CA2202533A1 - Her4 human receptor tyrosine kinase - Google Patents

Abstract

The molecular cloning, expression, and biological characteristics of a novel receptor tyrosine kinase related to the epidermal growth factor receptor, termed HER4/p180erbB4, are described. An HER4 ligand capable of inducing cellular differentiation of breast cancer cells is also disclosed. In view of the expression of HER4 in several human cancers and in certain tissues of neuronal and muscular origin, various diagnostic and therapeutic uses of HER4derived and HER4-related biological compositions are provided.

Description

CA 02202~33 1997-04-11 WC!~ 96r~20l9 PCT/US9~;/13524 HER4 ~ N R~ 'UK TYR08INE RINASE

This application is a continuation-in-part of United States Application Serial No. 08/150,704, filed November 10, 1993, which is a continuation-in-part of United States Application Serial No. 07/981,165, filed November 24, 1992, each of which applications are incorporated herein in their entireties.

1. Introduction The present invention is generally directed to a novel receptor tyrosine kinase related to the epidermal growth factor receptor, termed HER4/pl80 ("HER4"), and to novel diagnostic and therapeutic 1~ compositions comprising HER4-derived or HER4-related biological components. The invention is based in part upon applicants discovery of human HER4, its complete nucleotide coding sequence, and functional properties of the H~R4 receptor protein. More specifically, the invention is directed to HER4 biologics comprising, for example, polynucleotide molecules encoding HER4, HER4 polypeptides, anti-HE~4 antibodies which recognize epitopes of HER4 polypeptides, ligands which interact with HER4, and diagnostic and therapeutic compositions and methods based fundamentally upon such molecules. In view of the expression of HER4 in several human cancers and in certain tissues of neuronal and muscular origin, the present invention provides a framework upon which effective biological therapies may be designed. The invention is hereinafter described in detail, in part by way of experimental examples specifically illustrating various aspects of the invention and particular embodiments thereof.

.~1 IR.~TITI ITF Rl-IFFT ~RI 11 F

CA 02202~33 1997-04-11 WO 96/12019 PCrlUS95/13S24 Z

2. Background of the Invention Cells of virtually all tissue types express transmembrane receptor molecules with intrinsic tyrosine kinase activity through which various growth and differentiation factors mediate a range of biological effects (reviewed in Aaronson, 1991, Science 254:1146-52). Included in this group of receptor tyrosine kinases (RTKs) are the receptors for polypeptide growth factors such as epidermal growth factor (EGF), insulin, platelet-derived growth factor (PDGF), neurotrophins (i.e., NGF), and fibroblast growth factor (FGF). Recently, the ligands for several previously-characterized receptors have been identified, including ligands for c-kit (steel factor), met ~hepatocyte growth factor), trk (nerve growth factor) (see, respectively, Zsebo et al., 1990, Cell 63:195-201; Bottardo et al ., 1991, Science 251:80Z-04; Kaplan et al., 1991, Nature 350:158-160).
In addition, the soluble factor NDF, or heregulin-alpha (HRG-~), has been identified as the ligand for HER2, a receptor which is highly related to HER4 (Wen et al ., l99Z, Cell 69:559-72; Holmes et al ., 1992, Science 256:1205-10).
The heregulins are a family of molecules that were first isolated as specific ligands for HER2 (Wen, et al ., 1992, Cell, 69:559-572; Holmes et al ., 1992, Science 256:1205-1210; Falls et al ., 1993, Cell 72:801-815; and Marchionni et al ., 1993, Nature 362:312-318). A rat homologue was termed Neu differentiation factor (NDF) based on its ability to induce differentiation of breast cancer cells through its interaction with HERZ/Neu (Wen et al., supra).
Heregulin also appears to play an important role in development and maintenance of the nervous system based on its abundant expression in cells of neuronal SUBSTITUTE SHEET (RULE 26~

CA 02202533 1997-04-ll WO 96tl2019 PCTIUS95/13524

3 --origin and on the recognition that alternatively spli~ed forms of the heregulin gene encode for two recently characterized neurotrophic activities. one r neural-derived factor is termed acetylcholine receptor 5 inducing activity (ARIA)(Falls et al., supra). This heregulin isoform is responsible for stimulation of neurotransmitter receptor synthesis during formation of the neuromuscular junction. A second factor is called glial growth factor (GGF) reflecting the 10 proliferative affect this molecule has on glial cells in the central and peripheral nervous system (Marchionni et al ., supra ) . Additional, less well characterized molecules that appear to be isoforms of heregulin, include p45, gp30, and p75 (Lupu et al., l99o, Science 249:1552-1555; and Lupu et al., 1992, Proc. Natl. Acad. Sci. U.S.A. 89:2287-2291).
Several HER2-neutralizing antibodies fail to block heregulin activation of human breast cancer cells. Heregulin only activates tyrosine phosphorylation of HER2 in cells o~ breast, colon, and neuronal origin, and not in fibroblasts or ovarian cell lines that overexpress recombinant HER2 (Peles et al., 1993, EMBO J. 12:961-971).
Biological relationships between various human malignancies and genetic aberrations in growth factor-receptor tyrosine kinase signal pathways are known to exist. Among the most notable such relationships involve the EGF receptor (EGFR) family of receptor tyrosine kinases (see Aaronson, supra ) . Three human EGFR-family members have been identified and are known to those skilled in the art: EGFR, HER2/p185'r~32 and HER3/p160'r~33 (see, respectively, Ullrich et al., 1984, Nature 309:418-25; Coussens et al ., 1985, Science 230:1132-39; Plowman et al ., 1990, Proc. Natl. Acad.
3s ~IIR~TITlITF ~HFFT (Rlll E 26 CA 02202~33 1997-04-11 WO 96112019 PCI'JUS95113524 Sci. U.S.A. 87:4905-09). EGFR-related molecules from other species have also been identified.
The complete nucleotide coding sequence of other EGFR-family members has also been determined from other organisms including: the drosophila EGFR ("DER":
Livneh et al ., 1985, Cell 40:599-607), nematode EGFR
("let-23": Aroian et al., 1990, Nature 34~:693-698), chicken EGFR ("CER": Lax et al ., 1988, Mol. Cell.
Biol. 8:1970-1978), rat EGFR (Petch et al., 1990, Mol.
Cell. Biol. 10:2973-2982), rat HER2/Neu (Bargmann et al., 1986, Nature, 319:226-230) and a novel member isolated from the fish and termed Xiphophorus melanoma related kinase ("Xmrk": Wittbrodt et al., 1989, Nature 342:415-421). In addition, PCR technology has led to the isolation of other short DNA fragments that may encode novel receptors or may represent species-specific homologs of known receptors. One recent example is the isolation tyro-2 (Lai, C. and Lemke, G., 1991, Neuron 6:691-704) a fragment encoding 54 amino acids that is most related to the EGFR family.
Overexpression of EGFR-family receptors is frequently observed in a variety of aggressive human epithelial carcinomas. In particular, increased expression of EGFR is associated with more aggressive carcinomas of the breast, bladder, lung and stomach (see, for example, Neal et al., 1985, Lancet 1:366-68;
Sainsbury et al., 1987, Lancet 1:1398-1402; Yasui et al., 1988, Int. J. Cancer 41:211-17; Veale et al., 1987, Cancer 55:513-16). In addition, amplification and overexpression of HER2 has been associated with a wide variety of human malignancies, particularly breast and ovarian carcinomas, for which a strong correlation between HER2 overexpression and poor clinical prognosis and/or increased relapse probability have been established (see, for example, SUBSTITUTE SHEET (RULE 26~

Slamon et al., 1987, Science 235:177-82, and 1989, Science 244:707-12). Overexpression of ~ER2 has also been correlated with other human carcinomas, including carcinoma of the stomach, endometrium, salivary gland, bladder, and lung ~Yokota et al., 1986, Lancet 1:765-67; Fukushigi et al ., 1986, Mol. Cell. Biol. 6:955-58;
Yonemura et al., 1991, Cancer Res. 51:1034; Weiner et al., 1990, Cancer Res. 50:421-25; Geurin et al ., 1988, oncoqene Res. 3:21-31; Semba et al., 1985, Proc. Natl.
Acad. Sci. U.S.A. 82:6497-6501; Zhau et al., 1990, Mol. Carcinoa. 3:354-57; McCann et al ., 1990, Cancer 65:88-92). Most recently, a potential link between HER2 overexpression and gastric carcinoma has been reported (Jaehne et al., 1992, J. Cancer Res. Clin.
Oncol. 118:474-79). Finally, amplified expression of the recently described HER3 receptor has been observed in a wide variety of human adenocarcinomas (Poller et al., 1992, J. Path 168:275-280; Krause et al., 1989, Proc. Natl. Acad. Sci. U.S.A. 86:9193-97; European Patent Application No. 91301737, published 9.4.91, EP
444 961).
Several structurally related soluble polypeptides capable of specifically binding to EGFR have been identified and characterized, including EGF, transforming growth factor-alpha (TGF-~), amphiregulin (AR), heparin-binding EGF (HB-EGF), and vaccinia virus growth factor (VGF) (see, respecti~ely, Savage et al., 1972, J. Biol. Chem. 247:7612-21; Marquardt et al ., 1984, Science 223:1079-82; Shoyab et al ., 1989, Science 243:1074-76; Higashiyama et al., 1991, Science 251:936-39; Twardzik et al ., 1985, Proc. Natl. Acad.
Sci. U.S.A. 82:5300-04). Despite the close structural relationships among receptors of the EGFR-family, none of these ligands has been conclusively shown to interact with HER2 or HER3.

~':;1 IR.C,TITI ITF RI~FFT ~RI 11 F

CA 02202~33 1997-04-11 WO 96/12019 PCI~/US9511352'~

Recently, several groups have reported the identification of specific ligands for HER2. Some of these ligands, such as gp30 (Lupu et al., 1990, Science 249:1552-55; Bacus et al., 1992, Cell Growth and Differentiation 3:401-11) interact with both EGFR
and HER2, while others are reported to bind specifically to HER2 (Wen et al., 1992, Cell 69:559-72; Peles et al'., 1992, Cell 69:205-16; Holmes et al., 1992, Science 256:1205-10; Lupu et al., 1992, Proc.
lo Natl. Acad. Sci. U.S.A. 89:2287-91; Huang et al., 1992, J. Biol. Chem. 276:11508-121). The best characterized of these ligands are neu differentiation factor (NDF) purified and cloned from ras-transformed Ratl-EJ cells (Wen et al., Peles et al., supra), and 15 the heregulins (HRG-~ 1, -B2, -~3), purified and cloned from human MDA-MB-231 cells (Holmes et al., supra). NDF and HRG-~ share 93~ sequence identity and appear to be the rat and human homologs of the same protein. Both of these proteins are similar size (44-20 45 kDa), increase tyrosine phosphorylation of HER2 in MDA-MB-453 cells and not the EGF-receptor, and have been reported to bind to HER2 in cross-linking studies on human breast cancer cells. In addition, NDF has been shown to induce differentiation of human m~mrAry 25 tumor cells to milk-producing, growth-arrested cells, whereas the heregulin family have been reported to stimulate proliferation of cultured human breast cancers cell monolayers.
Interestingly, although members of the heregulin 30 family are capable of stimulating tyrosine phosphorylation of HER2 in many mammary carcinoma cell lines, they are not able to act on this receptor in the ovarian carcinoma cell line SKOV3 or in HER2 transfected fibroblasts (Peles et al., 1993, EMB0 J. 4 3~ 12:961-971). These observations indicated the SUBSTITUTE SHEET (RULE 26~

-WO 96tl2019 PCI'JUS95113!j2'1 existence of other receptors for heregulin responsible for the activation of HER2. Such cross-activation between members of the receptor tyrosine kinase family has been already reported and is believed to arise 5 from a ligand induced receptor heterodimerization event (Wada et al., 1990, Cell 61:1339-1347).
Recently, it has been reported that HER3 binds heregulin (Carraway et al., 1994, J. Biol. Chem.
269:14303-14306), and in fact, this receptor seems to 10 be involved in the heregulin-mediated tyrosine kinase activation of HER2 (carraway et al., supra;
Sliwkowski et al ., 1994 , J. Biol. Chem. 269:14661-14665).
The means by which receptor polypeptides 15 transduce regulatory signals in response to ligand binding is not fully understood, and continues to be the subject of intensive investigation. However, important components of the process have been uncovered, including the understanding that 20 phosphorylation of and by cell surface receptors hold fundamental roles in signal transduction. In addition to the involvement of phosphorylation in the signal process, the intracellular phenomena of receptor dimerization and receptor crosstalk function as 25 primary components of the circuit through which ligand binding triggers a resulting cellular response.
Ligand binding to transmembrane receptor tyrosine kinases induces receptor dimerization, leading to activation of kinase function through the interaction 30 of adjacent cytoplasmic domains. Receptor crosstalk refers to intracellular communication between two or more proximate receptor molecules mediated by, for example, activation of one receptor throuyh a ' mechanism involving the kinase activity of the other.
35 one particularly relevant example of such a phenomenon SUB~TlTllTF .SHFFT (RllLE 2~1 CA 02202~33 1997-04-11 is the binding of EGF to the EGFR, resulting in activation of the EGFR kinase domain and cross-phosphorylation of HER2 (Kokai et al., 1989, Cell 58:287-92; Stern et al., 1988, EMBO J. 7:995-1001;
S King et al., 1989, Oncoqene 4:13-18).

3. Summary of the Invention HER4 is the fourth member of the EGFR-family of receptor tyrosine kinases and is likely to be involved not only in regulating normal cellular function but also in the loss of normal growth control associated with certain human cancers. In this connection, HER4 appears to be closely connected with certain carcinomas of epithelial origin, such as adenocarcinoma of the breast. As such, its discovery, and the elucidation of the HER4 coding sequence, open a number of novel approaches to the diagnosis and treatment of human cancers in which the aberrant expression and/or function of this cell surface receptor is involved.
The complete nucleotide sequence encoding the prototype HER4 polypeptide of the invention is disclosed herein, and provides the basis for several general aspects of the invention hereinafter described. Thus, the invention includes embodiments directly involving the production and use of HER4 polynucleotide molecules. In addition, the invention provides HER4 polypeptides, such as the prototype HER4 polypeptide disclosed and characterized in the sections which follow. Polypeptides sharing nearly equivalent structural characteristics with the prototype HER4 molecule are also included within the scope of this invention. Furthermore, the invention includes polypeptides which interact with HER4 expressed on the surface of certain cells thereby SUBSTITUTE SHEET (RULE 26~

-WO 96/12019 PCI~/US9~;/13~2~l g affecting their growth and/or differentiation. The invention is also directed to anti-HER4 antibodies, which have a variety of uses including but not limited to their use as components of novel biological approaches to human cancer diagnosis and therapy provided by the invention.
The invention also relates to the identification of HER4 ligands and methods for their purification.
The invention also relates to the discovery of an apparent functional relationship between HER4 and HER2, and the therapeutic aspects of the invention include those which are based on applicants' preliminary understanding of this relationship.
Applicants' data strongly suggests that HER4 interacts ~5 with HER2 either by heterodimer formation or receptor crosstalk, and that such interaction appears to be one mechanism by which the HER4 receptor mediates effects on cell ~ehavior. The reciprocal consequence is that HER2 activation is in some circumstances mediated through HER4.
In this connection, it appears that although heregulin induces phosphorylation of HER2 in cells expressing HER2 and HER4. Heregulin does not directly stimulate ~ER2 but acts by stimulating tyrosine phosphorylation of HER4.
Recognition of HER4 as a primary component of the heregulin signal transduction pathway opens a number of novel approaches to the diagnosis and treatment of human cancers in which the aberrant expression and/or function of heregulin and/or HER4 are involved. The therapeutic aspects of this invention thus include mediating a ligand's affect on HER4 and HER2 through antagonists, agonists or antibodies to HER4 ligands or HER4 receptor itself.

.~1 IR~iTITI ITF ~I`IFFT lRI 1I F 7fii~

CA 02202~33 1997-04-11 WO96112019 PCT~S95/1352 The invention also relates to chimeric proteins that specifically target and kill HER4 expressing tumor cells, polynucleotides encoding such chimeric proteins, and methods of using both in the therapeutic treatmènt of cancer and other human malignancies.
Applicants' data demonstrate that such recombinant chimeric proteins specifically bind to the HER4 receptor and are cytotoxic against tumor cells that express HER4 on their surface. The bifunctional 1() retention of both the specificity of the cell-binding portion of the molecule and the cytotoxic potential of the toxin portion makes for a very potent and targeted reagent.
The invention further relates to a method 1~ allowing determination of the cytotoxic activity of HER4 directed cytotoxic substances on cancer cells, thereby providing a powerful diagnostic tool; this will be of particular interest for prognosis of the effectiveness of these substances on an individual 2() malignancy prior their therapeutic use.

4. Brief Description of the Figures Figures l/l through l/5. Nucleotide sequence [SEQ ID No:l~ and deduced amino acid sequence of HER4 2~ of the coding sequence from position 34 to 3961 (1308 amino acid residues) [SEQ ID No:2]. Nucleotides are numbered on the left, and amino acids are numbered above the sequence.
Figures 2/l through 2/4. Nucleotide sequence 3() [SEQ ID No:3] and deduced amino acid sequence ([SEQ ID
No:4] of cDNAs encoding HER4 with alternate 3' end and without autophosphorylation domain. This sequence is identical with that of HER4 shown in Figures l/l through l/5 up to nucleotide 3168, where the sequence 3~ diverges and the open reading frame stops after 13 SUBSTITUTE SHEET (RULE 26~

CA 02202~33 lss7-04-ll WO96/1201g PCT~S95fl352 I I
amino acids, followed by an extended, unique 3'-untranslated region.
Figures 3/l through 3/3. Nucleotide sequence [SEQ ID No:5] and deduced amino acid sequence [SEQ ID
No:6] of cDNA encoding HER4 with a N-terminal truncation. This sequence contains the 3'-portion of the HER4 sequence where nucleotide position 156 of the truncated sequence aligns with position 2335 of the complete HER4 sequence shown in Figures 1/1 through 1() l/5 (just downstream from the region encoding the ATP-binding site of the HER4 kinase). The first 155 nucleotides of the truncated sequence are unique from HER4 and may represent the 5'-untranslated region of a transcript derived from a cryptic promoter within an l~ intron of the HER4 gene. (Section 6.2.2., infra).
Figures 4/1, 4/2 and 5. The deduced amino acid sequence of two variant forms of human HER4 aligned with the full length HER4 receptor as represented in Figures 1/1 through 1/5. Sequences are displayed 2() using the single-letter code and are numbered on the right with the comple~e HER4 sequence on top and the variant sequences below. Identical residues are indicated by a colon between the aligned residues.
Figures 4/1 and 4/2. HER4 with alternate 3'-end, lacking an autophosphorylation domain [SEQ ID No. 4].
This sequence is identical with that of HER4, shown in Figures 1/1 through 1/5, up to amino acid 1045, where the sequence diverges and continues for 13 amino acids before reaching a stop codon.
() Figure 5. HER4 with N-terminal truncation [SEQ
ID No. 6]. This sequence is identical to the 3'-portion of the HER4 shown in Figures 1/1 through 1/5 beginning at amino acid 768. (Section 6.2.2., lnfra).
Figures 6/1 and 6/2. Deduced amino acid sequence 3~ of human HER4 and alignment with other human EGFR-R.~TITI ITF ~ FT ~RI 11 F ~

CA 02202~33 lss7-04-ll WO96/12019 PCT~S95/1352 family members (EGFR [SEQ ID No:7]; HER2 [SEQ ID
No:8]; HER3 [SEQ ID No:9]). Sequences are displayed using the single-letter code and are numbered on the left. Identical residues are denoted with dots, gaps are introduced for optimal alignment, cysteine residues are marked with an asterisk, and N-linked glycosylation sites are denoted with a plus (+).
Potential protein kinase C phosphorylation sites are indicated by arrows (HER4 amino acid positions 679, 685, and G99). The predicted ATP-binding site is shown with 4 circled crosses, C-terminal tyrosines are denoted with open triangles, and tyrosines in HER4 that are conserved with the major autophosphorylation sites in the EGFR are indicated with black triangles.
l~ The predicted extracellular domain extends from the boundary of the signal sequence marked by an arrow at position 25, to the hydrophobic transmembrane domain which is overlined from amino acid positions 650 through 675. Various subdomains are labeled on the 2() right: I, II, III, and IV = extracellular subdomains (domains II and IV are cysteine-rich); TM =
transmembrane domain; TK = tyrosine kinase domain.
Domains I, III, TK are boxed.
Figure 7. Hydropathy profile of HER4, aligned 2~ with a comparison of protein domains for HER4 (1308 amino acids), EGFR (1210 amino acids), HER2 (1255 amino acids), and HER3 (134Z amino acids). The signal peptide is represented by a stippled box, the cysteine-rich extracellular subdomains are hatched, 3() the transmembrane domain is filled, and the cytoplasmic tyrosine kinase domain is stippled. The percent amino acid sequence identities between HER4 and other EGFR-family members are indicated. Sig, signal peptide; I, II, III, and IV, extracellular 3~ domains; TM, transmembrane domain; JM, juxtamembrane SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 WO96/12019 PCT~S95113524 domain; CaIn, calcium influx and internalization domain; 3'UTR, 3' untranslated region.
Figures 8A and 8B. Northern blot analysis from human tissues hybridized to HER4 probes. RNA size markers (in kilobases) are shown on the left. Lanes l ; through 8 represent 2 ~g of poly(A)+ mRNA from pancreas, kidney, skeletal muscle, liver, lung, placenta, brain, and heart, respectively. Figure 8A, Northern blot analysis of mRNA from human tissues hybridized to HER4 probes from the 3'-autophosphorylation domain; Figure 8B, Northern blot analysis from human tissues hybridized to HER4 probes from the 5'-extracellular domain (see Section 6.2.3., infra ) .
Figures 9A and sB. Immunoblo~ analysis of recombinant HER4 stably expressed in CHO-KI cells, according to procedure outlined in Section 7.l.3, infra. Membrane preparations from CHO-KI cells expressing recombinant HER4 were separated on 7~ SDS-2() polyacrylamide gels and transferred to nitrocellulose.
In Figure 9A, blots were hybridized with a monoclonal antibody to the C-terminus of HER2 (Ab3, Oncogene Science, Uniondale, NY) that cross-reacts with HER4.
In Figure 9B, blots were hybridized with a sheep 2~ antipeptide polyclonal antibody to a common epitope of HER2 and HER4. Lane l, parental CHO-KI cells; lanes 2 - 4, CHO-KI/HER4 cell clones 6, 21, and 3, respectively. Note the 180 kDa HER4 protein and the 130 kDa cross-reactive species. The size in ,() kilodaltons of prestained high molecular weight markers (BioRad, Richmond, CA) is shown on the left.
~igures lOA through lOD. Specific activation of HER4 tyrosine kinase by a breast cancer differentiation factor (see Section 8., infra) . Four 3~ recombinant cell lines, each of which was engineered r to overexpress a single member of EGFR-family of SUBSTITUTE SHEET ~Rl~LE 26~

CA 02202~33 1997-04-11 WO96/12019 PCT~S95113524 tyrosine kinase receptors (EGFR, HER2, HER3, and HER4), were prepared according to the methods described in Sections 7.1.2 and 8.1., infra. Cells from each of the four recombinant cell lines were stimuiated with various ligand preparations and assayed for receptor tyrosine phosphorylation using the assay described in Section 8.2., infra . Figure lOA, CHO/HER4 #3 cells; Figure lOB, CHO/HER2 cells;
Figure lOC, NRHER5 cells; and Figure lOD, 293/HER3 cells. Cells stimulated with: lane 1, buffer control;
lane 2, 100 ng/ml EGF; lane 3, ZO0 ng/ml amphiregulin;
lane 4, lO ml phenyl, column fraction 17 (Section 9, infra); lane 5, 10 ~1 phenyl column fraction 14 (Section 9., infra , and see description of Figure 11, 1~ below). The size (in kilodaltons) of the prestained molecular weight markers are labeled on the left of each panel. The phosphorylated receptor in each series migrates just below the 221 kDa marker. Bands at the bottom of the gels are extraneous and are due 2() to the reaction of secondary antibodies with the antibodies used in the immunoprecipitation.
Figures llA through llF. Biological and biochemical properties of the MDA-MB-453-cell differentiation activity purified from the conditioned 2~ media of HepG2 cells (Section 9., infra) . Figures llA
and llB show induction of morphologic differentiation.
Conditioned media from HepG2 cells was subjected to ammonium sulfate fractionation, followed by dialysis against PBS. Dilutions of this material were added to 3() MDA-MB-453 monolayer at the indicated protein concentrations. Figure llA, control; Figure llB, 80 ng per well; Figure llC, 2.0 ~g per well; Figure llD, Phenyl-5PW column elution profile monitored at 230 nm absorbance; Figure llE, Stimulation of MDA-MB-SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 WO g6~12019 PCl`lUS9511352'1 453 tyrosine autophosphorylation with the following ligand preparations: None (control with no factor added); TGF-a (50 ng/ml); CM (16-fold concentrated HepG2 ~conditioned medium tested at 2 ~1 and 10 ~1 per well~; fraction (phenyl column fractions 13 to 20, 10 ~1 per well). Figure llF, Densitometry analysis of the phosphorylation signals shown in Figure llE.
Figures 12A and 12B. NDF-induced tyrosine phosphorylation. Figure 12A, MDA-MB-453 cells (lane 1() 1, mock transfected COS cell supernatant; lane 2, NDF
transfected COS cell supernatant); Figure lZB, CHO/HER4 21-2 cells (lanes 1 and 2, mock transfected COS cell supernatant; lanes 3 and 4, NDF transfected COS cell supernatant). See Section 10., infra.
I~ Tyrosine phosphorylation was determined by the tyrosine kinase stimulation assay described in Section 8.2., infra .
Figures 13A and 13B. Regional location of the HER4 gene to human chromosome 2 band q33. Figure 13A, 2() Distribution of 124 sites of hybridization on human chromosomes; Figure 13B, Distribution of autoradiographic grains on diagram of chromosome 2.
Figure 14. Amino acid sequence of HER4-Ig fusion protein [SEQ ID No:10] (Section 5.4., infra).
2~ Figure 15. Recombinant heregulin induces tyrosine phosphorylation of HER4. Tyrosine phosphorylated receptors were detected by Western blotting with an anti-phosphotyrosine Mab. Arrows indicate the HER2 and HER4 proteins. Monolayers of 3() MDA-MB453 or CHO/HER4 cells were incubated with media from COS-1 cells transfected with a rat heregulin expression plasmid (HRG), or with a cDM8 vector control (-). The media was either applied directly (lx) or after concentrating ZO-fold (20x, and vector 3~ control). Solubilized cells were immunoprecipitated with anti-phosphotyrosine Mab. Monolayers of CHO/HER2 cells were incubated as above with transfected Cos-1 cell supernatants or with two stimulatory Mabs to HER2 .~1 IR.~TITI ITF C~IFFT ~Rl 11 F '~

CA 02202~33 lss7-04-ll WO96/12019 PCT~S9S/1352 (Mab 28 and 29). Solubilized cells were immunoprecipitated with anti-HER2 Mab.
Figures 16A through 16C. Expression of recombinant HER2 and HER4 in human CEM cells.
Transfected CEM cells were selected that stably express either HER2, HER4, or both recombinant receptors. In Figure 16A, recombinant HER2 was detected by immunmoprecipitation of cell lysates with anti-HER2 Mab (Ab-2) and Western blotting with another Il) anti-HER2 Mab (Ab-3). In Figure lGB, Recombinant HER4 was detected by immunoprecipitation of 35S-labeled cell lysates with HER4-specific rabbit anti-peptide antisera. In Figure 16C, Three CEM cell lines were selected that express one or both recombinant l~ receptors and aliquots of each were incubated with media control (-), with two HER2-stimulatory Mabs (Mab 28 and 29), or with an isotype matched control Mab (18.4). Solubilized cells were immunoprecipitated with anti-HER2 Mab (Ab-2) and tyrosine phosphorylated 2(~ HER2 was detected by Western blotting with an anti-phosphotyrosine Mab. The size in kilodaltons of prestained high molecular weight markers (Bio-Rad) is shown on the left and arrows indicate the HER2 and HER4 proteins.
2~ Figures 17A through 17C. Heregulin induces tyrosine phosphorylation in CEM cells expressing HER4.
Three CEM cell lines that express either HER2 or HER4 alone (CEM 1-3 and CEM 3-13) or together (CEM 2-9) were incubated with 7x concentrated supernatants from 3() mock-(-) or heregulin-transfected (+) COS-1 cells.
Solubilized cells were immunoprecipitated (IP) with anti-phosphotyrosine Mab (PY20); in Figure 17A, SUBSTITUTE SHEET (RULE 26) CA 02202~33 Isg7-04-ll WOg6/12019 PCT~S9~/13524 HER2-specific anti-HER2 Mab (Ab-2); in Figure 17B, HER4-specific Mab (6-4); in Figure 17C, in each case tyrosine phosphorylated receptors were detected by Western blotting with anti-phosphotyrosine Mab. The size in kilodaltons of prestained molecular weight - markers (BioRad) is shown on the left and arrows indica~e the HER2 and HER4 proteins. HRG, recombinant rat heregulin.
Figure 18. Covalent cross-linking of iodinated 1() heregulin to HER4. l I-heregulin was added to CHO/HER4 or CHO/HER2 cells for 2 h at 4 C. Washed cells were cross-linked with Bs3, lysed, and the proteins separated using 7% PAGE. Labeled bands were detected on the phosphorimager. Molecular weight l~ markers are shown on the left.
Figures l9A through l9D. Purification of p45 from HepG2 conditioned media. Column fractions were tested for their potential to induce differentiation of MDA-MB-453 cells. Active fractions were pooled as 2~ indicated by an horizontal bar. Figure lsA, Concentrated HepG2 conditioned medium was subjected to 50% ammonium sulfate precipitation. Supernatant resulting from this step was subjected to hydrophobic interaction chromatography using phenyl-Sepharose.
2~ Pooled fractions were then loaded on a DEAE-Sepharose column. Figure l9B, the DEAE-Sepharose column flow-through was subjected to CM-Sepharose chromatography.
Figure l9C, Affinity Chromatography of the MDA-MB-453 differentiation factor using heparin-5PW column.
3() Fractions 35-38 eluting around 1.3M NaCl were pooled.
Figure l9D, Size Exclusion chromatography of the differentiation factor. The molecular masses of calibration standards are indicated in kilodaltons.
Figure 20. Aliquots (25 microliter) of the active size exclusion column fractions (30 and 32) were electrophoresed under reducing conditions on a 12 5~ polyacrylamide gel. The gel was silver-stained.

.~1 IR.C.TITI ITF ~I-IFFT ~RI 11 F ~

CA 02202~33 l997-04-ll WO96/12019 PCT~S95/13524 -l8-Molecular masses of Bio-Rad silver stain standards are indicated in kilodaltons.
Figures 21A through 21C. Stimulation of tyrosine phosphorylation by p45. Figure 21A, Size exclusion column fractions were tested on MDA-MB-453 cells for the induction of tyrosine phosphorylation. Cell lysates were then electrophoresed on a 4-lS%
polyacrylamide gel. After transfer to nitrocellulose, proteins were probed with a phosphotyrosine antibody 1() and phosphoproteins detected by chemiluminescence.
The molecular mass of the predominantly phosphorylated protein is indicated. Figure 2lB, the experiments were performed on cells that had been transfected with expression plasmids for either HER4 (CHO/HER4) or HER2 I~ (CHO/HER2). Cell monolayers were incubated in the absence or the presence of p45 (size exclusion column fraction 32, lOO ng/ml). Samples were then processed as indicated in Figure 21A except that a 7.5%
polyacrylamide gel was used to separate the CHO/HER2 2() cell lysates. Figure 21C, CHO/HER2 cells were incubated in the presence or the absence of N29 monoclonal antibody to the extracellular domain of pl85 . Cell lysates were immunoprecipitated with the Ab-3 monoclonal antibody to pl85 2~ Precipitated proteins were subjected to SDS-PAGE, and phosphoproteins were detected as indicated under Section 13.4., supra.
Figures 22A and 22B. Binding and cross-linking of I-p45 to CHO-KI, CHO-HER2 and CHO/HER4 cells.
~) Figure 22A, Scatchard analysis of the binding of 1 I-p45 to CHO/HER4 cells. Increasing concentrations of l25I-p45 were incubated with cell monolayers for 2 h at 4 C. Nonspecific binding was subtracted from all cell-associated radioactivity data values. A
Scatchard plot as well as a saturation curve of the binding data are shown. Figure 22B, Covalent cross- , linking. I-p45 was added to the cells in the presence or absence of an excess of unlabeled p45 for SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 WO96/12019 PCT~S95113~2~1 _19_ 2 h at 4 C. After washing of the cells to remove unbound iodinated material, the cross-linking reagent bis-(sulfosuccinimidyl)-suberate was added to the _ cells for 45 min. at 4 C. Cells were lysed and proteins separated by electrophoresis on a 7.5%
polyacrylamide gel. Molecular masses of protein standards are indicated in kilodaltons. A Molecular Dynamics PhosphoImager was used to visualize the radioactive species.
1~) Figures 23A and 23B. Construction of the HAR-TX
~2 expression plasmid, encoding the hydrophilic leader sequence of amphiregulin (AR), heregulin ~2, and PE40, under control of the IPTG inducible T7 promoter;
Figure 23A, schematic diagram of the expression 1~ plasmid pSE 8.4, encoding HAR-TX ~2; Figure 23B, amino acid sequence of HAR ~2, the ligand portion of HAR-TX ~2, composed of the AR leader sequence and rat heregulin ~2 [SEQ ID No:40].
Figures 24A and 24B. cDNA sequence [SE~ ID
2() No:4l] and deduced amino acid sequence [SEQ ID No:42]
of the chimera HAR-TX ~2, comprising the amphiregulin (AR) leader sequence and the coding sequences of rat heregulin Pseudomonas exotoxin PE40. The linker sequence between the two portions is indicated by a 2~ bar above the sequence, the ligand portion is located at the 5' (N-terminal), the PE40 exotoxin portion is located at the 3' (C-terminal) part of the sequence.
Nucleotides are numbered on the right side, and amino acids are numbered below the sequence.
Figure 25. Purification of the chimeric HAR-TX
b2 protein: shown is a Coomassie brilliant blue stained SDS-PAGE (4-20~) of the different purification steps. Lanes l - 5 have been loaded under reducing conditions. Lane l, MW standards; lane 2, refolded 3~ HAR-TX ~2, 20x concentrated; lane 3, POROS HS flow-through, 20x concentrated; lane 4, POROS HS eluate;

~UBSTITllTE BHEET (RI~LE 26~

CA 02202~33 1997-04-11 WO96112019 PCT~S95/1352 lane 5, Source 15S eluate (pure HAR-TX ~2, 2 ~g); lane 6, 2 ~g HAR-TX ~2, loaded under non-reducing conditions.
~ igure 26. Membrane-based ELISA binding analysis, performed to determine the binding activity of the purified HAR-TX ~2 protein. Binding of HAR-TX
p2 (0) and PE40 (-) to membranes prepared from the HER4 expressing human breast carcinoma cell line.
Figure 27. HAR-TX b~2 induced tyrosine 1~ phosphorylation in transfected CEM cells. CEM cells co-expressing HER4 and HER2 (H2,4), or expressing HER4 (H4), HER2 (H2), HERl (Hl) alone, respectively, were incubated in the presence (+) or absence (-) of HAR-TX
~2, then solubilized, and immunoblotted with the 1~ monoclonal anti-phosphotyrosine antibody PY20. The arrow indicates the phosphorylated receptor band, the molecular weight is indicated in kDA.
Figures 28A and 28B. Cytotoxic effect of HAR-TX
~2 on tumor cell lines. Figure 28A, following 48 2() hours incubation with HAR-TX ~2, the cell killing effect of HAR-TX ~2 on the tumor cell lines LNCaP (-), AU565 (0), SKBR3 (-), and SKOV3 (i-') by quantification of fluorescent calcein cleaved from calcein-AM.
Figure 28B, Competitive cytotoxicity of HAR-TX ~2 with 2~ heregulin ~2-Ig. LNCaP cells were co-incubated with 50 ng/ml HAR-TX ~2 and increasing concentrations (2-5000 ng/ml) of either heregulin ~2-Ig (r~) or LG-Ig (-). The data represent the mean of triplicate assays.
Figure 29. HAR-TX ~2 induced tyrosine 3() phosphorylation in tumor cells expressing HER3 (L2987) or co-expressing HER2 and HER3 (H3396). Cells were incubated in the presence (+) or in the absence (-) of HAR-TX ~2, solubilized, and immunoblotted with the monoclonal anti-phosphotyrosine antibody PY20.

SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 WO 96~12019 P~ ;5113~;2'1 Phosphorylated receptors are indicated by an arrow, the molecular weight is indicated in kDa.

5. Detailed Description of the Invention The present invention is directed to ; HER4/pl80 r B ("HER4"), a closely related yet distinct member of the Human EGF Receptor (HE~)/neu subfamily of receptor tyrosine kinases, as well as HER4-encoding polynucleotides (e.g., cDNAs, genomic DNAs, RNAs, anti-sense RNAs, etc.), the production of mature and precursor forms of HER4 from a HER4 polynucleotide coding sequence, recombinant HER4 expression vectors, HER4 analogues and derivatives, anti-HER4 antibodies, HER4 ligands, and diagnostic and therapeutic uses of 1~ HER4 polynucleotides, polypeptides, ligands, and antibodies in the field of human oncology and neurobiology.
As discussed in section 2, supra, HER2 has been reported to be associated with a wide variety of human 2() malignancies, thus the understanding of its activation mechanisms as well as the identification of molecules involved are of particular clinical interest. This invention uncovers an apparent functional relationship between the HER4 and HER2 receptors involving HER4-2~ mediated phosphorylation of HER2, potentially viaintracellular receptor crosstalk or receptor dimerization. In this connection, the invention also .~1 IR!~;TITI ITF RHFFT rRI 11 E 26~

CA 02202~33 1997-04-11 WO 96/12019 PCI~/US95113524 provides HER4 ligands capable of inducing cellular differentiation in breast carcinoma cells that appears to involve HER4-mediated phosphorylation of HER2.
Furthermore, applicants' data provide evidence that heregulin mediates biological effects on such cells not directly through HER2, as has been reported (Peles et al ., 1992, Cell 69:205-216), but instead by means of a direct interaction with HER4, and/or through an interaction with a HER2/ HER4 complex. In cell lines expressing both HER2 and HER4, binding of heregulin to HER4 may stimulate HER2 either by heterodimer formation of these two related receptors or by intracellular receptor crosstalk.
Recently, also HER3 has been reported to bind heregulin (see Section 2, supra). However, various observations indicate that the heregulin-mediated activation of HER3 varies considerably, depending on the context of expression, suggesting that other cellular components may be involved in the modulation of HER3 activity (reviewed in: Carraway and Cantley, 1994, Cell 78:5-8).
Unless otherwise indicated, the practice of the present invention utilizes standard techniques of molecular biology and molecular cloning, micro~iology, immunology, and recombinant DNA known in the art.
Such techniques are described and explained throughout the literature, and can be found in a number of more comprehensive publications such as, for example, Sambrook et al ., Molecular Cloning; A Laboratory Manual (Second Edition, 1989).

5.1. ~R~ Polynucleotides One aspect of the present invention is directed to HER4 polynucleotides, including recombinant polynucleotides encoding the prototype HER4 SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 WO !~6/12019 PCT/US95113!;2 polypeptide shown in FIG. lA and lB, polynucleotides r which are related or are complementary thereto, and recombinant vectors and cell lines incorporating such recombinant polynucleotides. The term "recombinant 5 polynucleotide" as used herein refers to a polynucleotide of genomic, cDNA, synthetic or semisynthetic origin which, by virtue of its origin or manipulation, is not associated with any portion of the polynucleotide with which it is associated in 10 nature, and may be linked to a polynucleotide other than that to which it is linked in nature, and includes single or double stranded polymers of ribonucleotides, deoxyribonucleotides, nucleotide analogs, or combinations thereof. The term also 15 includes various modifications known in the art, including but not limited to radioactive and chemical labels, methylation, caps, internucleotide modifications such as those with charged linkages (e.g., phosphorothothioates, phosphorodithothioates, 20 etc.) and uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoamidites, carbamites, etc.), as well as those containing pendant moeties, intercalcators, chelators, alkylators, etc.
Related polynucleotides are those having a contiguous 25 stretch of about 200 or more nucleotides and sharing at least about 80% homology to a corresponding sequence of nucleotides within the nucleotide sequence disclosed in FIG. lA and lB. Several particular embodiments o f such HER4 polynucleotides and vectors 30 are provided in example Sections 6 and 7, inf~a.
HER4 polynucleotides may be obtained using a variety of general techniques known in the art, including molecular cloning and chemical synthetic methods. One method by which the molecular cloning of 35 cDNAs encoding the prototype HER4 polypeptide of the RC~TITI ITF ~I-IF~T (Rl 11 F ~

CA 02202~33 1997-04-11 invention (FIG. lA and 1 B), as well as several HER4 polypeptide variants, is described by way of example in Section 6., in f ra . Conserved regions of the sequences of EGFR, HER2, HER3, and Xmrk are used for selection of the degenerate oligonucleotide primers which are then used to isolate HER4. Since many of these sequences have extended regions of amino acid identity, it is difficult to determine if a short PCR
fragment represents a unique molecule or merely the species-specific counterpart of EGFR, HER2, or HER3.
Often the species differences for one protein are as great as the differences within species for two distinct proteins. For example, fish Xmrk has regions of 47/55 (85~) amino acid identity to human EGFR, suggesting it might be the fish EGFR, however isolation of another clone that has an amino acid sequence identical to Xmrk in this region (57/57) shows a much higher homology to human EGFR in its flanking sequence (92% amino acid homology) thereby suggesting that it, and not Xmrk, is the fish EGFR
(Wittbrodt et al., 1989, Nature 342:415-421). As described in Section 6., infra, it was necessary to confirm that a murine HER4/erbB4 PCR fragment was indeed a unique gene, and not the murine homolog of EGFR, HER2, or HER3, by isolating genomic fragments corresponding to murine EGFR, erbB2 and erbB3.
Sequence analysis of these clones confirmed that this fragment was a novel member of the EGFR family.
Notably a region of the murine clone had a stretch of 60/64 amino acid identity to human HER2, but comparison with the amino acid and DNA sequences of the other EGFR homologs from the same species (mouse) firmly established it encoded a novel transcript.
HER4 polynucleotides may be obtained from a variety of cell sources which produce HER4-like SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 WO 96~12019 PCI'IUS9511352 activities and/or which express HER4-encoding mRNA.
In this connection, applicants have identified a number of suitable human cell sources for HER4 ; polynucleotides, including but not limited to brain, cerebellum, pituitary, heart, skeletal muscle, and a variety of breast carcinoma cell lines (see Section

6., infra).
For example, polynucleotides encoding HER4 polypeptides may be o~tained by cDNA cloning from RNA
lo isolated and purified from such cell sources or by genomic cloning. Either cDNA or genomic libraries of clones may be prepared using techniques well known in the art and may be screened for particular HER4-encoding DNAs with nucleotide probes which are substantially complementary to any portion of the HER4 gene. Various PCR cloning techniques may also be used to obtain the HER4 polynucleotides of the invention.
A number of PCR cloning protocols suitable for the isolation of HER4 polynucleotides have been reported in the literature (see, for example, PCR Protocols: A
Guide to Methods and APplications, Eds. Inis et al., Academic Press, 1990).
For the construction of expression vectors, polynucleotides containing the entire coding region of the desired H~R4 may be isolated as full length clones or prepared by splicing two or more polynucleotides together. Alternatively, HER4-encoding DNAs may be synthesized in whole or in part by chemical synthesis using techniques standard in the art. Due to the inherent degeneracy of nucleotide coding sequences, any polynucleotide encoding the desired HER4 polypeptide may be used for recombinant expression.
Thus, for example, the nucleotide sequence encoding the prototype HER4 of the invention provided in FIG.
3s SUBSTITUTE SHEET (RULE 26 =
CA 02202~33 1997-04-11 WO 96112019 PCI'/US95/13524 lA and lB may be altered by substitu~ing nucleotides such that the same HER4 product is obtained.
The invention also provides a number of useful applications of the HER4 polynucleotides of the S invention, including but not limited to their use in the preparation of HER4 expression vectors, primers and probes to detect and/or clone HER4, and diagnostic reagents. Diagnostics based upon HER4 polynucleotides include various hybridization and PCR assays known in the art, utilizing HER4 polynucleotides as primers or probes, as appropriate. One particular aspect of the invention relates to a PCR kit comprising a pair of primers capable of priming cDNA synthesis in a PCR
reaction, wherein each of the primers is a HER4 polynucleotide of the invention. Such a kit may be useful in the diagnosis of certain human cancers which are characterized by aberrant HER4 expression. For example, certain human carcinomas may overexpress HER4 relative to their normal cell counterparts, such as human carcinomas of the breast. Thus, detection of HER4 overexpression mRNA in breast tissue may be an indication of neoplasia. In another, related embodiment, human carcinomas characterized by overexpression of HER2 and expression or overexpression of HER4 may be diagnosed by a polynucleotide-based assay kit capable of detecting both HER2 and HER4 mRNAs, such a kit comprising, for example, a set of PCR primer pairs derived from divergent sequences in the HER2 and HER4 genes, respectively.

5.2. HER4 Polypeptides Another aspect of the invention is directed to HER4 polypeptides, including the prototype HER4 polypeptide provided herein, as well as polypeptides SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 WO96112019 PCT~S95/13~2 derived from or having su~stantial homology to the amino acid sequence of the prototype HER4 molecule.
The term "polypeptide~ in this context refers to a r polypeptide prepared by synthetic or recom~inant 5 means, or which is isolated from na~ural sources. The term "substantially homologous~ in this context refers to polypeptides of about 80 or more amino acids sharing greater than about 90% amino acid homology to a corresponding contiguous amino acid sequence in the lO prototype HER4 primary structure (FIG. lA and lB).
The term "prototype HER4" refers to a polypeptide having the amino acid sequence of precursor or mature HER4 as provided in FIG. lA and lB, which is encoded by the consensus cDNA nucleotide sequence also 15 provided therein, or by any polynucleotide sequence which encodes the same amino acid sequence.
HER4 polypeptides of the invention may contain deletions, additions or substitutions of amino acid residues relative to the sequence of the prototype 20 HE~4 depicted in FIG. lA and lB which result in silent changes thus producing a bioactive product. Such amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or the amphipathic 25 nature of the resides involved. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; amino acids with uncharged polar head groups or nonpolar head groups 30 having similar hydrophilicity values include the following: leucine, isoleucine, valine; glycine, alanine; asparagine, glutamine; serine, threonine;
phenylalanine, tyrosine.
The HER4 polypeptide depicted in FIG. lA and lB
35 has all of the fundamental structural features ~IIR~TITIITF~FFTrRIIIE26~

CA 02202~33 1997-04-11 WO 96112019 PCI~/US9511352'1 characterizing the EGFR-family of receptor tyrosine kinases (Hanks et al., 1988, Science 241:42-S2). The precursor contains a single hydrophobic stretch of 26 amino acids characteristic of a transmembrane region that bisects the protein into a 625 amino acid extracellular ligand binding domain, and a 633 amino acid C-terminal cytoplasmic domain. The ligand binding domain can be further divided into 4 subdomains (I - IV), including two cysteine-rich regions (II, residues 186-334; and IV, residues 496-633), and two flanking domains (I, residues 29-185;
and III, residues 335-495) that may define specificity for ligand binding (Lax et al., 1988, Mol. Cell. Biol.
8:1970-78). The extracellular domain of HER4 is most lS similar to HER3, where domains II-IV of HER4 share 56-67% identity to the respective domains of HER3. In contrast, the same regions of EGFR and HER2 exhibit 43-51~ and 34-46% homology to HER4, respectively (FIG.
6A and 6B). The 4 extracellular subdomains of EGFR
and HER2 share 39-50% identity. HER4 also conserves all 50 cysteines present in the extracellular portion of EGFR, HER2, and HER3, except that the HER2 protein lacks the fourth cysteine in domain IV. There are 11 potential N-linked glycosylation sites in HER4, conserving 4 of 12 potential sites in EGFR, 3 of 8 sites in HER2, and 4 of 10 sites in HER3.
Following the transmembrane domain of HER4 is a cytoplasmic juxtamembrane region of 37 amino acids.
This region shares the highest degree of homology with EGFR (73% amino acid identity) and contains two consensus protein kinase C phosphorylation sites at amino acid residue numbers 679 (serine) and 699 tThreonine) in the FIG. lA and lB sequence, the latter of which is present in EGFR and HER2. Notably, HER4 lacks a site analogous to Thr654 of EGFR.

SUBSTITUTE SHEET (RULE 26~

wa 96112019 PCT~S95/13~2 Phosphorylation of this residue in the EGFR appears to block ligand-induced internalization and plays an important role in its transmembrane signaling (Livneh r et al ., 1988, Mol. Cell. Biol. 8 : 2302-08) . HER4 also contains Thr692 analogous to Thr694 of HER2. This threonine is absent in EGFR and HER3 and has been proposed to impart cell-type specificity to the mitogenic and transforming activity of the HER2 kinase (DiFiore et al . 1992, EMBO J. 11: 3927-33) . The juxtamembrane region of HER4 also contains a MAP
kinase consensus phosphorylation site at amino acid number 699 (Threonine), in a position homologous to Thr699 of EGFR which is phosphorylated by MAP kinase in response to EGF stimulation (Takishima et 21., 1991, Proc. Natl. Acad. Sci. U.S.A. 88:2520-25).
The remaining cytoplasmic portion of HER4 consists of a 276 amino acid tyrosine kinase domain, an acidic helical structure of 38 amino acids that is homologous to a domain required for ligand-induced 20 internalization of the EGFR (Chen et al., 1989, Cell S9:33-43), and a 282 amino acid region containing 18 tyrosine residues characteristic of the autophosphorylation domains of other EGFR-related proteins (FIG. 6A and 6B). The 276 amino acid tyrosine kinase domain conserves all the diagnostic structural motifs of a tyrosine kinase, and is most related to the catalytic domains of EGFR (79%
identity) and HER2 (77% identity), and to a lesser degree, HER3 (63% identity). In this same region, EGFR and HER2 share 83% identity. Examples of the various conserved structural motifs include the - following: the ATP-binding motif (GXGXXG) [SEQ ID
No:11] with a distal lysine residue that is predicted to be involved in the phosphotransfer reaction (Hanks 35 et al., 198, Science 241:42-52; Hunter and Cooper, in .~1 IR~TITI ITF ~F!FFT ~RULE 261 CA 02202~33 1997-04-11 WO 96/12019 PCrrUS9511352 The Enzymes Vol. 17 (eds. Boyer and Krebs) pp. 191-246 (Academic Press 1986)); tyrosine-kinase specific signature sequences (DLAARN [SEQ ID No:12] and PIKWMA
[SEQ ID No:13~) and Tyr875 (FIG. 6A and 6B), a residue that frequently serves as an autophosphorylation site in many tyrosine kinases (Hunter and Cooper, supra);
and approximately 15 residues that are either highly or completely conserved among all known protein kinases (Plowman et al., 1990, Proc. Natl. Acad. Sci.
lo U.S.A. 87:4905-09; Hanks et al ., supra) . The C-terminal 282 amino acids of HER4 has limited homology with HER2 (27%) and EGFR (19%). However, the C-terminal domain of each EGFR-family receptor is proline-rich and conserves stretches of 2-7 amino acids that are generally centered around a tyrosine residue. These residues include the major tyrosine autophosphorylation sites of EGFR at TyrlO68, TyrlO86, Tyrll48, and Tyrll73 (FIG. 6A and 6B, filled triangles; Margolis et al., 1989, J. Biol. Chem.
264:10667-71).

5.3. ~ecombinant Syntheqi~ of ~BR4 Polypeptides The HER4 polypeptides of the invention may be produced by the cloning and expression of DNA encoding the desired HER4 polypeptide. Such DNA may be ligated into a number of expression vectors well known in the art and suitable for use in a number of acceptable host organisms, in fused or mature form, and may contain a signal sequence to permit secretion. Both prokaryotic and eukaryotic host expression systems may be employed in the production of recombinant HER4 polypeptides. For example, the prototype HER4 precursor coding sequence or its functional equivalent may be used in a host cell capable of processing the precursor correctly. Alternatively, the coding SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 WOg6/lZOl9 PCT~S95113~24 seq~ence for mature HER4 may be used to directly express the mature HER4 molecule. Functional equivalents of the HER4 precursor coding sequence include any DNA sequence which, when expressed inside the appropriate host cell, is capable of directing the synthesis, processing and/or export of HER4.
Production of a HER4 polypeptide using recom~inant DNA technology may be divided into a four-step process for the purposes of description: (l) isolation or generation of DNA encoding the desired HER4 polypeptide; (2) construction of an expression vector capable of directing the synthesis of the desired HER4 polypeptide; (3) transfection or transformation of appropriate host cells capable of l~ replicating and expressing the HER4 coding sequence and/or processing the initial product to produce the desired HER4 polypeptide; and (4) identification and purification of the desired HER4 product.

5.3.l. Isolation or Generation of HER4 Encoding DNA
HER4-encoding DNA, or functional equivalents thereof, may be used to construct recombinant expression vectors which will direct the expression of the desired HER4 polypeptide product. In a specific embodiment, DNA encoding the prototype HER4 polypeptide (FIG. lA and lB), or fragments or functional equivalents thereof, may be used to generate the recombinant molecules which will direct the expression of the recombinant HER4 product in appropriate host cells. HER4-encoding nucleotide sequences may be obtained from a variety of cell sources which produce HER4-like activities and/or which express HER4-encoding m~NA. For example, HER4-encoding cDNAs may be obtained from the breastadenocarcinoma cell line MDA-MB-4s3 (ATCC HTBl31) as ~ ~R.C:TlTl ITF RHFFT (Rl ~I F 2~;1 CA 02202~33 1997-04-11 WO 96/12019 PCI~/US95/13524 described in Section 6., infra . In addition, a number of human cell sources are suitable for obtaining HER4 cDNAs, including but not limited to various epidermoid and breast carcinoma cells, and normal heart, kidney, and brain cells (see Section 6.2.3., infra) .
The HER4 coding sequence may be obtained by molecular cloning from RNA isolated and purified from such cell sources or by genomic cloning. Either cDNA
or genomic libraries of clones may be prepared using techniques well known in the art and may be screened for particular HER4-encoding DNAs with nucleotide probes which are substantially complementary to any portion of the HER4 gene. Alternatively, cDNA or genomic DNA may be used as templates for PCR cloning with suita~le oligonucleotide primers. Full length clones, i.e., those containing the entire coding region of the desired HER4 may be selected for constructing expression vectors, or overlapping cDNAs can be ligated together to form a complete coding sequence. Alternatively, HER4-encoding DNAs may be synthesized in whole or in part by chemical synthesis using techniques standard in the art.

5.3.2. Construction of ~ER4 Espression Vectors Various expression vector/host systems may be utilized e~ually well by those skilled in the art for the recombinant expression of HER4 polypeptides. Such systems include but are not limited to microorganisms such as bacteria transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA
expression vectors containing the desired HE~4 coding sequence; yeast transformed with recombinant yeast expression vectors containing the desired HER4 coding r sequence; insect cell systems infected with recombinant virus expression vectors (e.g., SUBSTITUTE SHEET (RULE 26~

WO 96/12019 PCI~/US9~;113~24 baculovirus) containing the desired HER4 coding sequence; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e . g ., Ti plasmid) containing the desired HER4 coding sequence;
or animal cell systems infected with recombinant virus expression vectors (e.g., adenovirus, vaccinia virus) including cell lines engineered to contain multiple copies of the H~R4 DNA either stably amplified (e.g., CHO/dhfr, CH0/glutamine synthetase) or unstably amplified in double-minute chromosomes (e.g., murine cell lines).
The expression elements of these vectors vary in their strength and specificities. Depending on the host/vector system utilized, any one of a number of suitable transcription and translation elements may be used. For instance, when cloning in ~r~ lian cell systems, promoters isolated from the genome of mammalian cells, (e.g., mouse metallothionein promoter) or from viruses that grow in these cells, (e.g., vaccinia virus 7.5K promoter or Moloney murine sarcoma virus long terminal repeat) may be used.
Promoters produced by recombinant DNA or synthetic techniques may also be used to provide for transcription of the inserted sequences.
Specific initiation signals are also required for sufficient translation of inserted protein coding sequences. These signals include the ATG initiation codon and adjacent sequences. In cases where the entire HER4 gene including its own initiation codon - and adjacent sequences are inserted into the appropriate expression vectors, no additional translational control signals may be needed. However, in cases where only a portion of the coding sequence ~ 1 IR~;TITI ITF ~1 IFFT ~RI 11 E 26~

CA 02202~33 1997-04-11 WO 96112019 PCI'IUS9S11352~1 is inserted, exogenous translational control signals, including the ATG initiation codon must be provided.
Furthermore, the initiation codon must be in phase with the reading frame of the H~R4 coding sequences to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of transcription attenuation sequences, enhancer elements, etc.
For example, in cases where an adenovirus is used as a vector for driving expression in infected cells, the desired HER4 coding sequence may be ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence. This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g., region E3 or E4) will result in a recombinant virus that is viable and capable of expressing HER4 in infected hosts. Similarly, the vaccinia 7.5K promoter may be used. An alternative expression system which could be used to express HER4 is an insect system. In one such system, Autographa californica nuclear polyhidrosis virus (AcNPV) is used as a vector to express foreign genes. The virus grows in Spodoptera frugiperda cells. The HER4 coding sequence may be cloned into non-essential regions (for example the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (for example the polyhedrin promoter). Successful insertion of the HER4 coding sequence will result in inactivation of the polyhedrin gene and production of non-occluded recombinant virus (i.e., virus lacking the proteinaceous coat encoded by the polyhedrin gene).

SUBSTITUTE SHEET (RULE 26~

WO96tl2019 PCTNS95/1352 - ~5 -These recombinant viruses are then used to infect Spodoptera frugiperda cells in which the inserted gene is expressed. Yet another approach uses retroviral vectors prepared in amphotropic packaging cell lines, 5 which permit high efficiency expression in numerous cells types. This method allows one to assess cell-type specific processing, regulation or function of the inserted protein coding se~uence.
In addition, a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Expression from certain promoters can be elevated in the presence of certain inducers (e.g., zinc and cadmium ions for lS metallothionein promoters). Therefore, expression of the recombinant HER4 polypeptide may be controlled.
This is important if the protein product of the cloned foreign gene is lethal to host cells. Furthermore, modifications (e.g., phosphorylation) and processing (e.g., cleavage) of protein products are important for the function of the protein. Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of protein. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed.

5.3.3. Transformants Expressing ~ER~ Gene Products The host cells which contain the recombinant coding sequence and which express the desired ~ER4 polypeptide product may be identified by at least four general approaches (a) DNA-DNA, DNA-~NA or RNA-antisense RNA hybridization; (b) the presence or absence of "mar~er" gene functions; (c) assessing the level of transcription as measured by the expression ~IIR.'~TITllTFRHFFT(RllLE26~

CA 02202~33 1997-04-11 WO 96/12019 PCI~/US95/13~i2 1 of HER4 mRNA transcripts in the host cell; and (d) detection of the HER4 product as measured by immunoassay and, ultimately, by its biological activities.
In the first approach, for example, the presence of HER4 coding sequences inserted into expression vectors can be detected by DNA-DNA hybridization using hybridization probes and/or primers for PCR reactions comprising polynucleotides that are homologous to the HER4 coding sequence.
In the second approach, the recombinant expression vec~or/host system can be identified and selected based upon the presence or absence of certain "marker" gene functions (e.g., thymidine kinase activity, resistance to antibiotics, resistance to methotrexate (MTX), resistance to methionine sulfoximine (MSX), transformation phenotype, occlusion body formation in baculovirus, etc.). For example, if the HER4 coding sequence is inserted within a marker gene sequence of the vector, recombinants containing that coding sequence can be identified by the absence of the marker gene function. Alternatively, a marker gene can be placed in tandem with the HER4 sequence under the control of the same or different promoter used to control the expression of the HER4 coding sequence. Expression of the marker in response to induction or selection indicates expression of the HER4 coding sequence. In a particular embodiment described by way of example herein, a HER4 expression vector incorporating glutamine synthetase as a selectable marker is constructed, used to transfect CHO cells, and amplified expression of HER4 in CHO
cells is obtained by selection with increasing concentration of MSX.

SUBSTITUTE SHEET (RULE 26~ -CA 02202~33 1997-04-11 WO 96/12019 PCI'IUS9511352 In the third approach, transcriptional activity for the HER4 coding region can be assessed by hybridization assays. For example, polyadenylated RNA
can be isolated and analyzed ~y Northern blot using a probe homologous to the HER4 coding sequence or particular portions thereof. Alternatively, total nucleic acids of the host cell may be extracted and assayed for hybridization to such probes.
In the fourth approach, the expression of HER4 can be assessed immunologically, for example by Western blots, immunoassays such as radioimmunoprecipitation, enzyme-linked immunoasSays and the like. Alternatively, expression of HER4 may be assessed by detecting a biologically active product. Where the host cell secretes the gene product the cell free media obtained from the cultured transfectant host cell may be assayed for HER4 activity. Where the gene product is not secreted, cell lysates may be assayed for such activity. In either case, assays which measure ligand binding to HER4, HER4 phosphorylation, or other ~ioactivities of HER4 may be used.

5.4. Anti-HER4 Antibodies The invention is also directed to polyclonal and monoclonal antibodies which recognize epitopes of HER4 polypeptides. Anti-HER4 antibodies are expected to have a variety of useful applications in the field of oncology, several of which are described generally below. More detailed and specific descriptions of various uses for anti-HER4 antibodies are provided in the sections and subsections which follow. Briefly, anti-HER4 antibodies may be used for the detection and quantification of HER4 polypeptide expression in cultured cells, tissue samples, and in vivo. Such lCTITI IT~ T IRI 11 F l;)Fi~

CA 02202~33 1997-04-11 WO 96/12019 PCI~/US9!j/1352 immunological detection of HER4 may be used, for example, to identify, monitor, and assist in the prognosis of neoplasms characterized by aberrant or attenuated HER4 expression and/or function.
Additionally, monoclonal antibodies recognizing epitopes from different parts of the HER4 structure may be used to detect and/or distinguish between native HER4 and various subcomponent and/or mutant forms of the molecule. Anti-HER4 antibody preparations are also envisioned as useful biomodulatory agents capable of effectively treating particular human cancers. In addition to the various diagnostic and therapeutic utilities of anti-HER4 antibodies, a number of industrial and research applications will be obvious to those skilled in the art, including, for example, the use of anti-HER4 antibodies as affinity reagents for the purification of HER4 polypeptides, and as immunological probes for elucidating the biosynthesis, metabolism and biological functions of HER4.
Anti-HER4 antibodies may be useful for influencing cell functions and behaviors which are directly or indirectly mediated by HER4. As an example, modulation of HER4 biological activity with anti-HER4 antibodies may influence HER2 activation and, as a consequence, modulate intracellular signals generated by HER2. In this regard, anti-HER4 antibodies may be useful to effectively block ligand-induced, HER4-mediated activation of HER2, thereby affecting HER2 biological activity. Conversely, anti-HER4 antibodies capable of acting as HER4 ligands may be used to trigger HER4 biological activity and/or initiate a ligand-induced, HER4-mediated effect on HER2 biological activity, resulting in a cellular SUBSTITUTE SHEET (RULE 26~

-WO S~i/12019 PCI'I~JS95113524 response such as differentiation, growth inhibition, etc.
Additionally, anti-HER4 antibodies conjugated to ; cytotoxic compounds may be used to selectively target such compounds to tumor cells expressing ~ER4, resulting in tumor cell death and reduction or eradication of the tumor. In a particular embodiment, toxin-conjugated antibodies having the capacity to bind to HER4 and internalize into such cells are administered systemically for targeted cytotoxic effect. The preparation and use of radionuclide and toxin conjugated anti-HER4 antibodies are further described in Section 5.5., infra.
Overexpression of HER2 is associated with several human cancers. Applicants' data indicate that HER4 is expressed in certain human carcinomas in which HER2 overexpression is present. Therefore, anti-HER4 antibodies may have growth and differentiation regulatory effects on cells which overexpress HER2 in zO com~ination with HER4 expression, including but not limited to breast adenocarcinoma cells. Accordingly, this invention includes antibodies capable of binding to the HER4 receptor and modulating HER2 or HER2-HER4 functionality, thereby affecting a response in the target cell. For the treatment of cancers involving HER4-mediated regulation of HER2 biological activity, agents capable of selectively and specifically affecting the intracellular molecular interaction between these two receptors may be conjugated to internalizing anti-HER4 antibodies. The specificity of such agents may result in biological effects only in cells which co-express HER2 and HER4, such as breast cancer cells.
Various procedures known in the art may be used for the production of polyclonal antibodies to ~iIIR.C;TITlITF ~iHFFT rRllLE 26~

CA 02202~33 1997-04-11 WO 96/12019 PCI'/US9511352 epitopes of HER4. For the production of polyclonal antibodies, a number of host animals are acceptable for the generation of anti-~ER4 antibodies by immunization with one or more injections of a HER4 polypeptide preparation, including but not limited to rabbits, mice, rats, etc. Various adjuvants may be used to increase the immunological response in the host animal, depending on the host species, including but not limited to Freund~s (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, oil emulsions, keyhole lympet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum.
A monoclonal antibody to an epitope of HER4 may be prepared by using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include but are not limited to the hybridoma technique originally described by Kohler and Milstein (1975, Nature 256, 495-497), and the more recent human B-cell hybridoma technique (Kosbor et al ., 1983, ImmunoloqY TodaY 4:72) and EBV-hybridoma technique (Cole et al., 1985, Monoclonal Antibodies and Cancer Therapy, Alan R.
Liss, Inc., pp. 77-96). In addition, techniques developed for the production of ~chimeric antibodies"
by splicing the genes from a mouse antibody molecule of appropriate antigen specificity together with genes from a human antibody molecule of appropriate biological activity may be used (Morrison et al., 1984, Proc. Natl. Acad. Sci., 81:6851-6855; Neuberger et al., 1984, Nature, 312:604-608; Takeda et al., 1985, Nature, 314:452-454). Alternatively, techniques described for the production of single chain SUBSTITUTE SHEET (RULE 26~

WO96/12019 PCT~S95tl3524 antibodies (U.S. Patent ~,946,778) can be adapted to produce HER4-specific single chain antibodies.
Recombinant human or humanized versions of anti-HER4 monoclonal antibodies are a preferred embodiment for human therapeutic applications. Humanized antibodies may be prepared according to procedures in the literature (e.g., Jones et al., 1986, Nature 321:522-25; Reichman et al., 1988, Nature 332:323-27;
Verhoeyen et al., 1988, Science 239:1534-36). The recently described "gene conversion mutagenesis"
strategy for the production of humanized anti-HER2 monoclonal antibody may also be employed in the production of humanized anti-HER4 antibodies (Carter et al., 1992, Proc. Natl. Acad. Sci. U.S.A. 89:4285-89). Alternatively, techniques for generating a recombinant phage library of random com~inations of heavy and light regions may be used to prepare recombinant anti-HER4 antibodies (e . g ., Huse et al ., 1989, Science 246:1275-81).
As an example, anti-HER4 monoclonal antibodies may be generated by immunization of mice with cells selectively overexpressing HER4 (e.g., CH0/HER4 21-2 cells as deposited with the ATCC) or with partially purified recombinant HER4 polypeptides. In one 2S embodiment, the full length HER4 polypeptide (FIG. lA
and lB) may be expressed in Baculovirus systems, and membrane fractions of the recombinant cells used to immunize mice. Hybridomas are then screened on CHOtHER4 cells (e.g., CH0 HER4 21-2 cells as deposited 30 with the ATCC) to identify monoclonal antibodies reactive with the extracellular domain of HER4. Such r monoclonal antibodies may be evaluated for their ability to block NDF, or HepG2-differentiating factor, binding to HER4; for their ability to bind and stay 35 resident on the cell surface, or to internalize into .~IIR.~TITIITF~HFFTrRULE261 CA 02202~33 1997-04-11 WO 96/12019 PCI'IIJS9511352 1 cells expressing HER4; and for their ability to directly upregulate or downregulate HER4 tyrosine autophosphorylation and/or to directly induce a HER4-mediated signal resulting in modulation of cell growth or differentiation. In this connection, monoclonal antibodies N28 and N29, directed to HER2, specifically bind HER2 with high affinity. However, monoclonal N29 binding results in receptor internalization and downregulation, morphologic differentiation, and inhibition of HER2 expressing tumor cells in athymic mice. In contrast, monoclonal N28 binding to HER2 expressing cells results in stimulation of autophosphorylation, and an acceleration of tumor cell growth both in vitro and in vivo (Bacus et al., 1992, Cancer Res. 52:2580-89; Stancovski et al., 1991, Proc.
Natl. Acad. Sci. U.S.A. 88:8691-95). In yet another embodiment, a soluble recombinant HER4-Immunoglobulin (~ER4-Ig) fusion protein is expressed and purified on a Protein A affinity column. The amino acid sequence of one such HER4-Ig fusion protein is provided in FIG.
14. The soluble HER4-Ig fusion protein may then be used to screen phage libraries designed so that all available combinations of a variable domain of the antibody binding site are presented on the surfaces of the phages in the library. Recombinant anti-HER4 antibodies may be propagated from phage which specifically recognize the HER4-Ig fusion protein.
Antibody fragments which contain the idiotype of the molecule may be generated by known techniques.
For example, such fragments include but are not limited to: the F(ab)~E2 fragment which can be produced by pepsin digestion of the intact antibody molecule; the Fab' fragments which can be generated by reducing the disulfide bridges of the F(ab')2 fragment, and the two Fab fragments which can be SUBSTITUTE SHEET (RULE 26~
-WO96/12019 PCT~S95113~21 generated by treating the antibody molecule with papain and a reducing agent. Alternatively, Fab expression libraries may be constructed (Huse et al., 1989, Science, 246:1275-1281) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity to HER4 protein.

5.5. HER4 ~igands one aspect of the present invention is directed to HER4 ligands. As defined herein, HE~4 ligands are capable of binding to the 180K transmembrane protein, ~ER4/pl80'rb~4 or functional analogues thereof, and activating tyrosine kinase activity. Functional analogues of HER4/pl80~r~a4-ligands are capable of lS activating HER4 tyrosine kinase activity. Activation of the tyrosine kinase activity may stimulate autophosphorylation and may affect a biological activity mediated by HER4. It has been observed in systems described in Section 12 and 13 that binding of HER4 ligands to HER4 triggers tyrosine phosphorylation and affects differentiation of breast cancer cells.
The HER4 ligands of the present invention include NDF, a 44 kDa glycoprotein isolated from ras-transformed rat fibroblasts (Wen et al., 1992, Cell 2s 69:559-572); heregulin, its human homologue, which exists as multiple isoforms (Peles et al., 1992, Cell 69:205-218 and Holmes et al ., 1992, Science 256:1205-1210) including p45, a 45K heparin-binding glycoprotein that shares several features with the heregulin-family of proteins including molecular weight, ability to induce differentiation of breast cancer cells, activation of tyrosine phosphorylation in MDA-MB453 cells, and N-terminal amino acid sequence (Section 13, infra), gp30, and p75 (LupU et al., 1990, .~1 lR~iTlTI ITF ~HFFT ~Rl 11 F 7~i~

CA 02202~33 1997-04-11 WO 96/12019 PCI~/US95/1352 1 Science 249:1552-1555 and Lupu et al ., 1992, Proc.
Natl. Acad. Sci. USA 89:2287-2291).
HE~4 ligands of the present invention can be prepared by synthetic or recombinant means, or can be isolated from natural sources. The HER4 ligand of the present invention may contain deletions, additions or substitutions of amino acid residues relative to the sequence of NDF, p45 or other heregulins or any HER4 ligand known in the art as long as the ligand lo maintains HER4 receptor binding and tyrosine kinase activation capacity. Such amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydropho~icity, hydrophilicity and/or the amphipathic nature of the resides involved.
For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; amino acids with uncharged polar head groups or nonpolar head groups having similar hydrophilicity values include the following: leucine, isoleucine, valine; glycine, alanine; asparagine, glutamine; serine, threonine;
phenylalanine, tyrosine.

5.5.1. Recom~inant Expression of HER4 Ligan~s The HER4 ligands of the present invention may be produced by the cloning and expression of DNA encoding the desired HER4 ligand. Such DNA may be ligated into a number of expression vectors well known in the art and suitable for use in a number of acceptable host organisms, in fused or mature form, and may contain a signal sequence to permit secretion. Both prokaryotic and eukaryotic host expression systems may be employed in the production of recombinant HER4 ligands. For example, a HER4 ligand precursor coding sequence or its functional equivalent may be used in a host cell SUBSTITUTE SHEET (RULE 26~

WO96/12019 PCT~S9511352l capable of processing the precursor correctly.
Alternatively, the coding sequence for a mature HER4 ligand may be used to directly express the mature HER4 ligand molecule. Functional equivalents of the HER4 S ligand precursor coding sequence include any DNA
sequence which, when expressed inside the appropriate host cell, is capable of directing the synthesis, processing and/or export of the HER4 ligand.
Production of a HER4 ligand using recombinant DNA
technology may be divided into a four-step process for the purposes of description: (1) isolation or generation of DNA encoding the desired HER4 ligand;
(2) construction of an expression vector capable of directing the synthesis of the desired HER4 ligand;
(3) transfection or transformation of appropriate host cells capable of replicating and expressing the HER4 ligand coding sequence and/or processing the initial product to produce the desired HER4 ligand; and (4) identification and purification of the desired HER4 ligand product.

5.5.2. Isol~tion of HER4 Enco~ing DNA
HER4 ligand-encoding nucleic acid sequences may be obtained from human hepatocellular carcinoma cell lines, specifically the HepG2 cells available from the ATCC, accession number HB 8065. In addition, a number of human cell sources are suitable for obtaining HER4 ligand nucleic acids, including MDA-MB-231 cells available from the ATCC, accession number HTB 26, brain tissue (Falls et al., 1993, Cell 72:801-815 and Marchionni et al., 1993 Nature 362:312-318), and any cell source capable of producing an activity capable of binding to the 180K transmembrane protein, HER4/pl80'rb~4, encoded by the HER4/ERBB4 gene and activating tyrosine kinase activity.

SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 WO 96/12019 PCI`/US95113~2 Methods useful in assaying for the identification of HER4 ligands is disclosed in Section 5.8., infra.
The techniques disclosed in Sections 5.3.2. and 5.3.3., infra apply to the construction of HER4 ligand expression vectors and identification of recombinant transformants expressing HER4 ligand gene products.

5.5.3. Anti-HER4 Ligand Antibodies The present invention is also directed to polyclonal and monoclonal antibodies which recognize eptitopes of HER4 ligand polypeptides. Anti-HER4 ligand antibodies are expected to have a variety of useful applications in the field of oncology.
Briefly, anti-HER4 ligand antibodies may be used for the detection and quantification of HER4 ligand polypeptide expression in cultured cells, tissue samples, and in vivo. For example, monoclonal antibodies recognizing epitopes from different parts of the HER4 ligand structure may be used to detect and/or distinguish binding from non-binding regions of the ligand. Anti-HER4 ligand antibody preparations are also envisioned as useful biomodulatory agents capable of effectively treating particular human cancers. An anti-HER4 ligand antibody could be used to block signal transduction mediated through HER4, thereby inhibiting undesirable biological responses.
In addition to the various diagnostic and therapeutic utilities of anti-HER4 ligand antibodies, a number of industrial and research applications will be obvious to those skilled in the art, including, for example, the use of anti-HER4 ligand antibodies as affinity reagents for the purification of HER4 ligand polypeptides, and as immunological probes for elucidating the biosynthesis, metabolism and biological functions of HER4 ligands.

SUBSTITUTE SHEET (RULE 26~

WOg6112019 PCT~S951~3524 Anti-HER4 ligand antibodies may ~e useful for influencing cell functions and behaviors which are directly or indirectly mediated by HE~4. As an example, modulation of HER4 biological activity with s anti-HER4 ligand antibodies may influence HER2 activation and, as a consequence, modulate intracellular signals generated by HER2. In this regard, anti-HER4 ligand antibodies may be useful to effectively block ligand-induced, HER4-mediated activation of HER2, thereby affecting HER2 biological activity. Conversely, anti-HER4 ligand antibodies capable of acting as HER4 ligands may be used to trigger HER4 biological activity andtor initiate a ligand-induced, HER4-mediated ef~ect on HER2 lS biological activity, resulting in a cellular response such as differentiation, growth inhibition, etc.
Additionally, anti-HER4 ligand antibodies conjugated to cytotoxic compounds may be used to selectively target such compounds to tumor cells expressing HER4, resulting in tumor cell death and reduction or eradication of the tumor.
Various procedures known in the art may be used for the production of antibodies to epitopes of HER4 ligand (see Section 5.4, supra) .
5.6. Diagnostic Methods The invention also relates to the detection of human neoplastic conditions, particularly carcinomas of epithelial origin, and more particularly human breast carcinomas. In one embodiment, oligomers corresponding to portions of the consensus HER4 cDNA
sequence provided in FIG. lA and l~ are used for the quantitative detection of HER4 m~NA levels in a human biological sample, such as blood, serum, or tissue biopsy samples, using a suitable hybridization or PCR

~1 IR~::TITI ITF ~I~FFT rRI 11 F 26~

CA 02202~33 1997-04-11 WO 96/12019 PCrlUS95/1352 1 format assay, in order to detect cells or tissues expressing abnormally high levels of HER4 as an indication of neoplasia. In a related embodiment, detection of HER4 mRNA may be combined with the detection HER2 mRNA overexpression, using appropriate HER2 sequences, to identify neoplasias in which a functional relationship between HER2 and HER4 may exist.
In another embodiment, labeled anti-HER4 antibodies or antibody derivatives are used to detect the presence of HER4 in biological samples, using a variety of immunoassay formats well known in the art, and may be used for in situ diagnostic radioimmunoimaging. Current diagnostic and staging techniques do not routinely provide a comprehensive scan of the body for metastatic tumors. Accordingly, anti-HER4 antibodies labeled with, for example, fluorescent, chemiluminescent, and radioactive molecules may overcome this limitation. In a preferred embodiment, a gamma-emitting diagnostic radionuclide is attached to a monoclonal antibody which is specific for an epitope of HER4, but not significantly cross-reactive with other EGFR-family members. The labeled antibody is then injected into a patient systemically, and total body imaging for the distribution and density of HER4 molecules is performed using gamma cameras, followed by localized imaging using computerized tomography or magnetic resonance imaging to confirm and/or evaluate the condition, if necessary. Preferred diagnostic radionuclides include but are not limited to technetium-9sm, indium-111, iodine-123, and iodine-131.
Recombinant antibody-metallothionein chimeras (Ab-MTs) may be generated as recently described (Das SUBSTITUTE SHEET (RULE 261 CA 02202533 1997-04-ll WO 96/12019 PCI~/US9!;/13~iZ'I

et al., 1992, Proc. Natl. Acad. Sci. U.S.A. 89:9749-53). Such Ab-MTs can be loaded with technitium-99m by virtue of the metallothionein chelating function, and - may offer advantages over chemically conjugated chelators. In particular, the highly conserved metallothionein structure may result in minimal immunogenicity.

5.7. Assayq for the Identification of ~ER4 lo Ligands Cell lines overexpressing a single member of the EGFR-family can be generated by transfection of a variety of parental cell types with an appropriate expression vector as described in Section 7., infra.
Candidate ligands, or partially purified preparations, may be applied to such cells and assayed for receptor binding and/or activation. For example, a CHO-KI cell line transfected with a HER4 expression plasmid and lacking detectable EGFR , HER2, or HER3 may be used to screen for HER4-specific ligands. A particular embodiment of such a cell line is described in Section

7 ., in~ra , and has been deposited with the ATCC
(CH0/HER4 21-2). Ligands may be identified by detection of H~R4 autophosphorylation, stimulation of DNA synthesis, induction of morphologic differentiation, relief from serum or growth factor requirements in the culture media, and direct binding of labeled purified growth factor. The invention also relates to a bioassay for testing potential analogs of ~ER4 ligands based on a capacity to affect a biological activity mediated by the HER4 receptor.
-~IIR~TITIITF~FFTrRIIIF~

CA 02202~33 1997-04-11 WO 96/12019 PCI~/US9511352 5.8. Use Of The Invention in Cancer Therapy 5.8.1. T~rgeted Cancer Therapy The invention is also directed to methods for the treatment of human cancers involving abnormal expression and/or function of HER4 and cancers in which HER2 overexpression is combined with the proximate expression of HER4, including but not limited to human breast carcinomas and other neoplasms overexpressing HER4 or overexpressing HER2 in combination with expression of HER4. The cancer therapy methods of the invention are generally based on treatments with unconjugated, toxin- or radionuclide- conjugated HER4 antibodies, ligands, and derivatives or fragments thereof. In one specific embodiment, such HER4 antibodies or ligands may be used for systemic and targeted therapy of certain cancers overexpressing HER2 and/or HER4, such as metastatic breast cancer, with minimal toxicity to normal tissues and organs. Importantly, in this connection, an anti-HER2 monoclonal antibody has been shown to inhibit the growth of human tumor cells overexpressing HER2 (~acus et al., 1992, Cancer Res.
52:2580-89). In addition to conjugated antibody therapy, modulation of heregulin signaling through HER4 provides a means to affect the growth and differentiation of cells overexpressing HER2, such as certain breast cancer cells, using HER4-neutralizing monoclonal antibodies, NDF/HER4 antagonists, monoclonal antibodies or ligands which act as super-agonists for HER4 activation, or agents which block the interaction between HER2 and HER4, either by disrupting heterodimer formation or by blocking HER-mediated phosphorylation of the HER2 substrate.

SUBSTITUTE SHEET (RULE 26~

WO~6/12019 PCT~S95J1352 For targeted immunotoxin-mediated cancer therapy, various drugs or toxins may be conjugated to anti-HER4 antibodies and fragments thereof, such as plant and bacterial toxins. For example, ricin, a cytotoxin from the Ricinis communis plant may be conjugated to an anti-HER4 antibody using methods known in the art (e.g., Blakey et al., 1988, Proq. Allerqy 45:50-so;
Marsh and Neville, 1988, J. Immunol. 140:3674-78).
Once ricin is inside the cell cytoplasm, its A chain inhibits protein synthesis by inactivating the 60S
ribosomal subunit (May et al., 1989, EMBO J. 8:301-

08). Immunotoxins of ricin are therefore extremely cytotoxic. However, ricin immunotoxins are not ideally specific because the B chain can bind to virtually all cell surface receptors, and immunotoxins made with ricin A chain alone have increased specificity. Recombinant or deglycosylated forms of the ricin A chain may resuIt in improved survival (i.e., slower clearance from circulation) of the immunotoxins. Methods for conjugating ricin A chain to antibodies are known (e.g., Vitella and Thorpe, in:
Seminars in Cell Bioloqy, pp 47-58; Saunders, Philadelphia l99l). Additional toxins which may be used in the formulation of immunotoxins include but are not limited to daunorubicin, methotrexate, ribosome inhibitors (e.g., trichosanthin, trichokirin, gelonin, saporin, mormordin, and pokeweed antiviral protein) and various bacterial toxins (e.g., Pseudomonas exotoxin). Immunotoxins for targeted cancer therapy may be administered by any route which will result in antibody interaction with the target cancer cells, including systemic administration and injection directly to the site of tumor. Another therapeutic strategy may be the administration of immunotoxins by sustained-release systems, such as ~IIR~TITUTE~HFFT(RULE26~

CA 02202~33 1997-04-11 WO 96112019 PCI~/US95/1352 1 semipermeable matrices of solid hydrophobic polymers containing the therapeutic agent. Various of sustained-release materials have been established and are well known by those skilled in the art.
Sustained-release capsules may, depending on their chemical nature, release immunotoxic molecules for a few weeks up to over 100 days. Depending on the chemical nature and the biological stability of the therapeutic reagent, additional strategies for protein stabilization may be employed.
For targeted radiotherapy using anti-HER4 antibodies, preferred radionuclides for labeling include alpha, beta, and Auger electron emitters.
Examples of alpha emitters include astatine 211 and bismuth 212; beta emitters include iodine 131, rhenium 188, copper 67 and yttrium 90; and iodine 12S is an example of an Auger electron emitter.
Similarly as suggested for the use of toxin-conjugated antibodies as therapeutic agents for targeted cancer therapy, purified ligand molecules may be chemically conjugated to cytotoxic substances. In addition, recombinant chimeric polypeptides comprising a HER4 binding (=ligand) portion fused to all or part of a cytotoxin may be engineered by constructing vectors comprising DNA encoding the ligand in reading frame with DNA encoding the toxin or part thereof.
Such recombinant ligand-toxins may be used to specifically target HER4 expressing cancer cells. A
particular embodiment of such a ligand-toxin is disclosed herein and described in more detail in Sections 5.8.2., inf~a , and Section 15, infra .

SUBSTITUTE S~EET (RULE 26~

WO96tl201~ PCT~S95113521 5.8.2. The Generation Of A Heregulin-toxin 8pecifically Targeting ~ER4 Expressing - Tumor Cells Another aspect of the invention relates to the deyelopment of a strategy to selectively target and kill HER4 expressing tumor cells. More particularly, HER4 expressing tumor cells may be specifically targeted and killed by contacting such tumor cells with a fusion protein comprising a cytotoxic polypeptide covalently linked to a polypeptide which is capable of activating HER4 expressed on such cells.
In a specific embodiment described by way of example in Section 15, infra, a fusion protein comprising a chimeric heregulin ~2 ligand and the cytotoxic substance PE40 is generated by expression of the corresponding chimeric coding sequence. PE40 is a derivative of the Pseudomonas exotoxin PE, a potent cell killing agent made by Pseudomonas aeruginosa (Fitzgerald et al., 1980, Cell 21:867-873). The wildtype protein PE contains three domains whose functions are cell recognition, membrane translocation, and ADP ribosylation of elongation factor 2. It kills cells by binding to a cell surface receptor, entering the cell via an endocytotic vesicle and catalyzing ADP-ribosylation of elongation factor 2. The derivative PE40 lacks the cell ~inding function of the wildtype protein, but still exhibits strong cytotoxic activity. Generation of PE40 fusion proteins with specific cell targeting molecules have been described (Kondo et al., 1988, J. Biol. Chem.
263:9470-9475 (PE40 fusions with different monoclonal antibodies); Friedman et al., 1993, Cancer Res.
53:334-339 (BR96/PE40 fusions); U.S. Pat. No. 5206353 - (CD4/PE40 fusions); U.S. Pa~. No. 5082927 (IL-4/PE40 fusions) and U.S. Pat. No. 4892827 (TGF-~/PE40 and IL-2/PE40 fusions)).

~IIR~TITUTE~HEET(RULE26 CA 02202~33 1997-04-11

9 PCI'IUS95/1352 The chimeric heregulin-toxin protein HAR-TX ~2 described in Section 15, infra, contains the amphiregulin (AR) leader sequence thereby facilitating the purification of the recombinant protein. As confirmed by applicants' data, the AR leader has no influence on the binding specificity of the recombinant heregulin-toxin. Related embodiments include, for example, PE40 linked to other members of the heregulin family, like heregulin-~1 and heregulin-~, and other molecules capable of activating HER4.
In a cytotoxicity assay with cultured tumor celllines, the applicants demonstrate specificity of the cytotoxic effect of the chimeric heregulin-PE40 protein to HER4 expressing cancer cells; they include but are not limited to prostate carcinoma, bladder carcinoma, and a considerable number of different breast cancer types, including breast carcinoma cells with amplified HER2 expression. The bifunctional retention of both the specificity of the cell binding portion of the molecule and the cytotoxic potential of PE40 provides a very potent and targeted reagent.
An effective therapeutic amount of heregulin-toxin will depend upon the therapeutic objectives, the route of administration, and the condition of the patient. Accordingly, dosages should be titrated and the route of administration modified as required to obtain the optimal therapeutic effect. A typical daily dosage may be in the range of 0.1 mg/kg - l mg/kg, preferably between 0.1 and 0.5 mg/kg, with intravenous administration. For regression of solid tumors, it may take 3-5 doses, with schedules such as 3 doses, each four days apart. Also the use of sustained-release preparations (see Section 5.8.1., supra) may be considered for administration of the reagent. The therapeutic efficacy of heregulin-toxin SUBSTITUTE SHEET (RULE 26~

WO96/12019 PCT~S95113S21 may ~e between 2 and l0, which means that a tumor regression effect would be expected between 2- and lO-fold below the toxic dose (see Section 15, infra).
- Desirably, the heregulin-toxin will be administered at a dose and frequency that achieves the desired therapeutic effect, which can be monitored using conventional assays.
Cancer therapy with heregulin-toxins of the invention may be combined with chemotherapy, surgery, and radiation therapy, depending on the type of tumor.
One advantage of using a low molecular weight toxin drug is that they are capable of targeting metastatic lesions that cannot be located and removed by surgery.
Heregulin-toxins may also be particularly useful on patients that are MDR (Multi Drug Resistance) positive since their mechanism of action is not inhibited by the p-glycoprotein pump of MDR positive cells as are many standard cancer therapeutic drugs.

5.9. Other ~herapeutic ~se of HER4 Ligands Additional therapeutic uses of HER4 ligands may include other diseases ca~sed by deficient H~R4 receptor tyrosine kinase activation rather than by hyperactivation. In this regard, type II diabetes mellitus is the consequence of deficient insulin-mediated signal transduction, caused by mutations in the insulin-receptor, including mutations in the ligand-binding domain (Taira et al., 1889, Science 245:63-66; Odawara et al ., 1989, Science 245:66-68;
Obermeier-Kusser et al., 1989, J. Biol. Chem.
264:9497-9504). Such diseases might be treated by administration of modified ligands or ligand-analogues which re-establish a functional ligand-receptor interaction.

.~ IR.C:TlTI ITF ~HFFT ~RI 11 F 21i~

CA 02202~33 1997-04-11 WO 96112019 PCI~/US95/13!j2-~

5.10. HER4 Analogues The production and use of derivatives, analogues and peptides related to HER4 are also envisioned and are within the scope of the invention. Such derivatives, analogues and peptides may be used to compete with native HER4 for binding of HER4 specific ligand, thereby inhibiting HER4 signal transduction and function. The inhibition of HER4 function may be utilized in several applications, including but not lo limited to the treatment of cancers in which HER4 biological activity is involved.
In a specific embodiment, a series of deletion mutants in the HER4 nucleotide coding sequence depicted in FIG. lA and lB may be constructed and analyzed to determine the minimum amino acid sequence requirements for binding of a HER4 ligand. Deletion mutants of the HER4 coding sequence may be constructed using methods known in the art which include but are not limited to use of nucleases and/or restriction enzymes; site-directed mutagenesis techniques, PCR, etc. The mutated polypeptides expressed may be assayed for their ability to bind HER4 ligand.
The DNA sequence encoding the desired HER4 analogue may then be cloned into an appropriate expression vector for overexpression in either bacteria or eukaryotic cells. Peptides may be purified from cell extracts in a number of ways including but not limited to ion-exchange chromatography or affinity chromatography using HER4 ligand or antibody. Alternatively, polypeptides may be synthesized by solid phase techniques followed by cleavage from resin and purification by high performance liquid chromatography.

SUBSTITUTE SHEET (RULE 26 WO g6112019 P~TJIJS95113!;2 6. Example: Isolation of cDNAs Encoding HER4 EGFR and the related proteins, H~R2, HER3, and Xmrk exhibit extensive amino acid homology in their - tyrosine kinase domains (Kaplan et al., 1991, Nature 350:15~-160; Wen et al., 1992, Cell 69:559-72i Holmes et al., 1992, Science 256:1205-10; Hirai et al., Science 1987 238:1717-20). In addition, there is strict conservation of the exon-intron boundaries within the genomic regions that encode these catalytic domains (Wen et al., supra; Lindberg and Hunter, 1990, Mol. Cell. Biol. 10:6316-24; and unpublished observations). Degenerate oligonucleotide primers were designed based on conserved amino acids encoded by a single exon or adjacent exons from the kinase domains of these four proteins. These primers were used in a polymerase chain reaction (PCR) to isolate genomic fragments corresponding to murine EGFR, erbB2 and erbB3. In addition, a highly related DNA fragment (designated MER4) was identified as distinct from these other genes A similar strategy was used to obtain a cDNA clone corresponding to the human homologue of MER4 from the breast cancer cell line, MDA-MB-453. Using this fragment as a probe, several breast cancer cell lines and human heart were found to be an abundant source of the EGFR-related transcript.
cDNA libraries were constructed using RNA from human heart and MDA-MB-453 cells, and overlapping clones were isolated spanning the complete open reading frame of HER4/erbB4.
6.1. Materials and Methods 6.1.1. ~olecular Cloning Several pools of degenerate oligonucleotides were synthesized based on conserved sequences from EGFR-family members (Table I) (5'-ACNGTNTGGGARYTNAYHAC-3' SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 WO 96/12019 PCI'/US9511352~1 [SEQ ID No:14]; 5'-CAYGTNAARATHACNGAYTTYGG-3' [SEQ ID
No:16]; 5'-GACGAATTCCNATHAARTGGATGGC-3' [SEQ ID
No:17]; 5'-AANGTCATNARYTCCCA-3' tSEQ ID No:18]; 5'-TCCAGNGCGATCCAYTTDATNGG-3' [SEQ ID No:19]; 5'-S GG~TCDATCATCCARCCT-3' tSEQ ID No:20]; 5'-CTGCTGTCAGCATCGATCAT-3' ~SEQ ID No:21~; TVWELMT [SEQ
ID No:22]; HVKITDFG [SEQ ID No:23]; PIKWMA [SEQ ID
No:13]; VYMIILK [SEQ ID No:24]; WELMTF [SEQ ID No:25];
PIKWMALE [SEQ ID No:26]; CWMIDP tSEQ ID No:27]. Total genomic DNA was isolated from subconfluent murine K1735 melanoma cells and used as a template with these oligonucleotide primers in a 40 cycle PCR
amplification. PCR products were resolved on agarose gels and hybridized to 32P-labeled probes from the kinase domain of human EGFR and HER2. Distinct DNA
bands were isolated and subcloned for se~uence analysis. Using the degenerate oligonucleotides H4VWELM and H4VYMIIL as primers in a PCR amplification (Plowman et al., 1990, Proc. Natl. Acad. Sci. U.S.A.
87:4905-09), one clone (MER4-8s) was identified that contained a 144 nucleotide insert corresponding to murine erbB4. This 32P-labeled insert was used to isolate a 17-kilo~ase fragment from a murine T-cell genomic library (Stratagene, La Jolla, CA) that was found to contain two exons of the murine erbB4 gene.
A specific oligonucleotide (4M3070) was synthesized based on the DNA sequence of an erbB4 exon, and used in a PCR protocol with a degenerate 5'-oligonucleotide (H4PIKWMA) on a template of single stranded MDA-MB-453 cDNA. This reaction generated a 260 nucleotide fragment (pMDAPIK) corresponding to human HER4. cDNA
libraries were constructed in lambda ZAP II
(Stratagene) from oligo(dT)- and specific-primed MDA-MB453 and human heart RNA (Plowman et al,, supra ;
Plowman et al., 1990, Mol. Cell. Biol. 10:1969-81).

SUBSTITUTE SHEET (RULE 26~

WO96/12~19 PCT~S95/1352 HER4-specific clones were isolated by pro~ing the libraries with the 32P-labeled insert from pMDAPIK. To complete the cloning of the 5'-portion of HER4, we used a PCR strategy to allow for rapid amplification of cDNA ends (Plowman et al ., supra ; Frohman et al ., 1988, Proc. Natl. Acad. Sci. U.S.A. 85:8998-9002).
All cDNA clones and several PCR generated clones were sequenced on both strands using T7 polymerase with oligonucleotide primers (Tabor and ~ichardson, 1987, Proc. Natl. Acad. Sci. U.S.A. 84:4767-71).

TAB~E I
O~IGON~CLEOTIDE PREPAR~TIONs FOR C~ONING ~ER4 Nucleoeide Encoded 3esi~nacion Sequen~e' ~ a~ Sequen~e Orien~a~ior. S-~.ID No.
VWELM S'-A~ln~ARYTNA~AC-3~ 256-fold TVWELMT 3en~e 14 ~4~ITDFG S'-CAYGTNAARATYAC~GAYTTYGG-3' 768-~old HVX~TDFG sense lS
H4PIKWMA S'-GACGAATTCCNATHAARTGGATGGC 4a-fold P~WMA gcn~e lS
U4VYMIIL S~-ACAYTTNARDATDATCATRT~NAC-3~ ;76-~old VYMIILK an~i~ense 17 H4WSLMTF 5'-AANGTCAT~ARYTCCCA-3' 32-fold WELMTF an~en3e 18 ~4PI~WMA S'-TCCAGNGCGATCC~YTTDATNGG-3' 96-~old p~WMALE an~isense l9 H4CWMIDP S'- oe RT0 ATCAICCARCCT-3' 12-~old CWM}DP aneisense 20 2 O 4M3070 5~ ~AGCATCG~TC~T-3' ~ero er~R4 exon an~isense 21 :Ceg-~eraee r.ucleotlde re3idue de~lgna~ons:
D - A. G, or T;
H . A, C, or T:
A, C, G. or T:
y . c or T.

6.l.2. Northern Blot An~ly~is 3'- and 5'-HER4 specific [~32P]UTP-labeled antisense RNA probes were synthesized from the linearized plasmids pHtlBl.6 (containing an 800 bp ~ER4 fragment beginning at nucleotide 3098) and p5'H4E7 (containing a l kb fragment from the 5'-end of the HER4 sequence), respectively. For tissue distribution analysis (Section 6.2.3., infra ), the Northern blot (Clontech, Palo Alto, CA) contained 2 Mg SUBSTITUTE SHEET (P~ULE 26~

CA 02202~33 1997-04-11 WO96/12019 PCT~S95/1352 poly(A)+ mRNA per lane from 8 human tissue samples immobilized on a nylon membrane. The filter was prehybridized at 60 C for several hours in RNA
hybridization mixture (50% formamide, 5X SSC, 0.5%
SDS, lOx Denhardt's solution, 100 /~g/ml denatured herring sperm DNA, 100 ~g/ml tRNA, and 10 ~g/ml polyadenosine) and hybridized in the same buffer at 60 C, overnight with 1-1.5 x 106 cpm/ml of 32P-labeled antisense RNA probe. The filters were washed in O.lXSSC/0.1% SDS, 65 C, and exposed overnight on a PhosphoImager (Molecular Dynamics, Sunnyvale, CA).

6.1.3. Semi-Quantitative PCR Detection of RNA was isolated from a variety of human cell lines, fresh frozen tissues, and primary tumors.
Single stranded cDNA was synthesized from 10 ~g of each RNA by priming with an oligonucleotide containing a T17 track on its 3'-end (XSCT17:5'GACTCGAGTCGACATCGA~ lllllllllllll-3') [SEQ ID No:28].
1% or 5% of each single strand template preparation ~as then used in a 35 cycle PCR reaction with two HER4-specific oligonucleotides:
4H2674: 5'-GAAGAAAGACGACTCGTTCATCGG-3' [SEQ ID No:29], and 4H2965: 5'-GACCATGACCATGTAAACGTCAATA-3' [SEQ ID No:30].
Reaction products were electrophoresed on 2% agarose gels, stained with ethidium bromide and photographed on a W light box. The relative intensity of the 291-bp HER4-specific bands were estimated for each sample as shown in Table II.

SUBSTITUTE SHEET (RULE 26~

WO 96112019 PCI'IUS9S113S2 1 6.2. Re~ults 6.2.1. Sequence Analysis of cDNA Clones Encodi~g ~ER4 cDNA clones encoding parts of the HER4 coding and non-coding nucleotide sequences were isolated by PCR
cloning according to the method outlined in Section 6.1.1., supra. The complete HER4 nucleotide sequence assembled from these cDNAs is shown in FIG. lA and lB
and contains a single open reading frame encoding a lo polypeptide of 1308 amino acids. The HER4 coding region is flanked by a 33 nucleotide 5'-untranslated region and a 1517 nucleotide 3'-untranslated region ending with a poly(A) tail. A 25 amino acid hydrophobic signal sequence follows a consensus initiating methionine at position number 1 in the amino acid sequence depicted in FIG. lA and lB. In relation to this signal sequence, the mature HER4 polypeptide would be predicted to begin at amino acid residue number 26 in the sequence depicted in FIG. lA
and lB (Gln), followed by the next 1283 amino acids in the sequence. Thus the prototype mature HER4 of the invention is a polypeptide of 1284 amino acids, having a calculated Mr of 144,260 daltons and an amino acid sequence corresponding to residues 26 through 1309 in FIG. lA and lB.
Comparison of the HER4 nucleotide and deduced amino acid sequences (FIG. lA and lB) with the available DNA and protein sequence databases indicated that the HE~4 nucleotide sequence is unique, and revealed a 60/64 amino acid identity with HER2 and a 54/54 amino acid identity to a fragment of a rat EGFR
homolog, tyro-2.

6.2.2. ~equence Analysis of Related cDNAs Several cDNAs encoding polypeptides related to the prototype HER4 polypeptide (FIG. lA and lB) were R~TITI ITF ~I IFFT ~Rl 11 F ~

CA 02202~33 l997-04-ll WO96/12019 PCT~S95/1352l also isolated from the MDA-MB-453 cDNA library and comprised two forms.
The first alternative type of cDNA was identical to the consensus HER4 nucleotide sequence up to nucleotide 3168 (encoding Arg at amino acid position 1045 in the FIG. lA and lB) and then abruptly diverges into an apparently unrelated sequence (FIG. 2A and 2B, FIG. 4). Downstream from this residue the open reading frame continues for another 13 amino acids before reaching a stop codon followed by a 2 kb 3'-untranslated sequence and poly(A) tail. This cDNA
would be predicted to result in a HER4 variant having the C-terminal autophosphorylation domain of the prototype HER4 deleted.
A second type of cDNA was isolated as 4 independent clones each with a 3'-sequence identical to the HER4 consensus, but then diverging on the 5'-side of nucleotide 2335 (encoding Glu at amino acid position 768 in the FIG. lA and lB), continuing upstream for only another 114-154 nucleotides (FIG. 3, FIG. 5). Nucleotide 2335 is the precise location of an intron-exon junction in the HER2 gene (Coussens et al., 1985, Science 230:1132-39; Semba et al., 1985, Proc. Natl. Acad. Sci. U.S.A. 82:6497-6501), suggesting these cDNAs could be derived from mRNAs that have initiated from a cryptic promoter within the flanking intron. These 5'-truncated transcripts contain an open reading frame identical to that of the HER4 cDNA sequence of FIG. lA and lB, beginning with the codon for Met at amino acid position 772 in FIG.
lA and lB. These cDNAs would be predicted to encode a cytoplasmic HER4 variant polypeptide that initiates just downstream from the ATP-binding domain of the HER4 kinase.

SUBSTITUTE SHEET (RULE 26~

WO9~/12019 PCT~S9~113S2 6.2.3. Human Tissue Distribution of HER4 Expression `Northern blots of poly(A)l mRNA from human tissue samples were hybridized with antisense RNA probes to the 3'-end of HER4, encoding the autophosphorylation domain, as described in Section 6.l. 2 ., supra. A HER4 mRNA transcript of approximately 6kb was identified, and was found to be most abundant in the heart and skeletal muscle (FIG. 8, Panel l). An mRNA of greater than approximately 15 kb was detected in the brain, with lower levels also detected in heart, skeletal muscle, kidney, and pancreas tissue samples.
The same blot was stripped and rehybridized with a probe from the 5'-end of HER4, within the extracellular domain coding region, using identical procedures. This hybridization confirmed the distribution of the 15 kb HER4 mRNA spe~ies, and detected a 6.5 kb mRNA species in heart, skeletal muscle, kidney, and pancreas tissue samples (FIG. 8, Panel 2) with weaker signals in lung, liver, and placenta. In addition, minor transcripts of l.7-2.6 kb were also detected in pancreas, lung, brain, and skeletal muscle tissue samples. The significance of the different sized RNA transcripts is not known.
Various human tissues were also examined for the presence of HER4 mRNA using the semi-quantitative PCR
assay described in Section 6.l.3., supra. The results are shown in Table II, together with results of the assay on primary tumor samples and neoplastic cell lines tSection 6.2.4., immediately below). These results correlate well with the Northern and solution hybridization analysis results on the selected RNA
samples. The highest levels of HER4 transcript expression were found in heart, kidney, and brain tissue samples. In addition, high levels of HER4 mRNA
expression were found in parathyroid, cerebellum, SUBSTITUTESHEET(RULE26~

~=

WO 96tl2019 PCI'I`US95/1352 pituitary, spleen, testis, and breast tissue samples.
Lower expression levels were found in thymus, lung, salivary gland, and pancreas tissue samples, Finally, low or negative expression was observed in liver, prostate, ovary, adrenal, colon, duodenum, epidermis, and bone marrow samples.

6.2.4. HE~4 mRNA ExpresYion i~ Prim~ry Tumor~ and Variou~ Cell Line~ of Neoplastic Origin HER4 mRNA expression profiles in several primary tumors and a number of cell lines of diverse neoplastic origin were determined with the semi-quantitative PCR assay (Section 6.1.3, supra) using primers from sequences in the HER4 kinase domain. The results are included in Table II. This analysis detected the highest expression of H~R4 ~NA in 4 human mammary adenocarcinoma cell lines (T-47D, MDA-M3-453, BT-474, and H3396), and in neuroblastoma (SK-N-MC), and pancreatic carcinoma (Hs766T) cell lines.
Intermediate expression was detected in 3 additional m~m~ry carcinoma cell lines (MCF-7, MDA-MB-330, MDA-MB-361). Low or undetectable expression was found in other cell lines derived from carcinomas of the breast (MDB-MB-231, MDA-MB-157, MDA-MB-468, SK-BR-3), kidney (Caki-1, Caki-2, G-401), liver (SK-HEP-1, HepG2), pancreas (PANC-l, AsPC-1, Capan-l), colon (HT-29), cervix (CaSki), vulva (A-41), ovary (PA-1, Caov-3), melanoma (SK-MEL-28), or in a variety of leukemic cell lines. Finally, high level expression was observed in Wilms (kidney) and breast carcinoma primary tumor samples.

SUBSTITUTE SHEET (RULE 26 WO96/12019 PCT~S90~3~2 - 6~ -TABLE II
; HER4 EXPRES8ION BY PRC ANALYSI8 VERY STRONG STRONG MEDIUM
5 T47D (breast) MDA-MB-453 (breast) MCF-7 (breaQt) BT-474 (brea~t) MDA-MB-330 (breast) H3396 (brea~t) MDA-MB-157 (breast) H~766T (pancreatic) JEG-3 (choriocarcinoma) SK-N-MC (neural) HEPM (palate) Wilms Tumor (~idney) 458(medullablastoma) BreaQt Carcinoma

10 Xidney Brain Skeletal Muscle Heart Cerebellum Thymus Parathyroid Pituitary Pancreas Breast Lung Testi~ Salivary Gland Spleen ~EAR NEGATIVE
MDB-MB-231 (breast) MDA-MB-468 (breast) MDA-M3-157 (breast) G-401 (kidney) S~-BR-3 (breast) HepG2 (liver) A-431 (vulva) PANC-l (pancreas) Caki-1 (kidney) AsPC-l(pancrea~) Caki-2 ~kidney) Capan-l (pancreas) SR-HEP-1 (liver) HT-29 (~olon) THP-1 (macrophage) CaSki (cer~ix) PA-1 (ovary) Prostate Caov-3 (ovary) Adrenal SK-MEL-28 (melanoma) ovary HUF (fibroblast) Colon H2981 (lung) Placenta Ovarian tumor GEO (colon) ALL bone marrow AML bone marrow Duodenum Epidermi~
Liver Bone marrow stroma 7. Example: Recombinant Expression of HER4 30 7.l. Materials and ~ethods 7.l.l. C~O-RI Cells and Culture Conditions CHO-KI cells were obtained from the ATCC
(Accession Number CCL 61). These cells lack any detectable EGFR, HER2, or HER3 by immunoblot, tyrosine .~iIIR~TITlITF ~HFFT rRllLE 26~

CA 02202~33 1997-04-11 phosphorylation, and 35S-labeled immunoprecipitation analysis. Transfected cell colonies expressing HER4 were selected in glutamine-free Glasgow modified Eagle's medium (GMEM-S, Gibco) supplemented with 10%
dialyzed fetal bovine serum an increasing concentrations of methionine sulfoximine (Bebbington, 1991, in Methods: A Companion to Methods in EnzymolooY
2:136-14S Academic Press).

7.1.2. Expression Vector Construction and Transfections The complete 4 kilobase coding sequence of prototype HER4 was reconstructed and inserted into a glutamine synthetase expression vector, pEE14, under the control o f the cytomegalovirus immediate-early promoter (Bebbington, supra) to generate the HER4 expression vector pEEHER4. This construct (pEEHER4) was linearized with MluI and transfected into CHO-KI
cells by calcium phosphate precipitation using standard techniques. Cells were placed on selective media consisting of GMEM-S supplemented with 10%
dialyzed fetal bovine serum and methionine sulfoximine at an initial concentration of 25 ~M (L-MSX) as described in Bebbington, su pra, for the selection of initial resistant colonies. After 2 weeks, isolated colonies were transferred to 48-well plates and expanded for HER4 expression immunoassays as described immediately below. Subsequent rounds of selection using higher concentrations of MSX were used to isolate cell colonies tolerating the highest concentrations of MSX. A number of CHO/HER4 clones selected at various concentrations of MSX were isolated in this manner.

SUBSTITUTE SHEET (RULE 26~

W096112019 PCT~S~511352 7.l.3. HER4 ~xpression Im~unoassay Confluent cell monolayers were scraped into hypotonic lysis buffer (lO mM Tris pH7.4, 1 mM XCl, 2 mM MgCl2) at 4 C, dounce homogenized with 30 strokes, and the cell debris was removed by centri~ugation at 3500 x g, 5 min. Membrane fractions were collected by centrifugation at lOO,OOO x g, 20 min, and the pellet was resuspended in hot Laemmli sample buffer with 2-mercaptoethanol. Expression of the HER4 polypeptide was detected by immunoblot analysis on solubilized cells or membrane preparations using HE~2 immunoreagents generated to either a l9 amino acid region of the HER2 kinase domain, which coincidentally is identical to the HER4 sequence (residues 927-945), or to the C-terminal 14 residues of HER2, which share a stretch of 7 consecutive residues with a region near the C-terminus of HER4. on further amplification, HER4 was detected from solubilized cell extracts by immunoblot analysis with PY20 anti-phosphotyrosine antibody (ICN Biochemicals), presumably reflecting autoactivation and autophosphorylation of HER4 due to receptor aggregation resulting from abberantly high receptor density. More specifically, expression was detected by immunobloting with a primary murine monoclonal antibody to HER2 (Neu-Ab3, Oncogene Science) diluted 1:50 in blotto (2.5% dry milk, 0.2%
NP40 in PBS) using 12sI-goat anti-mouse Ig F(ab')2 (Amersham, UK) diluted l:500 in blotto as a second antibody. Alternatively, a sheep polyclonal antipeptide antibody against HER2 residues 929-947 (Cambridge Research Biochemicals, Valleystream, NY) was used as a primary immunoreagent diluted l:lOO in blotto with ~2sI-Protein G (Amersham) diluted l:200 in blotto as a second antibody. Filters were washed with SUBSTITUTE SHEET (RULE 26 CA 02202~33 1997-04-11 WO 96112019 Pcl~/us9511352-1 blotto and exposed overnight on a phosphoImager (Molecular Dynamics).

7.2. Results CHO-KI cells transfected with a vector encoding the complete human prototype HER4 polypeptide were selected for amplified expression in media containing increasing concentrations of methionine sulfoximine as outlined in Section 7.1., et seq., supra. Expression of HER4 was evaluated using the immunoassay described in Section 7.1. 3 ., supra . Several transfected CHO-KI
cell clones stably expressing HER4 were isolated. One particular clone, CHO/HER4 21-2, was selected in media supplemented with 250 ~M MSX, and expresses high levels of HER4. CHO/HER4 21-2 cells have been deposited with the ATCC.
Recombinant HER4 expressed in CHO/HER4 cells migrated with an apparent Mr of 180,000, slightly less than HER2, whereas the parental CHO cells showed no cross-reactive bands (FIG. 9). In addition, a 130 kDa band was also detected in the CHO/HER4 cells, and presumably represents a degradation product of the 180 kDa mature protein. CHO/HER4 cells were used to identify ligand specific binding and autophosphorylation of the HER4 tyrosine kinase (see Section 9., et seq., infra ) .

8. Example: Assay for Detecting EGFR-Family Ligands 8.1. Cell Lines A panel of four recombinant cell lines, each expressing a single member of the human EGFR-family, were generated for use in the tyrosine kinase stimulatory assay described in Section 8.2., below.
The cell line CHO/HE~4 3 was generated as described in Section 7.1. 2, supra.

SUBSTITUTE SHEET (RULE 26~
, WO 96112019 PCTJUS95113~;2-l CHO/HER2 cells (clone 1-2500) were selected to express high levels of recombinant human pl85'rb~2 by dihydrofolate reductase-induced gene amplification in dhfr-deficient CHO cells. The HER2 expression plasmid, cDNeu, was generated by insertion of a full length HER2 coding sequence into a modified pCDM8 (Invitrogen, san Diego, CA) expression vector (Seed and Aruffo, 19~7, Proc. Natl. Adad. Sci. U.S.A.
84:3365-69) in which an expression cassette from pSV2DHFR (containing the murine dhfr cDNA driven by the SV40 early promoter) has ~een inserted at the pCDM8 vëctor's unique BamHI site. This construct drives HER2 expression from the CMV immediate-early promoter.
NRHER5 cells (Velu et al., 1987, Science 1408-lo) were obtained from Dr. Hsing-Jien Kung (Case Western Reserve University, Cleveland, OH). This murine cell line was clonally isolated from NR6 cells infected with a retrovirus stock carrying the human EGFR, and was found to have approximately 1o6 human EGFRs per cell.
The cell line 293/HER3 was selected for high level expression of pl60'rb33. The parental cell line, 293 human embryonic kidney cells, constitutively expresses adenovirus Ela and have low levels of EGFR
expression. This line was established by cotransfection of linearized cHER3 (Plowman et al., 1990, Proc. Natl. Acad. Sci. U.S.A. 87:4905-09) and pMClneoPolyA (neomycin selectable marker with an Herpes simplex thymidine kinase promoter, Stratagene), with selection in DMEM/F12 media containing 500~g/ml G418.

SUBSTITUTE SHEET (RULE 261 CA 02202~33 1997-04-11 WO96/12019 PCT~S9511352 8.2. Tyrosine Kinase Stimulation ASSAY
Cells were plated in 6-well tissue culture plates (Falcon), and allowed to attach at 37 C for 18-24 hr.
Prior to the assay, the cells were changed to serum-free media for at least 1 hour. Cell monolayers were then incubated with the amounts of ligand preparations indicated in Section 7.3., below for 5 min at 37 C.
Cells were then washed with PBS and solubilized on ice with 0.5 ml PBSTDS containing phosphatase inhibitors (10 mM NaHPO4, 7.25, 150 mM NaCl, 1% Triton X-100, 0.5% deoxycholate, 0.1% SDS, 0.2% sodium azide, 1 mM
NaF, 1 mM EGTA, 4 mM sodium orthovanadate, 1%
aprotinin, 5 mg/ml leupeptin). Cell debris was removed by centrifugation (12000 x g, 15 min, 4 C) and the cleared supernatant reacted with 1 mg murine monoclonal antibody to phosphotyrosine (PY20, ICN
Biochemicals, Cleveland, Ohio) for CHO/HER4 and 293/HER3 cells, or 1 mg murine monoclonal antibody to HER2 (Neu-Ab3, Oncogene Sciences) for CHO/HER2 cells, or 1 mg murine monoclonal antibody EGFR-1 to human EGFR (Amersham) for NRHER5 cells. Following a 1 hr incubation at 4 C, 30 ~1 of a 1:1 slurry (in PBSTDS) of anti-mouse IgG-agarose (for PY20 and Neu-Ab3 antibodies) or protein A-sepharose (for EGFR-R1 antibody) was added and the incu~ation was allowed to continue an additional 30 minutes. The beads were washed 3 times in PBSTDS and the complexes resolved by electrophoresis on reducing 7% SDS-polyacrylamide gels. The gels were transferred to nitrocellulose and blocked in TNET (10 mM Tris pH7.4, 75 mM NaCl, 0.1 Tween-20, 1 mM EDTA). PY20 antiphosphotyrosine antibody diluted 1:1000 in TNET was used as the primary antibody followed by l2'I-goat anti-mouse Ig F(ab')2 diluted 1:500 in TNET. Blots were washed SUBSTITUTE SHEET (RULE 26) WO 96112019 PCI'I~JS9S113S2J~

with TNET and exposed on a phosphorimager (Molecular Dynamics).

8.3. Results Several EGF-family member polypeptide and ligand preparations were tested for their ability to stimulate tyrosine phosphorylation of each of four EGFR-family receptors expressed in recombinant CHO
cells using the tyrosine phosphorylation stimulation assay described in Section 8.2., above. The particular preparations tested for each of the four recombinant cell lines and the results obtained in the assay are tabulated below, and autoradiographs of some of these results are shown in FIG. 10.
TAB~E III
8TIMULATION OF q~YR PEO8P~IORYLATION
OF EGFR--FAMILY RE~ ~ .L O~S

PREPARATION RECOMBINANT CELLS
CHO/HER4#3 CHO/HER2 NRHER5 2293/HER3 EGF - - +
AMPHIREGULIN - - +
TGF-~ - - +
25 HB-EGF - _ +
FRACTION 17* + - _ -FRACTION 14*
* The identification of the HER4 tryrosine kinase stimulatory activity within the conditioned media of HepG2 cells and the isolation of these preparations is described in Section 9, infra.
;

The results indicate that EGF, AR, TGF-~, and HB-EGF, four related ligands which mediate their growth regulatory signals in part through interaction with SUBSTITUTE SHEET (RULE 261 CA 02202~33 1997-04-11 WO96/12019 PCT~S95/1352 EGFR, were able to stimulate tyrosine phosphorylation of EGFR expressed in recombinant NIH3T3 cells (for EGF, see FIG. lO, Panel 3, lane 2), but not HER4, HER2, or HER3 expressed in recombinant CHO or 293 ~' cells (FIG. lO, Panel l, 2, 4, lanes 2 and 3).
Additionally, as discussed in more detail below, the assay identified a HepG2-derived preparation (fraction 17) as a HER4 ligand capable of specifically stimulating tyrosine phoshorylation of HER4 expressed in CHO/HER4 cells alone.

9. Example: Icolation of a ~ER4 Ligand 9.l. Material~ A~d Methods 9.l.l. Cell Differentiation Aqsay For the identification of ligands specific for HER2, HER3 or HER4, the receptor expression profile of MDA-MB-453 cells offers an excellent indicator for morphologic differentiation inducing activity. This cell line is known to express HER2 and HER3, but contains no detectable EGFR. The results of the semi-quantitative PCR assays (Table III) indicated high level expression of HER4 in MDA-MB-453 cells. In addition, cDNA encoding the prototype HER4 polypeptide of the invention was first isolated from this cell line (Section 6., supra).
MDA-MB-453 cells (7500/well) were grown in 50 ml DMEM supplemented with 5% FBS and lx essential amino acids. Cells were allowed to adhere to 96-well plates for 24 hr. Samples were diluted in the above medium, added to the cell monolayer in 50 ml final volume, and the incubation continued for an additional 3 days.
Cells were then examined by inverted light microscopy for morphologic changes.

SUBSTITUTE SHEET (RULE 26 WO 96112019 PCIIUS9511352~1 9 .1. 2 . 8Ource Cells Serum free media from a panel of cultures of human cancer cells were screened for growth regulatory activity on MDA-MB-453 cells. A human hepatocarcinoma cell line, HepG2, was identified as a source of a factor which induced dramatic morphologic differentiation of the MDA-MB-453 cells.

9.1.3. Purification of ~ER4 Ligand lo The cell differentiation assay described in Section 10.1.1., supra, was used throughout the purification procedure to monitor the column fractions that induce morphological changes in MDA-MB-453 cells.
For large-scale production of conditioned medium, HepG2 cells were cultured in DMEM containing 10~ fetal bovine serum using Nunc cell factories. At about 70 confluence, cells were washed then incubated with serum-free DMEM. Conditioned medium (HepG2-C~) was collected 3 days later, and fresh serum-free medium added to the cells. Two additional harvests of HepG2-CM were collected per cell factory. The medium was centrifuged and stored at -20 C in the presence of 500 mM PMSF.
Ten litres of HepG2-CM were concentrated 16-fold using an Amicon ultrafiltration unit (10,000 molecular weight cutoff membrane), and subjected to sequential precipitation with 20% and 60% ammonium sulfate.
After centrifugation at 15,000 x g, the supernatant was extensively dialyzed against PBS and passed through a DEAE-sepharose (Pharmacia) column pre-e~uilibrated with PBS. The flow-through fraction was then applied onto a 4 ml heparin-acrylic (Bio-Rad) column equilibrated with PBS. Differentiation inducing activity eluted from the heparin column between 0.4 and 0.8 M NaCl. Active heparin fractions SUBSTITUTE SHEET rRULE 26~

CA 02202~33 1997-04-ll WO 96/12019 PCrlUS95/1352 were pooled, brought to 2.0 M ammonium sulfate, centrifuged at 12,000 x g for 5 min, and the resulting supernatant was loaded onto a phenyl-5PW column (8 x 75 mm, Waters). Bound proteins were eluted with a decreasing gradient from 2.0 M ammonium sulfate in 0.1 M Na2HPO4, pH 7.4 to 0.1 M Na2HPO4. Dialyzed fractions were assayed for tyrosine phosphorylation of MDA-MB-453 cells, essentially as described (Wen et a7., 1992, Cell 69:559-72), except PY20 was used as the primary antibody and horseradish peroxidase-conjugated goat F(ab')2 anti-mouse Ig (Cappell) and chemiluminescence were used for detection. Phosphorylation signals were analyzed using the Molecular Dynamics personal densitometer.
9.2. Results Semi-purified HepG2-derived factor demonstrated a capacity to induce differentiation in MDA-MB-453 cells (FIG. 11, Panel 1-3). With reference to the micrographs shown in FIG. 11, Panel 1-3, untreated MDA-MB-453 cells are moderately adherent and show a rounded morphology (FIG. 11, Panel 1). In contrast, the addition of semi-purified HepG2-derived factor induces these cells to display a noticeably flattened morphology with larger nuclei and increased cytoplasm (FIG. 11, Panel 2 and 3). This HepG2-derived factor preparation also binds to heparin, a property which was utilized for purifying the activity.
on further purification, the HepG2-derived factor was found to elute from a phenyl hydrophobic interaction column at l.OM ammonium sulfate (fractions 16 to 18). FIG. 11, Panel 4, shows the phenyl column elution profile. Tyrosine phosphorylation assays of the phenyl column fractions revealed that the same fractions found to induce SUBSTITUTE SHEET (RULE 26~

WO ~6/12(~19 PCI`/US9511352-1 differentiation of the human breast carcinoma cells are also able to stimulate tyrosine phosphorylation of a 185 kDa protein in MDA-MB-453 cells (FIG. 11, Panel 5). In particular, fraction 16 induced a 4.5-fold increase in the phosphorylation signal compared to the baseline signal observed in unstimulated cells, as determined by densitometry analysis (FIG. 11, Panel 6).
The phenyl fractions were also tested against the panel of cell lines which each overexpress a single member of the EGFR-family (Section 9.1., supra).
Fraction 17 induced a significant and specific activation of the HER4 kinase ( FIG. 10, Panel 1, lane 4) without directly affecting the phosphorylation of HER2, EGFR, or HER3 (FIG. 10, Panel 1-4, lane 4).
Adjacent fraction 14 was used as a control and had no effect on the phosphorylation of any of the EGFR-family receptors ~FIG. lO, Panel 1-4, lane 5).
Further purification and analysis of the factor present in fraction 17 indicates that it is a glycoprotein of 40 to 45 kDa, approximately the same size as NDF and HRG. The HepG2-derived factor also has functional properties similar to NDF and HRG, inasmuch as it stimulates tyrosine phosphorylation of HER2/pl~5 in MDA-M~-453 cells, but not EGFR in NR5 cells, and induces morphologic differentiation of HER2 overexpressing human breast cancer cells.
Recently, several groups have reported the identification of specific ligands for HER2 (see Section 2., supra ., including NDF and HRG-~. In contrast to these molecules, the HepG2-derived factor described herein failed to stimulate phosphorylation of HER2 in CH0/HER2 cells, but did stimulate phosphorylation of HER4 in CH0/HER4 cells. These findings are intriguing in view of the ability of the .CI IR~TITI ITI: Cl`l~:T ~111 F ~

CA 02202~33 1997-04-11 WO 96/12019 PCI'IUS95/1352 1 HepG2-derived factor to stimulate phosphorylation of MDA-MD-453 cells, a cell line known to overexpress HER2 and HER3 and the source from which HER4 was cloned. Since EGFR and HER2 have been shown to act S synergistically, it is conceivable that HER4 may also interact with other EGFR-family members. In this connection, these results suggest that NDF may bind to HER4 in MDA-MB-453 cells resulting in the activation of HER2. The results described in Section 10., immediately below, provide evidence that NDF interacts directly with HER4, resulting in activation of HER2.

10. Example: Reconbinant NDF-Induced, HER4 Mediated Phosphoryl~tion of ~ER2 Recombinant NDF was expressed in COS cells and tested for its activity on HER4 in an assay system essentially devoid of other known members of the EGFR-family, notably EGFR and HER2.
A full length rat NDF cDNA was isolated from normal rat kidney RNA and inserted into a cDM8-based expression vector to generate cNDFl.6. This construct was transiently expressed in COS cells, and conditioned cell supernatants were tested for NDF
activity using the tyrosine kinase stimulation assay described in Section 8.2., supra . Supernatants from cNDF1.6 transfected cells upregulated tyrosine phosphorylation in MDA-MB-453 cells relative to mock transfected COS media FIG. 12, Panel 1.
Phosphorylation peaked 10-lS minutes after addition on NDF.
The crude NDF supernatants were also tested for the ability to phosphorylate EGFR (NRS cells), HER2 (CHO/HER2 1-2500 cells), and HER4 (CH0/HER4 21-2 cells). The NDF preparation had no effect on phosphorylation of EGFR, or HER2 containing cells, but induced a 2.4 to 4 fold increase in tyrosine SUBSTITUTE SHEET (RULE 26~

WO 96/12019 PCI'JUS95fl3524 phosphorylation of HER4 after 15 minutes incubation (see FIG. 12, Panel 2). These findings provide preliminary evidence that NDF/HRG-~ mediate their effects not through direct binding to HER2, but instead by means of a direct interaction with HER4.
In cell lines expressing both HER2 and HER4, such as MDA-MB-453 cells and other breast carcinoma cells, binding of NDF to HER4 may stimulate HER2 either by heterodimer formation of these two related transmembrane receptors, or by intracellular crosstalk. Formal proof of the direct interaction between NDF and HER4 will require crosslinking of l2sI-NDF to CHO/HER4 cells and a detailed analysis of its binding characteristics.
. ~rle: Chromosomal ~apping of the ~E~4 Gene A HE~4 cDNA probe corresponding to the 5' portion of the gene (nucleotide positions 34-1303) was used for in situ hybridization mapping of the HER4 gene.
In situ hybridization to metaphase chromosomes from lymphocytes of two normal male donors was conducted using the HER4 probe labeled with 3H to a specific activity of 2.6 x 10' cpm/~g as described (~arth et al., 1986, Proc. Natl. Acad. Sci. U.S.A. 83:7400-04).
The final probe concentration was o.oS ~g/~l of hybridization mixture. Slides were exposed for one month. Chromosomes were identified by Q banding.

11.1. Results A total of 58 metaphase cells with autoradiographic grains were examined. Of the 124 hybridization sites scored, 38 (31%) were located on the distal portion of the long arm of chromosome 2 (FIG. 13). The greatest number of grains (21 grains) was located at band q33, with significant numbers of ~;IIBSTITllTE .BHFFT rRllLE 26~

CA 02202~33 1997-04-11 WO 96/12019 PCIIUS9511352~1 grains on bands q34 (10 grains) and q35 (7 grains).
No significant hybridization on other human chromosomes was detected.

12. ~xample: Activation of the ~ER4 Receptor i5 Involved in ~ignal Transduction by ~eregulin 12.1. RecombinAnt ~eregulin Induction of Tyrosine Phosphorylation of HER4 lZ.l.l ~ateriAls an~ Metho~s CHO cells expressing recombinant HER4 or HER2 were generated as previously described in Section 8.
Cells (1 x 105 of CHO/HER2 and CHO/HER4, and 5 x 105 of MDA-MB453) were seeded in 24 well plates and cultured 24 h. Cells were starved in serum free media for 1-6 h prior to addition of conditioned media from transfected COS cells, or 25 ~g/ml HER2-stimulatory Mab (N28 and N29) (Stancovski et al ., l991, Proc.
Natl. Acad. Sci. U.S.A. 88:8691-8695). Following 10 min treatment at room temperature, cells were solubilized (Section 13, infra) and immunoprecipitated with 2 ~g anti-phosphotyrosine Mab (PY20, ICN
Biochemicals) or anti-HER2 Mab (c-neu Ab-2, Oncogene Sciences) and anti-mouse IgG-agarose (Sigma). Western blots were performed using PY20 as described supra, and bands were detected on a Molecular Dynamics phosphorimager-Recombinant rat heregulin was produced as follows. A 1.6 kb fragment encoding the entire open reading frame of rat heregulin (and 324 bp of S'-untranslated sequence) was obtained by PCR using normal rat kidney RNA as a template. This fragment was inserted into a CDM8-based expression vector (Invitrogen) to generate cND~1.6. The expression plasmid was introduced into COS-1 cells using the DEAE-dextranchloroquine method (Seed et al., Proc.
Natl. Acad. Sci. U.S.A. 1987, 84:3365-3369). After SUBSTITUTE SHEET (RULE 26~

CA 02202533 l997-04-ll WO S16ll2019 PCTJUS95~1352 two days of growth in Dulbecco's Modified Eagle Medium (DMEM?/10% FBS, the medium was replaced with DM~M and the incubation continued for an additional 48 h.
Clarified conditioned medium was either used directly or was dialyzed against 0.1 M acetic acid for 2 days, dried, and resuspended as a 20-fold concentrate in DMEM.

12.1.2. ~E~ Tyrosine Phosphorylation As shown in FIG. 15, recombinant heregulin induces tyrosine phosphorylation of HER4. Tyrosine phosphorylated receptors were detected by Western blotting with an anti-phosphotyrosine Mab a, Monolayers of MDA-MB453 or CH0/HER4 cells were incubated with media from COS-1 cells transfected with a rat heregulin expression plasmid (HRG), or with a cDM8 vector control (-). The media was either applied directly (lx) or after concentrating 20-fold (20x, and vector control). Solubilized cells were immunoprecipitated with anti-phosphotyrosine Mab. b, Monolayers of CH0/HER2 cells were incubated as above with transfected Cos-1 cell supernatants or with two stimulatory Mabs to HER2 (Mab 28 and 29). Solubilized cells were immunoprecipitated with anti-HER2 Mab.
Arrows indicate the HER2 and HER4 proteins.

12 .1. 3 . ~e8ult5 In order to determine if HER4 is involved in signaling by heregulin, the ability of recombinant rat heregulin to stimulate tyrosine phosphorylation in a panel of Chinese hamster ovary (CHo) cells that ectopically express human HER2 or HER4 was examined.
The activity of recombinant heregulin was first confirmed by its ability to stimulate differentiation of human breast cancer cells (data not shown) and to .CI IR~:TITI ITF ~ T ~1 11 F '7~

CA 02202~33 l997-04-ll WO 96/12019 PCI'/US95/1352 induce tyrosine phosphorylation of a high molecular weight protein in MDA-MB453 cells (FIG. 15, Panel l).
Heregulin had no effect on CHO cells expressing only HER2 (FIG. 15, Panel 3), yet these cells were shown to have a functional receptor since their tyrosine kinase activity could be stimulated by either of two antibodies specific to the extracellular domain of HER2 (FIG. 15, Panel 3). However, heregulin was able to induce tyrosine phosphorylation of a 180K protein in CHO cells expressing HER4 (FIG. 15, Panel 2).
Species differences in ligand-receptor interactions have been reported for EGF receptor (Lax et al., 1988, Mol. Cell. Biol. 8:1970-1978) . It is unlikely that such differences are responsible for our failure to detect a direct interaction between rat heregulin and human HER2, since previous studies have shown that rat heregulin does not directly interact with rat HER2/neu (Peles et al., supra). In addition, rat, rabbit, and human heregulin share high sequence homology and have been shown to induce tyrosine phosphorylation in their target cells of human origin (Wen D. et al., supra; Holmes et al., supra; and Falls et al., supra).

12.2. Expr~ssion o~ ~ecombin~nt ~ER2 ~nd ~ER4 in ~uman CEM Cells 12.2.1. ~aterials and MethodQ
cNHER2 and cNHER4 expression plasmids were generated by insertion of the complete coding sequences of human HER2 and HER4 into cNE0, an expression vector that contains an SV2-NE0 expression unit inserted at a unique BamHI site of CDM8. These constructs were linearized and transfected into CEM
cells by electroporation with a Bio-Rad Gene Pulser apparatus essentially as previously described (Wen et al., supra). Stable clones were selected in RPMI/10%

SUBSTITUTE SHEET (RULE 26~

WO96112019 PCT~S95J13~2 FBS supplemented with 500 ~g/ml active Geneticin.
HER2 immunoprecipitations were as described in FIG.
15, using 5 x lo6 cells per reaction, and the HER2 _ Western blots were performed with a second anti-HER2 Ma~ (c-neu Ab-3, Oncogence Sciences). For metabolic labeling of HER4, 5 x l06 cells were incubated for 4-6 h in methionine and cysteine-free Minimal Essential Medium (MEM) supplemented with 2% FBS and 250 ~Ci/ml [3sS]Express protein labeling mix (New England Nuclear). Cells were washed twice in RPMI and solubilized as above. Lysates were then incubated for 6 h, 4- C with 3 ~l each of two rabbit antisera raised against synthetic peptides corresponding to two regions of the cytoplasmic domain of human HER4 (66qLARLLEGDEKEYNADGGe8 [SEQ ID No:3l] and 1010EEDLEDMMDAEEY1022 [SEQ ID No:32]). Immune complexes were precipitated with 5 ~g goat anti-rabbit Ig (Cappel) and Protein G Sepharose (Pharmacia).
Proteins were resolved on 7~ SDS-polyacrylamide gels and exposed on the phosphorimager. For Mab-stimulation assays, 5 x lo6 cells were resuspended in l00 ~l RPMI and 25 /~g/ml Mab was added for 15 min at room temperature. Control Mab 18.4 is a murine IgG1 specific to human amphiregulin (Plowman et al., l990, Mol. Cell. Biol. l0:1969-1981). Following Mab-treatment, cells were washed in PBS, solubilized (Section 13, infra), and immunoprecipitated with anti-HER2 Mab (Ab-2). Tyrosine phosphorylated HER2 was detected by PY20 Western blot as in FIG. 15.
12.2.2. ExprQssion of HER2 and HER4 in ~uman CEM Cell~
Expression of recombinant HER2 and HER4 in human CEM cells is shown in FIG. 16. Transfected CEM cells were selected that stably express either HER2, HER4, or both recombinant receptors. In FIG. 16, Panel l, SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 WO 96tl2019 PCI~/US95/1352 recombinant HER2 was detected by immunmoprecipitation of cell lysates with anti-HER2 Mab (Ab-2) and Western blotting with another anti-HER2 Mab (Ab-3). In FIG.
16, Panel 2, recombinant HER4 was detected by immunoprecipitation of 35S-labeled cell lysates with HER4-specific rabbit anti-peptide antisera. In FIG.
16, Panel 3, three CEM cell lines were selected that express one or both recombinant receptors and aliquots of each were incubated with media control (-), with two HER2-stimulatory Mabs (Mab 28 and 29), or with an isotype matched control Mab (18.4). Solubilized cells were immunoprecipitated with anti-HER2 Mab (Ab-2) and tyrosine phosphorylated HER2 was detected by Western blotting with an anti-phosphotyrosine Mab. The size in kilodaltons of prestained high molecular weight markers (Bio-Rad) is shown on the left and arrows indicate the HER2 and HER4 proteins.

12.2.3. Results These findings of Example 12 support the earlier observation that HER2 alone is not sufficient to transduce the heregulin signal. To further address this possibility, a panel of human CEM cells that express the recombinant receptors either alone or in combination was established. The desired model system was of human origin, since many of the reagents against erbB family members are specific to the human homologues. CEM cells are a human T lymphoblastoid cell line and were found to lack expression of EGF
receptor, HER2, HER3, or HER4, by a variety of immunologic, biologic, and genetic analyses (data not shown). FIG. 16 demonstrates the selection of three CEM cell lines that express only HER2 (CEM 1-3), only HER4 (CEM 3-13), or both HER2 and HER4 (CEM 2-9). The presence of a functionally and structurally intact SUBSTITUTE SHEET (RULE 26) -WO !;~6/12019 PCTJ~JS9S113~i2'~

HER2 in the appropriate cells was confirmed by the induction of HER2 tyrosine phosphorylation by each of the two antibodies specific to the extracellular - domain of HER2, but not by an isotype matched control antibody (FIG. 16, Panel 3).

12.3. Heregulin In~uction of Tyrosine Phosphorylation in CEM Cells Expressing 12.3.1. Materials and Methods ~ecombinant rat heregulin was prepared as in FIG.
15, and diluted to 7x in RPMI. The HER4-specific Mab was prepared by immunization of mice with recombinant HER4 (manuscript in preparation). CEM cells (5 x 106) were treated with the concentrated supernatants for 10 min, room temperature and precipitated with PY20 or anti-HER2 Mab (Ab-2) as described in FIG. 15.
Immunoprecipitation with anti-~ER4 Mab was performed by incubation of cells lysates with a 1:5 dilution of hy~ridoma supernatent for several hours followed by 2 ~g rabbit anti-mouse Ig (cappel) and Protein A
Sepharose CL-4B (Pharmacia). PY20 Westerns as described in FIG. 15.

12.3.2. ~eregulin Induction of Tyrosine Phosphorylation in CEM Cells Expre 9 sing ~ER4 As shown in FIG. 17, heregulin induces tyrosine phosphorylation in CEM cells expressing HER4. Three CEM cell lines that express either HER2 or HER4 alone 30 (CEM 1-3 and CEM 3-13) or together (CEM 2-9) were incubated with 7x concentrated supernatants from mock-(-) or heregulin-transfected (+) COS-1 cells.
Solubilized cells were immunoprecipitated (IP) with anti-phosphotyrosine Mab (PY20) (FIG. 17, Panel 1);
35 HER2-specific anti-HER2 Mab (Ab-2) (FIG. 17, Panel 2);
or HER4-specific Mab (6-4) (FIG. 17, Panel 3). In SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 WO 96/12019 PCI~/US95/1352 each case, tyrosine phosphorylated receptors were detected by Western blotting with anti-phosphotyrosine Mab. The size in kilodaltons of prestained molecular weight markers (BioRad) is shown on the left and arrows indicate the HER2 and HER4 proteins.

12.3.3 Result~
The panel of cEM cells were then analyzed by phosphotyrosine Western blots of cells lysates following treatment with heregulin and immunoprecipitation with three different monoclonal antibodies (Mabs). Precipitation with an anti-phosphotyrosine antibody (PY20) again demonstrates that heregulin is able to stimulate tyrosine phosphorylation in cells expressing HER4, but not in cells expressing only HER2 (FIG. 17, Panel 1).
However, precipitation with an antibody specific to the extracellular domain of HER2 demonstrates that HER2 is tyrosine phosphorylated in response to heregulin in cells that co-express HER4 (FIG. 17, Panel 2). Furthermore, precipitation with a HER4-specific Mab confirms that heregulin induces tyrosine phosphorylation of HER4 irrespective of HER2 expression (FIG. 17, Panel 3). Due to co-expression of HER2 and HER4 in many breast carcinomas, these findings suggest that earlier studies of heregulin-HER2 interactions may require reevaluation.

12.4. Covalent Cross-linking of Iodinated Heregulin to HER4 12.4.1. Materi~ls ~nd Methods To facilitate purification, recombinant heregulin was produced as an epitope-tagged fusion with amphiregulin. The 63 amino acid EGF-structural motif of rat heregulin (Wen et al., supra) from serine 177 to tyrosine 239 was fused to the N-terminal 141 amino SUBSTITUTE SHEET (RULE 26~

WO96tl2019 PCT~S951~352 acids of the human amphiregulin precursor (Plowman et al., supra). This truncated portion of heregulin has previously been shown to be active when expressed in E. coli (Holmes et al ., supra ), and the N-terminal residues of amphiregulin provide an epitope for immunologic detection and purification of the recombinant protein. This cDNA fragment was spliced into a cDM8 based expression vector for transient expression in COS-1 cells. Recombinant heregulin was lo purified by anion exchange and reverse phase chromatography as shown to be active based on the specific stimulation of HER4 tyrosine phosphorylation.
Purified heregulin was iodinated with 250 ~Ci of l2sI-labeled Bolton-Hunter reagent (NEN). CHO/HER4 or CHO/HER2 cells were incubated with l2sI-heregulin (105-cpm) for 2 h at 4 C. Monolayers were washed in PBS
and 3 mM Bis(sulfosuccinimidyl) suberate (BS3, Pierce) was added for 30 min on ice. The cells were washed in tris-buffered saline, dissolved in SDS sample buffer, run on a 7% polyacrylamide gel, and visualized on the phosphorimager.

12.4.2. Results As shown in FIG. 18, previous binding and covalent cross-linking studies have demonstrated that p45 binds specifically to HER4 and displays a single high-affinity site with a Kd of 5 nM on CH0/HE~4 cells (Section 13, infra). Preliminary cross-linking studies have been performed on these cells with recombinant heregulin revealing a high molecular weight species that corresponds to the heregulin-HER4 receptor complex.

SUBSTITUTE SHEET (RULE 261 CA 02202~33 1997-04-11 WO 96/12019 PCI~/US95/1352 12.5 Resultg As the data demonstrate heregulin induces tyrosine phosphorylation of HER4 in the absence of HER2. In contrast, heregulin does not directly - 5 stimulate HER2. However, in the presence of HER4, heregulin induces phosphorylation of HER2, presumably either by transphosphorylation or through receptor heterodimerization. Together, these experiments suggest that HER4 is the receptor for heregulin.
Most breast cancer cells that overexpress HER2 have been shown to be responsive to heregulin, whereas HER2-positive ovarian and fibroblast lines do not respond to the ligand. This observation could be explained by the fact that HER4 is co-expressed with HER2 in most or all of the breast cancer cell lines studied, but not in the ovarian carcinomas.
Furthermore, overexpression of HER2 in heregulin-responsive breast cancer cells leads to increased binding, whereas expression of HER2 in heregulin-unresponsive ovarian or fibroblast cells has no effect(Peles et al., supra).
Northern and in situ hybridization analyses localizes HER4 to the white matter and glial cells of the central and peripheral nervous system, as well as to cardiac, skeletal, and smooth muscle. This distribution is consistent with HER4 being involved in signaling by the neurotropic factors, GGF, and ARIA.
Recognition of HER4 as a primary component of the heregulin signal transduction pathway will assist in deciphering the molecular mechanisms that results in its diverse biologic effects.

SUBSTITUTE SHEET (RULE 26~

WO 96/12019 PCTllJ59S11352

13. Example: Purification of the ~ER4 ligand, p45 13.1 Material~ an~ ~ethods 13.1.1. Cell Culture and Reagents MDA-MB 453 cells were obtained from the American S Type Culture Collection (Rockville, MD) and cultured in Dulbecco's modified Eagle's medium tDMEM) supplemented with 10% fetal bovine serum and amino acids (Life Technologies, Inc.). HepG2 cells were obtained from Dr. S. Radka and cultured in 10~ fetal bovine serum containing DMEM. For large scale production of serum-free conditioned medium, HepG2 cells were propagated in Nunc cell factories. Chinese hamster ovary cells (CHO-KI) expressing high levels of either recombinant human pl85'rb~2 (CHO/HER2) or recombinant human pl80'rb34 (CHO/HER4) were generated and cultured as described in Section 8. N29 monoclonal antibody to the extracellular portion of the human HER2 receptor was a gift from Dr. Y. Yarden. Ab-3 c-neu monoclonal antibody that reacts with the human pl85'rb32 was from Oncogene Science Inc.

13 .1. 2. Human Breast Cancer Cell Differentiation Assay MDA-MB-453 human breast cancer cells overexpress pl85'rba2 but do not express the EGFR at their surface (Kraus, 1987, EMBO J. 6:605-610). A cell differentiation assay was used to monitor the chromatography fractions for their ability to induce phenotypic differentiation in MDA-MB-453 cells.

13.1.3. Purification of p45 ; Medium conditioned by HepG2 cells (HepG2-CM, 60 liters) was concentrated 26-fold using an Amicon ultrafiltration unit (10,000 molecular weight cutoff membranes) and then subjected to 50~ ammonium sulfate ((NH4)2SO44) precipitation. After centrifugation at SUBSTITUTE SHEET (RULE 261 CA 02202~33 1997-04-11 WO 96/12019 PCI'/US9511352'1 25,000 x g for 1 h, the supernatant was loaded, as five separate runs, on a phenyl-Sepharose column ~2.5 x 24.5 cm, Pharmacia LKB Biotechnology Inc.) equilibrated with 1.9 M (NH4)2S04 in 0.1 M Na2HP04, pH
7.4. Bound proteins were eluted with a 240 ml linear decreasing gradient from 1.9 M to 0 M (NH4)2S04 in 0.1 M phosphate buffer, pH 7.4. The flow rate was 70 ml/h, and 5.8-ml fractions were collected. Active fractions were pooled, concentrated, dialyzed against PBS, and then applied (three separate runs) to a DEAE-Sepharose column (2.5 x 25 cm, Pharmacia) equilibrated with PBS, pH 7.3. The flow rate was 1 ml/min. The column flow-through was then loaded (two separate runs) on a CM-Sepharose Fast Flow column (2.5 x 13.5 cm, Pharmacia) pre-equilibrated with PBS, pH 7.3.
Proteins were eluted at 1 ml/min. with a 330-ml gradient from PBS to 1 M NaCl in PBS. Fractions of 5 ml were collected. The active material was loaded on a TSKgel heparin-5PW HPLC column (7.5 x 75 mm, TosoHaas) equilibrated with PBS. The flow rate was 0.5 ml/min. A 50-ml linear NaC1 gradient (PBS to 2 M
in PBS) followed by an isocratic elution with 2 M NaCl was used to elute the bound proteins. Fractions of 1 ml were collected. Active fractions corresponding to the 1.3 M NaC1 peak of protein were pooled and concentrated. A Protein Pak SW-200 size exclusion chromatography column (8 x 300 mm, Waters) equilibrated with lO0 mM Na2HP04, pH7.4, 0.01% Tween 20 was used as a final step of purification. The flow rate was 0.5 ml/min., and 250-~l fractions were collected. Column fractions were then analyzed by SDS-PAGE (12.5% gel) under reducing conditions and proteins detected by silver staining.

~5 SUBSTITUTE SHEET ~RULE 26) WO 96/12019 PCl~/US95/13S2 13.1.4. Detection of ~yrosine-Phosphorylated Proteins by Western Blotting Aliquots of PBS-dialyzed column fractions were diluted to 200 ~l in PBS, then added to individual wells of 4 8-well plated containin~ either 5 x 105 MDA-MB-453 cells, 2 x 104 CHOJHER2 cells or s x 104 CHO/HER2 cells. Following a 10-min. incubation at 37 C, cells were washed and then lysed in 100 ~1 of boiling electrophoresis sample buffer. Lysates were heated at 100 C for 5 min., cleared by centrifugation, and then subjected to SDS-PAGE. After electrophoresis, proteins were transferred to nitrocellulose. The membrane was blocked for 2 h at room temperature with 6% hovine serum albumin in 10 mM
15 Tria-HC1, pH 8.0, 150 mM NaC1, 0.05% Tween 20. PY20 monoclonal anti-phosphotyrosine antibody (ICN, 2 h at 22 C) and horseradish peroxidase-conjugated goat anti-mouse IgG F~ab')2 (Cappel, lh at 22 C) were used as primary and secondary probing reagents, respectively.
Proteins phosphorylated on tyrosine residues were detected with a chemiluminescence reagent (Amersham Corp.).

13 .1. 5. C~O/HER2 Stimulation As~ay CHO/HERZ cells were seeded in 24-well plates at 1 X 105 cells/well and cultured 24 h. Monoclonal antibody N29 specific to the extracellular domain of pl85'rb32 (Stancovski et al., l991, PNAS 88:8691-8695) was added at 25 ~g/ml. Following a 20-min. incubation 3 at room temperature, media were removed and cells were solubilized for 10 min. on ice in PBS-TDS (10 mM
sodium phosphate, pH 7.25, 150 mM NaC1, 1% Triton, o.5% sodium deoxycholate, 0.1% SDS, 0.2% NaN3, 1 mM
r NaF, 1 m M phenylmethylsulfonyl fluoride, 20 ~g/ml aprotinin~ with occasional vortexing. Clarified ~1 lR~:TlTI IT~ T IDI ~

CA 02202~33 1997-04-11 WO 96/12019 PCI'/US95/13~2'1 extracts were incubated for 2 h at 4 C with an antip-185'rb~32 antibody (Ab-3 c-neu, Oncogene Science Inc.).
Rabbit anti-mouse IgG (Cappel) and protein A-Sepharose were then added, and samples were incubated an additional 30 min. Immune complexes were washed 3 times with PBS-TDS, resolved on a 7% polyacrylamide gel, and electrophoretically transferred to nitrocellulose. Phosphorylation of the receptor was assessed by Western blot using a 1:1000 dilution of PY20 phosphotyrosine primary antibody (ICN
Biochemicals) and a 1:500 dilution of 125I-sheep anti-mouse F(ab') 2 (Amersham Corp.).

13.1.6. Covalent Cross-linking of Iodinated p45 HPLC-purified p45 (1.5 ~g) was iodinated with 250 ~Ci of l24I-labeled Bolton-Hunter reagent obtained from Du Pont-New England Nuclear. l25I-p4s was purified by filtration through a Pharmacia PD-10 column. The specific activity was 104 cpm/ng. 12sI-p45 retained its biological activity as confirmed in a differentiation assay as well as a kinase stimulation assay (data not shown). Binding of radiolabeled p45 was performed on 2 x 105 CHO/HER4 cells and 4 x 105 CHO-KI or CHO/HER2 cells in 12-well plates. Cell monolayers were washed twice with 1 ml of ice-cold binding buffer (DMEM
supplemented with 44 mM sodium bicarbonate, 50 mM BES
[N-, N-Bis (2-hydroxyethyl) -2-aminoethan-sulfonic acid], pH 7.0, 0.1~ bovine serum albumin) and then incubated on ice for 2 h with 50 ng/ml 125I-p45 in the absence or the presence of 250 ng/ml unlabeled p45.
The monolayers were washed twice with PBS and then incubated in the presence of 1 mM
bis (sulfosuccinimidyl)suberate (BS3, Pierce) in PBS for 45 min. on ice. Supernatants were discarded, and the reaction was quenched by adding 0.2 M glycine in PBS.

SUBSTITUTE SHEET (RUEE 26~

W096/12019 PCT~S95)13~2 Cells were washed and then lysed by adding 150 ~l of boiling electrophoresis sample buffer containing o.l M
dithiothreitol. Samples were boiled for 5 min. and 50 . ~l of each sample was loaded on 7.5% polyacrylamide - 5 gels. Dried gels were analyzed using a Molecular Dynamics PhosphorImager and then exposed to Kodak X-Omat AR films.

13.l.7. Binding Analysis of Iodinated p45 CHO/~ER4 cells, CHO-KI cells (lO; cells/well), and CHo/HER2 cells (2 x lOs cells/well) were seeded in 24-well plates. After 48 h, cells were washed with binding buffer and then incubated with increasing concentrations of 12~I-p45. Nonspecific binding was determined in the presence of excess unla~eled p45.
After a 2-h incubation at 4 c, the cells were washed three times with binding buffer and then lysed in 500 ~l of 0.5M NaOH, O.l~ SDS. Cell-associated radioactivity was determined by using a ~-counter.
Scatchard analysis was performed using the computerized LIGAND program (Munson and Rodbard, 1980, Anal. Biochem 107:220-239).

13.l.8. N-terminal Amino Acid ~equence The N-terminal sequence analysis of p45 (z5 pmol) was performed as previously described (Shoyab et al., l990, Proc. Natl. Acad. Sci. 87:7912-7916).

13.2. Purification of the ~ER4 ligand, p45 Sixty liters of medium conditioned by HEPG2 cells was used as a starting material, and throughout the purification procedure, bioactivity was assessed by a cell differentiation assay described in Section lO.1.1., supra. After concentration (1540 mg of protein) and ammonium sulfate precipitation, the SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 WO 96/12019 PCrlUS9511352-~

active material (1010 mg of protein~ was loaded on a phenyl-Sepharose column (FIG. l9, Panel 1). Column fractions 40-85 (348 mg of protein eluting between lM
ammonium sulfate and OM ammonium sulfate) were found ,~
to induce morphological changes in MDA-MB-453 cells.
The biologically active column flow-through (174 mg of protein) was subjected to a cation-exchange chromotography (FIG. 19, Panel 2) with activity eluting between 0.35 and 0.48 M NaCl. The active fractions were pooled (1.5 mg of protein) and applied to an analytical heparin column (FIG. 19, Panel 3).
The differentiation activity eluted from the heparin column between 0.97 and 1.45 M NaCl (fractions 27-38).
Size exclusion chromatography of the heparin column fractions 35-38 achieved a homogeneous preparation of the human breast cancer cell differentiation factor.
A major protein peak eluted with a molecular weight greater than 70,000 (FIG. 19, Panel 4). Fractions 30 and 32 assayed at 30 ng/ml confirmed the bioactivity of this protein with phenotypic changes being apparent after 24 hours. SDS-PAGE analysis of these column fractions followed by silver staining of the gel showed that the biologically active peak contained a single protein migrating around 45 kDA (FIG. 20). The faint 67 kDa band corresponds to a staining artifact, as evidenced by the left lane of the gel, which contained no sample. The amount of pure protein recovered in fractions 30-33 was estimated to be 6 micrograms. The difference in the molecular weight estimated by size exclusion chromatography and SDS-PAGE indicates that this protein may form dimers or oligomers under non-denaturing conditions.

SUBSTITUTE SHEET (RULE 26~

-WO 96/12~19 PCI`JUS9!j11352;~

13.3. N-terminal Amino ACid Sequence of p45 Twenty-five pmol of p45 was subjected to direct amino acid sequencing, identifying the sequence Ser-Gly-X-Lys-Pro-X-X-Ala-Ala [SEQ ID No:33]. An X
denotes a sequenator cycle in which a precise amino acid could not be assigned. comparison of this partial sequence with two protein data bases (GenBank release 73, EMBL release 32) revealed a perfect homology between the identified residues and a region of the amino terminus of heregulin (Holmes et al., supra) The N-terminal serine residue of p45 corresponds to residue 20 of the deduced amino acid sequence of heregulins.

13.~. p45 Stimulateq Protein Phosphorylation FIG. 21, Panel 1 shows the stimulatory effect of sequential fractions from the size exclusion chromatography column on tyrosine phosphorylation in MDA-MB-453 cells. Densitometric analysis of the 20 autoradiogram revealed that ~ractions 30-34 were essentially equipotent. Homogeneously purified p45 specifically stimulated tyrosine phosphorylation of pl8 O~rbB4 ( FIG. 21, Panel 2). p45 was not able to stimulate phosphorylation in CH0/HER2 cells, and the 25 cell were found to express functional p1ss~rbB2 receptor as evidenced by immunoreactivity with 5 monoclonal antibodies specific to different regions of pl85'rbB2.
p45 has an N-terminal amino acid sequence similar to the recently isolated pl85'rbB2 ligand.
13.5. Binding and Covalent Cro~-linking of P45 to p18o~rb8~
Binding and cross-linking studies were performed f in order to confirm that p45 was able to bind to pl80'rb94. Binding studies revealed that while no SUBSTITUTE SHEET ~RULE 261 CA 02202~33 1997-04-11 WO 96112019 PCI~/IJS9511352 specific binding of 125I-p45 to CH0-KI and CHO/HER2 cells could be measured, CH0/HER4 cells displayed a single high affinity site (Kd about 5nM) with 7 x 104 receptors/cell (FIG. 22, Panel 1). The results of iodinated p45 cross-linking to CH0-KI, CHO/HER2, or CHO/HER4 cells are presented in FIG. 22, Panel 2.
Whereas no cross-linked species was observed in either CHO-KI or CHO/HER2 cells, four distinct bands were observed in CHO/HER4 cells, migrating as 45-, 100-, and 210-kDa species, and a very high molecular weight species. In the presence of unlabeled p45, ~25I-p45 binding was greatly reduced. The 45 kDa band represents uncross-linked yet p180'rb~4 associated 125I-p45. The 210 kDa band corresponds to the p45-pl80'rb~4 complex (assuming an equimolar stoichiometry of ligand and receptor), whereas the high molecular weight band is presumed to be a dimerized form of the receptor-ligand complex. The 100 kDa band could represent a truncated portion of the extracellular domain of the pl80'rb~4 receptor complexed to 125I-p45 or a covalently associated p45 dimer. The c-kit ligand provides precedence for cross-linked dimers (Williams et al., 1990, Cell 63:167-174).

13.6. Re~ults The HER4 ligand, p45, purified from medium conditioned by HepG2, induces differentiation of breast cancer cells and activates tyrosine phosphorylation of a 185 kDa protein in MDA-MB-453 cells. p45 is not capable of directly binding to pl85'rbB2 but shows specificity to HER4/pl80erb~4.

SUBSTITUTE SHEET (RULE 26~

WO 96/12019 ~ US95/1352 1~. Example: Targeted Cytotoxicity Mediated By A
Chimeric Heregulin-Toxin Protein

14.1. Materials an~ Methods 14.1.1. Reagents and Cell ~ines Heregulin ~2-Ig and the mouse monoclonal antibody directed against the Pseudomonas exotoxin (PE) was supplied by Dr. J.-M. Colusco and by Dr. Tony Siadek, respectively (Bristol-Myers-squibb, Seattle, WA). The cell lines BT474, MDA-MB-453, T47D, SKBR-3, and MCF-7 (all breast carcinoma), LNCaP (prostate carcinoma), CEM (T-cell leukemia) and SXOV3 (ovarian carcinoma) were obtained from ATCC (Rockville, MD). The H3396 breast carcinoma cell line and the L2987 lung carcinoma cell line were established at Bristol-Myers-Squibb ~Seattle, WA). The AU565 breast carcinoma cell line was purchased from the Cell Culture laboratory, Naval Biosciences Laboratory (Naval Supply Center, Oakland, CA). All cell lines were of human origin.
BT474 and T47D cells were cultured in IMDM
supplemented with 10~ fetal bovine serum (FBS) and 10 ~g/ml insulin~ MCF-7, H3396, LNCaP and L2987 were cultured in IMDM supplemented with 10~ FBS. SKBR3 and SKOV3 cells were grown in McCoys media supplemented with 10% FBS and 0.5% non-essential amino acids.
AU565 cells were cultured in RPMI 1640 media supplemented with 15% FBS and CEM transfectants (see section 15.1.5., infra) were cultured in RPMI 1640 supplemented with 10% FBS and 500 ~g/ml G418.
14.1.2. Construction of HA~-T2 ~2 Expression Plasmid Rat heregulin cDNA (Wen et al., 1994, Mol. Cell.
; Biol. 14:1909-1919) was isolated by RT-PCR using mRNA
from rat kidney cells as template. The cDNA was SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 WO 96112019 PCTIUS95/1352'1 prepared in chimeric form with the AR leader sequence by a two-step PCR insertional cloning protocol using cARP (Plowman et al., 1990, Mol. Cell. Biol. 10:1969-1981) as template to amplify the 5' end of the chimeric ligand using the oligonucleotide primers CARP5:
(5'-CGGAAGCTTCTAGAGATCCCTCGAC-3') [SEQ ID No:34]
and ANSHLIK2:
(3'CCGCACACTTTATGTGTTGGCTTGTGTTTCTTCTA~ llCCA
G- 5') [SEQ ID No:35].
The EGF-like domain PCR was amplified from cNDF1.6 (Plowman et al., 1993, Nature 366:473-475) using the oligonucleotide primers ANSHLIK1:
(5'-CAAAAATGGAAAAAATAGAAGAAACAGAAGCCATCTCATAA
AGTGTGCGG-3') t SEQ ID No:36]
and XNDF1053:
(3'-GTCTCTAGATTAGTAGAGTTCCTCCG~~ CTTG-5') [ SEQ ID
No:37].
The products were com~ined and reamplified using the oligonucleotide primers CARP5 and XNDF1053. The HAR (heregulin-amphiregulin) construct (cNANSHLIK) was PCR amplified in order to insert an Nde I restriction site on the 5' end and a ~ind III restriction site on the 3' end with the oligonucleotide primers NARP1:
(5'-GTCAGAGTTCATATGGTAGTTAAGCCCCCCCAAAAC-3') [ SEQ ID
No:38]
and NARP4:
(3'-GGCAGTTCTATGAACACGTTCACGGGCTTGCTTAAATGACCGCTGGCA
ACGGTCTTGATACAATACCGTAGAAAAATGTTTAGCCTCCTTGAGATGTTCGAA
TCTCCTAGAAAC-5') [SEQ ID No:39].

SUBSTITUTE SHEET (RULE 26) WO96/12019 PCT~S95~13~2 The resulting 287 bp DNA fragment was digested with Nde I and Hind III, followed by ligation into the compatibly digested expression plasmid pBW 7.0 which contained, in frame at the 5~ fusion site, the nucleotide sequence encoding for of PE40 (Friedman et al., 1993, Cancer Res. 53:334-339). The resulting expression plasmid pSE 8.4 then contained the gene fusion encoding the chimeric heregulin-toxin protein, under the control of a IPTG-inducible T7 promoter.
14.l.3. Expre~ion and Isolation of Recombinant HAR-T~ ~2 Protein The plasmid pSE 8.4 encoding the chimeric protein HAR-TX ~2 was transformed into the E. coli strain BL21 (~DE3). Cells were grown by fermentation in T broth containing lO0 ~g/ml ampicillin at 37C to a optical density of A6;0 = 4.8, followed by induction of protein expression with l mM isopropyl-l-thio-~-D-galactopyranoside (IPTG). After 90 minutes the cells were harvested by centrifugation. The cell pellet was frozen at -70C, then thawed and resuspended at 4C in solubilization buffer (50 mM Tris-HCl (pH 8.0), lO mM
EDTA, l ug/ml leupeptin, 2 ug/ml aprotinin, l ug/ml pepstatin-A, 0.5 mM PMSF) containing l~ tergitol by homogenization and sonication. The insoluble material of the suspension, containing inclusion bodies with the HAR-TX ~z protein, was pelleted by centrifugation and washed three times with solubilization buffer containing 0.5% tergitol (first wash), l M NaCl (second wash), and buffer alone (third wash).
The resulting pellet containing pre-purified inclusion bodies was dissolved in 6.5 M guanidine-HCl, O.l M Tris-HCl (pH 8.0), 5 mM EDTA; sonicated; and refolded by rapid dilution (lO0-fold) into O.l M Tris-HCl (pH 8.0), 1.3 M urea, 5 mM EDTA, 1 mM glutathione, SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 WO 96112019 PCI~/US9511352 1 and 0.1 mM oxidized glutathione at 4C. The addition of the denaturating agent urea at low concentration was utilized to allow slow refolding and avoid the formation of aggregates. The refolded HAR-TX ~2 ~' protein was diluted 2-fold with 50 mM sodium phosphate (pH 7.0) and applied to a cation-exchange resin (POROS
50 HS, PerSeptive Biosystems, Cambridge, MA), pre-equilibrated in the same buffer. The HAR-TX ~2 protein was eluted with a 450 nM NaCl step gradient in 50 mM sodium phosphate (pH 7.0) and fractions were analyzed using SDS-PAGE and Coomassie blue staining.
Final purification of pooled fractions was performed by chromatography using Source 15S cation-exchange media (Pharmacia, Uppsala, Sweden) equilibrated with 50 mM sodium phosphate (pH 6.0). Chimeric HAR-TX ~2 protein was eluted with a gradient of 0-1 M NaCl in the same buffer and analyzed by SDS-PAGE.

14.1.4. ELI~A Test for Determination of Binding Activity Membranes from 5 x 10' MDA-MB-453 cells were prepared and coated to 96 well plates as previously described for H3396 human breast carcinoma cells (Siegall et al., 1994, J. Immunol. 152:2377-2384).
Subsequently, the membranes were incubated with titrations of either HAR-TX ~2 or PE40 ranging from 0.3 - 300 ug/ml and the mouse monoclonal anti-PE
antibody EXA2-lH8 as the secondary reagent (Siegall et al ., supra ) . The isolate of the toxin portion PE40 alone was used to determine unspecific binding activity to ~he membrane preparations, in comparison with the specific binding activity of HAR-TX ~2.

SUBSTITUTE SHEET (RULE 26~

WO96112019 PCT~S95~13~2 _ 99 _ 14.l.5. Phosphotyrosine Analysis of tr~n~fected CEM cell lines `CEM cells expressing various receptors of the EGF - R family (1-5 x lo6 cells) were stimulated with 500 q 5 nglml HAR-TX ~2 for 5 minutes at room temperature.
The cells were pelleted and resuspended in O.l ml lysis buffer (50 mM Tris-HCl, pH 7.4, l50 mM NaCl, 5 mM MgCl2, 1~ NP40, 0.5% deoxycholate, 0.1% sodium dodecylsulfate, 1 mM sodium orthovanadate) at 4c.
lO Insoluble material was pelleted by centrifugation at lO,000 x g for 30 seconds, and samples were analyzed by SDS-PAGE and subsequent Western blot analysis using the anti-phosphotyrosine antibodies 4GlO (ICN, Irvine, CA) and PY20 (Upstate Biotechnology, Lake Placid, New

15 York).

14.l.6. Cytotoxicity Assays For cytotoxicity assays, tumor cells (lOs cells/ml) in growth medium were added to 96-well flat 20 bottom tissue culture plates (o.l ml/well) and incubated at 37c for 16 h. Cells were incubated with HAR-TX ~2 for 48 h at 37C, washed twice with phosphate buffered saline (PBS), followed by addition of 200 ~l/well of l.5 ~M calcein-AM (Molecular Probes Inc., 25 Eugene, OR). The plates were incubated for 40 minutes at room temperature (RT), and the fluorescence measured using a Fluorescence Concentration Analyzer (Baxter Heathcare Corp., Mundelein, IL) at excitation/emission wavelengths of 485t530 nm.
30 Calcein-AM is mem~rane permeable and virtually non-fluorescent. When it is hydrolyzed by intracellular esterases, an intensely fluorescent product, calcein is formed. The % cytotoxicity was calculated as previously described (Siegall et al., supra). To 35 determine the specificity of the cytotoxic effect of HAR-TX ~2 competitive assays were performed on LNCaP

SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 WO 96tl2019 PCI'/US9511352 and on MDA-MB-453 cells. Treated essentially as described above, plates were incubated with increasing concentrations of HAR-TX ~2 in presence heregulin ~2-Ig (0.002-5.0 ~g/ml) or with HAR-TX ~2 (50 ng/ml).
Isotype matched L6-Ig (Hellstrom et al., 1986, Cancer Res. 46:3917-3923) was used as negative control for the competition assay.

14.1.7. Generation of Monoclonal Antibodies to HE~4 HER4, expressed in baculovirus, was used as the immunogen for subcutaneous injection into 4-6 week old female BALB/c mice. Immunization was performed 4 times (approximately 1 month apart) with 20 ~g of HER4 protein given each time. Spleen cells from immunized mice were removed four days after the final immunization and fused with the mouse myeloma line P2x63-Ag8.653 as previously described (Siegall et al., supra ) . Positive hybridoma supernatants were selected by ELISA screening on plates coated with HER4 transfected CH0 cells (Plowman et al., 1993, Nature 366:473-475) and selected against parental CHO cells and human fibroblasts. Secondary screening was performed by ELISA on plates coated with baculovirus/HER4 membranes. Positive hybridomas were rescreened by two additional rounds of ELISA using CHO/HER4 and HER4 negative cells, and identified false positive were removed. Positive hybridomas were cloned in soft agar and tested for reactivity with the HER4 positive MDA-MB-453 human breast carcinoma cell line and CEM cells co-transfected with HER4 and HER2.
Anti-HER4 hybridoma line 6-4-11 (IgGl) was cloned in soft agar and screened for reactivity to native and denatured HER4. A second antibody (7-142, IgG2a) was SUBSTITUTE SHEET (RULE 26~

-also selected and found to bind to the cytoplasmic domain of HER4.
The characteristics for both antibodies are summarized in Table VI (see section 15.2.8., infra) 14.1.8. Quantitation of ~ER2, ~R3, and HER4 Protein in tumor cell line~

Cell-surface expression of HER2, HER3, and HER4 protein was determined by quantification of specific antibody binding, detected by the CAS Red Chromagen system (Becton Dickson Cellular Imaging System, Elmhurst, IL). HER2 staining was performed by using mouse anti-HER2 mAb 24.7 (Stancovski et al., l991, Proc. Natl. Acad. Sci. USA 88:8691-8695) as primary, and biotinylated goat anti-mouse IgG (Jackson Labs, West Grove, PA) as secondary antibody as previously described (Bacus et al., 1993, Cancer Res. 53:5251-5261). For detection of HER3 and HER4 the primary antibodies used were, respectively, mouse anti-HER3 mAb RTJ2 (Santa Cruz Biotech, Santa Cruz, CA) at 2.5 ~g/ml concentration or mouse anti-HER4 mAb 6-4-11 at 15 ~g/ml concentration followed by incubation with biotinylated rabbit anti-mouse IgG (Zymed Labs, South San Francisco, CA).
The staining procedure was performed at RT as follows: cells were fixed in 10% neutral buffered formalin for 60 minutes, washed with H2O and rinsed with Tris buffered saline (TBS; 0.05 M Tris, 0.15 M
NaCl, pH 7.6). Unspecific binding sites were blocked by incubation with 10~ goat serum (for HER2) or rabbit serum (for HER3 and HER4) in 0.1~ bovine serum albumin/TBS for 15 minutes. Subsequently, cells were incubated with primary and secondary antibodies for 30 and 20 minutes, respectively, followed by incubation with alkaline phosphatase conjugated streptavidin SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 WO 96tl2019 PCI'lUS9S/13~i2 (Jackson Labs) for 15 minutes, with TBS washing between the steps. Detection of antibody binding was achièved using CAS Red Chromagen (Becton Dickinson Cellular Imaging System, supra) for 4 minutes (HER2), ~-lO minutes (HER3), and 10-12 minutes (HER4). Cells were counterstained as described in the CAS DNA stain protocol (Becton Dickinson Cellular Imaging System).

14.1.9. Image Analy~is Image analysis was performed as previously described (Bacus et al., 1993, supra ; Bacus et al ., 1992, Cancer Res. 52:2580-2589; Peles et al., 1992, Cell 69:205-216). In the quantitation of HER2, both solid state imaging channels of the CAS 200 Image Analyzer (Becton Dickinson Cellular Imaging System), a microscope-based, two-color system were used. The two imaging channels were specifically matched to the two components of the stains used. one channel was used for quantitating the total DNA of the cells in the field following Feulgen staining as described (Bacus et al., 1990, Mol. Carcinoq. 3:350-362), and the other for quantitating the level of HER2, HER3, and HER4 proteins following immunostaining. ~hen the total DNA
amount per cell was known, the average total HER2, HER3, and HER4 per cell were computed. sparsely growing AU565 cells were used for calibrating the HER2 protein. Their level of staining was defined as 100%
of HER2 protein content (1.0 relative amounts - 10,000 sum of optical density); all other measurementS of HER2, HER3, and HE~4 protein were related to this value.

14.1.10. Determination of the LD50 of HAR-TX ~2 For toxicity studies, HAR-TX ~2 at different concentrations was administered intravenous in 0.2 ml SUBSTITUTE SHEET (RULE 26~

WO 96/12019 PC~,IUS9511352'~

PBS. Per group each two mice and two rats were injected.

14.2. RE~TS
514.2.1. Con~tructiOn, ~xpr~ssion, and Purification of HAR-TX ~2 The HAR-TX ~2 expression plasmid, encoding the hydrophilic leader sequence from amphiregulin (AR), heregulin ~2, and PE40, under control of the IPTG
inducible T7 promoter, was constructed as described in Section 15.1.2., supra , and is diagrammatically shown in FIG. 23, Panel 1. The AR leader se~uence was added to the N-terminus of heregulin to facilitate the purification procedure (FIG. 23, Panel 2). FIG. 24A
and 24B show the nucleotide sequence and the deduced amino acid sequence of the cDNA encoding HAR-TX ~2 Chimeric HAR-TX ~2 protein was expressed in E.
col i of inclusion bodies. Recombinant protein was denatured and refolded as described in Section 15.1.2., supra, and applied to cation-exchange chromatography on a POROS HS column. Semi-purified HAR-TX ~2 protein was detected by PAGE and Coomassie blue staining as major band migrating at 51 kDa (FIG.
25, lane 2). The column flow-through from POROS HS
contained only small amounts of HA~-TX ~2 (FIG. 25, lane 3). POROS HS chromatography resulted in ~50%
purity of HAR-TX ~2 (FIG. 25, lane 4). Further purification, to >95~ purity, was done by chromatography using Source 15S cation-exchange resin (FIG. 25, lane 5). The monomeric nature of purified -HAR-TX ~2 was determined by non-reducing SDS-PAGE
(FIG. 25, lane 6) which exhibited the same migration pattern as under reducing conditions (FIG. 25, lane 5).

SUBSTITUTE SHEET (RULE 26 WO96112019 PCT~S95/13521 14.2.2. ~inding of EAR-~X ~2 to MDA-MB-453 Cell Membrane~
To determine the specific binding activity of HAR-TX ~2, an ELISA assay was performed using membranes of the HER4 positive human breast carcinoma cell line MDA-MB-4s3 as the target for binding. HAR-TX ~2 was found to bind to the immobilized cell membranes in a dose-dependent fashion up to 300 ~g/ml (FIG. 26). PE40, the toxin component of HAR-TX ~2 used as negative control, was una~le to bind to MDA-MB-453 membranes.

14.2.3. Tyrosine Phosphorylation of HER
Forms on Transfected CEM Cells To test the biological activity of HAR-TX ~2 a HER4 receptor phosphorylation assay was performed as previously described for heregulin (Carraway et al., 1994, J. Biol. Chem. 269:14303-14306). CEM cells expressing different HER family mem~ers were exposed to HAR-TX ~2 and stimulation of tyrosine phosphorylation was analyzed by phosphotyrosine immunoblot analysis (Section 4, supra; Section 15.1.5., supra) . As shown in FIG. 27, HAR-TX ~2 induced tyrosine phosphorylation in CEM cells expressing HER4 either alone or together with HER2, but not in cells expressing only HER2 or HERl. This result demonstrates that HER4 is sufficient and necessary for induction of tyrosine phosphorylation in response to HAR-TX ~2, which is not true for HERl and for HER2. The fact that HAR-TX ~2 does not induce tyrosine phosphorylation in CEM cells transfected with HERl confirms that the hydrophilic leader sequence of amphiregulin does not affect the specificity of the SUBSTITUTE SHEET (RULE 26~

WO ~6/12019 PCTIUSg~/1352-~

heregulin moiety in its selective interaction between receptor family members.

14.2.4. Cytotoxicity of HAR-TX ~2 Against Tumor Cells The cell killing activity of HAR-TX ~2 was determined against a variety of human cancer cell lines. AU56~ and SKBR3 breast carcinomas and LNCaP
prostate carcinoma were sensitive to HAR-TX ~2 with 1 ECso values of 25, 20, 4.5 ng/ml, respectively, while SKOV3 ovarian carcinoma cells were insensitive to HAR-TX ~2 (EC50 ~2000 ng/ml) (FIG. 28, Panel 1). Addition of heregulin ~2-Ig to LNCaP cells reduced the cytotoxic activity of HAR-TX ~2 (FIG. 28, Panel 2).
In contrast, L6-Ig, a chimeric mouse-human antibody with a non-related specificity but matching human FC
domains (Hellstrom et al., supra), did not inhibit the HAR-TX ~2 cytotoxic activity (FIG. 28, Panel 2).
Thus, the cytotoxic effect of HAR-TX ~2 was due to specific heregulin-mediated binding. Similar data were obtained using MDA-MB-453 cells (not shown).

14.2.5. E~2, ~ER3, and HER4 Receptor Density on Human Tumor Cells:
2~ Correlation with ~AR-TX ~2-Hediated cytotoxicity To understand why cell lines differed in their sensitivity to HAR-TX ~2, their levels of HER2, HER3, and HER4 were quantitated by image analysis (see Section 15.1.8. and 15.1.9., supra) using receptor specific monoclonal antibodies (Table IV). The data strongly indicate that HER4 expression is required for heregulin directed cytotoxic activity. All seven of the tumor cell lines which expressed detectable levels of HER4 were found to be sensitive to HAR-TX ~2-SUBSTITUTE SHEET ~RULE 26~

WO 96/12019 PCI'/US9511352-~

mediated killing with ECso values ranging from 1-125 ng/ml. Moreover, the sensitivity of the différent cell lines correlates directly with the expressiOn level of HER4: MCF-7 cells displaying the lowest detectable levels of HER4 were found to be the least sensitive (ECso = 125 ng/ml) of the cells which did respond. All four cell lines which were found to be devoid of any detectable HER4 expression on their surface were found to be resistant to HAR-TX ~2.
Three of them, SKOV3, L2987 and H3396, displayed both HER2 and HER3 in the absence of HER4.

TABLE IV
Comparative ~ER2, HER3, and ~ER4 cell ~urface receptor density and cytotoxicity of ~AR-TX ~2 on human tumor cell lines RELATIVE AMOUNTS
EC50 ~
Cell Line Type HER2 HER3 ~ER4 (nq/ml) BT474 Breast 1.6 0.32 0.3 MDA-MD-453 Breast 1.2 1.08 0.3 2 25 LNCaP Prostate 0.7 2.6 0.85 4.5 T47D Breast 0.04 0.1 0.1 9.5 SKBR3 Breast 4.6 2.5 0.56 20 AU565 Breast 4.6 0.73 0.18 25 MCF-7 Breast 0.04 1.8 0.05 125 H3396 Breast 0.6 2.5 -- >2000 SKOV3 Ovarian 0.64 1.3 -- >2000 L2987 Lung 0.16 1.4 -- >2000 30 CEM T leukemia -- -- -- >2000 SUBSTITUTE SHEET (RULE 26~

WO 96~12019 Pcous95~l3~;2 14 . 2 . 6 . ~AR~ 2 Induces Tyrosi~e Phosphorylation in Tumor Cells That Do Not Express ~ER4 In contrast to reports that heregulin directly binds to both HER3 and HER2/HER3 in a heterodimer configuration (carraway et al., 1994, J. Biol. Chem.
269:14303-14306; Sliwkowski et al., 1994, J. Biol.
Chem. 269:14661-15665), tumor cells that express HER3 alone (L2987) or co-express HER2 and HER3 (H3396 and SKOV3 ) were insensitive to HAR-TX ~2. Direct interaction of H3396 and L2s87 cells with the chimeric protein was determined by phosphotyrosine immunoblots following HAR-TX ~2 induction. HAR-TX ~2 was found to 1~ induce tyrosine phosphorylation in both tumor cell types (FIG. 29) similar to that previously seen in COS-7 cells transfected with HER2 and HER3 (Sliwkowski et al., supra). SROV3 cells were found to exhibit the same tyrosine phosphorylation pattern in the presence or absence of heregulin and thus direct interaction between receptors and heregulin could not be established (data not shown). However, previous studies indicate that heregulin does not bind to these cells (Peles et al., supra).

14.2.7. Toxicity of HAT-TX ~2 For the toxicity studies, HAR-TX ~2 was administered as described in section 15.1.10. In mice, 2/2 animals died at 2 mg/kg, 2/2 died at 1 mg/~g, 1/2 died at 0.75 mg/kg, and 0/2 died at 0.~
mg/kg, thus the LDso is about 0.75 mg/kg (Ta~le V). In rats the determined LDs was slightly higher, as 50% of the animals died at 1 mg/kg (Table V).

SUBSTITUTE SHEET tRULE 26 W O96tl2019 PCTrUS9511352 TABLE V
Toxicity of HAR-TX ~2 8peciesdose[mg/ng] Lethality [%]
mouse 0.5 o 0.75 50 2 lOo rat 1 50 2 loo 14.2.8. Characteristics of HER4 ~pecific Monoclonal Antibodies lS The characteristics of the HER4 specific monoclonal antibodies disclosed herein are summarized in Table VI.

TABLE VI
Characteristics of HER4 Antibodies Abbreviations: Cyto, cytoplasmic domain;
ECD, extracellular domain; FACS, fluorescence-activated cell sorter analysis; fibro, fibroblasts; ICC, immunocytochemistry;
RIP, receptor immunoprecipitation;
E~yorldo~I~oeyp~ R~P~--t-r~ ACS EI~R4Ig ~CC TCC
f ~ ~ro C~O/E14 EIAR2 I g 6-4-11 IgGl ~ - ECD
7-142 IgG2a - ~ Cyto - - - ~

15. Microorganism and Cell De~osit~
The following microorganisms and cell lines have been deposited with the American Type Culture Collection, SUBSTITUTE SHEET (RULE 26~

WO g6112019 PCTIUS9~11352 and have been assigned the following accession numbers:
Microorqanism Plasmid Accession Number - E.coli SCS-1 pBSHER4Y 69131 (con~aining the complete human HER4 coding sequence) Cell Line Accession Number CHO/HER4 21-2 C~L11205 Hybridoma Cell line 6-4-11 H~11715 Hybridoma Cell line 7-142 HB11716 The present invention is not ~o be limited in scope by the microorganisms and cell lines deposited or the embodiments disclosed herein, which are intended as single illustrations of one aspect of the invention, and any which are functionally equivalent are within the scope of the invention. Indeed, various modifications of the invention, in addition to those shown and described herein, will become apparent to those skilled in the art from the foregoing description. Such modifications are intended to fall within the scope of the appended claims. All base pair and amino acid residue numbers and sizes given for polynucleotides and polypeptides are approximate and used for the purpose of description.
All publications and patent applications mentioned in this specification are indicative of the level of skill of those skilled in the art to which the invention pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

SUBSTITUTE SHEET (RULE 26 CA 02202~33 1997-04-11 W O96/lZ019 PCTrUS9511352 SEQUENCE LISTING

(1) GENERAL~INFORMATION:
(i) APPLICANTS: Plowman, Gregory D.
Culouscou, Jean-Michel Shoyab, Mohammed Siegall, Clay B.
Hellstrom, Ingegerd Hellstrom, Karl E.
(ii) TITLE OF INVENTION: HER4 HUMAN RECEPTOR TYROS ~iE KINASE
(iii) NUMBER OF SEQUENCES: 42 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Pennie & Edmonds (B) STREET: 1155 Avenue of the Americas (C) CITY: New York (D) STATE: New York (E) COUNTRY: U.S.A.
(F) ZIP: 10036-2711 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version -1.25 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: To be assigned.
(B) FILING DATE: Concurrently herewith.
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 08/150,704 (B) FILING DATE: 10-NOV-1993 (C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Misrock, S. Leslie (B) REGISTRATION NUMBER: 18,872 (C) REFERENCE/DOCKET NUMBER: 5624-230 (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (212) 790-9090 (B) TELEFAX: (212) 869-a864/974 (C) TELEX: 66141 PENNIE

(2) INFORMATION FOR SEQ ID NO:l:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5501 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 34..3961 SUBSTITUTE SHEET (RULE 26) CA 02202~33 1997-04-ll W O~G/12019 PCTnUS95/13~2-(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:

-Met Lys Pro Ala Thr Gly Leu ~Trp Val Trp Val Ser Leu Leu Val Ala Ala Gly Thr Val Gln Pro Ser = 10 15 20 Asp Ser Gln Ser Val Cys Ala Gly Thr Glu Asn Lys Leu Ser Ser Leu Ser Asp Leu Glu Gln Gln Tyr Arg Ala Leu Arg Lys Tyr Tyr Glu Asn Cys Glu Val Val Met Gly Asn Leu Glu Ile Thr Ser Ile Glu His Asn Arg Asp Leu Ser Phe Leu Arg Ser Val Arg Glu Val Thr Gly Tyr Val Leu Val Ala Leu Asn Gln Phe Arg Tyr Leu Pro Leu Glu Asn Leu Arg 90 95 lOO

Ile Ile Arg Gly Thr Lys Leu Tyr Glu Asp Arg Tyr Ala Leu Ala Ile Phe Leu Asn Tyr Arg Lys Asp Gly Asn Phe Gly Leu Gln Glu Leu Gly Leu Lys Asn Leu Thr Glu Ile Leu Asn Gly Gly Val Tyr Val Asp Gln Asn Lys Phe Leu Cys Tyr Ala Asp Thr Ile His Trp Gln Asp Ile Val Arg Asn Pro Trp Pro Ser Asn Leu Thr Leu Val Ser Thr Asn Gly Ser Ser Gly Cys Gly Arg Cys His Lys Ser Cys Thr Gly Arg Cys Trp Gly l90 195 Pro Thr Glu Asn His Cys Gln Thr Leu Thr Arg Thr Val Cys Ala Glu 200 . 205 210 215 Gln Cys Asp Gly Arg Cys Tyr Gly Pro Tyr Val Ser Asp Cys Cys His Arg-Glu Cys Ala Gly Gly Cys Ser Gly Pro Lys Asp Thr Asp Cys Phe SUBSTITUTE SHEET (RUl_E 26~

CA 02202~33 1997-04-11 W O96/12019 PCTrUS95/1352 Ala Cys Met Asn Phe Asn Asp Ser Gly Ala Cys Val Thr Gln Cys Pro CAA ACC TTT ~GTC TAC AAT CCA ACC ACC TTT CAA CTG GAG CAC AAT TTC 870 Gln Thr Phe Val Tyr Asn Pro Thr Thr Phe Gln Leu Glu His Asn Phe Asn Ala Lys Tyr Thr Tyr Gly Ala Phe Cys Val Lys Lys Cys Pro His Asn Phe Val Val Asp Ser Ser Ser Cys Val Arg Ala Cys Pro Ser Ser Lys Met Glu Val Glu Glu Asn Gly Ile Lys Met Cys Lys Pro Cys Thr Asp Ile Cys Pro Lys Ala Cys Asp Gly Ile Gly Thr Gly Ser Leu Met Ser Ala Gln Thr Val Asp Ser Ser Asn Ile Asp Lys Phe Ile Asn Cys Thr Lys Ile Asn Gly Asn Leu Ile Phe Leu Val Thr Gly Ile His Gly Asp Pro Tyr Asn Ala Ile Glu Ala Ile Asp Pro Glu Lys Leu Asn Val Phe Arg Thr Val Arg Glu Ile Thr Gly Phe Leu Asn Ile Gln Ser Trp Pro Pro Asn Met Thr Asp Phe Ser Val Phe Ser Asn Leu Val Thr Ile Gly Gly Arg Val Leu Tyr Ser Gly Leu Ser Leu Leu Ile Leu Lys Gln Gln Gly Ile Thr Ser Leu Gln Phe Gln Ser Leu Lys Glu Ile Ser Ala Gly Asn Ile Tyr Ile Thr Asp Asn Ser Asn Leu Cys Tyr Tyr His Thr Ile Asn Trp Thr Thr Leu Phe Ser Thr Ile Asn Gln Arg Ile Val Ile Arg Asp Asn Arg Lys Ala Glu Asn Cys Thr Ala Glu Gly Met Val Cys Asn His Leu Cys Ser Ser Asp Gly Cys Trp Gly Pro Gly Pro Asp Gln SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 W O 9~12019 PCT/US95/13~2.1 Cys Leu Ser Cys Arg Arg Phe Ser Arg Gly Arg Ile Cys Ile Glu Ser - Cys Asn Leu Tyr Asp Gly Glu Phe Arg Glu Phe Glu Asn Gly Ser Ile Cys Val Glu Cys Asp Pro Gln Cys Glu Lys Met Glu Asp Gly Leu Leu Thr Cys His Gly Pro Gly Pro Asp Asn Cys Thr Lys Cys Ser His Phe Lys Asp Gly Pro Asn Cys Val Glu Lys Cys Pro Asp Gly Leu Gln Gly Ala Asn Ser Phe Ile Phe Lys Tyr Ala Asp Pro Asp Arg Glu Cys Xis Pro Cys His Pro Asn Cys Thr Gln Gly Cys Asn Gly Pro Thr Ser ~is Asp Cys Ile Tyr Tyr Pro Trp Thr Gly His Ser Thr Leu Pro Gln His Ala Arg Thr Pro Leu Ile Ala Ala Gly Val Ile Gly Gly Leu Phe Ile Leu Val Ile Val Gly Leu Thr Phe Ala Val Tyr Val Arg Arg Lys Ser Ile Lys Lys Lys Arg Ala Leu Arg Arg Phe Leu Glu Thr Glu Leu Val Glu Pro Leu Thr Pro Ser Gly Thr Ala Pro Asn Gln Ala Gln Leu Arg Ile Leu Lys Glu Thr Glu Leu Lys Arg Val Lys Val Leu Gly Ser Gly Ala Phe Gly Thr Val Tyr Lys Gly Ile Trp Val Pro Glu Gly Glu Thr Val Lys Ile Pro Val Ala Ile Lys Ile Leu Asn Glu Thr Thr Gly Pro ; 745 750 755 Lys Ala Asn Val Glu Phe Met Asp Glu Ala Leu Ile Met Ala Ser Met Asp His Pro His Leu Val Arg Leu Leu Gly Val Cys Leu Ser Pro Thr SUBSTITUTE SHEET (RULE 26~
_ . . _ . .

CA 02202~33 1997-04-11 W O96/12019 PCTrUS95/13~2 Ile Gln Leu Val Thr Gln Leu Met Pro His Gly Cys Leu Leu Glu Tyr GTC CAC GAG~CAC AAG GAT AAC ATT GGA TCA CAA CTG CTG CTT AAC TGG 2502 Val His Glu His Lys Asp Asn Ile Gly Ser Gln Leu Leu Leu Asn Trp Cys Val Gln Ile Ala Lys Gly Met Met Tyr Leu Glu Glu Arg Arg Leu Val ~is Arg Asp Leu Ala Ala Arg Asn Val Leu Val Lys Ser Pro Asn His Val Lys Ile Thr Asp Phe Gly Leu Ala Arg Leu Leu Glu Gly Asp G~A AAA GAG TAC AAT GCT GAT GGA GGA AAG ATG CCA ATT AAA TGG ATG 2694 Glu Lys Glu Tyr Asn Ala Asp Gly Gly Lys Met Pro Ile Lys Trp Met Ala Leu Glu Cys Ile His Tyr Arg Lys Phe Thr His Gln Ser Asp Val 890 895 9oO

Trp Ser Tyr Gly Val Thr Ile Trp Glu Leu Met Thr Phe Gly Gly Lys Pro Tyr Asp Gly Ile Pro Thr Arg Glu Ile Pro Asp Leu Leu Glu Lys Gly Glu Arg Leu Pro Gln Pro Pro Ile Cys Thr Ile Asp Val Tyr Met Val Met Val Lys Cys Trp Met Ile Asp Ala Asp Ser Arg Pro Lys Phe Lys Glu Leu Ala Ala Glu Phe Ser Arg Met Ala Arg Asp Pro Gln Arg Tyr Leu Val Ile Gln Gly Asp Asp Arg Met Lys Leu Pro Ser Pro Asn Asp Ser Lys Phe Phe Gln Asn Leu Leu Asp Glu Glu Asp Leu Glu Asp Met Met Asp Ala Glu Glu Tyr Leu Val Pro Gln Ala Phe Asn Ile Pro Pro Pro Ile Tyr Thr Ser Ary Ala Arg Ile Asp Ser Asn Arg Ser Glu Ile Gly His Ser Pro Pro Pro Ala Tyr Thr Pro Met Ser Gly Asn Gln SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 WO 96/12019 PCTNS95l13~2 Phe Val Tyr Arg Asp Gly Gly Phe Ala Ala GlU Gln Gly Val Ser Val CCC TAC AGA~GCC CCA ACT AGC ACA ATT CCA GAA GCT CCT GTG GCA CAG 3318 Pro Tyr Arg Ala Pro Thr Ser Thr Ile Pro Glu Ala Pro Val Ala Gln Gly Ala Thr Ala Glu Ile Phe Asp Asp Ser Cys Cys Asn Gly Thr Leu Arg Lys Pro Val Ala Pro His Val Gln Glu Asp Ser Ser Thr Gln Arg Tyr Ser Ala Asp Pro Thr Val Phe Ala Pro Glu Arg Ser Pro Arg Gly Glu Leu Asp Glu Glu Gly Tyr Met Thr Pro Met Arg Asp Lys Pro Lys Gln Glu Tyr Leu Asn Pro Val Glu Glu Asn Pro Phe Val Ser Arg Arg Lys Asn Gly Asp Leu Gln Ala Leu Asp Asn Pro Glu Tyr His Asn Ala Ser Asn Gly Pro Pro Lys Ala Glu Asp Glu Tyr Val Asn Glu Pro Leu Tyr Leu Asn Thr Phe Ala Asn Thr Leu Gly Lys Ala Glu Tyr Leu Lys Asn Asn Ile Leu Ser Met Pro Glu Lys Ala Lys Lys Ala Phe Asp Asn Pro Asp Tyr Trp Asn His Ser Leu Pro Pro Arg Ser Thr Leu Gln His Pro Asp Tyr Leu Gln Glu Tyr Ser Thr Lys Tyr Phe Tyr Lys Gln Asn Gly Arg Ile Arg Pro Ile Val Ala Glu Asn Pro Glu Tyr Leu Ser Glu Phe Ser Leu Lys Pro Gly Thr Val Leu Pro Pro Pro Pro Tyr Arg His Arg Asn Thr Val Val CTCCAATTTC CCCACCCCCC T~ lllC--~C TGGTGGTCTT CCTTCTACCC CAAGGCCAGT 4 0 5 7 A~llllGACA CTTCCCAGTG GAAGATACAG AGATGCAATG ATAGTTATGT GCTTACCTAA 4117 SUBSTITUTE SHEET (RULE 26~
.. . . . . .. . . ..

CA 02202~33 1997-04-11 WO96/12019 PCT~US95/1352 CTTGAACATT AGAGGGAAAG ACTGAAAGAG AAAGATAGGA GGAACCACAA lvlll~llCA 4177 TTTCTCTGCA TGGvllv~lC AGGAGAATGA AACAGCTAGA GAAGGACCAG AAAATGTAAG 4237 GCAATGCTGC CTACTATCAA ACTAGCTGTC A~lllllllC 11111~1111 TCTTTCTTTG 4297 lllClllCll Ccl-ll-lll 1lllllllll TTTTAAAGCA GATGGTTGAA ACACCCATGC 4357 TAl~lv L' 1 CC TATCTGCAGG AACTGATGTG TGCATATTTA GCATCCCTGG AAATCATAAT 4417 AAAGTTTCCA TTAGAACAAA AGAATAACAT TTTCTATAAC ATATGATAGT GTCTGAAAT. 4477 TTGGillllll TCAllllvll TTGCTCTGAC CGATTCCTTT ATATTTGCTC CCCTATTTTT 4657 GCAGATACTC AGAAATGTAG TTTGCACTTA AGCTGTAATT TTAlllvllC lllll~lGAA 5077 (2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGT~: 130~3 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) ~OLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
Met Lys Pro Ala Thr Gly Leu Trp Val Trp Val Ser Leu Leu Val Ala Ala Gly Thr Val Gln Pro Ser Asp Ser Gln Ser Val Cys Ala Gly Thr Glu Asn Lys Leu Ser Ser Leu Ser Asp Leu Glu Gln Gln Tyr Arg Ala SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 WO g6/1201g ~ uS95l~352 Leu Arg Lys Tyr Tyr Glu Asn Cys Glu Val Val Met Gly Asn Leu Glu ,, 50 sS 60 Ile Thr Ser Ile Glu His Asn Arg Asp Leu Ser Phe Leu Arg Ser Val Arg Glu Val Thr Gly Tyr Val Leu Val Ala Leu Asn Gln Phe Arg Tyr 85 gO 95 Leu Pro Leu Glu Asn Leu Arg Ile Ile Ary Gly Thr Lys Leu Tyr Glu Asp Arg Tyr Ala Leu Ala Ile Phe Leu Asn Tyr Arg Lys Asp Gly Asn Phe Gly Leu Gln Glu Leu Gly Leu Lys Asn Leu Thr Glu Ile Leu Asn Gly Gly Val Tyr Val Asp Gln Asn Lys Phe Leu Cys Tyr Ala Asp Thr Ile His Trp Gln Asp Ile Val Arg Asn Pro Tr~ Pro Ser Asn Leu Thr Leu Val Ser Thr Asn Gly Ser Ser Gly Cys Gly Arg Cys His Lys Ser Cys Thr Gly Arg Cys Trp Gly Pro Thr Glu Asn His Cys Gln Thr Leu Thr Arg Thr Val Cys Ala Glu Gln Cys Asp Gly Arg Cys Tyr Gly Pro Tyr Val Ser Asp Cys Cys His Arg Glu Cys Ala Gly Gly Cys Ser Gly Pro Lys Asp Thr Asp Cys Phe Ala Cys Met Asn Phe Asn Asp Ser Gly Ala Cys Val Thr Gln Cys Pro Gln Thr Dhe Val Tyr Asn Pro Thr Thr Phe Gln Leu Glu His Asn Phe Asn Ala Lys Tyr Thr Tyr Gly Ala Phe Cys Val Lys Lys Cys Pro His Asn Phe Val Val Asp Ser Ser Ser Cys Val Arg Ala Cys Pro Ser Ser Lys Met Glu Val Glu Glu Asn Gly Ile Lys Met Cys Lys Pro Cys Thr Asp Ile Cys Pro Lys Ala Cys Asp Gly Ile Gly Thr Gly Ser Leu Met Ser Ala Gln Thr Val Asp Ser Ser Asn Ile Asp Lys Phe Ile Asn Cys Thr Lys Ile Asn Gly Asn Leu Ile Phe Leu Val Thr Gly Ile His Gly Asp Pro Tyr Asn Ala Ile Glu Ala Ile Asp Pro Glu Lys Leu Asn Val Phe Arg Thr Val Arg Glu Ile Thr Gly SUSSTlTlJTE SHEET (RULE ~6~

CA 02202~33 1997-04-11 WO 96/12019 PCI~/US9~/1352-1 Phe Leu Asn Ile Gln Ser Trp Pro Pro Asn Met Thr Asp Phe Ser Val 405 410 ~15 he Ser Asn Leu Val Thr Ile Gly Gly Arg Val Leu Tyr Ser Gly Leu Ser Leu Leu Ile Leu Lys Gln Gln Gly Ile Thr Ser Leu Gln Phe Gln Ser Leu Lys Glu Ile Ser Ala Gly Asn Ile Tyr Ile Thr Asp Asn Ser Asn Leu Cys Tyr Tyr His Thr Ile Asn Trp Thr Thr Leu Phe Ser Thr le Asn Gln Arg Ile Val Ile Arg Asp Asn Arg Lys Ala Glu Asn Cys hr Ala Glu Gly Met Val Cys Asn His Leu Cys Ser Ser Asp Gly Cys Trp Gly Pro Gly Pro Asp Gln Cys Leu Ser Cys Arg Arg Phe Ser Arg Gly Arg Ile Cys Ile Glu Ser Cys Asn Leu Tyr Asp Gly Glu Phe Arg Glu Phe Glu Asn Gly Ser Ile Cys Val Glu Cys Asp Pro Gln Cys Glu vs Met Glu Asp Gly Leu Leu Thr Cys His Gly Pro Gly Pro Asp Asn ys Thr Lys Cys Ser His Phe Lys Asp Gly Pro Asn Cys Val Glu Lys Cys Pro Asp Gly Leu Gln Gly Ala Asn Ser Phe Ile Phe Lys Tyr Ala Asp Pro Asp Arg Glu Cys His Pro Cys His Pro Asn Cys Thr Gln Gly Cys Asn Gly Pro Thr Ser His Asp Cys Ile Tyr Tyr Pro Trp Thr Gly is Ser Thr Leu Pro Gln His Ala Ary Thr Pro Leu Ile Ala Ala Gly al Ile Gly Gly Leu Phe Ile Leu Val Ile Val Gly Leu Thr Phe Ala Val Tyr Val Arg Arg Lys Ser Ile Lys Lys Lys Arg Ala Leu Arg Arg Phe Leu Glu Thr Glu Leu Val Glu Pro Leu Thr Pro ser Gly Thr Ala Pro Asn Gln Ala Gln Leu Arg Ile Leu Lys Glu Thr G1U Leu Lys Arg al Lys Val Leu Gly Ser Gly Ala Phe Gly Thr Val Tyr Lys Gly Ile rp Val Pro Glu Gly Glu Thr Val Lys Ile Pro Val Ala Ile Lys Ile eu Asn Glu Thr Thr Gly Pro Lys Ala Asn Val Glu Phe Met Asp Glu SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 W O 96/12019 PCTnUS9Sl1352l Ala Leu Ile Met Ala Ser Met Asp His Pro His Leu Val Arg Leu Leu Gly Val Cys Leu Ser Pro Thr Ile Gln Leu Val Thr Gln Leu Met Pro 7~5 790 795 800 is Gly Cys Leu Leu Glu Tyr Val His Glu His Lys Asp Asn Ile Gly er Gln Leu Leu Leu Asn Trp Cys Val Gln Ile Ala Lys Gly Met Met Tyr Leu Glu Glu Arg Arg Leu Val His Arg Asp Leu Ala Ala Arg Asn a35 840 845 Val Leu Val Lys Ser Pro Asn His Val Lys Ile Thr Asp Phe Gly Leu Ala Arg Leu Leu Glu Gly Asp Glu Lys Glu Tyr Asn Ala Asp Gly Gly ys Met Pro Ile Lys Trp Met Ala Leu Glu Cys Ile His Tyr Arg Lys he Thr His Gln Ser Asp Val Trp Ser Tyr Gly Val Thr Ile Trp Glu Leu Met Thr Phe Gly Gly Lys Pro Tyr Asp Gly Ile Pro Thr Arg Glu Ile Pro Asp Leu Leu Glu Lys Gly Glu Arg Leu Pro Gln Pro Pro Ile Cys Thr Ile Asp Val Tyr Met Val Met Val Lys Cys Trp Met Ile Asp la Asp Ser Arg Pro Lys Phe Lys Glu Leu Ala Ala Glu Phe Ser Arg et Ala Arg Asp Pro Gln Arg Tyr Leu Val Ile Gln Gly Asp Asp Arg Met Lys Leu Pro Ser Pro Asn Asp Ser Lys Phe Phe Gln Asn Leu Leu Asp Glu Glu Asp Leu Glu Asp Met Met Asp Ala Glu Glu Tyr Leu Val Pro Gln Ala Phe Asn Ile Pro Pro Pro Ile Tyr Thr Ser Arg Ala Arg le Asp Ser Asn Arg Ser Glu Ile Gly His Ser Pro Pro Pro Ala Tyr hr Pro Met Ser Gly Asn Gln Phe Val Tyr Arg Asp Gly Gly Phe Ala Ala Glu Gln Gly Val Ser Val Pro Tyr Arg Ala Pro Thr Ser Thr Ile Pro Glu Ala Pro Val Ala Gln Gly Ala Thr Ala Glu Ile Phe Asp Asp Ser Cys Cys Asn Gly Thr Leu Arg Lys Pro Val Ala Pro His Val Gln SUBSTITUTE SHEET (RULE 26~

CA 02202~33 l997-04-ll WO 96/12019 PCTrUS9S/135Z~

Glu Asp Ser Ser Thr Gln Arg Tyr Ser Ala Asp Pro Thr Val Phe Ala ro Glu Arg Ser Pro Arg Gly Glu Leu Asp Glu Glu Gly Tyr Met Thr Pro Met Arg Asp ~ys Pro Lys Gln Glu Tyr Leu Asn Pro Val Glu Glu Asn Pro Phe Val Ser Arg Arg Lys Asn Gly Asp Leu Gln Ala Leu Asp Asn Pro Glu Tyr His Asn Ala Ser Asn Gly Pro Pro Lys Ala Glu Asp lu Tyr Val Asn Glu Pro Leu Tyr Leu Asn Thr Phe Ala Asn Thr Leu ly Lys Ala Glu Tyr Leu Lys Asn Asn Ile Leu Ser Met Pro Glu Lys Aia Lys Lys Ala Phe Asp Asn Pro Asp Tyr Trp Asn His Ser Leu Pro Pro Arg Ser Thr Leu Gln His Pro Asp Tyr Leu Gln Glu Tyr Ser Thr Lys Tyr Phe Tyr Lys Gln Asn Gly Arg Ile Arg Pro Ile Val Ala Glu Asn Pro Glu Tyr Leu Ser Glu Phe Ser Leu Lys Pro Gly Thr Val Leu Pro Pro Pro Pro Tyr Arg His Arg Asn Thr Val Val (2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5555 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: un~nown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
(}3) LOCATION: 34..3210 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:

Met Lys Pro Ala Thr Gly Leu Trp Val Trp Val Ser Leu Leu Val Ala Ala Gly Thr Val Gln Pro Ser Asp Ser Gln Ser Val Cys Ala Gly Thr Glu Asn Lys Leu Ser Ser Leu SUBSTITllTE SHEET (RULE 26~

CA 02202~33 1997-04-11 O 96/12019 PCT~US9511352 Ser Asp Leu Glu Gln Gln Tyr Arg Ala Leu Arg Lys Tyr Tyr Glu Asn TGT GAG GTT~ GTC ATG GGC AAC CTG GAG ATA ACC AGC ATT GAG CAC AAC 246 Cys Glu Val Val Met Gly Asn Leu Glu Ile Thr Ser Ile Glu His Asn Arg Asp Leu Ser Phe Leu Arg Ser Val Arg Glu Val Thr Gly Tyr Va Leu Val Ala Leu Asn Gln Phe Arg Tyr Leu Pro Leu Glu Asn Leu Arg Ile Ile Arg Gly Thr Lys Leu Tyr Glu Asp Arg Tyr Ala Leu Ala Ile Phe Leu Asn Tyr Arg Lys Asp Gly Asn Phe Gly Leu Gln Glu Leu Gly Leu Lys Asn Leu Thr Glu Ile Leu Asn Gly Gly Val Tyr Val Asp Gln Asn Lys Phe Leu Cys Tyr Ala Asp Thr Ile His Trp Gln Asp Ile Val Arg Asn Pro Trp Pro Ser Asn Leu Thr Leu Val Ser Thr Asn Gly Ser Ser Gly Cys Gly Arg Cys His Lys Ser Cys Thr Gly Arg Cys Trp Gly Pro Thr Glu Asn His Cys Gln Thr Leu Thr Arg Thr Val Cys Ala Glu Gln Cys Asp Gly Arg Cys Tyr Gly Pro Tyr Val Ser Asp Cys Cys His Arg Glu Cys Ala Gly Gly Cys Ser Gly Pro Lys Asp Thr Asp Cys Phe Ala Cys Met Asn Phe Asn Asp Ser Gly Ala Cys Val Thr Gln Cys Pro Gln Thr Phe Val Tyr Asn Pro Thr Thr Phe Gln Leu Glu Hls Asn Phe Asn Ala Lys Tyr Thr Tyr Gly Ala Phe Cys Val Lys ~ys Cys Pro His Asn Phe Val Val Asp Ser Ser Ser Cys Val Arg Ala Cys Pro Ser Ser SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-ll WO96/12019 PCTrUS95/1352 Lys Met Glu Val Glu Glu Asn Gly Ile Lys Met Cys Lys Pro Cys Thr Asp Ile Cys Pro Lys Ala Cys Asp Gly Ile Gly Thr Gly Ser Leu Met Ser Ala Gln Thr Val Asp Ser Ser Asn Ile Asp Lys Phe Ile Asn Cys Thr Lys Ile Asn Gly Asn Leu Ile Phe Leu Val Thr Gly Ile His Gly Asp Pro Tyr Asn Ala Ile Glu Ala Ile Asp Pro Glu Lys Leu Asn Val Phe Arg Thr Val Arg Glu Ile Thr Gly Phe Leu Asn Ile Gln Ser Trp Pro Pro Asn Met Thr Asp Phe Ser Val Phe Ser Asn Leu Val Thr Ile Gly Gly Arg Val Leu Tyr Ser Gly Leu Ser Leu Leu Ile Leu Lys Gln Gln Gly Ile Thr Ser Leu Gln Phe Gln Ser Leu Lys Glu Ile Ser Ala Gly Asn Ile Tyr Ile Thr Asp Asn Ser Asn Leu Cys Tyr Tyr His Thr Ile Asn Trp Thr Thr Leu Phe Ser Thr Ile Asn Gln Arg Ile Val Ile Arg Asp Asn Ary Lys Ala Glu Asn Cys Thr Ala Glu Gly Met Val Cys Asn His Leu Cys Ser Ser Asp Gly Cys Trp Gly Pro Gly Pro Asp Gln Cys Leu Ser Cys Arg Arg Phe Ser Arg Gly Arg Ile Cys Ile Glu Ser Cys Asn Leu Tyr Asp Gly Glu Phe Arg Glu Phe Glu Asn Gly Ser Ile Cys Val Glu Cys Asp Pro Gln Cys Glu Lys Met Glu Asp Gly Leu Leu Thr Cys His Gly Pro Gly Pro Asp Asn Cys Thr Lvs Cys Ser His Phe SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 W O~6/12019 PCTnUS9~113~2 Lys Asp Gly Pro Asn Cys Val Glu Lys Cys Pro Asp Gly Leu Gln Gly GCA AAC AGT~TTC ATT TTC AAG TAT GCT GAT CCA GAT CGG GAG TGC CAC 1878 Ala Asn Ser Phe Ile Phe Lys Tyr Ala Asp Pro Asp Arg Glu Cys His Pro Cys His Pro Asn Cys Thr Gln Gly Cys Asn Gly Pro Thr Ser His Asp Cys Ile Tyr Tyr Pro Trp Thr Gly His Ser Thr Leu Pro Gln His Ala Arg Thr Pro Leu Ile Ala Ala Gly Val Ile Gly Gly Leu Phe Ile Leu Val Ile Val Gly Leu Thr Phe Ala Val Tyr Val Arg Arg Lys Ser Ile Lys Lys Lys Arg Ala Leu Arg Arg Phe Leu Glu Thr Glu Leu Val Glu Pro Leu Thr Pro Ser Gly Thr Ala Pro Asn Gln Ala Gln Leu Arg Ile Leu Lys Glu Thr Glu Leu Lys Arg Val Lys Val Leu Gly Ser Gly Ala Phe Gly Thr Val Tyr Lys Gly Ile Trp Val Pro Glu Gly Glu Thr Val Lys Ile Pro Val Ala Ile Lys Ile Leu Asn Glu Thr Thr Gly Pro AAG GCA AAT GTG GAG TTC ATG GAT GAA GCT CTG ATC ATG GCA AGT ATG 23s8 Lys Ala Asn Val Glu Phe Met Asp Glu Ala Leu Ile Met Ala Ser Met Asp His Pro His Leu Val Arg Leu Leu Gly Val Cys Leu Ser Pro Thr Ile Gln Leu Val Thr Gln Leu Met Pro His Gly Cys Leu Leu Glu Tyr Val His Glu His Lys Asp Asn Ile Gly Ser Gln Leu Leu Leu Asn Trp Cys Val Gln Ile Ala Lys Gly Met Met Tyr Leu Glu Glu Arg Arg Leu Val His Arg Asp Leu Ala Ala Arg Asn Val Leu Val Lys Ser Pro Asn SUBST TUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 W O96/12019 PCTrUS95/1352 ~is Val Lys Ile Thr Asp Phe Gly Leu Ala Arg Leu Leu Glu Gly Asp Glu Lys Glu Tyr Asn Ala Asp Gly Gly Lys Met Pro Ile Lys Trp Met Ala Leu Glu Cys Ile His Tyr Arg Lys Phe Thr His Gln Ser Asp Val Trp Ser Tyr Gly Val Thr Ile Trp Glu Leu Met Thr Phe Gly Gly Lys Pro Tyr Asp Gly Ile Pro Thr Arg Glu Ile Pro Asp Leu Leu Glu Lys Gly Glu Arg Leu Pro Gln Pro Pro Ile Cys Thr Ile Asp Val Tyr Met Val Met Val Lys Cys Trp Met Ile Asp Ala Asp Ser Arg Pro Lys Phe Lys Glu Leu Ala Ala Glu Phe Ser Arg Met Ala Arg Asp Pro Gln Arg Tyr Leu Val Ile Gln Gly Asp Asp Arg Met Lys Leu Pro Ser Pro Asn Asp Ser Lys Phe Phe Gln Asn Leu Leu Asp Glu Glu Asp Leu Glu Asp Met Met Asp Ala Glu Glu Tyr Leu Val Pro Gln Ala Phe Asn Ile Pro Pro Pro Ile Tyr Thr Ser Arg Ala Arg Ile Asp Ser Asn Arg Ser Val Arg Asn Asn Tyr Ile ~is Ile Ser Tyr Ser Phe lrl~lllCTT AAAAAGATAT TATGATATAT TAGTCAAGAA GTAATACAAG TATAAATCTC 3587 CCGTGCAGTC CTTTGAACCT AATCACATCG AAAAGGcTGc TGAGAAGTAG Alllll~lll 3707 SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 Og6/1201g PCTfUS9~/13~2 AAACCTACTC TATATGAATT CCAlr~lllC TTTGAAAGCT GTCAAATCCA TGCATTTATT 3827 TTTATAAATT CATTCCTCAT ACATTCAACA TATATTGAG~ ACCACTGTAT GTGAAGCATT 3887 CTGACCAGTA CGGAGCATGA AGAAGTAGTA AAlll~l~lC TGTAATCAGT TTCTTCCATT 4067 GATAAGATAT AAACATGATG CTTAATTTTT TCTAGAAGAT AAll~ C TCTTAATCTA 4127 AGAACATTAT CATAGCTAGT AGAACCGACA GCATCCGATT l~l~llGACC ATAGCCATAA 4187 GAATATCTTC AACTTGCTGC TCATTATCTA ACA~ACATAA TTTTCTTTAT TTCATATTGA 4247 AATTCCTTAA ACAAACTTCA TGAGGTTCTA TTATTATCAT CCCC~l~lll CAAAGGAAGA 4367 GYCATGTTAT TTCCATGATG TGATTAGAGT CTGGGACTTG l~ll~lllGG GAAATTTCCC 4547 CATTTAGAAG ATCTGATATG GAAAGAGACA AAGATGGAGA CCTCAATTAT 1llll~llll 4667 AAAAGTTTAA AATTAGATCA ATGGATAGGT AAATGAATAA l~Nrl~llll GCTTGTGAGA 4787 TCTTTTTATA AGAATTCTTA CATTTCAGCT lrll~llCAT TTTAATTTAT AATTCTCAGT 5027 GTTACCTGTA GAlll~llll TA~lllllCA GTCCTTGGAA AAGAAATGGT GATTAAATAT 5207 ATAGTTTTCA GTCTGGCTTT ACGTAACTTT TACGGAAAT~ TCTAACATGT AcAAATGccA 5327 TGTTCCTCCT rl~lllCCTA CATGGCTGAA TTAGAAAACA AATTACTTCC ATTTTAAGTT 5387 GAAACCAAAA AA~Uu~AAAA AAAAAAAAA~ AAAAAAAAAA AAAAAAAA 5555 (2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTTCS:
(A) LENGTH: 1058 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear SUBSTITUTE SHEET (RULE 26~

CA 02202~33 l997-04-ll WO 96112019 PCI~/US9511352"

(ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
et Lys Pro~Ala Thr Gly Leu Trp Val Trp Val Ser Leu Leu Val Ala la Gly Thr Val Gln Pro Ser Asp Ser Gln Ser Val Cys Ala Gly Thr lu Asn Lys Leu Ser Ser Leu Ser Asp Leu Glu Gln Gln Tyr Arg Ala Leu Arg Lys Tyr Tyr Glu Asn Cys Glu Val Val Met Gly Asn Leu Glu Ile Thr Ser Ile Glu His Asn Arg Asp Leu Ser Phe Leu Arg Ser Val rg Glu Val Thr Gly Tyr Val Leu Val Ala Leu Asn Gln Phe Arg Tyr eu Pro Leu Glu Asn Leu Arg Ile Ile Arg Gly Thr Lys Leu Tyr Glu Asp Arg Tyr Ala Leu Ala Ile Phe Leu Asn Tyr Arg Lys Asp Gly Asn Phe Gly Leu Gln Glu Leu Gly Leu Lys Asn Leu Thr Glu Ile Leu Asn Gly Gly Val Tyr Val Asp Gln Asn Lys Phe Leu Cys Tyr Ala Asp Thr le His Trp Gln Asp Ile Val Arg Asn Pro Trp Pro Ser Asn Leu Thr eu Val Ser Thr Asn Gly Ser Ser Gly Cys Gly Arg Cys His Lys Ser Cys Thr Gly Arg Cys Trp Gly Pro Thr Glu Asn His Cys Gln Thr Leu Thr Arg Thr Val Cys Ala Glu Gln Cys Asp Gly Arg Cys Tyr Gly Pro Tyr Val Ser Asp Cys Cys His Arg Glu Cys Ala Gly Gly Cys Ser Gly ro Lys Asp Thr Asp Cys Phe Ala Cys Met Asn Phe Asn Asp Ser Gly la Cys Val Thr Gln Cys Pro Gln Thr Phe Val Tyr Asn Pro Thr Thr Phe Gln Leu Glu His Asn Phe Asn Ala Lys Tyr Thr Tyr Gly Ala Phe Cys Val Lys Lys Cys Pro His Asn Phe Val Val Asp Ser Ser Ser Cys Val Arg Ala Cys Pro Ser Ser Lys Met Glu Val Glu Glu Asn Gly Ile ys Met Cys Lys Pro Cys Thr Asp Ile Cys Pro Lys Ala Cys Asp Gly SUBSTITUTE SHEET (RULE 26~

-CA 02202~33 1997-04-ll Ile Gly Thr Gly Ser Leu Met Ser Ala Gln Thr ~ral Asp Ser Ser Asn ? Ile Asp Lys Phe Ile Asn Cys Thr Lys Ile Asn Gly Asn Leu Ile Phe 355 ~ 360 365 Leu Val Thr Gly Ile His Gly Asp Pro Tyr Asn Ala Ile Glu Ala Ile Asp Pro Glu Lys Leu Asn Val Phe Arg Thr Val Arg Glu Ile Thr Gly Phe Leu Asn Ile Gln Ser Trp Pro Pro Asn Met Thr Asp Phe Ser Val Phe Ser Asn Leu Val Thr Ile Gly Gly Arg Val Leu Tyr Ser Gly Leu 420 42=5 430 Ser Leu Leu Ile Leu Lys Gln Gln Gly Ile Thr Ser Leu Gln Phe Gln Ser Leu Lys Glu Ile Ser Ala Gly Asn Ile Tyr Ile Thr Asp Asn Ser Asn Leu Cys Tyr Tyr His Thr Ile Asn Trp Thr Thr Leu Phe Ser Thr Ile Asn Gln Arg Ile Val Ile Arg Asp Asn Arg Lys Ala Glu Asn Cys Thr Ala Glu Gly Met Val Cys Asn His Leu Cys Ser Ser Asp Gly Cys Trp Gly Pro Gly Pro Asp Gln Cys Leu Ser Cys Arg Arg Phe Ser Arg Gly Arg Ile Cys Ile Glu Ser Cys Asn Leu Tyr Asp Gly Glu Phe Arg Glu Phe Glu Asn Gly Ser Ile Cys Val Glu Cys Asp Pro Gln Cys Glu Lys Met Glu Asp Gly Leu Leu Thr Cys His Gly Pro Gly Pro Asp Asn Cys Thr Lys Cys Ser His Phe Lys Asp Gly Pro Asn Cys Val Glu Lys Cys Pro Asp Gly Leu Gln Gly Ala Asn Ser Phe Ile Phe Lys Tyr Ala Asp Pro Asp Arg Glu Cys His Pro Cys His Pro Asn Cys Thr Gln Gly Cys Asn Gly Pro Thr Ser His Asp Cys Ile Tyr Tyr Pro Trp Thr Gly ~is Ser Thr Leu Pro Gln His Ala Arg Thr Pro Leu Ile Ala Ala Gly Val Ile Gly Gly Leu Phe Ile Leu Val Ile Val Gly Leu Thr Phe Ala Val Tyr Val Arg Arg Lys Ser Ile Lys Lys Lys Arg Ala Leu Arg Arg Phe Leu Glu Thr Glu Leu Val Glu Pro Leu Thr Pro Ser Gly Thr Ala SUBSTITUTE SHEET (RULE 26~ _ __ __ CA 02202~33 l997-04-ll W O96/12019 PCTrUS95/1352 Pro Asn Gln Ala Gln Leu Arg Ile Leu Lys Glu Thr Glu Leu Lys Arg Val Lys Val Leu Gly Ser Gly Ala Phe Gly Thr Val Tyr Lys Gly Ile Trp Val Pro Glu Gly Glu Thr Val Lys Ile Pro Val Ala Ile Lys Ile Leu Asn Glu Thr Thr Gly Pro Lys Ala Asn Val Glu Phe Met Asp Glu Ala Leu Ile Met Ala Ser Met Asp His Pro His Leu Val Arg Leu Leu Gly Val Cys Leu Ser Pro Thr Ile Gln Leu Val Thr Gln Leu Met Pro His Gly Cys Leu Leu Glu Tyr Val His Glu His Lys Asp Asn Ile Gly Ser Gln Leu Leu Leu Asn Trp Cys Val Gln Ile Ala Lys Gly Met Met Tyr Leu Glu Glu Arg Arg Leu Val His Arg Asp Leu Ala Ala Arg Asn Val Leu Val Lys Ser Pro Asn His Val Lys Ile Thr Asp Phe Gly Leu Ala Arg Leu Leu Glu Gly Asp Glu Lys Glu Tyr Asn Ala Asp Gly Gly 865 870 87s 880 Lys Met Pro Ile Lys Trp Met Ala Leu Glu Cys Ile His Tyr Arg Lys Phe Thr His Gln Ser Asp Val Trp Ser Tyr Gly Val Thr Ile Trp Glu Leu Met Thr Phe Gly Gly L-~s Pro Tyr Asp Gly Ile Pro Thr Arg Glu Ile Pro Asp Leu Leu Glu Lys Gly Glu Arg Leu Pro Gln Pro Pro Ile Cys Thr Ile Asp Val Tyr Met Val Met Val Lys Cys Trp Met Ile Asp Ala Asp Ser Arg Pro Lys Phe Lys Glu Leu Ala Ala Glu Phe Ser Arg Met Ala Arg Asp Pro Gln Arg Tyr Leu Val Ile Gln Gly Asp Asp Arg Met Lys Leu Pro Ser Pro Asn Asp Ser Lys Phe Phe Gln Asn Leu Leu Asp Glu Glu Asp Leu Glu Asp Met Met Asp Ala Glu Glu Tyr Leu Val Pro Gln Ala Phe Asn Ile Pro Pro Pro Ile Tyr Thr Ser Arg Ala Arg Ile Asp Ser Asn Arg Ser Val Arg Asn Asn Tyr Ile His Ile Ser Tyr SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 WO 96112019 PCTrUS95/1352 Ser Phe (2) INFORMATION FOR SEQ ID NO:S:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 3321 base pairs - (B) TYPL: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 156..1782 (xi~ SEQUENCE DESCRIPTION: SEQ ID NO:5:

GGTATGGAAA GCCCTGGATG TTGAAATCTA GCTTCAAAAA GC~lG~ G AAATGTAGTT 120 Glu Ala Leu Ile Met Ala Ser Met Asp His Pro His Leu Val Arg Leu Leu Gly Val Cys Leu Ser ro Thr Ile Gln Leu Val Thr Gln Leu Met Pro His Gly Cys Leu Leu Glu Tyr Val His Glu His Lys Asp Asn Ile Gly Ser Gln Leu Leu Leu ~S 50 Asn Trp Cys Val Gln Ile Ala Lys Gly Met Met Tyr Leu Glu Glu Arg Arg Leu Val His Arg Asp Leu Ala Ala Arg Asn Val Leu Val Lys Ser Pro Asn His Val Lys Ile Thr Asp Phe Gly Leu Ala Arg Leu Leu Glu Gly Asp Glu Lys Glu Tyr Asn Ala Asp Gly Gly Lys Met Pro Ile Lys Trp Met Ala Leu Glu Cys Ile Hls Tyr Ary Lys Phe Thr His Gln Ser Asp Val Trp Ser Tyr Gly Val Thr Ile Trp Glu Leu Met Thr Phe Gly SUBSTITUTE SHEET (RULE 26~

CA 02202~33 l997-04-ll W O96/12019 PCTrUS9511352 GGA AAA CCC TAT GAT GGA ATT CCA ACG CGA GAA ATC CCT GAT TTA TTA 653GlfLys Pro Tyr Asp Gly Ile Pro Thr Arg Glu Ile Pro Asp Leu Leu GAG AAA GGA~GAA CGT TTG CCT CAG CCT CCC ATC TGC ACT ATT GAC GTT 701 Glu Lys Gly Glu Arg Leu Pro Gln Pro Pro Ile Cys Thr Ile Asp Val Tyr Met Val Met Val Lys Cys Trp Met Ile Asp Ala Asp Ser Arg Pro Lys Phe Lys Glu Leu Ala Ala Glu Phe Ser Arg Met Ala Arg Asp Pro Gln Arg Tyr Leu Val Ile Gln Gly Asp Asp Arg Met Lys Leu Pro Ser Pro Asn Asp Ser Lys Phe Phe Gln Asn Leu Leu Asp Glu Glu Asp Leu Glu Asp Met Met Asp Ala Glu Glu Tyr Leu Val Pro Gln Ala Phe Asn Ile Pro Pro Pro Ile Tyr Thr Ser Arg Ala Arg Ile Asp Ser Asn Arg Ser Glu Ile Gly His Ser Pro Pro Pro Ala Tyr Thr Pro Met Ser Gly Asn Gln Phe Val Tyr Arg Asp Gly Gly Phe Ala Ala Glu Gln Gly Val Ser Val Pro Tyr Arg Ala Pro Thr Ser Thr Ile.Pro Glu Ala Pro Val Ala Gln Gly Ala Thr Ala Glu Ile Phe Asp Asp Ser Cys Cys Asn Gly Thr Leu Arg Lys Pro Val Ala Pro His Val Gln Glu Asp Ser Ser Thr Gln Arg Tyr Ser Ala Asp Pro Thr Val Phe Ala Pro Glu Arg Ser Pro Arg Gly Glu Leu Asp Glu Glu Gly Tyr Met Thr Pro Met Arg Asp Lys Pro Lys Gln Glu Tyr Leu Asn Pro Val Glu Glu Asn Pro Phe Val Ser CGG AGA AAA AAT GGA GAC CTT CAA GCA TTG GAT AAT CCC GAA TAT CAC

SUBSTITUTE SHEET (RULE 26~

CA 02202~33 l997-04-ll W O 96tl2019 PCTnUS95J13~2 Arg Arg Lys Asn Gly Asp Leu Gln Ala Leu Asp Asn Pro Glu Tyr His AAT GCA TCC AAT GGT CCA CCC AAG GCC GAG GAT GAG TAT GTG AAT GAG 1~69 Asn Ala Se~ Asn Gly Pro Pro Lys Ala Glu Asp Glu Tyr Val Asn Glu - CCA CTG TAC CTC AAC ACC TTT GCC AAC ACC TTG GGA AAA GCT GAG TAC 1517Pro Leu Tyr Leu Asn Thr Phe Ala Asn Thr Leu Gly Lys Ala Glu Tyr ' 445 450 Leu Lys Asn Asn Ile Leu Ser Me~ Pro Glu Lys Ala Lys Lys Ala Phe Asp Asn Pro Asp Tyr Trp Asn His Ser ~eu Pro Pro Arg Ser Thr Leu Gln His Pro Asp Tyr Leu Gln Glu Tyr Ser Thr Lys Tyr Phe Tyr Lys Gln Asn Gly Arg Ile Arg Pro Ile Val Ala Glu Asn Pro Glu Tyr Leu Ser Glu Phe Ser Leu Lys Pro Gly Thr Val Leu Pro Pro Pro Pro Tyr AGA CAC CGG AAT ACT GTG GTG TAAGCTCAGT l~lG~lllll TAGGTGGAGA 1808 Val GACACACCTG CTCCAATTTC CCCACCCCCC T~~ l~lC TGGTGGTCTT CCTTCTACCC

TGTTTCTTCA lll~l~lGCA TGGGTTGGTC AGGAGAATGA AACAGCTAGA GAAGGACCAG 2048 AAAATGTAAG GCAATGCTGC CTACTATCAA ACTAGCTGTC A~lllllllC llll''l'~'ll'll' 2108 l~lll~lll~ llr~lll~ll C~l~ll~lll llllllllll TTTTAAAGCA GATGGTTGAA 2168 ACACCCATGC TAl~l~llCC TATCTGCAGG AACTGATGTG TGCATATTTA GCATCCCTGG 2228 GTCTGAAATT GAGAATCCAG 'l'll'~''l''l''l'CCC CAGCAGTTTC TGTCCTAGCA AGTAAGAATG 2348 TCAACACTTT TTG~llllll TCAllll~ll TTGCTCTGAC CGAllC~lll ATATTTGCTC 2468 TACATTTTTC AACAllllll TTTCTCCATA AATGACACTA CTTGATAGGC C~L 1G~11~1 2708 SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 W O96112019 PCTrUS95/1352 CTGAAGAGTA GAAGGGAAAC TAAGAGACAG llCl~'~lGG TTCAGGAAAA CTACTGATAC 2768 TGTCTACCTG GCAGATACTC AGAAATGTAG TTTGCACTTA AGCTGTAATT TTAlrl~llC 2888 lrlll-lGAA CTCCATTTTG GATTTTGAAT CAAGcAATAT GGAAGCAACC AGCAAATTAA 2948 CTAATTTAAG TACATTTTTA AAAAAAGAGC TAAGATAAAG ACTGTGGAAA TGccAAAccA 3008 TTCATATGTC ACCTTTGCTA CGCAAGGAAA TTTGTTcAGT TCGTATACTT CGTAAGAAGG 3128 AGTAGAAGGT AA~r~lllGC ACATAAATTG GTATAATAAA AAGAAAAACA CAAACATTCA 3248 AAGCTTAGGG ATAGGTCCTT GGGTCAAAAG TTGTAAATAA ATGTGAAACA l~lr~lCAAA 3308 AA~U~AAAA AAA 3321 (2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 541 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
Glu Ala Leu Ile Met Ala Ser Met Asp His Pro His Leu Val Arg Leu Leu Gly Val Cys Leu Ser Pro Thr Ile Gln Leu Val Thr Gln Leu Met Pro His Gly Cys Leu Leu Glu Tyr Val His Glu Hls Lys Asp Asn Ile Gly Ser Gln Leu Leu Leu Asn Trp Cys Val Gln Ile Ala Lys Gly Met Met Tyr Leu Glu Glu Arg Arg Leu Val His Arg Asp Leu Ala Ala Arg Asn Val Leu Val Lys Ser Pro Asn His Val Lys Ile Thr Asp Phe Gly Leu Ala Arg Leu Leu Glu Gly Asp Glu Lys Glu Tyr Asn Ala Asp Gly Gly Lys Met Pro Ile Lys Trp Met Ala Leu Glu Cys Ile His Tyr Arg Lys Phe Thr His Gln Ser Asp Val Trp Ser Tyr Gly Val Thr Ile Trp Glu Leu Met Thr Phe Gly Gly Lys Pro Tyr Asp Gly Ile Pro Thr Arg Glu Ile Pro Asp Leu Leu Glu Lys Gly Glu Arg Leu Pro Gln Pro Pro Ile Cys Thr Ile Asp Val Tyr Met Val Met Val Lys Cys Trp Met Ile SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 WO 96112019 PCT~S95113S2d 180 185 lgo Asp Ala Asp Ser Arg Pro Lys Phe Lys Glu Leu Ala Ala Glu Phe Ser Arg Met Ala Arg Asp Pro Gln Arg Tyr Leu Val Ile Gln Gly Asp Asp Arg Met Lys Leu Pro Ser Pro Asn Asp Ser Lys Phe Phe Gln Asn Leu Leu Asp Glu Glu Asp Leu Glu Asp Met Met Asp Ala GlU Glu Tyr Leu 24s 250 255 al Pro Gln Ala Phe Asn Ile Pro Pro Pro Ile Tyr Thr Ser Arg Ala Arg Ile Asp Ser Asn Arg Ser Glu Ile Gly His Ser Pro Pro Pro Ala Tyr Thr Pro Met Ser Gly Asn Gln Phe Val Tyr Arg Asp Gly Gly Phe 290 29s 300 Ala Ala Glu Gln Gly Val Ser Val Pro Tyr Arg Ala Pro Thr Ser Thr 30s 310 315 320 Ile Pro Glu Ala Pro Val Ala Gln Gly Ala Thr Ala GlU Ile Phe Asp 32s 330 335 sp Ser Cys Cys Asn Gly Thr Leu Arg Lys Pro Val Ala Pro His Val Gln Glu Asp Ser Ser Thr Gln Arg Tyr Ser Ala Asp Pro Thr Val Phe Ala Pro Glu Arg Ser Pro Arg Gly Glu Leu Asp Glu Glu Gly Tyr Met 370 37s 380 Thr Pro Met Arg Asp Lys Pro Lys Gln Glu Tyr Leu Asn Pro Val Glu Glu Asn Pro Phe Val Ser Arg Arg Lys Asn Gly Asp Leu Gln Ala Leu sp Asn Pro Glu Tyr His Asn Ala Ser Asn Gly Pro Pro Lys Ala Glu Asp Glu Tyr Val Asn Glu Pro Leu Tyr Leu Asn Thr Phe Ala Asn Thr Leu Gly Lys Ala Glu Tyr Leu Lys Asn Asn Ile Leu Ser Met Pro Glu 450 45s 460 Lys Ala Lys Lys Ala Phe Asp Asn Pro Asp Tyr Trp Asn His Ser Leu 465 470 47s 480 Pro Pro Arg Ser Thr Leu Gln His Pro Asp Tyr Leu Gln Glu Tyr Ser hr Lys Tyr Phe Tyr Lys Gln Asn Gly Arg Ile Arg Pro Ile Val Ala Glu Asn Pro Glu Tyr Leu Ser GlU Phe Ser Leu Lys Pro Gly Thr Val Leu Pro Pro Pro Pro Tyr Arg His Arg Asn Thr Val Val SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 WO 96112019 PCI'/US95/1352~1 (2) INFO~MATION ~OR SEQ ID NO: 7:
( i ) SEQUENCE: CHARACTERISTICS:
(A) LENGTH: 1210 amino acids (B) TYPE: amino acid (C) STR~NDEDNESS: unknown ( D ) TOPOLOGY: unknown ( ii ) MOLECUL~: TYPE: protein (xi ) SEQUENCE DESCRIPTION: SEQ ID NO: 7:
et Arg Pro Ser Gly Thr Ala Gly Ala Ala Leu Leu Ala Leu Leu Ala la Leu Cys Pro Ala Ser Arg Ala Leu Glu Glu Lys Lys Val Cys Gln ly Thr Ser Asn Lys Leu Thr Gln Leu Gly Thr Phe Glu Asp His Phe Leu Ser Leu Gln Arg Met Phe Asn Asn Cys Glu Val Val Leu Gly Asn Leu Glu Ile Thr Tyr Val Gln Arg Asn Tyr Asp Leu Ser Phe Leu Lys Thr Ile Gln Glu Val Ala Gly Tyr Val Leu Ile Ala Leu Asn Thr Val lu Arg Ile Pro Leu Glu Asn Leu Gln Ile Ile Arg Gly Asn Met Tyr Tyr Glu Asn Ser Tyr Ala Leu Ala Val Leu Ser Asn Tyr Asp Ala Asn llS 120 125 Lys Thr Gly Leu Lys Glu Leu Pro Met Arg Asn Leu Gln Glu Ile Leu His Gly Ala Val Arg Phe Ser Asn Asn Pro Ala Leu Cys Asn Val Glu 145 150 lSS 160 er Ile Gln Trp Arg Asp Ile Val Ser Ser Asp Phe Leu Ser Asn Met er Met Asp Phe Gln Asn His Leu Gly Ser Cys Gln Lys Cys Asp Pro Ser Cys Pro Asn Gly Ser Cys Trp Gly Ala Gly Glu Glu Asn Cys Gln l9S 200 205 Lys Leu Thr Lys Ile Ile Cys Ala Gln Gln Cys Ser Gly Arg Cys Arg Gly Lys Ser Pro Ser Asp Cys Cys His Asn Gln Cys Ala Ala Gly Cys hr Gly Pro Arg Glu Ser Asp Cys Leu Val Cys Arg Lys Phe Arg Asp lu Ala Thr Cys Lys Asp Thr Cys Pro Pro Leu Met Leu Tyr Asn Pro hr Thr Tyr Gln Met Asp Val Asn Pro Glu Gly Lys Tyr Ser Phe Gly SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 WO 96112019 PCT~S95~13~2 Ala Thr Cys Val Lys Lys Cys Pro Arg Asn Tyr Val Val Thr Asp His 290 ` 295 300 Gly Ser Cys Val Arg Ala Cys Gly Ala Asp Ser Tyr Glu Met Glu Glu Asp Gly Val Arg Lys Cys Lys Lys Cys Glu Gly Pro Cys Arg Lys Val 325 330 33s ys Asn Gly Ile Gly Ile Gly Glu Phe Lys Asp Ser Leu Ser Ile Asn Ala Thr Asn Ile Lys His Phe Lys Asn Cys Thr Ser Ile Ser Gly Asp 35s 360 365 Leu His Ile Leu Pro Val Ala Phe Arg Gly Asp Ser Phe Thr His Thr Pro Pro Leu Asp Pro Gln Glu Leu Asp Ile Leu Lys Thr Val Lys Glu le Thr Gly Phe Leu Leu Ile Gln Ala Trp Pro Glu Asn Arg Thr Asp eu His Ala Phe Glu Asn Leu Glu Ile Ile Arg Gly Arg Thr Lys Gln His Gly Gln Phe Ser Leu Ala Val Val Ser Leu Asn Ile Thr Ser Leu Gly Leu Arg Ser Leu Lys Glu Ile Ser Asp Gly Asp Val Ile Ile Ser Gly Asn Lys Asn Leu Cys Tyr Ala Asn Thr Ile Asn Trp Lys Lys Leu he Gly Thr Ser Gly Gln Lys Thr Lys Ile Ile Ser Asn Arg Gly Glu sn Ser Cys Lys Ala Thr Gly Gln Val Cys His Ala Leu Cys Ser Pro lu Gly Cys Trp Gly Pro Glu Pro Arg Asp Cys Val Ser Cys Arg Ser Arg Gly Arg Glu Cys Val Asp Lys Cys Lys Leu Leu Glu Gly Glu Pro Arg Glu Phe Val Glu Asn Ser Glu Cys Ile Gln Cys His Pro s45 550 555 560 lu Cys Leu Pro Gln Ala Met Asn Ile Thr Cys Thr Gly Arg Gly Pro sp Asn Cys Ile Gln Cys Ala His Tyr Ile Asp Gly Pro His Cys Val ys Thr Cys Pro Ala Gly Val Met Gly Glu Asn Asn Thr Leu Val Trp Lys Tyr Ala Asp Ala Gly His Val Cys His Leu Cys His Pro Asn Cys SUBSTITUTE SHEET (RULL 26 CA 02202~33 1997-04-11 WO 96/12019 PCI`IUS95/13S2~1 Thr Tyr Gly Cys Thr Gly Pro Gly Leu Glu Gly Cys Pro Thr Asn Gly ro Lys Ile Pro Ser Ile Ala Thr Gly Met Val Gly Ala Leu Leu Leu eu Leu Val Val Ala Leu Gly Ile Gly Leu Phe Met Arg Arg Arg His le Val Arg Lys Arg Thr Leu Arg Arg Leu Leu Gln Glu Arg Glu Leu Val Glu Pro Leu Thr Pro Ser Gly Glu Ala Pro Asn Gln Ala Leu Leu Arg Ile Leu Lys Glu Thr Glu Phe Lys Lys Ile Lys Val Leu Gly Ser ly Ala Phe Gly Thr Val Tyr Lys Gly Leu Trp Ile Pro Glu Gly Glu ys Val Lys Ile Pro Val Ala Ile Lys Glu Leu Arg Glu Ala Thr Ser ro Lys Ala Asn Lys Glu Ile Leu Asp Glu Ala Tyr Val Met Ala Ser Val Asp Asn Pro His Val Cys Arg Leu Leu Gly Ile Cys Leu Thr Ser Thr Val Gln Leu Ile Thr Gln Leu Met Pro Phe Gly Cys Leu Leu Asp yr Val Arg Glu His Lys Asp Asn Ile Gly Ser Gln Tyr Leu Leu Asn rp Cys Val Gln Ile Ala Lys Gly Met Met Tyr Leu Glu Asp Arg Arg eu Val His Arg Asp Leu Ala Ala Arg Asn Val Leu Val Lys Thr Pro Gln His Val Lys Ile Thr Asp Phe Gly Leu Ala Lys Leu Leu Gly Ala Glu Glu Lys Glu Tyr His Ala Glu Gly Gly Lys Val Pro Ile Lys Trp t Met Ala Leu Glu Ser Ile Leu His Arg Ile Tyr Thr His Gln Ser Val Trp Ser Tyr Gly Val Thr Val Trp Glu Leu Met Thr Phe Gly ys Pro Tyr Asp Gly Ile Pro Ala Ser Glu Ile Ser Ser Ile Leu Glu SUBSTITUTE SHEET (RULE 26~

. CA 02202~33 1997-04-11 Wo 96/12019 PCTllUS9511352 ~ Lys Gly Glu Arg Leu Pro Gln Pro Pro Ile Cys Thr Ile Asp Val Tyr Met Ile Met Val Lys Cys Trp Met Ile Asp Ala Asp Ser Arg Pro Lys Arg Glu Leu Ile Ile Glu Phe Ser Lys Met Ala Arg Asp Pro Gln 965 970 g75 Tyr Leu Val Ile Gln Gly Asp Glu Arg Met His Leu Pro Ser Pro Thr Asp Ser Asn Phe Tyr Arg Ala Leu Met Asp Glu Glu Asp Met Asp Asp Val Val Asp Ala Asp Glu Tyr Leu Ile Pro Gln Gln Gly Phe Phe lolo 1015 1020 Ser Ser Pro Ser Thr Ser Arg Thr Pro Leu Leu Ser Ser Leu Ser Ala Thr Ser Asn Asn Ser Thr Val Ala Cys Ile Asp Arg Asn Gly Leu Gln Ser Cys Pro Ile Lys Glu Asp Ser Phe Leu Gln Arg Tyr Ser Ser Asp Pro Thr Gly Ala Leu Thr Glu Asp Ser Ile Asp Asp Thr Phe Leu Pro Val Pro Glu Tyr Ile Asn Gln Ser Val Pro Lys Arg Pro Ala Gly Ser 1090 1095 lloo Val Gln Asn Pro Val Tyr His Asn Gln Pro Leu Asn Pro Ala Pro Ser 1105 lllo 1115 1120 Arg Asp Pro His Tyr Gln Asp Pro His Ser Thr Ala Val Gly Asn Pro Glu Tyr Leu Asn Thr Val Gln Pro Thr Cys Val Asn Ser Thr Phe Asp Ser Pro Ala Hls Trp Ala Gln Lys Gly Ser His Gln Ile Ser Leu Asp Asn Pro Asp Tyr Gln Gln Asp Phe Phe Pro Lys Glu Ala Lys Pro Asn Gly Ile Phe Lys Gly Ser Thr Ala Glu Asn Ala Glu Tyr Leu Arg Val 1185 llgo 1195 1200 Ala Pro Gln Ser Ser Glu Phe Ile Gly Ala (2) INFORMATION FOR SEQ ID NO: 8:
(i) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 1255 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: unknown SUBSTIT~TE SHEET (RU~E 26~

CA 02202~33 1997-04-11 WO 96/12019 PCr/US95/13St~

(D) TOPOLOGY: unknown (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
Met Glu Leu Ala Ala Leu Cys Arg Trp Gly Leu Leu Leu Ala Leu Leu ro Pro Gly Ala Ala Ser Thr Gln Val Cys Thr Gly Thr Asp Met Lys eu Arg Leu Pro Ala Ser Pro Glu Thr His Leu Asp Met Leu Arg His Leu Tyr Gln Gly Cys Gln Val Val Gln Gly Asn Leu Glu Leu Thr Tyr Leu Pro Thr Asn Ala Ser Leu Ser Phe Leu Gln Asp Ile Gln Glu Val ln Gly Tyr Val Leu Ile Ala His Asn Gln Val Arg Gln Val Pro Leu ln Arg Leu Arg Ile Val Arg Gly Thr Gln Leu Phe Glu Asp Asn Tyr la Leu Ala Val Leu Asp Asn Gly Asp Pro Leu Asn Asn Thr Thr Pro Val Thr Gly Ala Ser Pro Gly Gly Leu Arg Glu Leu Gln Leu Arg Ser Leu Thr Glu Ile Leu Lys Gly Gly Val Leu Ile Gln Arg Asn Pro Gln eu Cys Tyr Gln Asp Thr Ile Leu Trp Lys Asp Ile Phe His Lys Asn sn Gln Leu Ala Leu Thr Leu Ile Asp Thr Asn Arg Ser Arg Ala Cys is Pro Cys Ser Pro Met Cys Lys Gly Ser Arg Cys Trp Gly Glu Ser Ser Glu Asp Cys Gln Ser Leu Thr Arg Thr Val Cys Ala Gly Gly Cys Ala Arg Cys Lys Gly Pro Leu Pro Thr Asp Cys Cys His Glu Gln Cys la Ala Gly Cys Thr Gly Pro Lys His Ser Asp Cys Leu Ala Cys Leu is Phe Asn His Ser Gly Ile Cys Glu Leu His Cys Pro Ala Leu Val hr Tyr Asn Thr Asp Thr Phe Glu Ser Met Pro Asn Pro Glu Gly Arg SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 WO 9~/12019 PCI'IUS9~1352 Tyr Thr Phe Gly Ala Ser Cy5 Val Thr Ala CyS Pro Tyr Asn Tyr Leu Ser Thr Asp Val Gly Ser Cyg Thr Leu Val Cys Pro Leu His Asn Gln 30!; 310 315 320 lu Val Thr Ala Glu Asp Gly Thr Gln Arg Cys Glu Lys Cys Ser Lys ro Cys Ala Arg Val Cys Tyr Gly Leu Gly Met Glu His Leu Arg Glu al Arg Ala Val Thr Ser Ala Asn Ile Gln Glu Phe Ala Gly Cys Lys Lys Ile Phe Gly Ser Leu Ala Phe Leu Pro Glu Ser Phe Asp Gly ASp Pro Ala Ser Asn Thr Ala Pro Leu Gln Pro Glu Gln Leu Gln Val Phe lu Thr Leu Glu Glu Ile Thr Gly Tyr Leu Tyr Ile Ser Ala Trp Pro sp Ser Leu Pro Asp Leu Ser Val Phe Gln Asn Leu Gln Val Ile Arg ly Arg Ile Leu His Asn Gly Ala Tyr Ser Leu Thr Leu Gln Gly Leu Gly Ile Ser Trp Leu Gly Leu Arg Ser Leu Arg Glu Leu Gly Ser Gly Leu Ala Leu Ile His His Asn Thr His Leu Cys Phe Val His Thr Val ro Trp Asp Gln Leu Phe Arg Asn Pro His Gln Ala Leu Leu His Thr la Asn Arg Pro Glu Asp Glu Cys Val Gly Glu Gly Leu Ala Cys His ln Leu Cys Ala Arg Arg Ala Leu Leu Gly Ser Gly Pro Thr Gln Cys Val Asn Cys Ser Gln Phe Leu Arg Gly Gln Glu Cys Val Glu Glu Cys Arg Val Leu Gln Gly Leu Pro Arg Glu Tyr Val Asn Ala Arg His Cys eu Pro Cys His Pro Glu Cys Gln Pro Gln Asn Gly Ser Val Thr Cys he Gly Pro Glu Ala Asp Gln Cys Val Ala Cys Ala His Tyr Lys Asp ro Pro Phe Cys Val Ala Arg Cys Pro Ser Gly Val Lys Pro Asp Leu Ser Tyr Met Pro Ile Trp Lys Phe Pro Asp Glu Glu Gly Ala Cys Gln Pro Cys Pro Ile Asn Cys Thr His Ser Cys Val Asp Leu Asp Asp Lys SUBSTITUTE SHEET (RUL~ 26~

CA 02202~33 l997-04-ll WO96112019 PCTrUS95/1352 ly Cys Pro Ala Glu Gln Arg Ala Ser Pro Leu Thr Ser Ile Val Ser ~ 645 650 655 la Val Val Gly Ile Leu Leu Val Val Val Leu Gly Val Val Phe Gly le Leu Ile Lys Arg Arg Gln Gln Lys Ile Arg Lys Tyr Thr Met Arg Arg Leu Leu Gln Glu Thr Glu Leu Val Glu Pro Leu Thr Pro Ser Gly Ala Met Pro Asn Gln Ala Gln Met Arg Ile Leu Lys Glu Thr Glu Leu Arg Lys Val Lys Val Leu Gly Ser Gly Ala Phe Gly Thr Val Tyr Lys ly Ile Trp Ile Pro Asp Gly Glu Asn Val Lys Ile Pro Val Ala Ile ys Val Leu Arg Glu Asn Thr Ser Pro Lys Ala Asn Lys Glu Ile Leu Asp Glu Ala Tyr Val Met Ala Gly Val Gly Ser Pro Tyr Val Ser Arg Leu Leu Gly Ile Cys Leu Thr Ser Thr Val Gln Leu Val Thr Gln Leu Met Pro Tyr Gly Cys Leu Leu Asp His Val Arg Glu Asn Arg Gly Arg 805 . 810 815 eu Gly Ser Gln Asp Leu Leu Asn Trp Cys Met Gln Ile Ala Lys Gly et Ser Tyr Leu Glu Asp Val Arg Leu Val His Arg Asp Leu Ala Ala Arg Asn Val Leu Val Lys Ser Pro Asn His Val Lys Ile Thr Asp Phe Gly Leu Ala Arg Leu Leu Asp Ile Asp Glu Thr Glu Tyr His Ala Asp Gly Gly Lys Val Pro Ile Lys Trp Met Ala Leu Glu Ser Ile Leu Arg rg Arg Phe Thr His Gln Ser Asp Val Trp Ser Tyr Gly Val Thr Val rp Glu Leu Met Thr Phe Gly Ala Lys Pro Tyr Asp Gly Ile Pro Ala Arg Glu Ile Pro Asp Leu Leu Glu Lys Gly Glu Arg Leu Pro Gln Pro Pro Ile Cys Thr Ile Asp Val Tyr Met Ile Met Val Lys Cys Trp Met Ile Asp Ser Glu Cys Arg Pro Arg Phe Arg Glu Leu Val Ser Glu Phe Ser Arg Met Ala Arg Asp Pro Gln Arg Phe Val Val Ile Gln Asn Glu SUBSTITUTE SHEET (RULE 26~
.

CA 02202~33 1997-04-11 WO 96112019 PCTnUS9~/1352 Asp Leu Gly Pro Ala Ser Pro Leu Asp Ser Thr Phe Tyr Arg Ser Leu eu Glu Asp Asp Asp Met Gly Asp Leu Val Asp Ala Glu Glu Tyr Leu al Pro Gln Gln Gly Phe Phe Cys Pro Asp Pro Ala Pro Gly Ala Gly Gly Met Val His His Arg ~is Arg Ser Ser Ser Thr Arg Ser Gly Gly ly Asp Leu Thr Leu Gly Leu Glu Pro Ser Glu Glu Glu Ala Pro Arg er Pro Leu Ala Pro Ser Glu Gly Ala Gly Ser Asp Val Phe Asp Gly sp Leu Gly Met Gly Ala Ala Lys Gly Leu Gln Ser Leu Pro Thr His sp Pro Ser Pro Leu Gln Arg Tyr Ser GlU Asp Pro Thr Val Pro Leu Pro Ser Glu Thr Asp Gly Tyr Val Ala Pro Leu Thr Cys Ser Pro Gln ro Glu Tyr Val Asn Gln Pro ASp Val Arg Pro Gln Pro Pro Ser Pro rg Glu Gly Pro Leu Pro Ala Ala Arg Pro Ala Gly Ala Thr Leu Glu rg Ala Lys Thr Leu Ser Pro Gly Lys Asn Gly Val Val Lys Asp Val he Ala Phe Gly Gly Ala Val Glu Asn Pro Glu Tyr Leu Thr Pro Gln Gly Gly Ala Ala Pro Gln Pro His Pro Pro Pro Ala Phe Ser Pro Ala he Asp Asn Leu Tyr Tyr Trp Asp Gln Asp Pro Pro Glu Arg Gly Ala ro Pro Ser Thr Phe Lys Gly Thr Pro Thr Val Ala Glu Asn Pro Glu yr Gly Leu Asp Val Pro Val (2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1342 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:

SuBsTlTuTE-sHEET (RUEE 26~

CA 02202~33 1997-04-11 WO 96/12019 PCT/US9511352.1 Met Arg Ala Asn Asp Ala Leu Gln Val Leu Gly Leu Leu Phe Ser ~eu a Ary Gly Ser Glu Val Gly Asn Ser Gln Ala Val Cys Pro Gly Thr eu Asn Gly Leu Ser Val Thr Gly Asp Ala Glu Asn Gln Tyr Gln Thr Leu Tyr Lys Leu Tyr Glu Arg Cys Glu Val Val Met Gly Asn Leu Glu Ile Val Leu Thr Gly His Asn Ala Asp Leu Ser Phe Leu Gln Trp Ile Arg Glu Val Thr Gly Tyr Val Leu Val Ala Met Asn Glu Phe Ser Thr eu Pro Leu Pro Asn Leu Arg Val Val Arg Gly Thr Gln Val Tyr Asp ly Lys Phe Ala Ile Phe Val Met Leu Asn Tyr Asn Thr Asn Ser Ser His Ala Leu Arg Gln Leu Arg Leu Thr Gln Leu Thr Glu Ile Leu Ser Gly Gly Val Tyr Ile Glu Lys Asn Asp Lys Leu Cys His Met Asp Thr Ile Asp Trp Arg Asp Ile Val Arg Asp Arg Asp Ala Glu Ile Val Val ys Asp Asn Gly Arg Ser Cys Pro Pro Cys His Glu Val Cys Lys Gly rg Cys Trp Gly Pro Gly Ser Glu Asp Cys Gln Thr Leu Thr Lys Thr Ile Cys Ala Pro Gln Cys Asn Gly His Cys Phe Gly Pro Asn Pro Asn Gln Cys Cys His Asp Glu Cys Ala Gly Gly Cys Ser Gly Pro Gln Asp Thr Asp Cys Phe Ala Cys Arg His Phe Asn Asp Ser Gly Ala Cys Val ro Arg Cys Pro Gln Pro Leu Val Tyr Asn Lys Leu Thr Phe Gln Leu lu Pro Asn Pro His Thr Lys Tyr Gln Tyr Gly Gly Val Cys Val Ala 2~5 280 285 Ser Cys Pro Hls Asn Phe Val Val Asp Gln Thr Ser Cys Val Arg Ala Cys Pro Pro Asp Lys Met Glu Val Asp Lys Asn Gly Leu Lys Met Cys Glu Pro Cys Gly Gly Leu Cys Pro Lys Ala Cys Glu Gly Thr Gly Ser SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 WO 961121)l9 PCTJUS95/1352 Gly Ser Arg Phe Gln Thr Val Asp Ser Ser Asn Ile Asp Gly Phe Val sn Cys Thr ~ Lys Ile Leu Gly Asn Leu Asp Phe Leu Ile Thr Gly Leu Asn Gly Asp Pro Trp His Lys Ile Pro Ala Leu Asp Pro Glu Lys Leu Asn Val Phe Arg Thr Val Arg Glu Ile Thr Gly Tyr Leu Asn Ile Gln er Trp Pro Pro His Met ~lis Asn Phe Ser Val Phe Ser Asn Leu Thr hr Ile Gly Gly Arg Ser Leu Tyr Asn Arg Gly Phe Ser Leu Leu Ile et Lys Asn Leu Asn Val Thr Ser Leu Gly Phe Arg Ser Leu Lys Glu 435 440 4~5 Ile Ser Ala Gly Ary Ile Tyr Ile Ser Ala Asn Arg Gln Leu Cys Tyr His His Ser Leu Asn Trp Thr Lys Val Leu Arg Gly Pro Thr Glu Glu rg Leu Asp Ile Lys His Asn Arg Pro Arg Arg Asp Cys Val Ala Glu ly Lys Val Cys Asp Pro Leu Cys Ser Ser Gly Gly Cys Trp Gly Pro 500 5~5 510 ly Pro Gly Gln cys Leu Ser Cys Ary Asn Tyr Ser Arg Gly Gly Val Cys Val Thr His Cys Asn Phe Leu Asn Gly Glu Pro Arg Glu Phe Ala His Glu Ala Glu Cys Phe Ser Cys His Pro Glu Cvs Gln Pro Met Gly ly Thr Ala Thr Cys Asn Gly Ser Gly Ser Asp Thr Cys Ala Gln Cys la His Phe Arg Asp Gly Pro His Cys Val Ser Ser Cys Pro His Gly al Leu Gly Ala Lys Gly Pro Ile Tyr Lys Tyr Pro Asp Val Gln Asn Glu Cys Arg Pro Cys His Glu Asn Cys Thr Gln Gly Cys Lys Gly Pro Glu Leu Gln Asp Cys Leu Gly Gln Thr Leu Val Leu Ile Gly Lys Thr is Leu Thr Me~ Ala Leu Thr Val Ile Ala Gly Leu Val Val Ile Phe et Met Leu Gly Gly Thr Phe Leu Tyr Trp Arg Gly Arg Arg Ile Gln SUBSTITUTE SHEET (RULE 26~

CA 02202~33 l997-04-ll WO 96/12019 PCI'IUS9511352~1 Asn Lys Arg Ala Met Arg Arg Tyr Leu Glu Arg Gly Glu Ser Ile Glu Pro Leu Asp Pro Ser Glu Lys Ala Asn Lys Val Leu Ala Arg Ile Phe 690~ 695 700 Lys Glu Thr Glu Leu Arg Lys Leu Lys Val Leu Gly Ser Gly Val Phe Gly Thr Val His Lys Gly Val Trp Ile Pro Glu Gly Glu Ser Ile Lys e Pro Val Cys Ile Lys Val Ile Glu Asp Lys Ser Gly Arg Gln Ser he Gln Ala Val Thr Asp His Met Leu Ala Ile Gly Ser Leu Asp His Ala His Ile Val Arg Leu Leu Gly Leu Cys Pro Gly Ser Ser Leu Gln Leu Val Thr Gln Tyr Leu Pro Leu Gly Ser Leu Leu Asp His Val Arg Gln His Arg Gly Ala Leu Gly Pro Gln Leu Leu Leu Asn Trp Gly Val ln Ile Ala Lys Gly Met Tyr Tyr Leu Glu Glu His Gly Met Val His rg Asn Leu Ala Ala Arg Asn Val Leu Leu Lys Ser Pro Ser Gln Val Gln Val Ala Asp Phe Gly Val Ala Asp Leu Leu Pro Pro Asp Asp Lys Gln Leu Leu Tyr Ser Glu Ala Lys Thr Pro Ile Lys Trp Met Ala Leu Glu Ser Ile His Phe Gly Lys Tyr Thr His Gln Ser Asp Val Trp Ser yr Gly Val Thr Val Trp Glu Leu Met Thr Phe Gly Ala Glu Pro Tyr la Gly Leu Arg Leu Ala Glu Val Pro Asp Leu Leu Glu Lys Gly Glu Arg Leu Ala Gln Pro Gln Ile Cys Thr Ile Asp Val Tyr Met Val Met Val Lys Cys Trp Met Ile Asp Glu Asn Ile Arg Pro Thr Phe Lys Glu Leu Ala Asn Glu Phe Thr Arg Met Ala Arg Asp Pro Pro Arg Tyr Leu al Ile Lys Arg Glu Ser Gly Pro Gly Ile Ala Pro Gly Pro Glu Pro is Gly Leu Thr Asn Lys Lys Leu Glu Glu Val Glu Leu Glu Pro Glu Leu Asp Leu Asp Leu Asp Leu Glu Ala Glu Glu Asp Asn Leu Ala Thr lO10 1015 1020 SUBSTITUTE SHEET (RULE 26) CA 02202~33 1997-04-11 W O 96/12019 PCTrUS95~1352 Thr ~hr Leu Gly Ser Ala Leu Ser Leu Pro Val Gly Thr Leu Asn Arg Pro Arg Gly Ser Gln Ser Leu Leu Ser Pro Ser Ser Gly Tyr Met Pro et Asn Gln Gly Asn Leu Gly Gly Ser Cys Gln Glu Ser Ala Val Ser ly Ser Ser Glu Arg Cys Pro Arg Pro Val Ser Leu His Pro Met Pro 1075 ~080 1085 Arg Gly Cys Leu Ala Ser Glu Ser Ser Glu Gly His Val Thr Gly Ser G1U Ala Glu Leu Gln Glu Lys Val Ser Met Cys Arg Ser Arg Ser Arg Ser Arg Ser Pro Arg Pro Arg Gly Asp Ser Ala Tyr His Ser Gln Arg is Ser Leu Leu Thr Pro Val Thr Pro Leu Ser Pro Pro Gly Leu Glu lu G1U Asp Val Asn Gly Tyr Val Met Pro Asp Thr His Leu Lys Gly Thr Pro Ser Ser Arg Glu Gly Thr Leu Ser Ser Val Gly Leu Ser Ser Val Leu Gly Thr Glu Glu Glu Asp Glu Asp Glu Glu Tyr Glu Tyr Met Asn Arg Arg Arg Arg His Ser Pro Pro His Pro Pro Arg Pro Ser Ser eu Glu Glu Leu Gly Tyr Glu Tyr Met Asp Val Gly Ser Asp Leu Ser la Ser Leu Gly Ser Thr Gln Ser Cys Pro Leu His Pro Val Pro Ile Met Pro Thr Ala Gly Thr Thr Pro Asp Glu Asp Tyr Glu Tyr Met Asn rg Gl.n Arg Asp Gly Gly Gly Pro Gly Gly Asp Tyr Ala Ala Met Gly Ala Cys Pro Ala Ser Glu Gln Gly Tyr Glu Glu Met Arg Ala Phe Gln ly Pro Gly His Gln Ala Pro His Val His Tyr Ala Ary Leu Lys Thr eu Arg Ser Leu Glu Ala Thr Asp Ser Ala Phe Asp Asn Pro Asp Tyr Trp His Ser Arg Leu Phe Pro Lys Ala Asn Ala Gln Arg Thr 1330 (2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 911 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: unknown SUBSTITUTE SHEET (RULE 26~

CA 02202~33 l997-04-ll (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: protein (xi) S~QUENCE DESCRIPTION: SEQ ID NO:10:
et Lys Pro Ala Thr Gly Leu Trp Val Trp Val Ser Leu Leu Val Ala la Gly Thr Val Gln Pro Ser Asp Ser Gln Ser Val Cys Ala Gly Thr lu Asn Lys Leu Ser Ser Leu Ser Asp Leu Glu Gln Gln Tyr Arg Ala Leu Arg Lys Tyr Tyr Glu Asn Cys Glu Val Val Met Gly Asn Leu Glu Ile Thr Ser Ile Glu His Asn Arg Asp Leu Ser Phe Leu Arg Ser Val rg Glu Val Thr Gly Tyr Val Leu Val Ala Leu Asn Gln Phe Arg Tyr go 95 eu Pro Leu Glu Asn Leu Arg Ile Ile Arg Gly Thr Lys Leu Tyr Glu sp Arg Tyr Ala Leu Ala Ile Phe Leu Asn Tyr Arg Lys Asp Gly Asn Phe Gly Leu Gln Glu Leu Gly Leu Lys Asn Leu Thr Glu Ile Leu Asn Gly Gly Val Tyr Val Asp Gln Asn Lys Phe Leu Cys Tyr Ala Asp Thr 145 150 lSS 160 le His Trp Gln Asp Ile Val Arg Asn Pro Trp Pro Ser Asn Leu Thr eu Val Ser Thr Asn Gly Ser Ser Gly Cys Gly Arg Cys His Lys Ser ys Thr Gly Arg Cys Trp Gly Pro Thr Glu Asn His Cys Gln Thr Leu l9S 200 205 Thr Arg Thr Val Cys Ala Glu Gln Cys Asp Gly Arg Cys Tyr Gly Pro T'yrr Val Ser Asp Cys Cys His Arg Glu Cys Ala Gly Gly Cys Ser Gly ro Lys Asp Thr Asp Cys Phe Ala Cys Met Asn Phe Asn Asp Ser Gly la Cys Val Thr Gln Cys Pro Gln Thr Phe Val Tyr Asn Pro Thr Thr he Gln Leu Glu His Asn Phe Asn Ala Lys Tyr Thr Tyr Gly Ala Phe Cys Val Lys Lys Cys Pro His Asn Phe Val Val Asp Ser Ser Ser Cys Val Arg Ala Cys Pro Ser Ser Lys Met Glu Val Glu Glu Asn Gly Ile SUBSTITUTE SHEET (RULE 26~

-CA 02202~33 1997-04-11 Lys Met Cys Lys Pro Cys Thr Asp Ile Cys Pro Lys Ala Cys Asp Gly le Gly Thr Gly Ser Leu Met Ser Ala Gln Thr Val Asp Ser Ser Asn .~ 340 345 350 Ile Asp Lys Phe Ile Asn Cys Thr Lys Ile Asn Gly Asn Leu Ile Phe Leu Val Thr Gly Ile His Gly Asp Pro Tyr Asn Ala Ile Glu Ala Ile Asp Pro Glu Lys Leu Asn Val Phe Arg Thr Val Arg Glu Ile Thr Gly Phe Leu Asn Ile Gln Ser Trp Pro Pro Asn Met Thr Asp Phe Ser Val Phe Ser Asn Leu Val Thr Ile Gly Gly Arg Val Leu Tyr Ser Gly Leu Ser Leu Leu Ile Leu Lys Gln Gln Gly Ile Thr Ser Leu Gln Phe Gln Ser Leu Lys Glu Ile Ser Ala Gly Asn Ile Tyr Ile Thr Asp Asn Ser Asn Leu Cys Tyr Tyr His Thr Ile Asn Trp Thr Thr Leu Phe Ser Thr Ile Asn Gln Arg Ile Val Ile Arg Asp Asn Arg Lys Ala Glu Asn Cys Thr Ala Glu Gly Met Val Cys Asn His Leu Cys Ser Ser Asp Gly Cys Trp Gly Pro Gly Pro Asp Gln Cys Leu Ser Cys Arg Arg Phe Ser Arg Gly Arg Ile Cys Ile Glu Ser Cys Asn Leu Tyr Asp Gly Glu Phe Arg Glu Phe Glu Asn Gly Ser Ile Cys Val Glu Cys Asp Pro Gln Cys Glu Lys Met Glu Asp Gly Leu Leu Thr Cys His Gly Pro Gly Pro Asp Asn Cys Thr Lys Cys Ser His Phe Lys Asp Gly Pro Asn Cys Val Glu Lys Cys Pro Asp Gly Leu Gln Gly Ala Asn Ser Phe Ile Phe Lys Tyr Ala Asp Pro Asp Arg Glu Cys His Pro Cys His Pro Asn Cys Thr Gln Gly Cys Asn Gly Pro Thr Ser His Asp Cys Ile Tyr Tyr Pro Trp Thr Gly ~Iis Ser Thr Leu Pro Gln Asp Pro Val Lys Val Lys Ala Leu Glu Gly SUBSTITUTE SHEET (RUI_E 26) CA 02202~33 1997-04-11 W O96/12019 PCTrUS95/13~2 Phe Pro Arg Leu Val Gly Pro Asp Phe Phe Gly Cys Ala Glu Pro Ala sn Thr Phe Leu Asp Pro Glu Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr ro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu al Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Val Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser , 755 760 765 Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile er Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro ro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu al Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys (2) INFORMATION FOR SEQ ID NO:ll:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 a~ino acids (B) TYPE: amino acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:ll:
Gly Xaa Gly Xaa Xaa Gly (2) INFO~MATION FOR SEQ ID NO:12:

SUBSTITUTE SHEET (RULE 26) . CA 02202533 1997-04-11 wo 96/12019 PCrnJS9511352 (i) SEQUENCE CHARACTERISTICS:
(A) LENGT~: 6 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:
Asp Leu Ala Ala Arg Asn (2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:
Pro Ile Dys Trp Met Ala (2) INFORMATION FOR SEQ ID NO:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: sin~le (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:

(2) INFORMATION FOR SEQ ID NO:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 ~ase pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:

(2~ INFORMATION FOR SEQ ID NO:16:
(i) SEQUENCE CHARACTERISTICS:

SUBSTITUTE SHEET (RULE 26) CA 02202~33 1997-04-11 W O9611Z019 PCTrUS95/13~2 (A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:

(2) INFORMATION FOR SEQ ID NO:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:

(2) INFORMATION FOR SEQ ID NO:18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:

(2) INFORMATION FOR SEQ ID NO:lg:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (8) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:

(2) INFORMATION FOR SEQ ID NO:20:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single SUBSTITUTE SHEET (RULE 26~

W O96/12019 PCTnUS95~13524 (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:
GGRTCDATCA TCCARCCT l8 (2) INFORMATION FOR SEQ ID NO:21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:

(2) INFORMATION FOR SEQ ID NO:22:
(i) SEQUEN OE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:
Thr Val Trp Glu Leu Met Thr (2) INFORMATION FOR SEQ ID NO:23:
(i) S~:OU~N~' CHARACTERISTICS:
(A) LENGTH: 8 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:
His Val Lys Ile Thr Asp Phe Gly (2) INFORMATION FOR SEQ ID NO:24:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 W O96/12019 PCTrUS95/1352 (ii) MOLECULE TYPE: peptide ~xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:
Val Tyr Met Ile Ile Leu Lys (2) INFORMATION FOR SEQ ID NO:25:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:
Trp Glu Leu Met Thr Phe l 5 (2) INFORMATION FOR SEQ ID NO:26:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:
Pro Ile Lys Trp Met Ala Leu Glu (2) INFORMATION FOR SEQ ID NO:27:
(i) S~:Q~N~: CHARACTERISTICS:
(A) LENGTH: 6 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:
Cys Trp Met Ile Asp Pro l 5 (2) INFORMATION FOR SEQ ID NO:28:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 35 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown SUBSTITUTE SHEET (RULE 26~

W O9~/12019 PCTnUS9Sl13524 (ii) MOLECULE TYPE: DNA (genomic~

(xi) SEQUENCE DESCRIPTIoN: SEQ ID NO:28:
GACTCGAGTC GACATCGATT ~111111111 TTTTT 35 (~) INFORMATION FOR SEQ ID NO:29:
(i) SEQUENCE CXARACTERISTICS:
(A) LENGT~: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown ~ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:

(2) INFORMATION FOR SEQ ID NO:30:
(i) SEQUENCE CHARACTERISTICS:
tA) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPL: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:

(2) INFORMATION FOR SEQ ID NO:3l:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3l:
Leu Ala Arg Leu Leu Glu Gly Asp Glu Lys Glu Tyr Asn Ala Asp Gly l 5 l0 15 Gly (2) INFORMATION FOR SEQ ID NO:32:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 13 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown SUBSTITUTE SHEET (RULE 26) CA 02202~33 1997-04-11 W O96/12019 PCTrUS9511352 (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:
Glu Glu Asp Leu Glu Asp Met Met Asp Ala Glu Glu Tyr l 5 lO
(2) INFORMATION FOR SEQ ID NO:33:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Xaa (B) LOCATION: 3 (D) OTHER INFORMATION: "Xaa = Any amino acid~
(ix) FEATURE:
(A) NAME/KEY: Xaa (B) LOCATION: 6 (D) OTHER INFORMATION: "Xaa = Any amino acid~
(ix) FEATURE:
(A) NAME/KEY: Xaa (B) LOCATION: 7 (D) OTHER INFORMATION: "Xaa = Any amino acid~

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:
Ser Gly Xaa Lys Pro Xaa Xaa Ala Ala l 5 (2) INFORMATION FOR SEQ ID NO:3s:
(i) SEQUENCE C~ARACTERISTICS:
(A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3~:

(2) INFORMATION FOR SEQ ID NO:35:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 50 base pairs (B) TYPE: nucleic acid ~C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic~

SUBSTITUTE SHEET (RULE 26~

W O96/12019 ~CTnUS95l13524 (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:35:
; ~1LL1-1ACCT TTTTTATCTT ~1-11-~1~11C G~1--1-~1~1AT TTCACACGCC 50 (2~ INFORMATION FOR SEQ ID NO:36:
~i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 49 baSe PairS
(B) TYPE: nUC1eiC aCid (C) STRANDEDNESS: UnknOWn (D) TOPOLOGY: UnknOWn (ii) MOLECULE TYPE: DNA (genOmiC) (Xi) S~:UU~N~ DESCRIPTION: SEQ ID NO 36 (2) INFORMATION EOR SEQ ID NO:37:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 baSe pairs (B) TYPE: nUC1eiC aCid (C) STRANDEDNESS: UnknOWn (D) TOPOLOGY: UnknOWn (ii) MOLECULE TYPE: DNA (genOmiC) (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:

(2) INFORMATION FOR SEQ ID NO:38:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 baSe Pair5 (B) TYPE: nUC1eiC aCid (C) STRANDEDNESS: UnknOWn (D) TOPOLOGY: UnknOWn (ii) MOLECULE TYPE: DNA (genOmiC) (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:38:

(2) INFORMATION FOR SEQ ID NO:39:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 94 baSe Pair5 (B) TYPE: nUC1eiC aCid (C) STRANDEDNESS: UnknOWn (D~ TOPOLOGY: UnknOWn r (ii) MOLECULE TYPE: DNA (genomic) (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:39:

SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 W O96112019 PCTrUS95/13~2 (2) INFORMATION FOR SEQ ID NO:40:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 95 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:40:
Met Val Val Lys Pro Pro Gln Asn Lys Thr Glu Ser Glu Asn Thr Ser l 5 l0 15 sp Lys Pro Lys Arg Lys Lys Lys Gly Gly Lys Asn Gly Lys Asn Arg rg Asn Arg Ser His Leu Ile Lys Cys Ala Glu Lys Glu Lys Thr Phe Cys Val Asn Gly Gly Glu Cys Phe Thr Val Lys Asp Leu Ser Asn Pro Ser Arg Tyr Leu Cys Lys Cys Pro Asn Glu Phe Thr Gly Asp Arg Cys Gln Asn Tyr Val Met Ala Ser Phe Tyr Lys Ala Glu Glu Leu Tyr INFORMATION FOR SEQ ID NO:4l:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1389 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: l..l386 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:41:

Met Val Val Lys Pro Pro Gln Asn Lys Thr Glu Ser Glu Asn Thr Ser l s l0 15 Asp Lys Pro Lys Arg Lys Lys Lys Gly Gly Lys Asn Gly Lys Asn Ary Arg Asn Arg Ser His Leu Ile Lys Cys Ala Glu Lys Glu Lys Thr Phe TGT GTG AAT GGG GGC GAG TGC TTC ACG GTG AAG GAC CTG TCA AAC CCG l92 SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 W ~96/12019 PCTnUS9~J1352 Cys Val A5n Gly Gly Glu Cys Ph~ Thr Val Lys Asp Leu Ser Asn Pro _ TCA AGA TAC TTG TGC AAG TGC CCG AAC GAA TTT ACT GGC GAC CGT TGC 240 Ser Arg Tyr Leu Cys Lys Cys Pro Asn Glu Phe Thr Gly Asp Arg Cys CA~ AAC TAT GTT ATG GCA TCT TTT TAC AAA GCG GAG GAA CTC TAC AAG 288 Gln Asn Tyr Val Met Ala Ser Phe Tyr Lys Ala Glu Glu Leu Tyr Lys Leu Met Ala Glu Glu Gly Gly Ser Leu Ala Ala Leu Thr Ala His Gln Ala Cys His Leu Pro Leu Glu Thr Phe Thr Arg ~is Ary Gln Pro Arg Gly Trp Glu Gln Leu Glu Gln Cys Gly Tyr Pro Val Gln Arg Leu Val Ala Leu Tyr Leu Ala Ala Arg Leu Ser Trp Asn Gln Val Asp Gln Val Ile Arg Asn Ala Leu Ala Ser Pro Gly Ser Gly Gly Asp Leu Gly Glu Ala Ile Arg Glu Gln Pro Glu Gln Ala Arg Leu Ala Leu Thr Leu Ala 1~30 185 190 Ala Ala Glu Ser Glu Arg Phe Val Arg Gln Gly Thr Gly Asn Asp Glu Ala Gly Ala Ala Asn Ala Asp Val Val Ser Leu Thr Cys Pro Val Ala Ala Gly Glu Cys Ala Gly Pro Ala Asp Ser Gly Asp Ala Leu Leu Glu Arg Asn Tyr Pro Thr Gly Ala Glu Phe Leu Gly Asp Gly Gly Asp Val Ser Phe Ser Thr Arg Gly Thr Gln Asn Trp Thr Val Glu Arg Leu Leu Gln Ala His Arg Gln Leu Glu Glu Arg Gly Tyr Val Phe Val Gly Tyr His Gly Thr Phe Leu Glu Ala Ala Gln Ser Ile Val Phe Gly Gly Val Ars Ala Arg Ser Gln Asp Leu Asp Ala Ile Trp Arg Gly Phe Tyr Ile SUBSTITUTE SHEET (RULE 26~

CA 02202~33 1997-04-11 WO96/12019 PCTrUS95/1352 Ala Gly Asp Pro Ala Leu Ala Tyr Gly Tyr Ala Gln Asp Gln Glu Pro Asp Ala Arg Gly Arg Ile Arg Asn Gly Ala Leu Leu Arg Val Tyr Val Pro Arg Ser Ser Leu Pro Gly Phe Tyr Arg Thr Ser Leu Thr Leu Ala Gly Gly Glu Ala Ala Gly Glu Val Glu Arg Leu Ile Gly His Pro Leu Pro Leu Arg Leu Asp Ala Ile Thr Gly Pro Glu Glu Glu Gly Gly Arg 3~5 390 395 400 Leu Glu Thr Ile Leu Gly Trp Pro Leu Ala Glu Arg Thr Val Val Ile Pro Ser Ala Ile Pro Thr Asp Pro Arg Asn Val Gly Gly Asp Leu Asp Pro Ser Ser Ile Pro Asp Lys Glu Gln Ala Ile Ser Ala Leu Pro Asp Tyr Ala Ser Gln Pro Gly Lys Pro Pro Arg Glu Asp Leu Lys TAA
(2) INFORMATION FOR SEQ ID NO:42:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 462 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:42:
Met Val Val Lys Pro Pro Gln Asn Lys Thr Glu Ser Glu Asn Thr Ser sp Lys Pro Lys Arg Lys Lys Lys Gly Gly Lys Asn Gly Lys Asn Arg Arg Asn Arg Ser His Leu Ile Lys Cys Ala Glu Lys Glu Lys Thr Phe Cys Val Asn Gly Gly Glu Cys Phe Thr Val Lys Asp Leu Ser Asn Pro Ser Arg Tyr Leu Cys Lys Cys Pro Asn Glu Phe Thr Gly Asp Arg Cys ln Asn Tyr Val Met Ala Ser Phe Tyr Lys Ala Glu Glu Leu Tyr Lys eu Met Ala Glu Glu Gly Gly Ser Leu Ala Ala Leu Thr Ala His Gln SUBSTITUTE SHEET (RULE 26) CA 02202~33 1997-04-11 W O96112019 PCTnUS9~1352 Ala Cys His Leu Pro Leu Glu Thr Phe Thr Arg His Arg Gln Pro Arg Gly Trp Glu Gln Leu Glu Gln Cys Gly Tyr Pro Val Gln Arg Leu Val - Ala Leu Tyr Leu Ala Ala Arg Leu Ser Trp Asn Gln Val Asp Gln Val Ile Arg Asn Ala Leu Ala Ser Pro Gly Ser Gly Gly Asp Leu Gly Glu Ala Ile Arg Glu Gln Pro Glu Gln Ala Arg heu Ala Leu Thr Leu Ala Ala Ala GlU Ser Glu Arg Phe Val Arg Gln Gly Thr Gly Asn Asp Glu Ala Gly Ala Ala Asn Ala Asp Val Val Ser Leu Thr Cys Pro Val Ala Ala Gly Glu Cys Ala Gly Pro Ala Asp Ser Gly Asp Ala Leu Leu Glu Arg Asn Tyr Pro Thr Gly Ala Glu Phe Leu Gly Asp Gly Gly Asp Val Ser Phe Ser Thr Arg Gly Thr Gln Asn Trp Thr Val Glu Arg Leu Leu Gln Ala His Arg Gln Leu Glu Glu Arg Gly Tyr Val Phe Val Gly Tyr ~is Gly Thr Phe Leu Glu Ala Ala Gln Ser Ile Val Phe Gly Gly Val Arg Ala Arg Ser Gln Asp Leu Asp Ala Ile Trp Arg Gly Phe Tyr Ile Ala Gly Asp Pro Ala Leu Ala Tyr Gly Tyr Ala Gln Asp Gln Glu Pro Asp Ala Arg Gly Arg Ile Arg Asn Gly Ala Leu Leu Arg Val Tyr Val Pro Arg Ser Ser Leu Pro Gly Phe Tyr Arg Thr Ser Leu Thr Leu Ala Gly Gly Glu Ala Ala Gly Glu Val Glu Arg Leu Ile Gly His Pro Leu Pro Leu Arg Leu Asp Ala Ile Thr Gly Pro Glu Glu Glu Gly Gly Arg Leu Glu Thr Ile Leu Gly Trp Pro Leu Ala Glu Arg Thr Val Val Ile Pro Ser Ala Ile Pro Thr Asp Pro Arg Asn Val Gly Gly Asp Leu Asp Pro Ser Ser Ile Pro Asp Lys Glu Gln Ala Ile Ser Ala Leu Pro Asp Tyr Ala Ser Gln Pro Gly Lys Pro Pro Arg Glu Asp Leu Lys SUBSTITUTE SHEET (RULE 26~

Claims (73)

WHAT IS CLAIMED IS:

1. A recombinant polynucleotide comprising a sequence of at least about 200 nucleotides having greater than 80% homology to a contiguous portion of the HER4 nucleotide sequence depicted in FIG. 1A and 1B or its complement.

2. A recombinant polynucleotide comprising a sequence of nucleotides encoding at least about 70 contiguous amino acids within the HER4 amino acid sequence depicted in FIG. 1A and 1B.

3. A recombinant polynucleotide comprising a contiguous sequence of at least about 200 nucleotides within the HER4 nucleotide coding sequence depicted in FIG. 1A and 1B or its complement.

4. A recombinant polynucleotide comprising the HER4 nucleotide coding sequence depicted in FIG. 1A
and 1B or its complement.

5. A recombinant polynucleotide according to claim 1, 2, 3, or 4 which is a DNA polynucleotide.

6. A recombinant polynucleotide according to claim 1, 2, 3, or 4 which is a RNA polynucleotide.

7. An assay kit comprising a recombinant polynucleotide according to claim 1, 2, 3, or 4 to which a detectable label has been added.

8. A polymerase chain reaction kit (PCR) comprising a pair of primers capable of priming cDNA
synthesis in a PCR reaction, wherein each primer is a polynucleotide according to claim 5.

9. The PCR kit according to claim 8 further comprising a polynucleotide probe capable of hybridizing to a region of the HER4 gene between and not including the nucleotide sequences to which the primers hybridize.

10. A polypeptide comprising a sequence of at least about 80 amino acids having greater than 90%
identity to a contiguous portion of the HER4 amino acid sequence depicted in FIG. 1A and 1B.

11. A HER4 polypeptide comprising the amino acid sequence depicted in FIG. 1A and 1B from amino acid residues 1 through 1308.

12. A HER4 polypeptide comprising the amino acid sequence depicted in FIG. 1A and 1B from amino acid residues 26 through 1308.

13. A HER4 polypeptide comprising the amino acid sequence depicted in FIG. 1A and 1B from amino acid residues 1 through 1045.

14. A HER4 polypeptide comprising the amino acid sequence depicted in FIG. 1A and 1B from amino acid residues 26 through 1045.

15. A HER4 polypeptide comprising the amino acid sequence depicted in FIG. 2A and 2B.

16. A HER4 polypeptide comprising the amino acid sequence depicted in FIG. 1A and 1B from amino acid residues 772 through 1308.

17. A HER4 polypeptide comprising the amino acid sequence depicted in FIG. 3.

18. An antibody capable of inhibiting the interaction of a soluble polypeptide and human HER4.

19. An antibody according to claim 18 wherein the soluble polypeptide is a heregulin.

20. An antibody capable of stimulating HER4 tyrosine autophosphorylation.

21. An antibody capable of inducing a HER4-mediated signal in a cell, which signal results in modulation of growth or differentiation of the cell.

22. An antibody capable of inhibiting HepG2 fraction 17-stimulated tyrosine phosphorylation of HER4 expressed in CHO/HER4 21-2 cells as deposited with the ATCC.

23. An antibody which immunospecifically binds to human HER4.

24. An antibody according to claim 23 which resides on the cell surface after binding to HER4.

25. An antibody according to claim 23 which is internalized into the cell after binding to HER4.

26. An antibody which immunospecifically binds to human HER4 expressed in CHO/HER4 21-2 cells as deposited with the ATCC.

27. An antibody according to claim 23 which neutralizes HER4 biological activity.

28. An antibody according to claim 23 which is conjugated to a drug or toxin.

29. An antibody according to claim 23 which is radiolabeled.

30. Plasmid pBSHER4Y as deposited with the ATCC.

31. A recombinant vector comprising a nucleotide sequence encoding a polypeptide according to claim 10, 11, 12, 13, 14, 15, 16, or 17.

32. A host cell transfected with a recombinant vector according to claim 31.

33. A recombinant vector comprising a nucleotide sequence encoding a polypeptide according to claim 10, 11, 12, 13, 14, 15, 16, or 17, wherein the coding sequence is operably linked to a control sequence which is capable of directing the expression of the coding sequence in a host cell transfected therewith.

34. A host cell transfected with a recombinant vector according to claim 33.

35. Cell line CHO/HER4 21-2 as deposited with the ATCC.

36. An assay for detecting the presence of a HER4 ligand in a sample comprising:
(a) applying the sample to cells which have been engineered to overexpress HER4; and (b) detecting an ability of the ligand to affect an activity mediated by HER4.

37. The assay according to claim 36, wherein the cells are CHO/HER4 21-2 cells as deposited with the ATCC.

38. The assay according to claim 36, wherein the activity detected is HER4 tyrosine phosphorylation.

39. The assay according to claim 36, wherein the activity detected is morphologic differentiation.

40. A ligand for HER4 comprising a polypeptide which binds to HER4, stimulates tyrosine phosphorylation of HER4, and affects a biological activity mediated by HER4.

41. A ligand according to claim 40 which is capable of inducing morphological differentiation when added to cultured MDA-MB-453 cells.

42. A ligand according to claim 40 obtained from cultured HepG2 cell conditioned media.

43. An immunoassay for detecting HER4 comprising:
(a) providing an antibody according to claim 23 or 26;
(b) incubating a biological sample with the antibody under conditions which allow for the binding of the antibody to HER4; and (c) determining the amount of antibody present as a HER4-antibody complex.

44. A method for the in vivo delivery of a drug or toxin to cells expressing HER4 comprising conjugating an antibody according to claim 23 or 26, or an active fragment thereof, to the drug or toxin, and delivering the resulting conjugate to an individual by using a formulation, dose, and route of administration such that the conjugate binds to HER4.

45. A HER4 ligand comprising a polypeptide which is capable of binding to HER4 and activating protein kinase activity.

46. The ligand of claim 40 or claim 45 which is heregulin.

47. The ligand of claim 45 which is p45.

48. An isolated polypeptide of molecular weight 45 kDa as determined by SDS-Page analysis having an N-terminal amino acid sequence Ser-Gly-X-Lys-Pro-X-X-Ala-Ala, wherein said polypeptide is capable of binding to HER4 as expressed in MDA-MB-453 cells.

49. A chimeric polypeptide comprising a HER4 ligand fused to a cytotoxin.

50. A chimeric polypeptide according to claim 49 wherein the HER4 ligand is a heregulin, a functional derivative of a heregulin, or a homolog of a heregulin, which is capable of binding to and activating HER4.

51. A chimeric polypeptide according to claim 49 or 50 wherein the heregulin is heregulin-.alpha. (HRG-.alpha.).

52. A chimeric polypeptide according to claim 49 or 50 wherein the heregulin is heregulin-.beta.1 (HRG-.beta.1).

53. A chimeric polypeptide according to claim 49 or 50 wherein the heregulin is heregulin-.beta.2 (HRG-.beta.2).

54. A chimeric polypeptide according to claim 53 further comprising the amphiregulin leader peptide at the amino terminus.

55. A chimeric polypeptide according to claim 49 or 50 wherein the heregulin is heregulin-.beta.3 (HRG-.beta.3).

56. A chimeric polypeptide according to claim 49, 50, or 54 wherein the cytotoxin is PE40 or a functionally equivalent Pseudomonas arabinosa exotoxin derivative.

57. HAR-TX .beta.2 having the amino acid sequence depicted in SEQ ID No:42.

58. A recombinant polynucleotide comprising a sequence of nucleotides encoding a chimeric polypeptide according to claim 49.

59. A recombinant polynucleotide comprising a sequence of nucleotides encoding HAR-TX .beta.2.

60. A recombinant vector comprising the polynucleotide according to claim 59 under the control of an IPTG-inducible T7-promoter.

61. A monoclonal antibody which competitively inhibits the immunospecific binding of the monoclonal antibody produced by hybridoma cell line 6-4-11 as deposited with the ATCC to its epitope.

62. A monoclonal antibody which competitively inhibits the immunospecific binding of the monoclonal antibody produced by hybridoma cell line 7-142 as deposited with the ATCC to its epitope.

63. Hybridoma cell line 6-4-11 as deposited with the ATCC and assigned accession number HB11715.

64. Hybridoma cell line 7-142 as deposited with the ATCC and assigned accession number HB11716.

65. A method of delivering a molecule to a cell expressing HER4, comprising:

(a) generating a conjugate or a fusion of the molecule and a HER4 ligand; and (b) contacting the cell with the conjugate or fusion such that it binds to HER4 and is thereby internalized into the cell.

66. A method of delivering a molecule to a cell which expresses HER4, comprising contacting the cell with a conjugate or a fusion of a HER4 ligand and the molecule.

67. The method according to claim 65 or 66 wherein the molecule is a polypeptide.

68. The method according to claim 65 or 6 wherein the molecule is a polynucleotide.

69. The method according to claim 65 or 66 wherein the molecule is a radionuclide.

70. The method according to claim 65 or 66 wherein the molecule is an imaging label.

71. A method of delivering a cytotoxin to the cytoplasm of a cell which expresses HER4, comprising contacting the cell with a conjugate of the cytotoxin and a HER4 ligand, such that the conjugate binds to, activates, and is internalized via HER4.

72. A method of delivering a cytotoxin to the cytoplasm of a cell which expresses HER4, comprising contacting the cell with a chimeric polypeptide comprising a HER4 ligand fused to the cytotoxin, such that the chimeric polypeptide binds to, activates, and is internalized via HER4.

73. The method according to claim 72 wherein the chimeric polypeptide is HAR-TX .beta.2.