., 1992, Cell 69:559-72; Holmes et al., 1992, Science 256:1205-10; Hirai et al.,
Science 1987 238:1717-20). In addition, there is strict conservation of the exon-intron boundaries within the genomic regions that encode these catalytic domains (Wen et al., supra; Lindberg and Hunter, 1990, Mol. Cell. Biol. 10:6316-24; and unpublished
observations). Degenerate oligonucleotide primers were designed based on conserved amino acids encoded by a single exon or adjacent exons from the kinase domains of these four proteins. These primers were used in a polymerase chain reaction (PCR) to isolate genomic fragments corresponding to murine EGFR, erbB2 and erbB3. In addition, a highly related DNA fragment (designated MER4) was identified as distinct from these other genes. A similar strategy was used to obtain a cDNA clone corresponding to the human
homologue of MER4 from the breast cancer cell line, MDA-MB-453. Using this fragment as a probe, several breast cancer cell lines and human heart were found to be an abundant source of the EGFR-related transcript. cDNA libraries were constructed using RNA from human heart and MDA-MB-453 cells, and overlapping clones were isolated spanning the complete open reading frame of HER4/erbB4.
6.1. Materials and Methods
6.1.1. Molecular Cloning
Several pools of degenerate oligonucleotides were synthesized based on conserved sequences from EGFR-family members (Table I) (5'-ACNGTNTGGGARYTNAYHAC-3' [SEQ ID No: 14]; 5'-CAYGTNAARATHACNGAYTTYGG-3' [SEQ ID No: 16]; 5'-GACGAATTCCNATHAARTGGATGGC-3' [SEQ ID
No: 17]; 5'-AANGTCATNARYTCCCA-3' [SEQ ID No: 18]; 5'-TCCAGNGCGATCCAYTTDATNGG-3' [SEQ ID No: 19] ; 5'-GGRTCDATCATCCARCCT-3' [SEQ ID No:20]; 5'- CTGCTGTCAGCATCGATCAT-3' [SEQ ID No:21]; TVWELMT [SEQ ID No:22]; HVKITDFG [SEQ ID No: 23]; PIKWMA [SEQ ID No: 13]; VYMIILK [SEQ ID No:24]; WELMTF [SEQ ID No: 25]; PIKWMALE [SEQ ID No:26]; CWMIDP [SEQ ID No:27]. Total genomic DNA was isolated from subconfluent murine
K1735 melanoma cells and used as a template with these oligonucleotide primers in a 40 cycle PCR
amplification. PCR products were resolved on agarose gels and hybridized to 32P-labeled probes from the kinase domain of human EGFR and HER2. Distinct DNA bands were isolated and subcloned for sequence
analysis. Using the degenerate oligonucleotides
H4VWELM and H4VYMIIL as primers in a PCR amplification (Plowman et al., 1990, Proc. Natl. Acad. Sci. U.S.A. 87:4905-09), one clone (MER4-85) was identified that contained a 144 nucleotide insert corresponding to murine erbB4. This 32P-labeled insert was used to isolate a 17-kilobase fragment from a murine T-cell genomic library (Stratagene, La Jolla, CA) that was found to contain two exons of the murine erbB4 gene. A specific oligonucleotide (4M3070) was synthesized based on the DNA sequence of an erbB4 exon, and used in a PCR protocol with a degenerate 5'-oligonucleotide (H4PIKWMA) on a template of single stranded MDA-MB-453 cDNA. This reaction generated a 260 nucleotide fragment (pMDAPIK) corresponding to human HER4. cDNA libraries were constructed in lambda ZAP II
(Stratagene) from oligo(dT)- and specific-primed MDA-MB453 and human heart RNA (Plowman et al., supra;
Plowman et al., 1990, Mol. Cell. Biol. 10:1969-81). HER4-specific clones were isolated by probing the libraries with the 32P-labeled insert from pMDAPIK. To complete the cloning of the 5'-portion of HER4, we used a PCR strategy to allow for rapid amplification of cDNA ends (Plowman et al., supra ; Frohman et al., 1988, Proc. Natl. Acad. Sci. U.S.A. 85:8998-9002).
All cDNA clones and several PCR generated clones were sequenced on both strands using T7 polymerase with oligonucleotide primers (Tabor and Richardson, 1987, Proc. Natl. Acad. Sci. U.S.A. 84:4767-71).
Figure imgf000061_0001
6.1.2. Northern Blot Analysis
3'- and 5'-HER4 specific [α32P]DTP-labeled
antisense RNA probes were synthesized from the
linearized plasmids pHt1B1.6 (containing an 800 bp HER4 fragment beginning at nucleotide 3098) and p5'H4E7 (containing a 1 kb fragment from the 5'-end of the HER4 sequence), respectively. For tissue
distribution analysis (Section 6.2.3., infra), the Northern blot (Clontech, Palo Alto, CA) contained 2 Mg poly(A) + mRNA per lane from 8 human tissue samples immobilized on a nylon membrane. The filter was prehybridized at 60° C for several hours in RNA hybridization mixture (50% formamide, 5x SSC, 0.5% SDS, 10x Denhardt's solution, 100 μg/ml denatured herring sperm DNA, 100 μg/ml tRNA, and 10 μg/ml polyadenosine) and hybridized in the same buffer at 60° C, overnight with 1-1.5 × 106 cpm/ml of 32P-labeled antisense RNA probe. The filters were washed in 0.1XSSC/0.1% SDS, 65° C, and exposed overnight on a Phospholmager (Molecular Dynamics, Sunnyvale, CA).
6.1.3. Semi-Quantitative PCR Detection of
HER4
RNA was isolated from a variety of human cell lines, fresh frozen tissues, and primary tumors.
Single stranded cDNA was synthesized from 10 μg of each RNA by priming with an oligonucleotide containing a T17 track on its 3'-end
(XSCT17:5'GACTCGAGTCGACATCGATTTTTTTTTTTTTTTTT-3')
[SEQ ID No:28].
1% or 5% of each single strand template preparation was then used in a 35 cycle PCR reaction with two HER4-specific oligonucleotides:
4H2674 : 5'-GAAGAAAGACGACTCGTTCATCGG-3'
[SEQ ID No:29],
and
4H2965: 5'-GACCATGACCATGTAAACGTCAATA-3'
[SEQ ID No:30].
Reaction products were electrophoresed on 2% agarose gels, stained with ethidium bromide and photographed on a UV light box. The relative intensity of the 291-bp HER4-specific bands were estimated for each sample as shown in Table II. 6.2. Results
6.2.1. Sequence Analysis of cDNA Clones
Encoding HER4
cDNA clones encoding parts of the HER4 coding and non-coding nucleotide sequences were isolated by PCR cloning according to the method outlined in Section 6.1.1., supra. The complete HER4 nucleotide sequence assembled from these cDNAs is shown in FIG. 1A and 1B and contains a single open reading frame encoding a polypeptide of 1308 amino acids. The HER4 coding region is flanked by a 33 nucleotide 5'-untranslated region and a 1517 nucleotide 3'-untranslated region ending with a poly(A) tail. A 25 amino acid
hydrophobic signal sequence follows a consensus initiating methionine at position number 1 in the amino acid sequence depicted in FIG. 1A and 1B. In relation to this signal sequence, the mature HER4 polypeptide would be predicted to begin at amino acid residue number 26 in the sequence depicted in FIG. 1A and 1B (Gln), followed by the next 1283 amino acids in the sequence. Thus the prototype mature HER4 of the invention is a polypeptide of 1284 amino acids, having a calculated Mr of 144,260 daltons and an amino acid sequence corresponding to residues 26 through 1309 in FIG. 1A and 1B.
Comparison of the HER4 nucleotide and deduced amino acid sequences (FIG. 1A and 1B) with the
available DNA and protein sequence databases indicated that the HER4 nucleotide sequence is unique, and revealed a 60/64 amino acid identity with HER2 and a 54/54 amino acid identity to a fragment of a rat EGFR homolog, tyro-2.
6.2.2. Sequence Analysis of Related cDNAs Several cDNAs encoding polypeptides related to the prototype HER4 polypeptide (FIG. 1A and 1B) were also isolated from the MDA-MB-453 cDNA library and comprised two forms.
The first alternative type of cDNA was identical to the consensus HER4 nucleotide sequence up to nucleotide 3168 (encoding Arg at amino acid position 1045 in the FIG. 1A and 1B) and then abruptly diverges into an apparently unrelated sequence (FIG. 2A and 2B, FIG. 4). Downstream from this residue the open reading frame continues for another 13 amino acids before reaching a stop codon followed by a 2 kb 3'-untranslated sequence and poly(A) tail. This cDNA would be predicted to result in a HER4 variant having the C-terminal autophosphorylation domain of the prototype HER4 deleted.
A second type of cDNA was isolated as 4
independent clones each with a 3'-sequence identical to the HER4 consensus, but then diverging on the 5'-side of nucleotide 2335 (encoding Glu at amino acid position 768 in the FIG. 1A and 1B), continuing upstream for only another 114-154 nucleotides (FIG. 3, FIG. 5). Nucleotide 2335 is the precise location of an intron-exon junction in the HER2 gene (Coussens et al., 1985, Science 230:1132-39; Semba et al., 1985, Proc. Natl. Acad. Sci. U.S.A. 82:6497-6501),
suggesting these cDNAs could be derived from mRNAs that have initiated from a cryptic promoter within the flanking intron. These 5'-truncated transcripts contain an open reading frame identical to that of the HER4 cDNA sequence of FIG. 1A and 1B, beginning with the codon for Met at amino acid position 772 in FIG. 1A and 1B. These cDNAs would be predicted to encode a cytoplasmic HER4 variant polypeptide that initiates just downstream from the ATP-binding domain of the HER4 kinase. 6.2.3. Human Tissue Distribution of HER4
Expression
Northern blots of poly (A)+ mRNA from human tissue samples were hybridized with antisense RNA probes to the 3'-end of HER4, encoding the autophosphorylation domain, as described in Section 6.1.2., supra. A HER4 mRNA transcript of approximately 6kb was identified, and was found to be most abundant in the heart and skeletal muscle (FIG. 8, Panel 1). An mRNA of greater than approximately 15 kb was detected in the brain, with lower levels also detected in heart, skeletal muscle, kidney, and pancreas tissue samples.
The same blot was stripped and rehybridized with a probe from the 5'-end of HER4, within the
extracellular domain coding region, using identical procedures. This hybridization confirmed the
distribution of the 15 kb HER4 mRNA species, and detected a 6.5 kb mRNA species in heart, skeletal muscle, kidney, and pancreas tissue samples (FIG. 8, Panel 2) with weaker signals in lung, liver, and placenta. In addition, minor transcripts of 1.7-2.6 kb were also detected in pancreas, lung, brain, and skeletal muscle tissue samples. The significance of the different sized RNA transcripts is not known.
Various human tissues were also examined for the presence of HER4 mRNA using the semi-quantitative PCR assay described in Section 6.1.3., supra. The results are shown in Table II, together with results of the assay on primary tumor samples and neoplastic cell lines (Section 6.2.4., immediately below). These results correlate well with the Northern and solution hybridization analysis results on the selected RNA samples. The highest levels of HER4 transcript expression were found in heart, kidney, and brain tissue samples. In addition, high levels of HER4 mRNA expression were found in parathyroid, cerebellum, pituitary, spleen, testis, and breast tissue samples. Lower expression levels were found in thymus, lung, salivary gland, and pancreas tissue samples. Finally, low or negative expression was observed in liver, prostate, ovary, adrenal, colon, duodenum, epidermis, and bone marrow samples.
6.2.4. HER4 mRNA Expression in Primary
Tumors and Various Cell Lines of Neoplastic Origin
HER4 mRNA expression profiles in several primary tumors and a number of cell lines of diverse
neoplastic origin were determined with the semi-quantitative PCR assay (Section 6.1.3, supra) using primers from sequences in the HER4 kinase domain. The results are included in Table II. This analysis detected the highest expression of HER4 RNA in 4 human mammary adenocarcinoma cell lines (T-47D, MDA-MB-453, BT-474, and H3396), and in neuroblastoma (SK-N-MC), and pancreatic carcinoma (Hs766T) cell lines.
Intermediate expression was detected in 3 additional mammary carcinoma cell lines (MCF-7, MDA-MB-330, MDA- MB-361). Low or undetectable expression was found in other cell lines derived from carcinomas of the breast (MDB-MB-231, MDA-MB-157, MDA-MB-468, SK-BR-3), kidney (Caki-1, Caki-2, G-401), liver (SK-HEP-1, HepG2), pancreas (PANC-1, AsPC-1, Capan-1), colon (HT-29), cervix (CaSki), vulva (A-41), ovary (PA-1, Caov-3), melanoma (SK-MEL-28), or in a variety of leukemic cell lines. Finally, high level expression was observed in Wilms (kidney) and breast carcinoma primary tumor samples.
Figure imgf000067_0001
phosphorylation, and 35S-labeled immunoprecipitation analysis. Transfected cell colonies expressing HER4 were selected in glutamine-free Glasgow modified
Eagle's medium (GMEM-S, Gibco) supplemented with 10% dialyzed fetal bovine serum an increasing
concentrations of methionine sulfoximine (Bebbington, 1991, in Methods: A Companion to Methods in Enzymology 2:136-145 Academic Press). 7.1.2. Expression Vector Construction and
Transfections
The complete 4 kilobase coding sequence of prototype HER4 was reconstructed and inserted into a glutamine synthetase expression vector, pEE14, under the control of the cytomegalovirus immediate-early promoter (Bebbington, supra) to generate the HER4 expression vector pEEHER4. This construct (pEEHER4) was linearized with Mlul and transfected into CHO-KI cells by calcium phosphate precipitation using
standard techniques. Cells were placed on selective media consisting of GMEM-S supplemented with 10% dialyzed fetal bovine serum and methionine sulfoximine at an initial concentration of 25 μM (L-MSX) as described in Bebbington, supra, for the selection of initial resistant colonies. After 2 weeks, isolated colonies were transferred to 48-well plates and expanded for HER4 expression immunoassays as described immediately below. Subsequent rounds of selection using higher concentrations of MSX were used to isolate cell colonies tolerating the highest
concentrations of MSX. A number of CHO/HER4 clones selected at various concentrations of MSX were
isolated in this manner. 7.1.3. HER4 Expression Immunoassay
Confluent cell monolayers were scraped into hypotonic lysis buffer (10 mM Tris pH7.4, 1 mM KCl, 2 mM MgCl2) at 4° C, dounce homogenized with 30 strokes, and the cell debris was removed by centrifugation at 3500 × g, 5 min. Membrane fractions were collected by centrifugation at 100,000 × g, 20 min, and the pellet was resuspended in hot Laemmli sample buffer with 2-mercaptoethanol. Expression of the HER4 polypeptide was detected by immunoblot analysis on solubilized cells or membrane preparations using HER2
immunoreagents generated to either a 19 amino acid region of the HER2 kinase domain, which coincidentally is identical to the HER4 sequence (residues 927-945), or to the C-terminal 14 residues of HER2, which share a stretch of 7 consecutive residues with a region near the C-terminus of HER4. On further amplification, HER4 was detected from solubilized cell extracts by immunoblot analysis with PY20 anti-phosphotyrosine antibody (ICN Biochemicals), presumably reflecting autoactivation and autophosphorylation of HER4 due to receptor aggregation resulting from abberantly high receptor density. More specifically, expression'was detected by immunobloting with a primary murine monoclonal antibody to HER2 (Neu-Ab3, Oncogene
Science) diluted 1:50 in blotto (2.5% dry milk, 0.2% NP40 in PBS) using 125I-goat anti-mouse Ig F(ab')2 (Amersham, UK) diluted 1:500 in blotto as a second antibody. Alternatively, a sheep polyclonal
antipeptide antibody against HER2 residues 929-947 (Cambridge Research Biochemicals, Valleystream, NY) was used as a primary immunoreagent diluted 1:100 in blotto with 135I-Protein G (Amersham) diluted 1:200 in blotto as a second antibody. Filters were washed with blotto and exposed overnight on a phospholmager
(Molecular Dynamics).
7.2. Results
CHO-KI cells transfected with a vector encoding the complete human prototype HER4 polypeptide were selected for amplified expression in media containing increasing concentrations of methionine sulfoximine as outlined in Section 7.1., et seq., supra. Expression of HER4 was evaluated using the immunoassay described in Section 7.1.3., supra. Several transfected CHO-KI cell clones stably expressing HER4 were isolated. One particular clone, CHO/HER4 21-2, was selected in media supplemented with 250 μM MSX, and expresses high levels of HER4. CHO/HER4 21-2 cells have been
deposited with the ATCC.
Recombinant HER4 expressed in CHO/HER4 cells migrated with an apparent Mr of 180,000, slightly less than HER2, whereas the parental CHO cells showed no cross-reactive bands (FIG. 9). In addition, a 130 kDa band was also detected in the CHO/HER4 cells, and presumably represents a degradation product of the 180 kDa mature protein. CHO/HER4 cells were used to identify ligand specific binding and
autophosphorylation of the HER4 tyrosine kinase (see Section 9., et seq., infra).
8. Example: Assay for Detecting EGFR-Family Ligands 8.1. Cell Lines
A panel of four recombinant cell lines, each expressing a single member of the human EGFR-family, were generated for use in the tyrosine kinase
stimulatory assay described in Section 8.2., below. The cell line CHO/HER4 3 was generated as described in Section 7.1.2, supra. CHO/HER2 cells (clone 1-2500) were selected to express high levels of recombinant human p185erbB2 by dihydrofolate reductase-induced gene amplification in dhfr-deficient CHO cells. The HER2 expression
plasmid, cDNeu, was generated by insertion of a full length HER2 coding sequence into a modified pCDM8 (Invitrogen, San Diego, CA) expression vector (Seed and Aruffo, 1987, Proc. Natl. Adad. Sci. U.S.A.
84:3365-69) in which an expression cassette from pSV2DHFR (containing the murine dhfr cDNA driven by the SV40 early promoter) has been inserted at the pCDM8 vector's unique BamHI site. This construct drives HER2 expression from the CMV immediate-early promoter.
NRHER5 cells (Velu et al., 1987, Science 1408-10) were obtained from Dr. Hsing-Jien Kung (Case Western Reserve University, Cleveland, OH). This murine cell line was clonally isolated from NR6 cells infected with a retrovirus stock carrying the human EGFR, and was found to have approximately 106 human EGFRs per cell.
The cell line 293/HER3 was selected for high level expression of p160erbB3. The parental cell line, 293 human embryonic kidney cells, constitutively expresses adenovirus Ela and have low levels of EGFR expression. This line was established by
cotransfection of linearized cHER3 (Plowman et al., 1990, Proc. Natl. Acad. Sci. U.S.A. 87:4905-09) and pMClneoPolyA (neomycin selectable marker with an
Herpes simplex thymidine kinase promoter, Stratagene), with selection in DMEM/F12 media containing 500μg/ml G418. 8.2. Tyrosine Kinase Stimulation Assay
Cells were plated in 6-well tissue culture plates (Falcon), and allowed to attach at 37° C for 18-24 hr. Prior to the assay, the cells were changed to serum-free media for at least 1 hour. Cell monolayers were then incubated with the amounts of ligand preparations indicated in Section 7.3., below for 5 min at 37° C. Cells were then washed with PBS and solubilized on ice with 0.5 ml PBSTDS containing phosphatase inhibitors (10 mM NaHPO4, 7.25, 150 mM NaCl, 1% Triton X-100, 0.5% deoxycholate, 0.1% SDS, 0.2% sodium azide, 1 mM NaF, 1 mM EGTA, 4 mM sodium orthovanadate, 1%
aprotinin, 5 mg/ml leupeptin). Cell debris was removed by centrifugation (12000 × g, 15 min, 4° C) and the cleared supernatant reacted with 1 mg murine monoclonal antibody to phosphotyrosine (PY20, ICN Biochemicals, Cleveland, Ohio) for CHO/HER4 and
293/HER3 cells, or 1 mg murine monoclonal antibody to HER2 (Neu-Ab3, Oncogene Sciences) for CHO/HER2 cells, or 1 mg murine monoclonal antibody EGFR-1 to human EGFR (Amersham) for NRHER5 cells. Following a 1 hr incubation at 4° C, 30 μl of a 1:1 slurry (in PBSTDS) of anti-mouse IgG-agarose (for PY20 and Neu-Ab3 antibodies) or protein A-sepharose (for EGFR-Rl antibody) was added and the incubation was allowed to continue an additional 30 minutes. The beads were washed 3 times in PBSTDS and the complexes resolved by electrophoresis on reducing 7% SDS-polyacrylamide gels. The gels were transferred to nitrocellulose and blocked in TNET (10 mM Tris pH7.4, 75 mM NaCl, 0.1% Tween-20, 1 mM EDTA). PY20 antiphosphotyrosine antibody diluted 1:1000 in TNET was used as the primary antibody followed by 125I-goat anti-mouse Ig F(ab')2 diluted 1:500 in TNET. Blots were washed with TNET and exposed on a phosphorimager (Molecular Dynamics).
8.3. Results
Several EGF-family member polypeptide and ligand preparations were tested for their ability to
stimulate tyrosine phosphorylation of each of four EGFR-family receptors expressed in recombinant CHO cells using the tyrosine phosphorylation stimulation assay described in Section 8.2., above. The
particular preparations tested for each of the four recombinant cell lines and the results obtained in the assay are tabulated below, and autoradiographs of some of these results are shown in FIG. 10.
Figure imgf000073_0001
* The identification of the HER4 tryrosine kinase
stimulatory activity within the conditioned media of HepG2 cells and the isolation of these
preparations is described in Section 9, infra.
The results indicate that EGF, AR, TGF-α, and HB-EGF, four related ligands which mediate their growth regulatory signals in part through interaction with EGFR, were able to stimulate tyrosine phosphorylation of EGFR expressed in recombinant NIH3T3 cells (for EGF, see FIG. 10, Panel 3, lane 2), but not HER4, HER2, or HER3 expressed in recombinant CHO or 293 cells (FIG. 10, Panel 1, 2, 4, lanes 2 and 3).
Additionally, as discussed in more detail below, the assay identified a HepG2-derived preparation (fraction 17) as a HER4 ligand capable of specifically
stimulating tyrosine phoshorylation of HER4 expressed in CHO/HER4 cells alone.
9. Example: Isolation of a HER4 Ligand
9.1. Materials and Methods
9.1.1. Cell Differentiation Assay
For the identification of ligands specific for
HER2, HER3 or HER4, the receptor expression profile of MDA-MB-453 cells offers an excellent indicator for morphologic differentiation inducing activity. This cell line is known to express HER2 and HER3, but contains no detectable EGFR. The results of the semi-quantitative PCR assays (Table III) indicated high level expression of HER4 in MDA-MB-453 cells. In addition, cDNA encoding the prototype HER4 polypeptide of the invention was first isolated from this cell line (Section 6., supra).
MDA-MB-453 cells (7500/well) were grown in 50 ml DMEM supplemented with 5% FBS and 1x essential amino acids. Cells were allowed to adhere to 96-well plates for 24 hr. Samples were diluted in the above medium, added to the cell monolayer in 50 ml final volume, and the incubation continued for an additional 3 days. Cells were then examined by inverted light microscopy for morphologic changes. 9.1.2. Source Cells
Serum free media from a panel of cultures of human cancer cells were screened for growth regulatory activity on MDA-MB-453 cells. A human hepatocarcinoma cell line, HepG2, was identified as a source of a factor which induced dramatic morphologic
differentiation of the MDA-MB-453 cells.
9.1.3. Purification of HER4 Ligand
The cell differentiation assay described in
Section 10.1.1., supra , was used throughout the purification procedure to monitor the column fractions that induce morphological changes in MDA-MB-453 cells. For large-scale production of conditioned medium, HepG2 cells were cultured in DMEM containing 10% fetal bovine serum using Nunc cell factories. At about 70% confluence, cells were washed then incubated with serum-free DMEM. Conditioned medium (HepG2-CM) was collected 3 days later, and fresh serum-free medium added to the cells. Two additional harvests of HepG2-CM were collected per cell factory. The medium was centrifuged and stored at -20° C in the presence of 500 mM PMSF.
Ten litres of HepG2-CM were concentrated 16-fold using an Amicon ultrafiltration unit (10,000 molecular weight cutoff membrane), and subjected to sequential precipitation with 20% and 60% ammonium sulfate.
After centrifugation at 15,000 × g, the supernatant was extensively dialyzed against PBS and passed through a DEAE-sepharose (Pharmacia) column pre-equilibrated with PBS. The flow-through fraction was then applied onto a 4 ml heparin-acrylic (Bio-Rad) column equilibrated with PBS. Differentiation
inducing activity eluted from the heparin column between 0.4 and 0.8 M NaCl. Active heparin fractions were pooled, brought to 2.0 M ammonium sulfate, centrifuged at 12,000 × g for 5 min, and the resulting supernatant was loaded onto a phenyl-5PW column (8 × 75 mm. Waters). Bound proteins were eluted with a decreasing gradient from 2.0 M ammonium sulfate in 0.1 M Na2HPO4, pH 7.4 to 0.1 M Na2HPO4. Dialyzed fractions were assayed for tyrosine phosphorylation of MDA-MB-453 cells, essentially as described (Wen et al., 1992, Cell 69:559-72), except PY20 was used as the primary antibody and horseradish peroxidase-conjugated goat F(ab')2 anti-mouse Ig (Cappell) and chemiluminescence were used for detection. Phosphorylation signals were analyzed using the Molecular Dynamics personal
densitometer.
9.2. Results
Semi-purified HepG2-derived factor demonstrated a capacity to induce differentiation in MDA-MB-453 cells (FIG. 11, Panel 1-3). With reference to the
micrographs shown in FIG. 11, Panel 1-3, untreated MDA-MB-453 cells are moderately adherent and show a rounded morphology (FIG. 11, Panel 1). In contrast, the addition of semi-purified HepG2-derived factor induces these cells to display a noticeably flattened morphology with larger nuclei and increased cytoplasm (FIG. 11, Panel 2 and 3). This HepG2-derived factor preparation also binds to heparin, a property which was utilized for purifying the activity.
On further purification, the HepG2-derived factor was found to elute from a phenyl hydrophobic
interaction column at 1.0M ammonium sulfate
(fractions 16 to 18). FIG. 11, Panel 4, shows the phenyl column elution profile. Tyrosine
phosphorylation assays of the phenyl column fractions revealed that the same fractions found to induce differentiation of the human breast carcinoma cells are also able to stimulate tyrosine phosphorylation of a 185 kDa protein in MDA-MB-453 cells (FIG. 11, Panel 5). In particular, fraction 16 induced a 4.5-fold increase in the phosphorylation signal compared to the baseline signal observed in unstimulated cells, as determined by densitometry analysis (FIG. 11, Panel 6).
The phenyl fractions were also tested against the panel of cell lines which each overexpress a single member of the EGFR-family (Section 9.1., supra).
Fraction 17 induced a significant and specific
activation of the HER4 kinase ( FIG. 10, Panel 1, lane 4) without directly affecting the phosphorylation of HER2, EGFR, or HER3 (FIG. 10, Panel 1-4, lane 4).
Adjacent fraction 14 was used as a control and had no effect on the phosphorylation of any of the EGFR- family receptors (FIG. 10, Panel 1-4, lane 5).
Further purification and analysis of the factor present in fraction 17 indicates that it is a
glycoprotein of 40 to 45 kDa, approximately the same size as NDF and HRG. The HepG2-derived factor also has functional properties similar to NDF and HRG, inasmuch as it stimulates tyrosine phosphorylation of HER2/p185 in MDA-MB-453 cells, but not EGFR in NR5 cells, and induces morphologic differentiation of HER2 overexpressing human breast cancer cells.
Recently, several groups have reported the identification of specific ligands for HER2 (see
Section 2., supra., including NDF and HRG-α. In contrast to these molecules, the HepG2-derived factor described herein failed to stimulate phosphorylation of HER2 in CHO/HER2 cells, but did stimulate
phosphorylation of HER4 in CHO/HER4 cells. These findings are intriguing in view of the ability of the HepG2-derived factor to stimulate phosphorylation of MDA-MD-453 cells, a cell line known to overexpress HER2 and HER3 and the source from which HER4 was cloned. Since EGFR and HER2 have been shown to act synergistically, it is conceivable that HER4 may also interact with other EGFR-family members. In this connection, these results suggest that NDF may bind to HER4 in MDA-MB-453 cells resulting in the activation of HER2. The results described in Section 10., immediately below, provide evidence that NDF interacts directly with HER4, resulting in activation of HER2.
10. Example: Recombinant NDF-lnduoed, HER4 Mediated Phosphorylation of HER2
Recombinant NDF was expressed in COS cells and tested for its activity on HER4 in an assay system essentially devoid of other known members of the EGFR- family, notably EGFR and HER2.
A full length rat NDF cDNA was isolated from normal rat kidney RNA and inserted into a cDM8-based expression vector to generate cNDF1.6. This construct was transiently expressed in COS cells, and
conditioned cell supernatants were tested for NDF activity using the tyrosine kinase stimulation assay described in Section 8.2., supra. Supernatants from cNDFl.6 transfected cells upregulated tyrosine
phosphorylation in MDA-MB-453 cells relative to mock transfected COS media FIG. 12, Panel 1.
Phosphorylation peaked 10-15 minutes after addition onNDF.
The crude NDF supernatants were also tested for the ability to phosphorylate EGFR (NR5 cells), HER2
(CHO/HER2 1-2500 cells), and HER4 (CHO/HER4 21-2 cells). The NDF preparation had no effect on
phosphorylation of EGFR, or HER2 containing cells, but induced a 2.4 to 4 fold increase in tyrosine phosphorylation of HER4 after 15 minutes incubation (see FIG. 12, Panel 2). These findings provide preliminary evidence that NDF/HRG-α mediate their effects not through direct binding to HER2, but instead by means of a direct interaction with HER4. In cell lines expressing both HER2 and HER4, such as MDA-MB-453 cells and other breast carcinoma cells, binding of NDF to HER4 may stimulate HER2 either by heterodimer formation of these two related
transmembrane receptors, or by intracellular
crosstalk. Formal proof of the direct interaction between NDF and HER4 will require crosslinking of 125I-NDF to CHO/HER4 cells and a detailed analysis of its binding characteristics.
11. Example: Chromosomal Mapping of the HER4 Gene
A HER4 cDNA probe corresponding to the 5' portion of the gene (nucleotide positions 34-1303) was used for in situ hybridization mapping of the HER4 gene. in situ hybridization to metaphase chromosomes from lymphocytes of two normal male donors was conducted using the HER4 probe labeled with 3H to a specific activity of 2.6 × 107 cpm/μg as described (Marth et al., 1986, Proc. Natl. Acad. Sci. U.S.A. 83:7400-04). The final probe concentration was 0.05 μg/μl of hybridization mixture. Slides were exposed for one month. Chromosomes were identified by Q banding.
11.1. Results
A total of 58 metaphase cells with
autoradiographic grains were examined. Of the 124 hybridization sites scored, 38 (31%) were located on the distal portion of the long arm of chromosome 2 (FIG. 13). The greatest number of grains (21 grains) was located at band q33, with significant numbers of grains on bands q34 (10 grains) and q35 (7 grains). No significant hybridization on other human
chromosomes was detected.
12. Example: Activation of the HER4 Receptor is
Involved in signal Transduction by Heregulin
12.1. Recombinant Heregulin Induction of
Tyrosine Phosphorylation of HER4
12.1.1 Materials and Methods
CHO cells expressing recombinant HER4 or HER2 were generated as previously described in Section 8.
Cells (1 × 105 of CHO/HER2 and CHO/HER4, and 5 × 105 of
MDA-MB453) were seeded in 24 well plates and cultured
24 h. Cells were starved in serum free media for 1-6 h prior to addition of conditioned media from
transfected COS cells, or 25 μg/ml HER2-stimulatory
Mab (N28 and N29) (Stancovski et al., 1991, Proc.
Natl. Acad. Sci. U.S.A. 88:8691-8695). Following 10 min treatment at room temperature, cells were
solubilized (Section 13, infra) and immunoprecipitated with 2 μg anti-phosphotyrosine Mab (PY20, ICN
Biochemicals) or anti-HER2 Mab (c-neu Ab-2, Oncogene
Sciences) and anti-mouse IgG-agarose (Sigma). Western blots were performed using PY20 as described supra, and bands were detected on a Molecular Dynamics phosphorimager.
Recombinant rat heregulin was produced as
follows. A 1.6 kb fragment encoding the entire open reading frame of rat heregulin (and 324 bp of 5'-untranslated sequence) was obtained by PCR using normal rat kidney RNA as a template. This fragment was inserted into a CDM8-based expression vector
(Invitrogen) to generate cNDF1.6. The expression plasmid was introduced into COS-1 cells using the
DEAE-dextranchloroquine method (Seed et al., Proc.
Natl. Acad. Sci. U.S.A. 1987, 84:3365-3369). After two days of growth in Dulbecco's Modified Eagle Medium (DMEM)/10% FBS, the medium was replaced with DMEM and the incubation continued for an additional 48 h.
Clarified conditioned medium was either used directly or was dialyzed against 0.1 M acetic acid for 2 days, dried, and resuspended as a 20-fold concentrate in DMEM.
12.1.2. HER Tyrosine Phosphorylation
As shown in FIG. 15, recombinant heregulin induces tyrosine phosphorylation of HER4. Tyrosine phosphorylated receptors were detected by Western blotting with an anti-phosphotyrosine Mab a,
Monolayers of MDA-MB453 or CHO/HER4 cells were
incubated with media from COS-1 cells transfected with a rat heregulin expression plasmid (HRG), or with a cDM8 vector control (-). The media was either applied directly (1x) or after concentrating 20-fold (20x, and vector control). Solubilized cells were
immunoprecipitated with anti-phosphotyrosine Mab. b, Monolayers of CHO/HER2 cells were incubated as above with transfected Cos-1 cell supernatants or with two stimulatory Mabs to HER2 (Mab 28 and 29). Solubilized cells were immunoprecipitated with anti-HER2 Mab.
Arrows indicate the HER2 and HER4 proteins.
12.1.3. Results
In order to determine if HER4 is involved in signaling by heregulin, the ability of recombinant rat heregulin to stimulate tyrosine phosphorylation in a panel of Chinese hamster ovary (CHO) cells that ectopically express human HER2 or HER4 was examined. The activity of recombinant heregulin was first confirmed by its ability to stimulate differentiation of human breast cancer cells (data not shown) and to induce tyrosine phosphorylation of a high molecular weight protein in MDA-MB453 cells (FIG. 15, Panel 1). Heregulin had no effect on CHO cells expressing only HER2 (FIG. 15, Panel 3), yet these cells were shown to have a functional receptor since their tyrosine kinase activity could be stimulated by either of two
antibodies specific to the extracellular domain of HER2 (FIG. 15, Panel 3). However, heregulin was able to induce tyrosine phosphorylation of a 180K protein in CHO cells expressing HER4 (FIG. 15, Panel 2).
Species differences in ligand-receptor
interactions have been reported for EGF receptor (Lax et al., 1988, Mol. Cell. Biol. 8:1970-1978). It is unlikely that such differences are responsible for our failure to detect a direct interaction between rat heregulin and human HER2, since previous studies have shown that rat heregulin does not directly interact with rat HER2/neu (Peles et al., supra). In addition, rat, rabbit, and human heregulin share high sequence homology and have been shown to induce tyrosine phosphorylation in their target cells of human origin (Wen D. et al., supra; Holmes et al., supra; and Falls et al., supra). 12.2. Expression of Recombinant HER2 and HER4 in Human CEM Cells
12.2.1. Materials and Methods
CNHER2 and CNHER4 expression plasmids were generated by insertion of the complete coding
sequences of human HER2 and HER4 into cNEO, an
expression vector that contains an SV2-NEO expression unit inserted at a unique BamHI site of CDM8. These constructs were linearized and transfected into CEM cells by electroporation with a Bio-Rad Gene Pulser apparatus essentially as previously described (Wen et al., supra). Stable clones were selected in RPMI/10% FBS supplemented with 500 μg/ml active Geneticin.
HER2 immunoprecipitations were as described in FIG. 15, using 5 × 106 cells per reaction, and the HER2 Western blots were performed with a second anti-HER2 Mab (c-neu Ab-3, Oncogence Sciences). For metabolic labeling of HER4, 5 × 106 cells were incubated for 4-6 h in methionine and cysteine-free Minimal Essential Medium (MEM) supplemented with 2% FBS and 250 μCi/ml [35S]Express protein labeling mix (New England
Nuclear). Cells were washed twice in RPMI and
solubilized as above. Lysates were then incubated for 6 h, 4º C with 3 μl each of two rabbit antisera raised against synthetic peptides corresponding to two regions of the cytoplasmic domain of human HER4
(864LARLLEGDEKEYNADGG96 [SEQ ID No:31] and
1010EEDLEDMMDAEEY1022 [SEQ ID No: 32]). Immune complexes were precipitated with 5 μg goat anti-rabbit Ig
(Cappel) and Protein G Sepharose (Pharmacia).
Proteins were resolved on 7% SDS-polyacrylamide gels and exposed on the phosphorimager. For Mab-stimulation assays, 5 × 106 cells were resuspended in 100 μl RPMI and 25 μg/ml Mab was added for 15 min at room temperature. Control Mab 18.4 is a murine IgG1 specific to human amphiregulin (Plowman et al., 1990, Mol. Cell. Biol. 10:1969-1981). Following Mab-treatment, cells were washed in PBS, solubilized
(Section 13, infra), and immunoprecipitated with anti-HER2 Mab (Ab-2). Tyrosine phosphorylated HER2 was detected by PY20 Western blot as in FIG. 15.
12.2.2. Expression of HER2 and HER4 in
Human CEM cells
Expression of recombinant HER2 and HER4 in human CEM cells is shown in FIG. 16. Transfected CEM cells were selected that stably express either HER2, HER4, or both recombinant receptors. In FIG. 16, Panel 1. recombinant HER2 was detected by immunmoprecipitation of cell lysates with anti-HER2 Mab (Ab-2) and Western blotting with another anti-HER2 Mab (Ab-3). In FIG. 16, Panel 2, recombinant HER4 was detected by
immunoprecipitation of 35S-labeled cell lysates with HER4-specific rabbit anti-peptide antisera. In FIG. 16, Panel 3, three CEM cell lines were selected that express one or both recombinant receptors and aliquots of each were incubated with media control (-), with two HER2-stimulatory Mabs (Mab 28 and 29), or with an isotype matched control Mab (18.4). Solubilized cells were immunoprecipitated with anti-HER2 Mab (Ab-2) and tyrosine phosphorylated HER2 was detected by Western blotting with an anti-phosphotyrosine Mab. The size in kilodaltons of prestained high molecular weight markers (Bio-Rad) is shown on the left and arrows indicate the HER2 and HER4 proteins.
12.2.3. Results
These findings of Example 12 support the earlier observation that HER2 alone is not sufficient to transduce the heregulin signal. To further address this possibility, a panel of human CEM cells that express the recombinant receptors either alone or in combination was established. The desired model system was of human origin, since many of the reagents against erbB family members are specific to the human homologues. CEM cells are a human T lymphoblastoid cell line and were found to lack expression of EGF receptor, HER2, HER3, or HER4, by a variety of
immunologic, biologic, and genetic analyses (data not shown). FIG. 16 demonstrates the selection of three CEM cell lines that express only HER2 (CEM 1-3), only HER4 (CEM 3-13), or both HER2 and HER4 (CEM 2-9). The presence of a functionally and structurally intact HER2 in the appropriate cells was confirmed by the induction of HER2 tyrosine phosphorylation by each of the two antibodies specific to the extracellular domain of HER2, but not by an isotype matched control antibody (FIG. 16, Panel 3).
12.3. Heregulin Induction of Tyrosine
Phosphorylation in CEM-Cells Expressing HER4
12.3.1. Materials and Methods
Recombinant rat heregulin was prepared as in FIG. 15, and diluted to 7x in RPMI. The HER4-specific Mab was prepared by immunization of mice with recombinant HER4 (manuscript in preparation). CEM cells (5 × 106) were treated with the concentrated supernatants for 10 min, room temperature and precipitated with PY20 or anti-HER2 Mab (Ab-2) as described in FIG. 15.
Immunoprecipitation with anti-HER4 Mab was performed by incubation of cells lysates with a 1:5 dilution of hybridoma supernatent for several hours followed by 2 μg rabbit anti-mouse Ig (cappel) and Protein A
Sepharose CL-4B (Pharmacia). PY20 Westerns as
described in FIG. 15.
12.3.2. Heregulin Induction of Tyrosine
Phosphorylation in CEM cells
Expressing HER4
As shown in FIG. 17, heregulin induces tyrosine phosphorylation in CEM cells expressing HER4. Three
CEM cell lines that express either HER2 or HER4 alone (CEM 1-3 and CEM 3-13) or together (CEM 2-9) were incubated with 7x concentrated supernatants from mock-(-) or heregulin-transfected (+) COS-1 cells.
Solubilized cells were immunoprecipitated (IP) with anti-phosphotyrosine Mab (PY20) (FIG. 17, Panel 1); HER2-specific anti-HER2 Mab (Ab-2) (FIG. 17, Panel 2); or HER4-specific Mab (6-4) (FIG. 17, Panel 3). In each case, tyrosine phosphorylated receptors were detected by Western blotting with anti-phosphotyrosine Mab. The size in kilodaltons of prestained molecular weight markers (BioRad) is shown on the left and arrows indicate the HER2 and HER4 proteins.
12.3.3 Results
The panel of CEM cells were then analyzed by phosphotyrosine Western blots of cells lysates
following treatment with heregulin and
immunoprecipitation with three different monoclonal antibodies (Mabs). Precipitation with an anti-phosphotyrosine antibody (PY20) again demonstrates that heregulin is able to stimulate tyrosine
phosphorylation in cells expressing HER4, but not in cells expressing only HER2 (FIG. 17, Panel 1).
However, precipitation with an antibody specific to the extracellular domain of HER2 demonstrates that HER2 is tyrosine phosphorylated in response to
heregulin in cells that co-express HER4 (FIG. 17, Panel 2). Furthermore, precipitation with a HER4-specific Mab confirms that heregulin induces tyrosine phosphorylation of HER4 irrespective of HER2
expression (FIG. 17, Panel 3). Due to co-expression of HER2 and HER4 in many breast carcinomas, these findings suggest that earlier studies of heregulin-HER2 interactions may require reevaluation.
12.4. covalent cross-linking of Iodinated
Heregulin to HER4
12.4.1. Materials and Methods
To facilitate purification, recombinant heregulin was produced as an epitope-tagged fusion with
amphiregulin. The 63 amino acid EGF-structural motif of rat heregulin (Wen et al., supra) from serine 177 to tyrosine 239 was fused to the N-terminal 141 amino acids of the human amphiregulin precursor (Plowman et al., supra). This truncated portion of heregulin has previously been shown to be active when expressed in E. coli (Holmes et al., supra), and the N-terminal residues of amphiregulin provide an epitope for immunologic detection and purification of the
recombinant protein. This cDNA fragment was spliced into a cDM8 based expression vector for transient expression in COS-1 cells. Recombinant heregulin was purified by anion exchange and reverse phase
chromatography as shown to be active based on the specific stimulation of HER4 tyrosine phosphorylation. Purified heregulin was iodinated with 250 μCi of 125I-labeled Bolton-Hunter reagent (NEN). CHO/HER4 or CHO/HER2 cells were incubated with 125I-heregulin (105-cpm) for 2 h at 4° C. Monolayers were washed in PBS and 3 mM Bis(sulfosuccinimidyl) suberate (BS3, Pierce) was added for 30 min on ice. The cells were washed in tris-buffered saline, dissolved in SDS sample buffer, run on a 7% polyacrylamide gel, and visualized on the phosphorimager.
12.4.2. Results
As shown in FIG. 18, previous binding and
covalent cross-linking studies have demonstrated that p45 binds specifically to HER4 and displays a single high-affinity site with a Kd of 5 nM on CHO/HER4 cells (Section 13, infra). Preliminary cross-linking studies have been performed on these cells with recombinant heregulin revealing a high molecular weight species that corresponds to the heregulin-HER4 receptor complex. 12.5 Results
As the data demonstrate heregulin induces
tyrosine phosphorylation of HER4 in the absence of HER2. In contrast, heregulin does not directly stimulate HER2. However, in the presence of HER4, heregulin induces phosphorylation of HER2, presumably either by transphosphorylation or through receptor heterodimerization. Together, these experiments suggest that HER4 is the receptor for heregulin.
Most breast cancer cells that overexpress HER2 have been shown to be responsive to heregulin, whereas HER2-positive ovarian and fibroblast lines do not respond to the ligand. This observation could be explained by the fact that HER4 is co-expressed with HER2 in most or all of the breast cancer cell lines studied, but not in the ovarian carcinomas.
Furthermore, overexpression of HER2 in heregulin-responsive breast cancer cells leads to increased binding, whereas expression of HER2 in heregulin-unresponsive ovarian or fibroblast cells has no effect (Peles et al., supra).
Northern and in situ hybridization analyses localizes HER4 to the white matter and glial cells of the central and peripheral nervous system, as well as to cardiac, skeletal, and smooth muscle. This
distribution is consistent with HER4 being involved in signaling by the neurotropic factors, GGF, and ARIA. Recognition of HER4 as a primary component of the heregulin signal transduction pathway will assist in deciphering the molecular mechanisms that results in its diverse biologic effects. 13. Example: Purification of the HER4 Ligand, p45 13.1 Materials and Methods
13.1.1. Cell Culture and Reagents MDA-MB 453 cells were obtained from the American Type Culture Collection (Rockville, MD) and cultured in Dulbecco's modified Eagle's medium (DMEM)
supplemented with 10% fetal bovine serum and amino acids (Life Technologies, Inc.). HepG2 cells were obtained from Dr. S. Radka and cultured in 10% fetal bovine serum containing DMEM. For large scale
production of serum-free conditioned medium, HepG2 cells were propagated in Nunc cell factories. Chinese hamster ovary cells (CHO-KI) expressing high levels of either recombinant human p185erbB2 (CHO/HER2) or
recombinant human p180erbB4 (CHO/HER4) were generated and cultured as described in Section 8. N29 monoclonal antibody to the extracellular portion of the human HER2 receptor was a gift from Dr. Y. Yarden. Ab-3 c-neu monoclonal antibody that reacts with the human p185erbB2 was from Oncogene Science Inc.
13.1.2. Human Breast Cancer Cell
Differentiation Assay
MDA-MB-453 human breast cancer cells overexpress p185erbB2 but do not express the EGFR at their surface
(Kraus, 1987, EMBO J. 6:605-610). A cell
differentiation assay was used to monitor the
chromatography fractions for their ability to induce phenotypic differentiation in MDA-MB-453 cells.
13.1.3. Purification of p45
Medium conditioned by HepG2 cells (HepG2-CM, 60 liters) was concentrated 26-fold using an Amicon ultrafiltration unit (10,000 molecular weight cutoff membranes) and then subjected to 50% ammonium sulfate ((NH4)2SO44) precipitation. After centrifugation at 25,000 × g for 1 h, the supernatant was loaded, as five separate runs, on a phenyl-Sepharose column (2.5 × 24.5 cm, Pharmacia LKB Biotechnology Inc.)
equilibrated with 1.9 M (NH4)2SO4 in 0.1 M Na2HPO4, pH 7.4. Bound proteins were eluted with a 240 ml linear decreasing gradient from 1.9 M to 0 M (NH4)2SO4 in 0.1 M phosphate buffer, pH 7.4. The flow rate was 70 ml/h, and 5.8-ml fractions were collected. Active fractions were pooled, concentrated, dialyzed against PBS, and then applied (three separate runs) to a DEAE-Sepharose column (2.5 × 25 cm, Pharmacia) equilibrated with PBS, pH 7.3. The flow rate was 1 ml/min. The column flow-through was then loaded (two separate runs) on a CM-Sepharose Fast Flow column (2.5 × 13.5 cm, Pharmacia) pre-equilibrated with PBS, pH 7.3.
Proteins were eluted at 1 ml/min. with a 330-ml gradient from PBS to 1 M NaCl in PBS. Fractions of 5 ml were collected. The active material was loaded on a TSKgel heparin-5PW HPLC column (7.5 x 75 mm,
TosoHaas) equilibrated with PBS. The flow rate was 0.5 ml/min. A 50-ml linear NaCl gradient (PBS to 2 M in PBS) followed by an isocratic elution with 2 M NaCl was used to elute the bound proteins. Fractions of 1 ml were collected. Active fractions corresponding to the 1.3 M NaCl peak of protein were pooled and
concentrated. A Protein Pak SW-200 size exclusion chromatography column (8 × 300 mm. Waters)
equilibrated with 100 mM Na3HPO4, pH7.4, 0.01% Tween 20 was used as a final step of purification. The flow rate was 0.5 ml/min., and 250-μl fractions were collected. Column fractions were then analyzed by SDS-PAGE (12.5% gel) under reducing conditions and proteins detected by silver staining. 13.1.4. Detection of Tyrosine- Phospborylated Proteins by Western Blotting
Aliquots of PBS-dialyzed column fractions were diluted to 200 μl in PBS, then added to individual wells of 48-well plated containing either 5 × 105 MDA-MB-453 cells, 2 × 104 CHO/HER2 cells or 5 × 104
CHO/HER2 cells. Following a 10-min. incubation at 37° C, cells were washed and then lysed in 100 μl of boiling electrophoresis sample buffer. Lysates were heated at 100° C for 5 min., cleared by centrifugation, and then subjected to SDS-PAGE. After
electrophoresis, proteins were transferred to
nitrocellulose. The membrane was blocked for 2 h at room temperature with 6% hovine serum albumin in 10 mM Tria-HCl, pH 8.0, 150 mM NaCl, 0.05% Tween 20. PY20 monoclonal anti-phosphotyrosine antibody (ICN, 2 h at 22° C) and horseradish peroxidase-conjugated goat anti-mouse IgG F(ab')3 (Cappel, 1h at 22° C) were used as primary and secondary probing reagents, respectively. Proteins phosphorylated on tyrosine residues were detected with a chemiluminescence reagent (Amersham Corp.).
13.1.5. CHO/HER2 stimulation Assay CHO/HER2 cells were seeded in 24-well plates at 1 × 105 cells/well and cultured 24 h. Monoclonal
antibody N29 specific to the extracellular domain of p185erbB2 (stancovski et al., 1991, PNAS 88:8691-8695) was added at 25 μg/ml. Following a 20-min. incubation at room temperature, media were removed and cells were solubilized for 10 min. on ice in PBS-TDS (10 mM sodium phosphate, pH 7.25, 150 mM NaCl, 1% Triton, 0.5% sodium deoxycholate, 0.1% SDS, 0.2% NaN3, l mM NaF, 1 m M phenylmethylsulfonyl fluoride, 20 μg/ml aprotinin) with occasional vortexing. Clarified extracts were incubated for 2 h at 4° C with an antip- 185erbB2 antibody (Ab-3 c-neu, Oncogene Science Inc.). Rabbit anti-mouse IgG (Cappel) and protein A-Sepharose were then added, and samples were incubated an
additional 30 min. Immune complexes were washed 3 times with PBS-TDS, resolved on a 7% polyacrylamide gel, and electrophoretically transferred to
nitrocellulose. Phosphorylation of the receptor was assessed by Western blot using a 1:1000 dilution of PY20 phosphotyrosine primary antibody (ICN
Biochemicals) and a 1:500 dilution of 125I-sheep anti-mouse F(ab')2(Amersham Corp.).
13.1.6. Covalent Cross-linking of
lodinated p45
HPLC-purified p45 (1.5 μg) was iodinated with 250 μCi of 124I-labeled Bolton-Hunter reagent obtained from Du Pont-New England Nuclear. 125I-p45 was purified by filtration through a Pharmacia PD-10 column. The specific activity was 104 cpm/ng. 125I-p45 retained its biological activity as confirmed in a differentiation assay as well as a kinase stimulation assay (data not shown). Binding of radiolabeled p45 was performed on 2 × 105 CHO/HER4 cells and 4 × 105 CHO-KI or CHO/HER2 cells in 12-well plates. Cell monolayers were washed twice with 1 ml of ice-cold binding buffer (DMEM supplemented with 44 mM sodium bicarbonate, 50 mM BES [N-, N-Bis (2-hydroxyethyl) -2-aminoethan-sulfonic acid], pH 7.0, 0.1% bovine serum albumin) and then incubated on ice for 2 h with 50 ng/ml 125I-p45 in the absence or the presence of 250 ng/ml unlabeled p45. The monolayers were washed twice with PBS and then incubated in the presence of 1 mM
bis(sulfosuccinimidyl)suberate (BS3, Pierce) in PBS for 45 min. on ice. Supernatants were discarded, and the reaction was quenched by adding 0.2 M glycine in PBS. Cells were washed and then lysed by adding 150 μl of boiling electrophoresis sample buffer containing 0.1 M dithiothreitol. Samples were boiled for 5 min. and 50 μl of each sample was loaded on 7.5% polyacrylamide gels. Dried gels were analyzed using a Molecular Dynamics PhosphorImager and then exposed to Kodak X-Omat AR films.
13.1.7. Binding Analysis of lodinated p45 CHO/HER4 cells, CHO-KI cells (105 cells/well), and CHO/HER2 cells (2 × 10s cells/well) were seeded in 24-well plates. After 48 h, cells were washed with binding buffer and then incubated with increasing concentrations of 125I-p45. Nonspecific binding was determined in the presence of excess unlabeled p45. After a 2-h incubation at 4° C, the cells were washed three times with binding buffer and then lysed in 500 μl of 0.5M NaOH, 0.1% SDS. Cell-associated
radioactivity was determined by using a γ-counter.
Scatchard analysis was performed using the
computerized LIGAND program (Munson and Rodbard, 1980, Anal. Biochem 107:220-239).
13.1.8. N-terminal Amino Acid Sequence The N-terminal sequence analysis of p45 (25 pmol) was performed as previously described (Shoyab et al., 1990, Proc. Natl. Acad. Sci. 87:7912-7916).
13.2. Purification of the HER4 Ligand, p45
Sixty liters of medium conditioned by HEPG2 cells was used as a starting material, and throughout the purification procedure, bioactivity was assessed by a cell differentiation assay described in Section
10.1.1., supra. After concentration (1540 mg of protein) and ammonium sulfate precipitation, the active material (1010 mg of protein) was loaded on a phenyl-Sepharose column (FIG. 19, Panel 1). Column fractions 40-85 (348 mg of protein eluting between 1M ammonium sulfate and 0M ammonium sulfate) were found to induce morphological changes in MDA-MB-453 cells. The biologically active column flow-through (174 mg of protein) was subjected to a cation-exchange
chromotography (FIG. 19, Panel 2) with activity eluting between 0.35 and 0.48 M NaCl. The active fractions were pooled (1.5 mg of protein) and applied to an analytical heparin column (FIG. 19, Panel 3). The differentiation activity eluted from the heparin column between 0.97 and 1.45 M NaCl (fractions 27-38). Size exclusion chromatography of the heparin column fractions 35-38 achieved a homogeneous preparation of the human breast cancer cell differentiation factor. A major protein peak eluted with a molecular weight greater than 70,000 (FIG. 19, Panel 4). Fractions 30 and 32 assayed at 30 ng/ml confirmed the bioactivity of this protein with phenotypic changes being apparent after 24 hours. SDS-PAGE analysis of these column fractions followed by silver staining of the gel showed that the biologically active peak contained a single protein migrating around 45 kDA (FIG. 20). The faint 67 kDa band corresponds to a staining artifact, as evidenced by the left lane of the gel, which contained no sample. The amount of pure protein recovered in fractions 30-33 was estimated to be 6 micrograms. The difference in the molecular weight estimated by size exclusion chromatography and SDS-PAGE indicates that this protein may form dimers or oligomers under non-denaturing conditions. 13.3. N-terminal Amino Acid Sequence of p45
Twenty-five pmol of p45 was subjected to direct amino acid sequencing, identifying the sequence Ser-Gly-X-Lys-Pro-X-X-Ala-Ala [SEQ ID No: 33]. An X denotes a sequenator cycle in which a precise amino acid could not be assigned. Comparison of this partial sequence with two protein data bases (GenBank release 73, EMBL release 32) revealed a perfect homology between the identified residues and a region of the amino terminus of heregulin (Holmes et al., supra) The N-terminal serine residue of p45
corresponds to residue 20 of the deduced amino acid sequence of heregulins. 13.4. p45 Stimulates Protein Phosphorylation FIG. 21, Panel 1 shows the stimulatory effect of sequential fractions from the size exclusion
chromatography column on tyrosine phosphorylation in MDA-MB-453 cells. Densitometric analysis of the autoradiogram revealed that fractions 30-34 were essentially equipotent. Homogeneously purified p45 specifically stimulated tyrosine phosphorylation of p180erbB4 (FIG. 21, Panel 2). p45 was not able to stimulate phosphorylation in CHO/HER2 cells, and the cell were found to express functional p185erbB2 receptor as evidenced by immunoreactivity with 5 monoclonal antibodies specific to different regions of p185erbB2. p45 has an N-terminal amino acid sequence similar to the recently isolated p185erbB2 ligand.
13.5. Binding and Covalent Cross-linking of p45 to p180erbB4
Binding and cross-linking studies were performed in order to confirm that p45 was able to bind to p180erbB4. Binding studies revealed that while no specific binding of 125I-p45 to CHO-KI and CHO/HER2 cells could be measured, CHO/HER4 cells displayed a single high affinity site (Kd about 5nM) with 7 × 104 receptors/cell (FIG. 22, Panel 1). The results of iodinated p45 cross-linking to CHO-KI, CHO/HER2, or CHO/HER4 cells are presented in FIG. 22, Panel 2.
Whereas no cross-linked species was observed in either CHO-KI or CHO/HER2 cells, four distinct bands were observed in CHO/HER4 cells, migrating as 45-, 100-, and 210-kDa species, and a very high molecular weight species. In the presence of unlabeled p45, 125I-p45 binding was greatly reduced. The 45 kDa band
represents uncross-linked yet p180erbB4 associated 125I-p45. The 210 kDa band corresponds to the p45-p180erbB4 complex (assuming an equimolar stoichiometry of ligand and receptor), whereas the high molecular weight band is presumed to be a dimerized form of the receptor-ligand complex. The 100 kDa band could represent a truncated portion of the extracellular domain of the p180erbB4 receptor complexed to 125I-p45 or a covalently associated p45 dimer. The c-kit ligand provides precedence for cross-linked dimers (Williams et al., 1990, Cell 63:167-174). 13.6. Results
The HER4 ligand, p45, purified from medium conditioned by HepG2, induces differentiation of breast cancer cells and activates tyrosine
phosphorylation of a 185 kDa protein in MDA-MB-453 cells. p45 is not capable of directly binding to p185erbB2 but shows specificity to HER4/p180erbB4. 14. Example: Targeted Cytotoxicity Mediated By A Chimeric Heregulin-Toxin Protein
14.1. Materials and Methods
14.1.1. Reagents and Cell Lines
Heregulin β2-Ig and the mouse monoclonal antibody directed against the Pseudomonas exotoxin (PE) was supplied by Dr. J.-M. Colusco and by Dr. Tony Siadek, respectively (Bristol-Myers-Squibb, Seattle, WA). The cell lines BT474, MDA-MB-453, T47D, SKBR-3, and MCF-7 (all breast carcinoma), LNCaP (prostate carcinoma), CEM (T-cell leukemia) and SKOV3 (ovarian carcinoma) were obtained from ATCC (Rockville, MD). The H3396 breast carcinoma cell line and the L2987 lung
carcinoma cell line were established at Bristol-Myers-Squibb (Seattle, WA). The AU565 breast carcinoma cell line was purchased from the Cell Culture laboratory. Naval Biosciences Laboratory (Naval Supply Center, Oakland, CA). All cell lines were of human origin. BT474 and T47D cells were cultured in IMDM
supplemented with 10% fetal bovine serum (FBS) and 10 μg/ml insulin. MCF-7, H3396, LNCaP and L2987 were cultured in IMDM supplemented with 10% FBS. SKBR3 and SKOV3 cells were grown in McCoys media supplemented with 10% FBS and 0.5% non-essential amino acids.
AU565 cells were cultured in RPMI 1640 media
supplemented with 15% FBS and CEM transfectants (see section 15.1.5., infra) were cultured in RPMI 1640 supplemented with 10% FBS and 500 μg/ml G418.
14.1.2. Construction of HAR-TX β2 Expression
Plasmid
Rat heregulin cDNA (Wen et al., 1994, Mol. Cell. Biol. 14:1909-1919) was isolated by RT-PCR using mRNA from rat kidney cells as template. The cDNA was prepared in chimeric form with the AR leader sequence by a two-step PCR insertional cloning protocol using cARP (Plowman et al., 1990, Mol. Cell. Biol. 10:1969-1981) as template to amplify the 5' end of the chimeric ligand using the oligonucleotide primers
CARP5:
(5'-CGGAAGCTTCTAGAGATCCCTCGAC-3') [SEQ ID No: 34]
and
ANSHLIK2:
(3'CCGCACACn'lTATGTGTTGGCTTGTGTTTCTTCTATTTTTTCCA
TTTTTG-5') [SEQ ID No: 35].
The EGF-like domain PCR was amplified from cNDFl.6 (Plowman et al., 1993, Nature 366:473-475) using the oligonucleotide primers
ANSHLIKl:
(5'-CAAAAATGGAAAAAATAGAAGAAACAGAAGCCATCTCATAA
AGTGTGCGG-3') [SEQ ID No: 36]
and
XNDF1053:
(3'-GTCTCTAGATTAGTAGAGTTCCTCCGCTTTTTCTTG-5') [SEQ ID No:37].
The products were combined and reamplified using the oligonucleotide primers CARP5 and XNDF1053. The HAR (heregulin-amphiregulin) construct (cNANSHLIK) was PCR amplified in order to insert an Nde I restriction site on the 5' end and a Hind III restriction site on the 3' end with the oligonucleotide primers
NARP1:
(5'-GTCAGAGTTCATATGGTAGTTAAGCCCCCCCAAAAC-3') [SEQ ID No:38]
and
NARP4:
(3 ' -GGCAGTTCTATGAACACGTTCACGGGCTTGCTTAAATGACCGCTGGCA ACGGTCTTGATACAATACCGTAGAAAAATGTTTAGCCTCCTTGAGATGTTCGAA TCTCCTAGAAAC-5' ) [SEQ ID NO: 39]. The resulting 287 bp DNA fragment was digested with Nde I and Hind III, followed by ligation into the compatibly digested expression plasmid pBW 7.0 which contained, in frame at the 5' fusion site, the
nucleotide sequence encoding for of PE40 (Friedman et al., 1993, Cancer Res. 53:334-339). The resulting expression plasmid pSE 8.4 then contained the gene fusion encoding the chimeric heregulin-toxin protein, under the control of a IPTG-inducible T7 promoter.
14.1.3. Expression and Isolation of Recombinant
HAR-TX β2 Protein
The plasmid pSE 8.4 encoding the chimeric protein HAR-TX β2 was transformed into the E. coli strain BL21 (λDE3). Cells were grown by fermentation in T broth containing 100 μg/ml ampicillin at 37°C to a optical density of A650 = 4.8, followed by induction of protein expression with 1 mM isopropyl-1-thio-β-D-galactopyranoside (IPTG). After 90 minutes the cells were harvested by centrifugation. The cell pellet was frozen at -70°C, then thawed and resuspended at 4°C in solubilization buffer (50 mM Tris-HCl (pH 8.0), 10 mM EDTA, 1 ug/ml leupeptin, 2 ug/ml aprotinin, 1 ug/ml pepstatin-A, 0.5 mM PMSF) containing 1% tergitol by homogenization and sonication. The insoluble material of the suspension, containing inclusion bodies with the HAR-TX β2 protein, was pelleted by centrifugation and washed three times with solubilization buffer containing 0.5% tergitol (first wash), 1 M NaCl
(second wash), and buffer alone (third wash).
The resulting pellet containing pre-purifled inclusion bodies was dissolved in 6.5 M guanidine-HCl, 0.1 M Tris-HCl (pH 8.0), 5 mM EDTA; sonicated; and refolded by rapid dilution (100-fold) into 0.1 M Tris-HCl (pH 8.0), 1.3 M urea, 5 mM EDTA, 1 mM glutathione, and 0.1 mM oxidized glutathione at 4°C. The addition of the denaturating agent urea at low concentration was utilized to allow slow refolding and avoid the
formation of aggregates. The refolded HAR-TX β2 protein was diluted 2-fold with 50 mM sodium phosphate (pH 7.0) and applied to a cation-exchange resin (POROS 50 HS, PerSeptive Biosystems, Cambridge, MA), pre-equilibrated in the same buffer. The HAR-TX β2 protein was eluted with a 450 nM NaCl step gradient in 50 mM sodium phosphate (pH 7.0) and fractions were analyzed using SDS-PAGE and Coomassie blue staining. Final purification of pooled fractions was performed by chromatography using Source 15S cation-exchange media (Pharmacia, Uppsala, Sweden) equilibrated with 50 mM sodium phosphate (pH 6.0). Chimeric HAR-TX β2 protein was eluted with a gradient of 0-1 M NaCl in the same buffer and analyzed by SDS-PAGE.
14.1.4. ELISA Test for Determination of Binding
Activity
Membranes from 5 × 107 MDA-MB-453 cells were prepared and coated to 96 well plates as previously described for H3396 human breast carcinoma cells
(Siegall et al., 1994, J. Immunol. 152:2377-2384).
Subsequently, the membranes were incubated with
titrations of either HAR-TX β2 or PE40 ranging from 0.3 - 300 ug/ml and the mouse monoclonal anti-PE antibody EXA2-1H8 as the secondary reagent (Siegall et al., supra). The isolate of the toxin portion PE40 alone was used to determine unspecific binding
activity to the membrane preparations, in comparison with the specific binding activity of HAR-TX β2. 14.1.5. Phosphotyrosine Analysis of transfected CEM cell lines
CEM cells expressing various receptors of the
EGF-R family (1-5 × 106 cells) were stimulated with 500 ng/ml HAR-TX β2 for 5 minutes at room temperature.
The cells were pelleted and resuspended in 0.1 ml lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 5 mM MgCl2, 1% NP40, 0.5% deoxycholate, 0.1% sodium dodecylsulfate, 1 mM sodium orthovanadate) at 4°C.
Insoluble material was pelleted by centrifugation at
10,000 x g for 30 seconds, and samples were analyzed by SDS-PAGE and subsequent Western blot analysis using the anti-phosphotyrosine antibodies 4G10 (ICN, Irvine,
CA) and PY20 (Upstate Biotechnology, Lake Placid, New York).
14.1.6. Cytotoxicity Assays
For cytotoxicity assays, tumor cells (105
cells/ml) in growth medium were added to 96-well flat bottom tissue culture plates (0.1 ml/well) and
incubated at 37°C for 16 h. Cells were incubated with HAR-TX β2 for 48 h at 37°C, washed twice with phosphate buffered saline (PBS), followed by addition of 200 μl/well of 1.5 μM calcein-AM (Molecular Probes Inc., Eugene, OR). The plates were incubated for 40 minutes at room temperature (RT), and the fluorescence
measured using a Fluorescence Concentration Analyzer (Baxter Heathcare Corp., Mundelein, IL) at
excitation/emission wavelengths of 485/530 nm.
Calcein-AM is membrane permeable and virtually non-fluorescent. When it is hydrolyzed by intracellular esterases, an intensely fluorescent product, calcein is formed. The % cytotoxicity was calculated as previously described (Siegall et al., supra). To determine the specificity of the cytotoxic effect of HAR-TX β2 competitive assays were performed on LNCaP and on MDA-MB-453 cells. Treated essentially as described above, plates were incubated with increasing concentrations of HAR-TX β2 in presence heregulin β2-Ig (0.002-5.0 μg/ml) or with HAR-TX β2 (50 ng/ml). Isotype matched L6-Ig (Hellström et al., 1986, Cancer Res. 46:3917-3923) was used as negative control for the competition assay.
14.1.7. Generation of Monoclonal Antibodies to
HER4
HER4, expressed in baculovirus, was used as the immunogen for subcutaneous injection into 4-6 week old female BALB/c mice. Immunization was performed 4 times (approximately 1 month apart) with 20 μg of HER4 protein given each time. Spleen cells from immunized mice were removed four days after the final
immunization and fused with the mouse myeloma line P2×63-Ag8.653 as previously described (Siegall et al., supra). Positive hybridoma supernatants were selected by ELISA screening on plates coated with HER4
transfected CHO cells (Plowman et al., 1993, Nature 366:473-475) and selected against parental CHO cells and human fibroblasts. Secondary screening was performed by ELISA on plates coated with
baculovirus/HER4 membranes. Positive hybridomas were rescreened by two additional rounds of ELISA using CHO/HER4 and HER4 negative cells, and identified false positive were removed. Positive hybridomas were cloned in soft agar and tested for reactivity with the HER4 positive MDA-MB-453 human breast carcinoma cell line and CEM cells co-transfected with HER4 and HER2. Anti-HER4 hybridoma line 6-4-11 (IgG1) was cloned in soft agar and screened for reactivity to native and denatured HER4. A second antibody (7-142, IgG2a) was also selected and found to bind to the cytoplasmic domain of HER4.
The characteristics for both antibodies are summarized in Table VI (see section 15.2.8., infra)
14.1.8. Quantitation Of HER2, HER3, and HER4
Protein in tumor cell lines
Cell-surface expression of HER2, HER3, and HER4 protein was determined by quantification of specific antibody binding, detected by the CAS Red Chromagen system (Becton Dickson Cellular Imaging System,
Elmhurst, IL). HER2 staining was performed by using mouse anti-HER2 mAb 24.7 (Stancovski et al., 1991, Proc. Natl. Acad. Sci. USA 88:8691-8695) as primary, and biotinylated goat anti-mouse IgG (Jackson Labs, West Grove, PA) as secondary antibody as previously described (Bacus et al., 1993, Cancer Res. 53:5251-5261). For detection of HER3 and HER4 the primary antibodies used were, respectively, mouse anti-HER3 mAb RTJ2 (Santa Cruz Biotech, Santa Cruz, CA) at 2.5 μg/ml concentration or mouse anti-HER4 mAb 6-4-11 at 15 μg/ml concentration followed by incubation with biotinylated rabbit anti-mouse IgG (Zymed Labs, South San Francisco, CA).
The staining procedure was performed at RT as follows: cells were fixed in 10% neutral buffered formalin for 60 minutes, washed with H2O and rinsed with Tris buffered saline (TBS; 0.05 M Tris, 0.15 M NaCl, pH 7.6). Unspecific binding sites were blocked by incubation with 10% goat serum (for HER2) or rabbit serum (for HER3 and HER4) in 0.1% bovine serum
albumin/TBS for 15 minutes. Subsequently, cells were incubated with primary and secondary antibodies for 30 and 20 minutes, respectively, followed by incubation with alkaline phosphatase conjugated streptavidin (Jackson Labs) for 15 minutes, with TBS washing between the steps. Detection of antibody binding was achieved using CAS Red Chromagen (Becton Dickinson Cellular Imaging System, supra) for 4 minutes (HER2), 8-10 minutes (HER3), and 10-12 minutes (HER4). Cells were counterstained as described in the CAS DNA stain protocol (Becton Dickinson Cellular Imaging System).
14.1.9. Image Analysis
Image analysis was performed as previously described (Bacus et al., 1993, supra ; Bacus et al., 1992, Cancer Res. 52:2580-2589; Peles et al., 1992, Cell 69:205-216). In the quantitation of HER2, both solid state imaging channels of the CAS 200 Image Analyzer (Becton Dickinson Cellular Imaging System), a microscope-based, two-color system were used. The two imaging channels were specifically matched to the two components of the stains used. One channel was used for quantitating the total DNA of the cells in the field following Feulgen staining as described (Bacus et al., 1990, Mol. Carcinog. 3:350-362), and the other for quantitating the level of HER2, HER3, and HER4 proteins following immunostaining. When the total DNA amount per cell was known, the average total HER2, HER3, and HER4 per cell were computed. Sparsely growing AU565 cells were used for calibrating the HER2 protein. Their level of staining was defined as 100% of HER2 protein content (1.0 relative amounts = 10,000 sum of optical density); all other measurements of HER2, HER3, and HER4 protein were related to this value.
14.1.10. Determination of the LD50 of HAR-TX β2 For toxicity studies, HAR-TX β2 at different concentrations was administered intravenous in 0.2 ml PBS. Per group each two mice and two rats were injected.
14.2. RESULTS
14.2.1. Construction, Expression, and
Purification of HAR-TX β2
The HAR-TX β2 expression plasmid, encoding the hydrophilic leader sequence from amphiregulin (AR), heregulin β2 , and PE40, under control of the IPTG inducible T7 promoter, was constructed as described in Section 15.1.2., supra , and is diagrammatically shown in FIG. 23, Panel 1. The AR leader sequence was added to the N-terminus of heregulin to facilitate the purification procedure (FIG. 23, Panel 2). FIG. 24A and 24B show the nucleotide sequence and the deduced amino acid sequence of the cDNA encoding HAR-TX β2
Chimeric HAR-TX β2 protein was expressed in E. coli of inclusion bodies. Recombinant protein was denatured and refolded as described in Section
15.1.2., supra, and applied to cation-exchange
chromatography on a POROS HS column. Semi-purified HAR-TX β2 protein was detected by PAGE and Coomassie blue staining as major band migrating at 51 kDa (FIG. 25, lane 2). The column flow-through from POROS HS contained only small amounts of HAR-TX β2 (FIG. 25, lane 3). POROS HS chromatography resulted in >50% purity of HAR-TX β2 (FIG. 25, lane 4). Further purification, to >95% purity, was done by
chromatography using Source 15S cation-exchange resin (FIG. 25, lane 5). The monomeric nature of purified HAR-TX β2 was determined by non-reducing SDS-PAGE (FIG. 25, lane 6) which exhibited the same migration pattern as under reducing conditions (FIG. 25, lane 5). 14.2.2. Binding of HAR-TX β2 to MDA-MB-453 Cell Membranes
To determine the specific binding activity of HAR-TX β2 , an ELISA assay was performed using
membranes of the HER4 positive human breast carcinoma cell line MDA-MB-453 as the target for binding. HAR-TX β2 was found to bind to the immobilized cell membranes in a dose-dependent fashion up to 300 μg/ml (FIG. 26). PE40, the toxin component of HAR-TX β2 used as negative control, was unable to bind to MDA-MB-453 membranes.
14.2.3. Tyrosine Phosphorylation of HER
Forms on Transfected CEM cells
To test the biological activity of HAR-TX β2 a HER4 receptor phosphorylation assay was performed as previously described for heregulin (Carraway et al., 1994, J. Biol. Chem. 269:14303-14306). CEM cells expressing different HER family members were exposed to HAR-TX β2 and stimulation of tyrosine
phosphorylation was analyzed by phosphotyrosine immunoblot analysis (Section 4, supra; Section
15.1.5., supra). As shown in FIG. 27, HAR-TX β2 induced tyrosine phosphorylation in CEM cells
expressing HER4 either alone or together with HER2, but not in cells expressing only HER2 or HER1. This result demonstrates that HER4 is sufficient and necessary for induction of tyrosine phosphorylation in response to HAR-TX β2 , which is not true for HERl and for HER2. The fact that HAR-TX β2 does not induce tyrosine phosphorylation in CEM cells transfected with HERl confirms that the hydrophilic leader sequence of amphiregulin does not affect the specificity of the heregulin moiety in its selective interaction between receptor family members.
14.2.4. cytotoxicity of HAR-TX β2 Against
Tumor Cells
The cell killing activity of HAR-TX β2 was determined against a variety of human cancer cell lines. AU565 and SKBR3 breast carcinomas and LNCaP prostate carcinoma were sensitive to HAR-TX β2 with EC50 values of 25, 20, 4.5 ng/ml, respectively, while SKOV3 ovarian carcinoma cells were insensitive to HAR-TX β2 (EC50 >2000 ng/ml) (FIG. 28, Panel 1). Addition of heregulin β2-Ig to LNCaP cells reduced the
cytotoxic activity of HAR-TX β2 (FIG. 28, Panel 2). In contrast, L6-Ig, a chimeric mouse-human antibody with a non-related specificity but matching human Fc domains (Hellström et al., supra), did not inhibit the HAR-TX β2 cytotoxic activity (FIG. 28, Panel 2).
Thus, the cytotoxic effect of HAR-TX β2 was due to specific heregulin-mediated binding. Similar data were obtained using MDA-MB-453 cells (not shown).
14.2.5. HER2, HER3, and HER4 Receptor
Density on Human Tumor Cells:
Correlation with HAR-TX β2- Mediated Cytotoxicity
To understand why cell lines differed in their sensitivity to HAR-TX β2 , their levels of HER2, HER3, and HER4 were quantitated by image analysis (see
Section 15.1.8. and 15.1.9., supra) using receptor specific monoclonal antibodies (Table IV). The data strongly indicate that HER4 expression is required for heregulin directed cytotoxic activity. All seven of the tumor cell lines which expressed detectable levels of HER4 were found to be sensitive to HAR-TX β2- mediated killing with EC50 values ranging from 1-125 ng/ml. Moreover, the sensitivity of the different cell lines correlates directly with the expression level of HER4: MCF-7 cells displaying the lowest detectable levels of HER4 were found to be the least sensitive (EC50 = 125 ng/ml) of the cells which did respond. All four cell lines which were found to be devoid of any detectable HER4 expression on their surface were found to be resistant to HAR-TX β2.
Three of them, SKOV3, L2987 and H3396, displayed both HER2 and HER3 in the absence of HER4.
Figure imgf000108_0001
14.2.6. HAR-TX β2 Induces Tyrosine
Phosphorylation in Tumor Cells That Do Not Express HER4 In contrast to reports that heregulin directly binds to both HER3 and HER2/HER3 in a heterodimer configuration (Carraway et al., 1994, J. Biol. Chem. 269:14303-14306; Sliwkowski et al., 1994, J. Biol. Chem. 269:14661-15665), tumor cells that express HER3 alone (L2987) or co-express HER2 and HER3 (H3396 and SKOV3) were insensitive to HAR-TX β2. Direct
interaction of H3396 and L2987 cells with the chimeric protein was determined by phosphotyrosine immunoblots following HAR-TX β2 induction. HAR-TX β2 was found to induce tyrosine phosphorylation in both tumor cell types (FIG. 29) similar to that previously seen in COS-7 cells transfected with HER2 and HER3 (Sliwkowski et al., supra). SKOV3 cells were found to exhibit the same tyrosine phosphorylation pattern in the presence or absence of heregulin and thus direct interaction between receptors and heregulin could not be
established (data not shown). However, previous studies indicate that heregulin does not bind to these cells (Peles et al., supra).
14.2.7. Toxicity of HAT-TX β2
For the toxicity studies, HAR-TX β2 was
administered as described in section 15.1.10. In mice, 2/2 animals died at 2 mg/kg, 2/2 died at 1 mg/kg, 1/2 died at 0.75 mg/kg, and 0/2 died at 0.5 mg/kg, thus the LD50 is about 0.75 mg/kg (Table V). In rats the determined LD50 was slightly higher, as 50% of the animals died at 1 mg/kg (Table V).
Figure imgf000110_0001
14.2.8. Characteristics of HER4 Specific
Monoclonal Antibodies
The characteristics of the HER4 specific
monoclonal antibodies disclosed herein are summarized in Table VI.
Figure imgf000110_0002
15. Microorganism and Cell Deposits
The following microorganisms and cell lines have been deposited with the American Type Culture Collection, and have been assigned the following accession
numbers:
Figure imgf000111_0001
The present invention is not to be limited in scope by the microorganisms and cell lines deposited or the embodiments disclosed herein, which are
intended as single illustrations of one aspect of the invention, and any which are functionally equivalent are within the scope of the invention. Indeed, various modifications of the invention, in addition to those shown and described herein, will become apparent to those skilled in the art from the foregoing
description. Such modifications are intended to fall within the scope of the appended claims. All base pair and amino acid residue numbers and sizes given for polynucleotides and polypeptides are approximate and used for the purpose of description.
All publications and patent applications
mentioned in this specification are indicative of the level of skill of those skilled in the art to which the invention pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
Figure imgf000112_0001
Figure imgf000113_0001
.
Figure imgf000114_0001
.
Figure imgf000115_0001
Figure imgf000116_0001
Figure imgf000117_0001
Figure imgf000118_0001
Figure imgf000119_0001
Figure imgf000120_0001
Figure imgf000121_0001
Figure imgf000122_0001
Figure imgf000123_0001
Figure imgf000124_0001
Figure imgf000125_0001
Figure imgf000126_0001
Figure imgf000127_0001
Figure imgf000128_0001
Figure imgf000129_0001
Figure imgf000130_0001
Figure imgf000131_0001
Figure imgf000132_0001
Figure imgf000133_0001
Figure imgf000134_0001
Figure imgf000135_0001
Figure imgf000136_0001
Figure imgf000137_0001
Figure imgf000138_0001
Figure imgf000139_0001
Figure imgf000140_0001
Figure imgf000141_0001
Figure imgf000142_0001
Figure imgf000143_0001
Figure imgf000144_0001
Figure imgf000145_0001
Figure imgf000146_0001
Figure imgf000147_0001
Figure imgf000148_0001
Figure imgf000149_0001
Figure imgf000150_0001
Figure imgf000151_0001
Figure imgf000152_0001
Figure imgf000153_0001
Figure imgf000154_0001
Figure imgf000155_0001
Figure imgf000156_0001
Figure imgf000157_0001
Figure imgf000158_0001
Figure imgf000159_0001
Figure imgf000160_0001
Figure imgf000161_0001

Claims

WHAT IS CLAIMED IS:
1. A recombinant polynucleotide comprising a sequence of at least about 200 nucleotides having greater than 80% homology to a contiguous portion of the HER4 nucleotide sequence depicted in FIG. 1A and 1B or its complement.
2. A recombinant polynucleotide comprising a sequence of nucleotides encoding at least about 70 contiguous amino acids within the HER4 amino acid sequence depicted in FIG. 1A and 1B.
3. A recombinant polynucleotide comprising a contiguous sequence of at least about 200 nucleotides within the HER4 nucleotide coding sequence depicted in FIG. 1A and 1B or its complement.
4. A recombinant polynucleotide comprising the HER4 nucleotide coding sequence depicted in FIG. 1A and 1B or its complement.
5. A recombinant polynucleotide according to claim 1, 2 , 3 , or 4 which is a DNA polynucleotide.
6. A recombinant polynucleotide according to claim 1 , 2 , 3 , or 4 which is a RNA polynucleotide.
7. An assay kit comprising a recombinant
polynucleotide according, to claim 1, 2, 3 , or 4 to which a detectable label has been added.
8. A polymerase chain reaction kit (PCR)
comprising a pair of primers capable of priming cDNA synthesis in a PCR reaction, wherein each primer is a polynucleotide according to claim 5.
9. The PCR kit according to claim 8 further comprising a polynucleotide probe capable of
hybridizing to a region of the HER4 gene between and not including the nucleotide sequences to which the primers hybridize.
10. A polypeptide comprising a sequence of at least about 80 amino acids having greater than 90% identity to a contiguous portion of the HER4 amino acid sequence depicted in FIG. 1A and 1B.
11. A HER4 polypeptide comprising the amino acid sequence depicted in FIG. 1A and 1B from amino acid residues 1 through 1308.
12. A HER4 polypeptide comprising the amino acid sequence depicted in FIG. 1A and 1B from amino acid residues 26 through 1308.
13. A HER4 polypeptide comprising the amino acid sequence depicted in FIG. 1A and 1B from amino acid residues l through 1045.
14. A HER4 polypeptide comprising the amino acid sequence depicted in FIG. 1A and 1B from amino acid residues 26 through 1045.
15. A HER4 polypeptide comprising the amino acid sequence depicted in FIG. 2A and 2B.
16. A HER4 polypeptide comprising the amino acid sequence depicted in FIG. 1A and 1B from amino acid residues 772 through 1308.
17. A HER4 polypeptide comprising the amino acid sequence depicted in FIG. 3.
18. An antibody capable of inhibiting the interaction of a soluble polypeptide and human HER4.
19. An antibody according to claim 18 wherein the soluble polypeptide is a heregulin.
20. An antibody capable of stimulating HER4 tyrosine autophosphorylation.
21. An antibody capable of inducing a HER4-mediated signal in a cell, which signal results in modulation of growth or differentiation of the cell.
22. An antibody capable of inhibiting HepG2 fraction 17-stimulated tyrosine phosphorylation of HER4 expressed in CHO/HER4 21-2 cells as deposited with the ATCC.
23. An antibody which immunoβpecifically binds to human HER4.
24. An antibody according to claim 23 which resides on the cell surface after binding to HER4.
25. An antibody according to claim 23 which is internalized into the cell after binding to HER4.
26. An antibody which immunospecifically binds to human HER4 expressed in CHO/HER4 21-2 cells as deposited with the ATCC.
27. An antibody according to claim 23 which neutralizes HER4 biological activity.
28. An antibody according to claim 23 which is conjugated to a drug or toxin.
29. An antibody according to claim 23 which is radiolabeled.
30. Plasmid pBSHER4Y as deposited with the ATCC.
31. A recombinant vector comprising a nucleotide sequence encoding a polypeptide according to claim 10, 11, 12, 13, 14, 15, 16, or 17.
32. A host cell transfected with a recombinant vector according to claim 31.
33. A recombinant vector comprising a nucleotide sequence encoding a polypeptide according to claim 10,
11, 12, 13, 14, 15, 16, or 17, wherein the coding sequence is operably linked to a control sequence which is capable of directing the expression of the coding sequence in a host cell transfected therewith.
34. A host cell transfected with a recombinant vector according to claim 33.
35. Cell line CHO/HER4 21-2 as deposited with the ATCC.
36. An assay for detecting the presence of a HER4 ligand in a sample comprising:
(a) applying the sample to cells which have been engineered to overexpress HER4; and (b) detecting an ability of the ligand to affect an activity mediated by HER4.
37. The assay according to claim 36, wherein the cells are CHO/HER4 21-2 cells as deposited with the
ATCC.
38. The assay according to claim 36, wherein the activity detected is HER4 tyrosine phosphorylation.
39. The assay according to claim 36, wherein the activity detected is morphologic differentiation.
40. A ligand for HER4 comprising a polypeptide which binds to HER4, stimulates tyrosine
phosphorylation of HER4, and affects a biological activity mediated by HER4.
41. A ligand according to claim 40 which is capable of inducing morphological differentiation when added to cultured MDA-MB-453 cells.
42. A ligand according to claim 40 obtained from cultured HepG2 cell conditioned media.
43. An immunoassay for detecting HER4
comprising:
(a) providing an antibody according to claim 23 or 26;
(b) incubating a biological sample with the antibody under conditions which allow for the binding of the antibody to HER4; and
(c) determining the amount of antibody present as a HER4-antibody complex.
44. A method for the in vivo delivery of a drug or toxin to cells expressing HER4 comprising
conjugating an antibody according to claim 23 or 26, or an active fragment thereof, to the drug or toxin, and delivering the resulting conjugate to an
individual by using a formulation, dose, and route of administration such that the conjugate binds to HER4.
45. A HER4 ligand comprising a polypeptide which is capable of binding to HER4 and activating protein kinase activity.
46. The ligand of claim 40 or claim 45 which is heregulin.
47. The ligand of claim 45 which is p45.
48. An isolated polypeptide of molecular weight 45 kDa as determined by SDS-Page analysis having an N-terminal amino acid sequence Ser-Gly-X-Lys-Pro-X-X- Ala-Ala, wherein said polypeptide is capable of binding to HER4 as expressed in HDA-MB-453 cells.
49. A chimeric polypeptide comprising a HER4 ligand fused to a cytotoxin.
50. A chimeric polypeptide according to claim 49 wherein the HER4 ligand is a heregulin, a functional derivative of a heregulin, or a homolog of a
heregulin, which is capable of binding to and
activating HER4.
51. A chimeric polypeptide according to claim 49 or 50 wherein the heregulin is heregulin-α (HRG-α).
52. A chimeric polypeptide according to claim 49 or 50 wherein the heregulin is heregulin-ß1 (HRG-ß1).
53. A chimeric polypeptide according to claim 49 or 50 wherein the heregulin is heregulin-ß2 (HRG-ß2).
54. A chimeric polypeptide according to claim 53 further comprising the amphiregulin leader peptide at the amino terminus.
55. A chimeric polypeptide according to claim 49 or 50 wherein the heregulin is heregulin-ß3 (HRG-ß3).
56. A chimeric polypeptide according to claim 49, 50, or 54 wherein the cytotoxin is PE40 or a functionally equivalent Pseudomonas arabinosa exotoxin derivative.
57. HAR-TX ß2 having the amino acid sequence depicted in SEQ ID No:42.
58. A recombinant polynucleotide comprising a sequence of nucleotides encoding a chimeric
polypeptide according to claim 49.
59. A recombinant polynucleotide comprising a sequence of nucleotides encoding HAR-TX B2.
60. A recombinant vector comprising the
polynucleotide according to claim 59 under the control of an IPTG-inducible T7-promoter.
61. A monoclonal antibody which competitively inhibits the immunospecific binding of the monoclonal antibody produced by hybridoma cell line 6-4-11 as deposited with the ATCC to its epitope.
62. A monoclonal antibody which competitively inhibits the immunospecific binding of the monoclonal antibody produced by hybridoma cell line 7-142 as deposited with the ATCC to its epitope.
63. Hybridoma cell line 6-4-11 as deposited with the ATCC and assigned accession number HB11715.
64. Hybridoma cell line 7-142 as deposited with the ATCC and assigned accession number HB11716.
65. A method of delivering a molecule to a cell expressing HER4, comprising:
(a) generating a conjugate or a fusion of the molecule and a HER4 ligand; and
(b) contacting the cell with the conjugate or fusion such that it binds to HER4 and is thereby internalized into the cell.
66. A method of delivering a molecule to a cell which expresses HER4, comprising contacting the cell with a conjugate or a fusion of a HER4 ligand and the molecule.
67. The method according to claim 65 or 66 wherein the molecule is a polypeptide.
68. The method according to claim 65 or 66 wherein the molecule is a polynucleotide.
69. The method according to claim 65 or 66 wherein the molecule is a radionuclide.
70. The method according to claim 65 or 66 wherein the molecule is an imaging label.
71. A method of delivering a cytotoxin to the cytoplasm of a cell which expresses HER4, comprising contacting the cell with a conjugate of the cytotoxin and a HER4 ligand, such that the conjugate binds to, activates, and is internalized via HER4.
72. A method of delivering a cytotoxin to the cytoplasm of a cell which expresses HER4, comprising contacting the cell with a chimeric polypeptide comprising a HER4 ligand fused to the cytotoxin, such that the chimeric polypeptide binds to, activates, and is internalized via HER4.
73. The method according to claim 72 wherein the chimeric polypeptide is HAR-TX ß2.
PCT/US1995/013524 1994-10-14 1995-10-10 Her4 human receptor tyrosine kinase or the epidermal growth factor receptor family WO1996012019A2 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
JP8513469A JPH10507362A (en) 1994-10-14 1995-10-10 HER4 human receptor tyrosine kinase
AU39632/95A AU3963295A (en) 1994-10-14 1995-10-10 Her4 human receptor tyrosine kinase
MX9702664A MX9702664A (en) 1994-10-14 1995-10-10 Her4 human receptor tyrosine kinase.
EP95937555A EP0787187A1 (en) 1994-10-14 1995-10-10 Her4 human receptor tyrosine kinase
NO971686A NO971686L (en) 1994-10-14 1997-04-11 HER4-humanreseptortyrosinkinase
FI971532A FI971532A (en) 1994-10-14 1997-04-11 HER4, human receptor tyrosine kinase belonging to the skin growth factor receptor group

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US32344294A 1994-10-14 1994-10-14
US08/323,442 1994-10-14

Publications (3)

Publication Number Publication Date
WO1996012019A2 true WO1996012019A2 (en) 1996-04-25
WO1996012019A9 WO1996012019A9 (en) 1996-07-11
WO1996012019A3 WO1996012019A3 (en) 1996-08-15

Family

ID=23259216

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1995/013524 WO1996012019A2 (en) 1994-10-14 1995-10-10 Her4 human receptor tyrosine kinase or the epidermal growth factor receptor family

Country Status (9)

Country Link
EP (1) EP0787187A1 (en)
JP (1) JPH10507362A (en)
AU (1) AU3963295A (en)
CA (1) CA2202533A1 (en)
FI (1) FI971532A (en)
IL (1) IL115642A0 (en)
MX (1) MX9702664A (en)
NO (1) NO971686L (en)
WO (1) WO1996012019A2 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999019488A1 (en) * 1997-10-15 1999-04-22 Children's Medical Center Corporation Novel human egf receptors and use thereof
WO1999023209A2 (en) * 1997-10-31 1999-05-14 Georgetown University Medical Center ErbB-4 TARGETED RIBOZYMES
US7223393B2 (en) 2003-02-07 2007-05-29 Pdl Biopharma, Inc Amphiregulin antibodies and their use to treat cancer and psoriasis
US8652787B2 (en) 2008-11-12 2014-02-18 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Use of ERBB4 as a prognostic and therapeutic marker for melanoma

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0599274A1 (en) * 1992-11-24 1994-06-01 Bristol-Myers Squibb Company HER4, a human receptor tyrosine kinase of the epidermal growth factor receptor family

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0599274A1 (en) * 1992-11-24 1994-06-01 Bristol-Myers Squibb Company HER4, a human receptor tyrosine kinase of the epidermal growth factor receptor family

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
CANCER RES., vol. 55, 1 January 1995, pages 71-77, XP002004425 KIHARA ET AL.: "Cytotoxic activity of chimeric toxins containg the epidermal growth factor-like domain of heregulins fused to PE38KDEL, a truncated recombinant form of Pseudomonas exotoxin" *
EMBO J., vol. 13, no. 15, 1 August 1994, pages 3517-3523, XP002004422 NAGATA ET AL.: "Solution structure of the epidermal growth factor-like domain of heregulin-alpha, a ligand for p180erbB-4" *
INT. J. CANCER, vol. 60, no. 5, 3 March 1995, pages 730-739, XP000571537 JESCHKE ET AL.: "Targeted inhibition of tumor-cell growth by recombinant heregulin-toxin fusion proteins" *
J. BIOL. CHEM., vol. 268, no. 25, 5 September 1993, pages 18407-18410, XP002004423 CULOUSCOU ET AL.: "Characterization of a breast cancer cell differentiation factor that specifically activates the HER4/p180erbB4 receptor" *
J. BIOL. CHEM., vol. 269, no. 40, 7 October 1994, pages 25226-25233, XP002004421 TZAHAR ET AL.: "ErbB-3 and ErbB-4 function as the respective low and high affinity recpetors of all Neu differentiation factor/heregulin isoforms" *
J. BIOL. CHEM., vol. 270, no. 13, 31 March 1995, pages 7623-7630, XP002004424 SIEGAL, ET AL.: "HER4 expression correlates with cytotoxicity directed by a hergulin-toxin fusion protein" *
PROC. AM. ASSOC. CANCER RES. ANN. MEET., vol. 35, March 1994, page 382 XP002004420 SIEGALL ET AL.: "Activity of HER4 targeted ligand-toxin fusion proteins against human tumors" *
PROC. NATL ACAD. SCI., vol. 90, March 1993, pages 1746-1750, XP002004419 PLOWMAN ET AL.: "Ligand-specific activation of HER4/p180erbB4, a fourth member of the epidermal growth factor receptor family" *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999019488A1 (en) * 1997-10-15 1999-04-22 Children's Medical Center Corporation Novel human egf receptors and use thereof
WO1999023209A2 (en) * 1997-10-31 1999-05-14 Georgetown University Medical Center ErbB-4 TARGETED RIBOZYMES
WO1999023209A3 (en) * 1997-10-31 1999-09-02 Univ Georgetown Med Center ErbB-4 TARGETED RIBOZYMES
US7223393B2 (en) 2003-02-07 2007-05-29 Pdl Biopharma, Inc Amphiregulin antibodies and their use to treat cancer and psoriasis
US8652787B2 (en) 2008-11-12 2014-02-18 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Use of ERBB4 as a prognostic and therapeutic marker for melanoma

Also Published As

Publication number Publication date
CA2202533A1 (en) 1996-04-25
IL115642A0 (en) 1996-01-19
AU3963295A (en) 1996-05-06
JPH10507362A (en) 1998-07-21
NO971686D0 (en) 1997-04-11
MX9702664A (en) 1997-06-28
FI971532A0 (en) 1997-04-11
EP0787187A1 (en) 1997-08-06
NO971686L (en) 1997-06-16
WO1996012019A3 (en) 1996-08-15
FI971532A (en) 1997-06-11

Similar Documents

Publication Publication Date Title
US5811098A (en) Antibodies to HER4, human receptor tyrosine kinase
EP0599274A1 (en) HER4, a human receptor tyrosine kinase of the epidermal growth factor receptor family
US6696290B2 (en) ErbB2 and ErbB4 Chimeric Heteromultimeric Adhesins
US8226935B2 (en) ErbB2 and ErbB3 chimeric heteromultimer receptors
US5916755A (en) Methods of characterizing ligands for the erbB-3 receptor, methods of influencing erbB-3 activities and methods of diagnosing erbB-3-related neoplasm
Modjtahedi et al. The receptor for EGF and its ligands-expression, prognostic value and target for therapy in cancer
US8444990B2 (en) Antibody-induced apoptosis
Schmidt et al. Targeted inhibition of tumour cell growth by a bispecific single-chain toxin containing an antibody domain and TGF α
US20020002276A1 (en) Chimeric heteromultimer adhesins
EP0828843A1 (en) Recombinant heregulins and their biological functions upon receptor activation
WO1996012019A2 (en) Her4 human receptor tyrosine kinase or the epidermal growth factor receptor family
WO1996012019A9 (en) Her4 human receptor tyrosine kinase or the epidermal growth factor receptor family
QIAN et al. Identification of pl85neu sequences required for monoclonal antibody-or ligand-mediated receptor signal attenuation
WO2012048667A1 (en) Epidermal growth factor receptor variant lacking exon

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AU CA FI JP MX NO

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

COP Corrected version of pamphlet

Free format text: PAGES 1-159,DESCRIPTION,AND PAGES 160-168,CLAIMS,REPLACED BY NEW PAGES BEARING THE SAME NUMBER;PAGES 1/33-33/33,DRAWINGS,REPLACED BY NEW PAGES 1/44-44/44;DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: A3

Designated state(s): AU CA FI JP MX NO

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase

Ref document number: 2202533

Country of ref document: CA

Kind code of ref document: A

Ref document number: 2202533

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: PA/a/1997/002664

Country of ref document: MX

Ref document number: 971532

Country of ref document: FI

WWE Wipo information: entry into national phase

Ref document number: 1995937555

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1995937555

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1995937555

Country of ref document: EP