WO1996011213A1 - Inhibiteurs d'il-4 dimeres - Google Patents

Inhibiteurs d'il-4 dimeres Download PDF

Info

Publication number
WO1996011213A1
WO1996011213A1 PCT/US1995/013101 US9513101W WO9611213A1 WO 1996011213 A1 WO1996011213 A1 WO 1996011213A1 US 9513101 W US9513101 W US 9513101W WO 9611213 A1 WO9611213 A1 WO 9611213A1
Authority
WO
WIPO (PCT)
Prior art keywords
receptor
dimeric
dimeric compound
compound
peg
Prior art date
Application number
PCT/US1995/013101
Other languages
English (en)
Inventor
Rebecca W. Vanderslice
George M. Cox
Original Assignee
Amgen Boulder Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Amgen Boulder Inc. filed Critical Amgen Boulder Inc.
Priority to AU38308/95A priority Critical patent/AU3830895A/en
Publication of WO1996011213A1 publication Critical patent/WO1996011213A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • C07K14/7155—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for interleukins [IL]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • This invention relates to compounds that bind interleukin-4 (IL-4) and, more particularly, to dimeric compounds that are effective inhibitors of IL-4.
  • IL-4 inhibitor stems from the central role of IL-4 in the development and maintenance of primary and secondary immunoglobuiin E (IgE) responses and in the development of T cell helper type 2 (Th2)-associated immune responses.
  • IgE immunoglobuiin E
  • Th2 T cell helper type 2
  • IgE levels are associated with immediate hypersensitivity diseases such as asthma, allergic rhinitis, atopic dermatitis and eczema, among others (Geha, Current Opinion in Immunology, vol. 5, pg. 935-936, 1 993) .
  • IgE binds to specific receptors on mast cells and basophils. When cross-linked by antigen, the aggregated IgE causes mast cell/basophil degranulation, histamine release and cytokine synthesis.
  • IL-4 has been shown to induce IgE synthesis by peripheral blood mononuclear cells in vitro (Garrone et al., Eur. J. Immunology, vol. 21 , 1 365- 1 369, 1991 ).
  • mice in which the IL-4 gene has been disrupted are unable to make IgE antibodies in response to allergen challenge (Bleuthmann et al., J. Cellular
  • IL-4 deficient mice show reduced peribro ⁇ chial inflammation in a model of antigen-induced airway inflammation , confirming the role of IL-4 and IgE antibodies in disease pathogenesis (Cuvelier et al . , J. Cellular Biochemistry, vol. 0, Supplement 1 7B, pg. 87, 1 993) .
  • IL-4 and gamma interferon have been shown to play critical roles in determining whether immature ThO cells develop into Th 1 or Th2 type mature T cells (Maggi et al. , J. Immunology, vol. 1 48, pg. 21 42-2147, 1 992).
  • the effects of these cytokines appear to be reciprocal.
  • Th 1 - type responses are associated with cellular immune responses, whereas Th2-type responses are associated with humoral immune responses.
  • IL-4 has been shown to induce ThO cells to become Th2-like.
  • antibodies to IL-4 have been shown to inhibit development of Th2 cells and allow development of Th 1 cells.
  • Th2 cells characteristically secrete IL-4, II-5 and IL- 10 upon activation.
  • IL-10 acts to inhibit development of Th 1 cells and down regulates the antimicrobial activities of monocytes and macrophages.
  • gamma interferon induces ThO cells to become Th 1 - like.
  • Th 1 cells are characterized by the secretion of IL-2 and gamma interferon when activated.
  • Gamma interferon also inhibits development of Th2 cells.
  • Th2- type T cells secrete cytokines such as IL-5 that are implicated in pathological processes such as eosinophilia in asthma patients. Inhibiting development of Th2 T cells could reduce IL-5 levels in patients and prevent development of the pathological consequences of eosinophilia such as airway damage and hypersensitivity.
  • cytokines such as IL-5 that are implicated in pathological processes such as eosinophilia in asthma patients.
  • Inhibiting development of Th2 T cells could reduce IL-5 levels in patients and prevent development of the pathological consequences of eosinophilia such as airway damage and hypersensitivity.
  • IL-4 deficient mice do not develop eosinophilia and exhibit reduced airway inflammation in a model of antigen induced airway inflammation.
  • Soluble IL-4R also prevented development of a Th2-associated response in susceptible animals as reported in Gessner et al., Infection & Immunity, 62:41 1 2-41 1 7 ( 1 994).
  • the immunity conferred by anti-IL-4 therapy appears to be sustainable and to involve development of a Th1 response to the pathogen.
  • IL-4 inhibitors to reduce IgE levels and alleviating symptoms in immediate hypersensitivity diseases such as allergic rhinitis, asthma, atopic dermatitis and eczema, among others.
  • An IL-4 inhibitor is also needed to alter a patient's immune response from a Th2- to a Th1 -associated response, which may be beneficial to patients suffering from recurrent infections caused by yeast, intracellular parasites and viruses.
  • the present invention satisfies these needs and provides related advantages as well. Summary of the Invention
  • the present invention relates to dimeric compounds capable of binding and inhibiting the activity of IL-4.
  • the dimer compounds have the formula R,-X-R 2 , wherein R, is an IL-4 receptor; R 2 is an IL-4 receptor or an IL-2R c ; and X is a polymeric spacer.
  • the receptors comprise the extracellular domains of the naturally-occurring IL-4R and
  • IL-2R c and active fragments thereof.
  • X is polyethylene glycol having a molecular weight in the range of about 1 - 20 kD, preferably up to about 8 kD, and more preferably up to about 3.4 kD.
  • the dimeric compounds can be homodimers when R, and R 2 are IL-4 receptors and heterodimers when R, is an IL-4 receptor and R 2 is an IL- 2R c .
  • the invention further provides methods for making the dimeric compounds.
  • the methods can be accomplished by recombinant DNA technology.
  • the invention relates to methods of treating an IL-4 mediated disease by administering a therapeutically effective amount of the dimeric compounds of the invention.
  • the dimeric compounds can mediate the deleterious increase in IgE production and inhibit the development of Th2 T cells associated with certain IL-4 mediated diseases.
  • IL-4 mediated diseases include allergic rhinitis, asthma, atopic dermatitis, eczema, infections caused by yeast, intracellular parasites or viruses, such as HIV.
  • Pharmaceutical compositions are also provided for the use in the treatment of IL-4 mediated diseases.
  • the present invention also relates to the use of the dimeric compounds as diagnostic reagents and calibration standards for detecting or quantifying IL-4 in a sample.
  • the methods include: (a) contacting the dimeric compounds of the invention with the sample; (b) allowing the dimeric compounds to bind to IL-4; and (c) detecting or quantifying IL-4 bound to the dimeric compounds.
  • the dimeric compounds can also be used to purify IL-4 from a sample.
  • the sample is first contacted with the dimeric compounds and allowed to bind.
  • the bound IL-4 is then dissociated from the dimeric compounds and collected as purified IL-4.
  • the present invention provides dimeric compounds that are better or equal inhibitors of IL-4 than soluble IL-4 receptors. More particularly, the dimeric compounds have the formula R,-X-R 2 , wherein R, is an IL-4 receptor (IL-4R); R 2 is either an IL-4R or IL-2 receptor gamma chain (IL-2R c ); and X is a polymeric spacer, also referred to herein as a cross-linker. Accordingly, the dimeric compounds of the present invention contain at least one biologically active IL-4 receptor.
  • dimeric compounds refer to compounds containing two active moieties that can be the same or different.
  • “Homodimeric compounds” refer to compounds containing the same biologically active moieties, such as two IL-4 receptors.
  • “Heterodimeric compounds” refer to compounds containing two different active moieties, such as an IL-4 receptor and IL-2R c to form the IL-4 binding compounds of the present invention.
  • Murine and human IL-4 receptors have been cloned as described in Mosley et al.. Cell. 59:335-348 ( 1 989) and Galizzi et al.. Int. Immunol.. 2:669-675 ( 1 990) .
  • a soluble form of the IL-4 receptor (slL-4R) has been detected in mouse biological fluids, indicating that IL-4 receptors may be shed naturally from cells.
  • a cDNA encoding a naturally-occurring soluble form of the mouse IL-4 receptor has been described in Mosley et al., Cell, 59:335-348 (1 989). The cDNA encodes a protein that is missing the transmembrane and cytoplasmic domains of the receptor.
  • the cDNA appears to have been generated by alternative mRNA splicing.
  • the DNA sequence of the human IL-4 receptor is provided in Galizzi et al., supra.
  • mouse slL-4R either the recombinant protein encoded by the alternatively spliced cDNA or the naturally occurring protein purified from biological fluids, is capable of binding IL-4 and inhibiting its actions on cells in vitro and in vivo (Mosley et al., Cell. 59:335-348 (1 989; Fernandez-Botran & Vitetta, J. Exp. Med., 1 74:673-681 ( 1991 )).
  • the affinity of the slL-4R for IL-4 is less than that of the IL-4R on cells.
  • IL-4R for IL-4 results in a 3-fold difference in k d values determined in equilibrium binding studies (Fernandez-Botran and Vitetta, J. Exp. Med. , 1 74:673-681 ( 1 991 ) .
  • In vitro studies with a soluble form of the human IL-4R indicate that it also is capable of binding and neutralizing the activity of IL-4 on ceils (Garrone et al., Eur. J. Immunol. , 21 : 1 365-1 369 ( 1 991 ) .
  • the human slL-4R used was a truncated form of the cell bound receptor (missing the transmembrane and cytoplasmic domains) secreted from a mammalian cell line (COS cells) .
  • the affinity of the soluble human receptor for IL-4 has not been reported .
  • IL-2R c IL- 2R gamma chain
  • IL-2R c modulates the affinity of the IL-4R for 1 -4 by increasing IL-4R's high affinity interaction with IL-4.
  • the DNA sequence for human IL-2R c has been previously published.
  • heterodimeric compounds of the present invention could be prepared that have higher affinities for IL-4 than the soluble I -4 receptors as shown by an increase in bioactivity. It has also been found in the context of the heterodimeric compounds (IL-4R:IL-2R c ), that the I L- 2 R c portion provides increased bioactivity compared to mono-pegylated IL-4R or unpegylated IL-4R as shown by a decrease in dissociation rates reported in Example 8. It was unexpected that the IL-2R c would increase affinity by about 30 fold in light of Russell et al., Science. 262: 1 880 ( 1 993); Kondo et al., Science. 262: 1 874- 1 875 ( 1 993); and
  • the length of the polymeric spacer also had an affect on the bioactivity of the dimeric compounds of the present invention. It was unexpectedly found that the shorter the length of the polymeric spacers, the greater the affinity of the dimeric compounds for IL-4. For example, a 20kD PEG heterodimer had slightly better IC 50 values ( 1 -2 fold) than the soluble IL-4R, while a 3.4kD PEG heterodimer had substantially increased IC 50 values (up to 38-fold) . It is believed that the shorter spacer length facilitates a higher local effective concentration of the stabilizing IL-2R c subunit. As indicated above, the dimeric compounds of the present invention contain an
  • IL-4 receptor that is purified from a naturally-occurring source or by other means known in the art, such as by chemcial synthesis or recombinant DNA technology as described in EP Patent Application No. 0 367 566 A1 , published on May 9, 1 990, entitled “lnterleukin-4 Receptors, " which is incorporated herein by reference.
  • IL-2R c can a ' so be obtained by various means known in the art.
  • the preferred method for the production of the proteins is by recombinantly expressing the gene coding for the IL-4 receptor and IL-2R ⁇ e .
  • the genes coding for the desired proteins can be expressed in a variety of expression systems, including mammalian, yeast, insect and bacterial systems such as baculovirus and E.coli.
  • the Examples below provide particularly useful methods of obtaining the IL-4 receptor and
  • IL-2R c for use in the preparation of the compounds of the present invention.
  • the IL-4 receptor and IL-2R c are human.
  • the IL-4 receptor (IL-4R) is the soluble human IL-4 receptor extracellular domain that contains 207 amino acids ( 1 -207), while the IL-2R c refers to the soluble human IL-2R c extracellular domain that contains 254 amino acids (1 - 254) .
  • the terms "IL-4 receptor” or "IL-2R c " also include biologically active fragments of these extracellular domains. One skilled in the art can readily determine such active fragments without undue experimentation by testing the fragments in bioassays, such as the TF- 1 bioassay set forth in Example 7 below.
  • 2R c -FLAG refers to the 254 amino acid extracellular domain of !L-2R c plus an added cysteine at the C-terminal end, plus GG and the FLAG " " octapeptide sequence DYKDDDDK (SEQ.ID.NO. 1 ) obtained from IBI, Eastman Kodak Co. (New Haven, CT) .
  • the altered gene can be created either by standard site specific mutagenesis procedures or by the construction of the altered gene by standard gene synthesis procedures. These techniques are well known to those skilled in the art.
  • Polymeric spacers useful in the present invention include, for example, polyethylene glycol, monomethoxy polyethylene glycol, polypropylene glycol, polyoxyethylated glycerol, dihydroxy polyethylene glycol, dextran, colonic acids, carbohydrate polymers, amino acid polymers or biotin derivatives.
  • Other useful polymeric spacers include those known in the art such as peptide linkers, including r. portions of immunoglobulins and inert sequences of amino acids, and nucleic acid linkers.
  • PEGs Polyethylene glycols
  • PEGylation the modification of polypeptides with PEG serves to improve desirable pharmacokinetic properties in at least one of the following ways: O 96/11213
  • the dimeric compounds of the present invention will have a therapeutic value above the soluble IL-4 receptor due to increased pharmacokinetic properties.
  • PEG also facilitates the crosslinking of two receptor subunits to increase bioactivity for IL-4.
  • Useful PEGs of the present invention are those having molecular weights of up to 20,000, preferably those having molecular weights of 8,000 or less, and more preferably molecular weights of 3400 and less.
  • the approximate molecular weight of a polymeric unit is given in subscripts.
  • the dimeric compounds containing various sizes of PEG were found to be about 1 .3- to about 40-fold more effective in inhibiting th activity of IL-4 compared to wild-type soluble IL-4 receptor depending on the size of the PEG used as the spacer, with PEG 3400 more effective than PEG ⁇ 000 , which in turn was more effective than PEG 20 000 as reported in the Examples below.
  • activating group A functional or reactive group attached to the non-peptidic spacer is referred to herein as the activating group or linker.
  • Activating groups include the maleimide group, sulfhydryl group, thiol, triflate, tresylate, aziridine, oxirane, 5-pyridyl, NHS esters and vinyl-sulfones as described in U.S. Patent Application No. 08/259,41 3, filed June 1 4, 1 994, incorporated herein by reference.
  • PEGylated dimeric compounds can be prepared according to the procedures set forth in WO 92/1 6221 , published on October 1 , 1 992, specifically incorporated herein by reference, or as set forth in the Examples below.
  • the dimeric compounds of the present invention have a number of in vitro and in vivo uses.
  • the dimeric compounds can be used to affinity purify IL-4 from a number of sources, including serum from patients, cell culture supernatants or recombinantly produced IL-4, according to purification procedures.
  • methods of purifying IL-4 from a sample are accomplished by: (a) contacting a dimeric compound of the present invention with the sample; (b) allowing th dimeric compound to bind to IL-4; (c) dissociating the IL-4 from the dimeric compound; and (d) collecting the dissociated IL-4.
  • the dimeric compounds of the present invention can also be used as diagnostic reagents to detect or quantify IL-4 according to diagnostic methods well known in the art.
  • diagnostic methods well known in the art.
  • methods of detecting or quantifying lL-4 in a sample is accomplished by (a) contacting a dimeric compound with the sample suspected of containing IL-4; (b) allowing the dimeric compound to bind to IL-4; and (c) detecting or quantifying IL-4 bound to said dimeric compound.
  • the dimeric compounds of the present invention can additionally be used as calibration standards in a double determinant sandwich ELISA or in a solid phase binding assay. Such assays are well known in the art.
  • Another application for the use of the dimeric compounds is to inhibit IL-4 binding to target cells and thereby neutralize IL-4 bioactivity.
  • neutralizing antibodies were shown to be effective in inhibiting IL-4.
  • slL-4R ws more effective in neutralizing IL-4 than these known antibodies.
  • the dimeric compounds of the present invention were shown to be as effective or more effective in neutralizing IL-4 bioactivity than slL-4R.
  • the dimeric compounds can also be used as immunogens to produce polyclonal and monoclonal antibodies according to procedures well known in the art and as described, for example, in Harlow & Lane, Antibodies: A Laboratory Manual ( 1 988), incorporated herein by reference.
  • Such antibodies can, in turn, be used to detect IL-4 receptors or receptor complexes on the cell surface of T cells for in vitro and in vivo uses such as imaging or inhibiting the binding of IL-4 to the receptors according to procedures known in the art.
  • the dimeric compounds of the present invention can also be used to treat patients having an IL-4 mediated disease.
  • the dimeric compounds can be used to inhibit deleterious or pathological IgE production as well as the undesirable overproduction of Th2 T cells associated with IL-4 mediated diseases.
  • IL-4 mediated diseases include, for example, allergic rhinitis, asthma, atopic dermatitis and eczema.
  • the compounds can be used to treat patients having recurrent infections caused by yeast, intracellular parasites and viruses, including HIV.
  • the dimeric compounds can be formulated into a pharmaceutically-acceptable carrier to form the pharmaceutical compositions of the present invention.
  • pharmaceutically acceptable carrier means a non-toxic, generally inert vehicle for the active ingredient, which does not adversely affect the ingredient or the patient to whom the composition is administered. Suitable vehicles or carriers can be found in standard pharmaceutical texts, for example, in Remington's Pharmaceutical Sciences, 1 6th ed., Mack Publishing Co. , Easton, PA (1 980), incorporated herein by reference.
  • Such carriers include, for example, aqueous solutions such as bicarbonate buffers, phosphate buffers, Ringer's solution and physiological saline.
  • the carrier can contain other pharmaceutically-acceptable excipients for modifying or maintaining the pH, osmolarity, viscosity, clarity, color, sterility, stability, rate of dissolution, or odor of the formulation.
  • the pharmaceutical compositions can be prepared by methods known in the ⁇ . :, including, by way of an example, the simple mixing of reagents. Those skilled in the art will know that the choice of the pharmaceutical carrier and the appropriate preparation of the composition depend on the intended use and mode of administration.
  • the carrier and the dimeric compounds constitute a physiologically-compatible, slow-release formulation
  • the primary solvent in such a carrier can be either aqueous or non-aqueous in nature
  • the carrier can contain other pharmacologically-acceptable excipients for modifying or maintaining the pH, osmolarity, viscosity, clarity, color, sterility, stability, rate of dissolution, or odor of the formulation.
  • the carrier can contain still other pharmacologically-acceptable excipients for modifying or maintaining the stability, rate of dissolution, release, or absorption of the dime ⁇ c compounds
  • excipients are those substances usually and customarily employed to formulate dosages for parenteral administration in either unit dose or multi-dose form.
  • the pharmaceutical composition can be stored in sterile vials as a solution, suspension, gel, emulsion, solid, or dehydrated or lyophilized powder.
  • Such formulations can be stored either in a ready to use form or requiring reconstitution immediately prior to administration.
  • the preferred storage of such formulations is at temperatures at least as low as 4°C and preferably at -70°C It is also preferred that such formulations containing the dimeric compounds are stored and administered at or near physiological pH. It is presently believed that administration in a formulation at a high pH (i.e. greater than 8) or at a low pH (i.e. less than 5) is undesirable.
  • the manner of administering the formulations containing the IL-4 inhibitors of the present invention for systemic delivery can be via subcutaneous, intramuscular, intravenous, oral, intranasal, or vaginal or rectal suppository.
  • the manner of administration of the formulations containing the IL-4 inhibitor for local delivery is via intraarticular, intratracheal, or instillation or inhalations to the respiratory tract.
  • the IL-4 inhibitor can be encapsulated.
  • the encapsulated IL-4 inhibitor can be formulated with or without pharmaceutically-acceptable carriers customarily used in the compounding of solid dosage forms.
  • the capsule is designed so that the active portion of the formulation is released at that point in the gastro-intestinal tract when bioavailability is maximized and pre-systemic degradation is minimized. Additional excipients can be included to facilitate absorption of the IL- 1 inhibitor. Diluents, flavorings, low melting point waxes, vegetable oils, lubricants, suspending agents, tablet disintegrating agents, and binders can also be employed.
  • the specific dose is calculated according to the approximate body weight of the patient.
  • Other factors in determining the appropriate dosage can include the disease or condition to be treated or prevented, route of administration and the age, sex and medical condition of the pateint.
  • the dosage and administration is designed to create a preselected concentration range of the IL-4 inhibitor in the patient's blood stream. It is believed that the maintenance of circulating concentrations of the IL-4 inhibitor of less than 0.1 ng per ml of plasma may not be effective. It is believed that an appropriate dosage range of the dimeric compounds is between 0. 1 -1000 ng/ml of plasma.
  • IL-4 inhibitor formulations described herein can be used for veterinary as well as human applications and that the term "patient” should not be construed in a limiting manner.
  • the dosage ranges should be the same as specifiec above.
  • a plasmid containing the coding sequence for the mature portion of human IL-4 (preceded by methionine) was purchased from R & D Systems (Minneapolis, MN) . This sequence was modified using the polymerase chain reaction technique (PCR) to adapt it for cloning into the vector pT5T, which is described in PCT Patent Publication No. WO 91 /08285, incorporated herein by reference.
  • the oligonucleotide primers used in the PCR reaction had the sequences:
  • IL4(5')33 (SEQ.ID.NO.2):
  • the PCR conditions were 30 cycles of (1 minute at 95°C, 1 minute at 62°C, 1 minute at
  • WIBS were solubilized in 50mM Tris pH 8.5, 6M guanidine hydrochloride at a ratio of 1 : 10 (gWIBS:ml buffer) by homogenization using a Brinkmann Polytron (Model
  • the refold mix was centrifuged, (JA- 10 rotor, 9000 RPM, 35 min) and the supernatant filtered using a Gelman filling machine capsule, 5 /m (Gelman Sciences,
  • the filtered supernatant was concentrated and diafiltered using 2 Amicon S1 Y10 spiral wrap ultrafiltration cartridges in series (Amicon, Beverly, MA) .
  • the refold was concentrated approximately 3 fold with a concurrent buffer exchange of 3 fold.
  • the diafiltration buffer was 25mM potassium phosphate pH7.5, 50mM NaCI. Additional buffer was added to adjust concentrated diafiltered pool to approximately 80mM ionic strength.
  • the concentrated/diafiltered refold mixture was filtered over two 5 /M filling machine capsules.
  • the filtered refold was loaded onto a 40ml S-Sepharose column (Pharmacia LKB, Uppsala, Sweden). Column dimensions were 2.6cm x 7.5cm.
  • Buffer A contained 25mM potassium phosphate pH 7.4.
  • the column was previously equilibrated in 5% B (Buffer B is 25mM potassium phosphate pH 7.4, 1 M NaCI) before loading and the lL-4 was eluted with a gradient of 5-45% buffer B in 800ml at a flow rate of 1 0ml/min (0.5%/min).
  • the IL-4 eluted between 1 50 and 300mM NaCI.
  • Fractions containing IL-4 were pooled based on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis. The pool was concentrated approximately
  • the concentrated pool from the S-Sepharose column was split into 2 equal aliquots (approximately 30mg/aliquot by A280) absorbance at 280 nm and each run separately over a 450 ml Sephacryl S-100 (Pharmacia LKB) column (2.6cm x 86cm) .
  • the column was previously equilibrated with 25mM KPO4 pH7.4, 120mM NaCI. The column was run at a flow rate of 2ml/min and the IL-4 eluted at molecular weight (mw) equivalent to 14KD based on mw standards. IL-4-containing fractions were pooled based on SDS-PAGE analysis and concentrated approximately 2-3 fold using an Amicon stirred cell concentrator with a YM 10 membrane (Amicon, Beverly, MA) .
  • EXAMPLE 2 Construction of IL-4R Clones and Expression A. Construction of a baculoviral expression clone for IL-4R The extracellular domain of the human IL-4R was cloned from the human Raji
  • the sequences of the oligonucleotide primers were:
  • IL4R(BVp)39 SEQ.ID.NO.4
  • IL4R(3'p)51 (SEQ.ID.NO.5):
  • the PCR reaction mixture contained 1 X PCR buffer (from a cDNA Cycle kit, Invitrogen, San Diego, CA), 500 uM each of dATP, dCTP, dGTP and TTP, 1 uM of each primer (IL-4R(BVp)39 and IL4R(3'p)51 ), cDNA, water to 50 ul and 0.6 ul (3 units) of AMPLITAQ ' " (Taq DNA polymerase) (Perkin Eimer, Applied Biosystems Division, Foster City, CA) .
  • the PCR reaction conditions were 96°C for 3 minutes, 30 cycles of (94°C, 1 minute; 60°C, 0.5 minutes; 72°C, 2 minutes) and one cycle of 72°C for 1 0 minutes.
  • Agarose gel analysis of the PCR products revealed a faint band at the expected size of 740 nucleotides. This DNA band was eluted from an agarose gel.
  • One-tenth of the eluted DNA was reamplified by PCR using the same reaction conditions as above.
  • the PCR products were precipitated with ethanol, digested with Xbal and Bglll and electrophoresed on an agarose gel.
  • the approximate 740 nucleotide band was eluted and ligated to baculovirus expression plasmid pVL1 392 (Invitrogen, San Diego, CA) that had been digested with the same enzymes and purified in the same way.
  • the ligation mixture was used to transform E. coli strain DH5 ⁇ (catalog #C2022-1 , CLONTECH, Inc. Palo Alto, CA) .
  • IL-4R sequence was assembled from two clones that each contained single PCR errors.
  • Clone 3 contained an A to G change at position 359.
  • Clone 14 contained an A to G change at position 1 63.
  • the IL-4R contains a unique Sacl site at position 1 74, which separates the defective regions of the two clones.
  • the correct 5' end of clone 3 was joined to the correct 3' end of clone 14 as follows. Both clones were digested with
  • Sacl and Sacll the latter enzyme being unique in the plasmid.
  • the approximate 3330 bp band from clone 3 was gel-purified and ligated to the approximate 7030 bp band from clone 14 that had been gel purified.
  • the ligation mixture was used to transform E. coli strain DH5 ⁇ and transformants selected on agar plates containing ampicillin. One colony yielded a plasmid with a properly reconstructed IL-4R gene with the correct
  • the baculovirus exp ⁇ sion construct, pVL-IL4R was modified for expression of the mature amino acid sequence of the extracellular domain of the IL-4R in E. coli using PCR. Codons for the signal sequence were deleted using a primer, IL-4R(5'p)30, that overlaps the IL-4R coding sequence immediately following the signal sequence.
  • the primer adds an Ndel site for cloning purposes.
  • the 3' primer used in the PCR reaction, IL-4R(3'p2)31 contains Xbal. Kpnl, and BamHI restriction sites for cloning purposes.
  • the sequences of the primers are:
  • IL4R(5'p)30 (SEQ.ID.NO.6) : 5'-CCCCATATGAAGGTCTTGCAGGAGCCCACC-3'
  • IL4R(3'p2)31 SEQ.ID.NO.7
  • the PCR reaction mixture contained 100 pg pVL-IL4R DNA, 2.5 units Pfu polymerase (Stratagene, La Jolla, CA), Pfu polymerase buffer #3 (Stratagene, La Jolla, CA), 0.2 mM dATP, dCTP, dGTP and TTP, and 0.5 uM of each primer (IL4R(5'p)30 and IL4R(3'p2)31 .
  • PCR cycling conditions were as described above.
  • the PCR products were ethanol precipitated, digested with Kpnl and Ndel and the approximate 660 bp band purified after agarose gel electrophoresis. This DNA fragment was ligated to plasmid pT5T DNA that had been digested with the same enzymes and gel-purified.
  • the ligation mixture was used to transform E. coli DH5 ⁇ (catalog #C2022-1 ,
  • Affi-Gel 10 resin (Bio-Rad Laboratories, Richmond, CA) was activated by washing with ice cold, 10mM sodium acetate pH 4.5 for 10-1 5 min using a fitted funnel. The resin was recovered as a moist cake and added to refolded, purified, IL-4 at a concentration of 4-5mg IL-4 / ml of resin. The slurry was allowed to rock for 24- 48 hours at 4°C. The unbound sites on the resin were blocked by the addition of 1 M ethanolamine (100 /l/ml of resin) and rocked at 4°C for 1 hour. Coupling efficiencies were at least 90%. The affinity resin was equilibrated with 50mM Hepes pH 7.3, 1 50 M sodium chloride.
  • IL-4R Purification Approximately 10ml of equilibrated IL-4 affinity resin was added to 5L of IL-4R containing insect cell culture supernatant (previously filtered over .2 /m Gelman filling machine capsule), and rotated at 4°C overnight on a roller bottle apparatus (Bellco Biotechnology, Vineland, NJ) . The resin was recovered and subsequently transferred to a column ( 1 .5cm x 5.5cm ) . The resin was washed with 50mM HEPES, 1 50mM sodium chloride until the A280 absorbance at 280 nm returned to baseline.
  • the IL-4R was eluted from the column with 1 50mM sodium acetate pH 3.0, 1 50mM sodium chloride and neutralized with HEPES pH 9.0.
  • IL-4R containing fractions were pooled based on SDS-PAGE analysis.
  • the pooled fractions were concentrated using Amicon stirred cell concentrator with a YM 10 membrane (Amicon, Beverly, MA).
  • IL-4R resolves into several bands at 30-35 kDa in SDS-PAGE due to heterogeneous glycosylation. Some preparations required an additional size purification step to remove high molecular weight contaminants.
  • affinity column pooled concentrate was loaded onto S-100 column (2.6cm x 86cm 450 ml) Sephacryl S- 1 00 (Pharmacia LKB) previously equilibrated with, and run in, 1 0mM phosphate, 200mM sodium chloride at a flow rate of 2ml / min.
  • IL-4R containing fractions were pooled following SDS-PAGE analysis and again concentrated on an Amicon stirred cell. Approximately
  • 3-4mg of purified IL-4R is recovered from 5L of insect cell culture supernatant.
  • the IL-2R e cys-FLAG construct was cloned in two steps.
  • the first step entailed cloning a cDNA encoding the extracellular domain of the protein. A cysteine residue was added at the C-terminus of the protein during the cloning process.
  • the second step entailed replacing the 3' end of the cDNA with a new sequence encoding a cysteine followed by two glycines followed by the "FLAG ® " epitope (IBI/Eastman Kodak Company, New Haven, CT).
  • FLAG ® is an octapeptide having the following amino acid sequence: N-ASP-Try-Lys-Asp-Asp-Asp-Asp-Lys-C (SEQ.ID.NO.1 ).
  • FLAG epitope was added to facilitate purification of the protein by utilizing the monoclonal antibody to FLAG, referred to as ANTI-FLAG M2 (IBI, Kodak), linked to resin for affinity purification.
  • ANTI-FLAG M2 IBI, Kodak
  • the extracellular portion of the IL-2R e gene was cloned from the human Raji B cell line (ATCC ft CCL 86) .
  • mRNA was isolated from 3 x 10 6 Raji cells using a Micro- FastTrack mRNA Isolation Kit (Invitrogen, San Diego, CA) according to the manufacturer's instructions.
  • cDNA copies of one tenth of the mRNA were made using a cDNA Cycle Kit (Invitrogen, San Diego, CA).
  • the IL-2R c genes in one fifth of the Raji cDNA were then amplified by PCR using oligonucleotide primers complementary to the 5' and 3' ends of the extracellular portion of the IL-2R - sequence.
  • IL2RG(5'p)38 SEQ.ID.NO.8
  • the PCR reaction mixture contained 1 x "PCR Buffer” (from a cDNA Cycle Kit,
  • Clone 81 -4-2 was altered to add the following sequence: Gly Gly Asp Tyr Lvs Asp Asp ASP ASP Lvs Stop Stop (SEQ.ID.NO.10) at the carboxy terminus of the IL-2R- gamma by PCR mutagenesis using a 3' oligonucleotide primer [IL2RG(FLAG)67] that contained the changes and overlapped the 81 -4-2 sequence and a 5' oligonucleotide primer [IL2RG(494)27l that overlapped an internal sequence of 81 -4-2; the template was 81 -4-2 plasmid DNA.
  • the underlined region of the sequence encodes the "FLAG" epitope (IBI/Eastman Kodak Company, New Haven, CT).
  • the amplified DNA fragment was purified by running over a spin column, as described above, and cutting with BamHI and BPU I 1021 (the latter enzyme cuts near the 3' end of the IL2 receptor gamma gene) and eluting the 101 bp DNA fragment from an agarose gel.
  • the modified fragment was ligated to plasmid 81 -4-2 that had been cut with the same two restriction enzymes and gel purified in the same way. The result was to substitute the FLAG modified sequence for the previous end of the gene in clone 81 -4-2.
  • the PCR conditions used were 10mM Tris pH 8.3, 50mM KCI, 1 .5mM MgCI 2 , 0.001 % gelatin (Sigma Chemical Company, St. Louis, MO; catalogue # G2500), 200 /M each of dATP, dCTP, dGTP, TTP 20pmole of each primer (II2RG(494)27 and II2RG(FLAG)67], - 1 ng of template DNA (plasmid 81 -4-2), water to 100 /I, and 0.5 I
  • AMPLITAQ Taq DNA Polymerase
  • the baculovirus expression construct, 81 -4-2 was modified to express the mature amino acid sequence of the extracellular portion of IL-2R c in E. coli using PCR. This clone retained the cysteine codon (cys 234) at the 3' end of the gene. Codons for the first 22 amino acids were deleted using a primer [IL2RG(72p)33] that overlapped the IL-2R e sequence beginning at codon 23 and added an Ndel site, containing the initial methionine codon, to the 5' end. After the PCR the DNA was cleaned up by running it over a spin column, cutting with Ndel and BamHI, and eluting the 707 bp fragment from an agarose gel (as described previously).
  • the eluted fragment was ligated to plasmid pT5T DNA cut with the same enzymes and eluted from a gel in the same way.
  • E. coli strain DH5 ⁇ After transforming E. coli strain DH5 ⁇ with the ligation mixtures one of the resulting plasmids was sequenced on both strands and found to have the expected sequence.
  • This clone called 91 - 1 - 1
  • This strain with clone 91 - 1 - 1 was cultured and upon induction with IPTG was shown to express ⁇ L-2Ry at a high level.
  • the oligonucleotide primers used were:
  • IL2RG(72p)33 (SEQ.ID.NO.1 3) : 5' CCCCATATGCTGAACACGACAATTCTGACGCCC 3'
  • IL2RG(3'p)54 (SEQ.ID.N0.14):
  • the PCR reaction mixture contained 20mM Tris pH 8.75, 10mM KCI, 10mM
  • Plasmid clone 91 -1 -1 was modified to make a clone coding for the mature, extracellular, portion of IL-2r that did not contain a carboxy terminal cysteine.
  • An oligonucleotide, IL2RG(3' wt)41 was designed that overlapped the 3' end of the coding sequencebut deleted the terminal cysteine codon. This oligo was used with the 5' oligo il2rg(72p)33 described above and plasmid 91 -1 -1 as template in a polymerase chain reaction.
  • the sequences of the oligonucleotide primers used were: , , O 96/11213
  • IL2RG(72p)33 (SEQ. ID.N0.1 5):
  • the PCR reaction mixture contained 20mM Tris pH 8.75, 1 0mM KCI, 1 0mM (NH 4 ) 2 S0 4 , 2mM MgCI 2 , 0.1 % Triton X-1 00, 0.1 mg/ml bovine serum albumin, 200 /M each of dATP, dCTP, dGTP, TTP, 20pmole of each primer [H2RG(72p)33 and H2RG(3'wt)41 ], - 1 ng of template DNA (plasmid 91 - 1 - 1 ), water to 100 /I and 1 .I (2.5u) of Pfu DNA Polymerase (Stratagene, San Diego, CA) .
  • the PCR reaction conditions were 96°C for 3 minutes, 30 cycles of (95°C, 1 minute; 65'C, 1 minute; 72°C, 2 minutes), followed by 72°C for 10 minutes.
  • Plasmid DNA was prepared from E. coli DH5 ⁇ containing pVL1 392::IL-2R c - FLAG (90-1 -5) utilizing a commercial plasmid purification kit (Qiagen Inc., Chatsworth, CA) according to the manufacturer's instructions.
  • This plasmid DNA (5/ g), insect viral DNA (0.5/ g BaculoGold DNA, #21 100D,
  • Soluble IL-2R c was purified from insect cell culture supernatants by affinity chromatography using an ANTI-FLAG M2-antibody affinity resin.
  • Anti-FLAG M2 Antibody resin appropriate secondary antibody (IBI/Eastman Kodak Company, New Haven, CT.) was washed extensively and equilibrated with 50mM HEPES pH 7.3, 1 50mM sodium chloride.
  • Approximately 25ml of the equilibrated anti-FLAG affinity resin was added to 5L of IL-2R c containing insect cell culture supernatant [.2 ⁇ filtered) and rotated at 4°C on a roller bottle apparatus. The resin was recovered, transferred to a column (2.5cm x 5cm) and washed with phosphate buffered saline.
  • the IL-2R c -FLAG was eluted from the column with 100mM glycine pH 3.0 and neutralized with HEPES pH 9.0.
  • the IL-2R c containing fractions were pooled based on SDS-PAGE analysis and run over Sephacryl S-100 (Pharmacia LKB) sizing column
  • the purified IL-2R cys-FLAG subunit was reduced with varying concentrations of dithiothreitol (DTT) to determine the reduction concentration which facilitates addition of only one PEG group to the protein.
  • DTT dithiothreitol
  • the protein at 1 6 to 90 ⁇ M was reduced with 5 fold excess DTT and was then dialyzed.
  • the IL-2R c FLAG was
  • PEGylated with 8K methoxy-PEG-Maleimide (Synergen Lot #1 871 -53) at a 4: 1 PEG:protein ratio, 352//M:88 ⁇ M. React for 1 -2 hr at room temperature. PEGylation efficiency was approximately 70-80%.
  • the mono-PEGylated IL-4R was purified by gel filtration (Superose 12 10/30 column, Pharmacia LKB) run in 10mM phosphate pH7.5, 200mM sodium chloride at a flow rate of 0.3ml/min.
  • the mono-PEGylated-IL-4R containing fractions were pooled following SDS-PAGE analysis, and concentrated on an Amicon stirred cell with a YM 10 membrane (Amicon, Beverly, MA). Protein concentration was determined by Bradford protein assay.
  • Affinity purified IL-2R c (83 /M, Tris pH 7.0 50mM) was reduced with dithiothreitol (DTT, 5fold excess at 41 6 M) 30 minutes at room temperature. DTT was removed by dialysis against Tris 50mM pH 7.0, 4 hr, 4°C.
  • Affinity purified IL-4R (80//M in Tris pH 7.0 50mM) was reduced with 8 fold excess DTT at 640 M and incubated 30 min, at room temperature.
  • the reduced IL04R was run over size exclusion column to remove DTT (Bio-spin 6, Biorad #732- 6002). About 80% or 64//M of the reduced receptor was recovered.
  • K-IL-4R was added to 1 .5 to 4 fold excess reduced IL-2R ⁇ C to facilitate heterodimer formation. The mixture was allowed to react for 1 hr at room temperature and then overnight at 4°C. At least 50% of the mono-PEG IL-4R was converted to heterodimer.
  • the IL-4R/IL-2R e heterodimer was purified from other proteins by gel filtration (Superose 12 HR 10/30 or Superdex 75 HR 10/30, Pharmacia #17-1047-01 , same buffer as above). Run pooled peak fractions were run on reducing SDS-PAGE to assess purity and the protein concentration was determined by Bradford. Bioactivity of the heterodimer was assessed in the TF-1 bioassay described in Example 7.
  • Purified 3.4K PEG heterodimer run on reducing SDS-PAGE is contaminated with IL-2R c .
  • the heterodimer is - 75% of the total protein.
  • the contaminating IL-2R c appears to be aggregating with the heterodimer and, thus, is migrating with this high molecular weight molecule on the gel filtration column.
  • a second purification step can be used to obtain a more pure product.
  • two approaches will be taken. Firstly, salt, detergent and mild reducing agent will be tried to disassociate the aggregates of IL-2R and, thus, allow better resolution in the current method.
  • other chromatographic methods will be attempted which distinguish the more hydrophilic PEGylated proteins from the unmodified proteins, such methods include ion exchange, hydrophobic interaction, and reverse phase chromatography.
  • the purified IL-4R was reduced with DTT (600//M) and recovered from spun size exclusion column as decribed above.
  • the IL-4R was reacted with PEG 20K b s-maleimide at 2: 1 excess protein to PEG at 4°, overnight.
  • the mixture was purified by gel filtration (as above) .
  • the purified homodimer-PEG 20 ⁇ used for the bioassay appears to be 90% pure by reducing SDS-PAGE.
  • TF-1 cells (ATCC # CRL-2003) are human immature erythroleukemic cells which are stimulated to proliferate by IL-5, GM-CSF, EPO and IL-3.
  • IL-4 and IL-6 extend the survival of TF-1 cells according to Kitamura et al., J. Cellular Physiology, 140:323-334 ( 1 989) .
  • the cell line was passed every 2-3 days RPMI-1 640 (Bio-Whittaker #12- 1 1 5V) plus Pen-Strep at 100 units/ml, 100 mcg/ml, (Irvine Scientific, Walkersville, MD, Santa Ana, CA #9366) plus 10% fetal bovine serum defined, (HyClone Laboratories,
  • TF- 1 cells at 0.8 to 1 .2 x 10 6 cells/ml were harvested by centrifugation
  • IL-4 was diluted into microtiter wells (Corning Cell Wells, #25860, 96-well, flat bottom). The IL-4 concentration range tested was 0.05 pM to 3000 pM IL-4
  • the wells were incubated at 37°, C0 2 tissue culture incubator for 66 to 68 hrs. 3-[4, 5 Dimethyl thiazol-2-yl]-2, 5 diphenyl tetrazolium bromide, (MTT, Sigma) ( 10 /l/well of 5 mg/ml in PBS, 0.2 ⁇ filter sterilized) was added and mixed gently while protect from light.
  • the wells were incubated 37° for 6 hours and thereafter solubilized with DMF-SDS (N,N-dimethyl foramide 50%, sodium dodecyl sulfate 20% to pH 4.7 with acetic or hydrochloric acid and filtered (0.2/v), 50 l/well.
  • DMF-SDS N,N-dimethyl foramide 50%, sodium dodecyl sulfate 20% to pH 4.7 with acetic or hydrochloric acid and filtered (0.2/v), 50 l/well.
  • the wells were then incubated overnight at 37°C, read at
  • Table 1 shows data for the proliferative effect of measuring IL-4 concentrations on TF- 1 cells as measured in this MTT uptake assay.
  • TF- 1 proliferation assay (Table 2).
  • concentration of the constant IL-4 in this assay is 20pM.
  • the monoPEGylated IL-4R had slightly less (10-1 5%) bioactivity than the soluble IL-4R. The difference is not significant and is within experimental variation of the protein concentration determination and the bioasay.
  • the PEG 20K IL-4R constructs were compared in the TF- 1 assay with a constant concentration of IL-4 at 20pm (Table 3).
  • the monopegylated IL-4R-PEG 20K has the same bioactivity as the unmodified slL-4R indicating that modification of that cysteine with PEG has no detectable effect on the in vitro activity of the IL-4R.
  • the IC 50 's (inhibitory concentration which inhibits 50% of the proliferative activity of IL-4) reflects the affinity of the molecule for IL-4.
  • the IL-4R homodimer has an IC 50 which is less than would be expected for two IL-4R subunits acting independently. Thus, both dimers have some potential efficacy as IL-4 inhibitors.
  • Heterodimer-PEGg K has increased bioactivity in the in vitro assay as shown in Table 4.
  • the constant concentratio of IL-4 was 10pm, which is within the linear range of the IL-4 response.
  • the IC 50 for the heterodimer-PEG 8l ⁇ is 3.4 lower than the IC 50 for slL-4R.
  • the heterodimer-PEG 8K has greater bioactivity than the heterodimer-PEG 20 .
  • IL-4Receptor Absorbance 570-660 center constructs slL-4R. H ⁇ t 3.4K stL-4R Heterodimer 3.4K Heterodimer 3.4K nM nM Lot 1 Lot 2
  • the in vitro bioactivities of the IL-4R-PEG constructs and the unmodified siL- 2R c in t e TF- 1 assays are compared to the bioactivity of slL-4R in Table 6.
  • the IC 50 for slL-4R in a particular assay is divided by the IC 50 for that protein construct to give a relative in vitro activity for each.
  • the mono-pegylated IL-4R's are similar to unmodified slL-4R, indicating that the addition of PEG does not reduce the IL-4 inhibitory activity of the molecules.
  • IL-2R c has virtually no activity in this inhibitory assay.
  • the homodimeric and heterodimeric receptor constructs have improved bioactivity as IL-4 inhibitors.
  • the heterodimeric IL-4R:IL-2R c constructs have further improved inhibitory activity as the PEG cross-linker size is reduced. These data indicate that the IL-2R e increases IL-4 inhibitory activity and provides better IL-4 inhibitors as the cross-linker is reduced in length.
  • Homodimer has two IL-4R subunits per molecules; thus 3.3/2 is 1.6 for equivalence in this comparison.
  • IL-4 The dissociation rates of the IL-4R constructs from IL-4 were determined.
  • IL-4 was immobilized on a BIAcore'" chip and analyzed on a BIAcore ' " System (Pharmacia Biosensor AB, Uppsala, Sweden) according to the manufacturer's instructions. Table 7 reports the results of the analysis.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention concerne des composés dimères contenant des récepteurs d'IL-4. Ces composés dimères peuvent être des homodimères dans lesquels deux récepteurs d'IL-4 sont liés par un segment espaceur polymère, et des hétérodimères dans lesquels un récepteur d'IL-4 est lié par un segment espaceur polymère à une chaîne gamma de récepteurs d'IL-2. L'invention porte également sur des procédés de préparation et d'utilisation desdits composés ainsi que sur des compositions pharmaceutiques contenant ces derniers.
PCT/US1995/013101 1994-10-07 1995-10-05 Inhibiteurs d'il-4 dimeres WO1996011213A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU38308/95A AU3830895A (en) 1994-10-07 1995-10-05 Dimeric il-4 inhibitors

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US31949694A 1994-10-07 1994-10-07
US08/319,496 1994-10-07

Publications (1)

Publication Number Publication Date
WO1996011213A1 true WO1996011213A1 (fr) 1996-04-18

Family

ID=23242482

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1995/013101 WO1996011213A1 (fr) 1994-10-07 1995-10-05 Inhibiteurs d'il-4 dimeres

Country Status (2)

Country Link
AU (1) AU3830895A (fr)
WO (1) WO1996011213A1 (fr)

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997015663A1 (fr) * 1995-10-23 1997-05-01 Amrad Operations Pty. Ltd. Nouveau recepteur d'hematopoietine et sequences genetiques le codant
WO1998040409A1 (fr) * 1997-03-10 1998-09-17 Immunex Corporation Modification de proteines a sites proteges
EP0982317A1 (fr) * 1998-08-26 2000-03-01 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Inhibiteurs bivalents de protéasome
WO2000018932A2 (fr) * 1998-09-25 2000-04-06 Regeneron Pharmaceuticals, Inc. Antagonistes a base de recepteurs, modes d'elaboration et d'utilisation
EP0995757A2 (fr) * 1998-08-26 2000-04-26 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Inhibiteurs bivalemtes de la proteasome
WO2001092340A2 (fr) 2000-05-26 2001-12-06 Immunex Corporation Utilisation d'antagonistes vis-a-vis de l'interleukine-4 (il-4) et compositions correspondantes
US6433158B1 (en) 1998-06-22 2002-08-13 Immunex Corporation Site specific protein modification
US6911530B1 (en) 1995-10-23 2005-06-28 Amrad Operations, Pty., Ltd. Haemopoietin receptor and genetic sequences encoding same
US6927044B2 (en) 1998-09-25 2005-08-09 Regeneron Pharmaceuticals, Inc. IL-1 receptor based cytokine traps
US7083949B2 (en) 1998-09-25 2006-08-01 Regeneron Pharmaceuticals, Inc. Receptor based antagonists and methods of making and using
JP2007526745A (ja) * 2003-06-23 2007-09-20 コナリス リサーチ インスティチュート アーゲー 薬剤として有用なペグ化可溶性ｇｐ１３０二量体
US10906957B2 (en) 2016-09-27 2021-02-02 Epicentrx, Inc. Immunomodulatory fusion proteins
US11834492B2 (en) 2017-09-27 2023-12-05 Epicentrx, Inc. Human IL-10 receptor alpha fusion proteins

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0419091A1 (fr) * 1989-09-07 1991-03-27 Schering Corporation Récepteurs de l'interleukine-4
WO1992016221A1 (fr) * 1991-03-15 1992-10-01 Synergen, Inc. Pegylation de polypeptides
WO1993011234A1 (fr) * 1991-11-27 1993-06-10 Schering Corporation Region de domaine cytoplasmique du recepteur a l'interleukine-4 humaine, utilisee comme antagonistes de il-4
DE4228839A1 (de) * 1992-08-29 1994-03-03 Behringwerke Ag Verfahren zum Nachweis und zur Bestimmung von Mediatoren

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0419091A1 (fr) * 1989-09-07 1991-03-27 Schering Corporation Récepteurs de l'interleukine-4
WO1992016221A1 (fr) * 1991-03-15 1992-10-01 Synergen, Inc. Pegylation de polypeptides
WO1993011234A1 (fr) * 1991-11-27 1993-06-10 Schering Corporation Region de domaine cytoplasmique du recepteur a l'interleukine-4 humaine, utilisee comme antagonistes de il-4
DE4228839A1 (de) * 1992-08-29 1994-03-03 Behringwerke Ag Verfahren zum Nachweis und zur Bestimmung von Mediatoren

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
M. KONDO ET AL.: "Sharing of the Interleukin-2 (IL-2) Receptor gamma Chain Between Receptors for IL-2 and IL-4", SCIENCE, vol. 262, 17 December 1993 (1993-12-17), LANCASTER, PA US, pages 1874 - 1877 *
S.M. RUSSEL ET AL.: "Interleukin-2 Receptor gamma Chain: A Functional Component of the Interleukin-4 Receptor", SCIENCE, vol. 262, no. 5141, 17 December 1993 (1993-12-17), LANCASTER, PA US, pages 1880 - 1883 *

Cited By (31)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997015663A1 (fr) * 1995-10-23 1997-05-01 Amrad Operations Pty. Ltd. Nouveau recepteur d'hematopoietine et sequences genetiques le codant
US6911530B1 (en) 1995-10-23 2005-06-28 Amrad Operations, Pty., Ltd. Haemopoietin receptor and genetic sequences encoding same
WO1998040409A1 (fr) * 1997-03-10 1998-09-17 Immunex Corporation Modification de proteines a sites proteges
US6548644B1 (en) * 1997-03-10 2003-04-15 Immunex Corporation Site protected protein modification
US7129203B2 (en) 1998-06-22 2006-10-31 Immunex Corporation Site specific protein modification
US6451986B1 (en) 1998-06-22 2002-09-17 Immunex Corporation Site specific protein modification
US6433158B1 (en) 1998-06-22 2002-08-13 Immunex Corporation Site specific protein modification
EP0995757A3 (fr) * 1998-08-26 2002-05-22 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Inhibiteurs bivalentes de la proteasome
EP0995757A2 (fr) * 1998-08-26 2000-04-26 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Inhibiteurs bivalemtes de la proteasome
EP0982317A1 (fr) * 1998-08-26 2000-03-01 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Inhibiteurs bivalents de protéasome
AU758970C (en) * 1998-09-25 2007-05-03 Regeneron Pharmaceuticals, Inc. Receptor based antagonists and methods of making and using
US7417134B2 (en) 1998-09-25 2008-08-26 Regeneron Pharmaceuticals, Inc. IL-1 receptor based cytokine traps and method of using
US6472179B2 (en) 1998-09-25 2002-10-29 Regeneron Pharmaceuticals, Inc. Receptor based antagonists and methods of making and using
EP1405915A1 (fr) * 1998-09-25 2004-04-07 Regeneron Pharmaceuticals, Inc. Piège à IL-4 à base de protéines hybrides du récepteur IL
WO2000018932A2 (fr) * 1998-09-25 2000-04-06 Regeneron Pharmaceuticals, Inc. Antagonistes a base de recepteurs, modes d'elaboration et d'utilisation
US6927044B2 (en) 1998-09-25 2005-08-09 Regeneron Pharmaceuticals, Inc. IL-1 receptor based cytokine traps
US7083949B2 (en) 1998-09-25 2006-08-01 Regeneron Pharmaceuticals, Inc. Receptor based antagonists and methods of making and using
WO2000018932A3 (fr) * 1998-09-25 2000-11-02 Regeneron Pharma Antagonistes a base de recepteurs, modes d'elaboration et d'utilisation
AU758970B2 (en) * 1998-09-25 2003-04-03 Regeneron Pharmaceuticals, Inc. Receptor based antagonists and methods of making and using
US7927583B2 (en) 1998-09-25 2011-04-19 Regeneron Pharmaceuticals, Inc. Receptor based antagonists and methods of making and using
CN100345970C (zh) * 1998-09-25 2007-10-31 里珍纳龙药品有限公司 以受体为基础的拮抗剂和制备方法及用途
EP2990420A1 (fr) 2000-05-26 2016-03-02 Immunex Corporation Utilisation d'anticorps du recepteur de l'interleukine-4 et leurs compositions
EP2292665A1 (fr) 2000-05-26 2011-03-09 Immunex Corporation Utilisation des antagonistes de l'interleukine-4 et compositions correspondantes
WO2001092340A2 (fr) 2000-05-26 2001-12-06 Immunex Corporation Utilisation d'antagonistes vis-a-vis de l'interleukine-4 (il-4) et compositions correspondantes
EP3190126A1 (fr) 2000-05-26 2017-07-12 Immunex Corporation Utilisation d'anticorps contre le recepteur d'interleukine-4 (il-4r) et compositions correspondantes
US7361350B2 (en) 2002-10-28 2008-04-22 Regeneron Pharmaceuticals, Inc. Use of an IL-1 antagonist for treating arthritis
JP2007526745A (ja) * 2003-06-23 2007-09-20 コナリス リサーチ インスティチュート アーゲー 薬剤として有用なペグ化可溶性ｇｐ１３０二量体
JP4745224B2 (ja) * 2003-06-23 2011-08-10 コナリス リサーチ インスティチュート アーゲー 薬剤として有用なペグ化可溶性ｇｐ１３０二量体
US10906957B2 (en) 2016-09-27 2021-02-02 Epicentrx, Inc. Immunomodulatory fusion proteins
US12054530B2 (en) 2016-09-27 2024-08-06 Epicentrx, Inc. Immunomodulatory fusion proteins
US11834492B2 (en) 2017-09-27 2023-12-05 Epicentrx, Inc. Human IL-10 receptor alpha fusion proteins

Also Published As

Publication number Publication date
AU3830895A (en) 1996-05-02

Similar Documents

Publication Publication Date Title
US6372454B2 (en) Nucleic acid molecules encoding Follistatin-3
WO1999003982A1 (fr) Interleukine-20
AU7326594A (en) Recombinant ctla4 polypeptides and methods for making the same
WO1996011213A1 (fr) Inhibiteurs d'il-4 dimeres
JP2001527412A (ja) 抗菌ペプチド
US7390880B2 (en) Soluble interleukin-1 receptor accessory molecule
JP2006094863A (ja) ケモカインα−５
US6548063B1 (en) Synferon
WO2021116444A1 (fr) Constructions chimériques d'interleukine 2
AU765890B2 (en) Keratinocyte derived interferon
Cannon-Carlson et al. Expression, purification, and characterization of recombinant human interleukin-13 from NS-0 cells
WO1999000412A1 (fr) Proteine stimulant la production d'interferon et ses utilisations
JP2002508166A (ja) ヒトＤｅｎｄｒｉａｃおよびＢｒａｉｎｉａｃ−３
US7217529B2 (en) Antibodies to chemokine Alpha-6
US6465616B1 (en) Interleukin-5 antagonist
US20040063127A1 (en) Hematopoietic signaling factor
CN117645661A (zh) 一种聚乙二醇修饰的il-21衍生物及其应用
CA2256368A1 (fr) Antagoniste d'interleukine-5
MXPA01000692A (en) Keratinocyte derived interferon
JP2002500889A (ja) Ｉｌ−１６の変異体、その製造方法およびその使用
Gonzalez Functional Studies and X-ray Structure Analysis of Human Interleukin-5 Receptor Alpha and Human Interleukin-5 Complex
Patiño Gonzalez Functional Studies and X-Ray Structure Analysis of Human Interleukin-5 Receptor Alpha and Human Interleukin-5 Complex
AU2003271323A1 (en) Keratinocyte derived interferon

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU BB BG BR BY CA CH CN CZ DE DK EE ES FI GB GE HU IS JP KE KG KP KR KZ LK LR LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TT UA UG UZ VN

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): KE MW SD SZ UG AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase