WO1995031539A1 - Neurotransmitter transporter - Google Patents

Neurotransmitter transporter Download PDF

Info

Publication number
WO1995031539A1
WO1995031539A1 PCT/US1994/005363 US9405363W WO9531539A1 WO 1995031539 A1 WO1995031539 A1 WO 1995031539A1 US 9405363 W US9405363 W US 9405363W WO 9531539 A1 WO9531539 A1 WO 9531539A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
ntt
polynucleotide
dna
leu
Prior art date
Application number
PCT/US1994/005363
Other languages
French (fr)
Inventor
Yi Li
Robert D. Fleischmann
Original Assignee
Human Genome Sciences, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Human Genome Sciences, Inc. filed Critical Human Genome Sciences, Inc.
Priority to JP7529590A priority Critical patent/JPH10500299A/en
Priority to AU69125/94A priority patent/AU6912594A/en
Priority to PCT/US1994/005363 priority patent/WO1995031539A1/en
Priority to US08/424,424 priority patent/US5759854A/en
Priority to EP94917383A priority patent/EP0759978A4/en
Publication of WO1995031539A1 publication Critical patent/WO1995031539A1/en
Priority to US09/923,444 priority patent/US20020015980A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70571—Receptors; Cell surface antigens; Cell surface determinants for neuromediators, e.g. serotonin receptor, dopamine receptor
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/04—Centrally acting analgesics, e.g. opioids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/20—Hypnotics; Sedatives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/24—Antidepressants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/26—Psychostimulants, e.g. nicotine, cocaine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Definitions

  • This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptide of the present invention is a neurotransmitter transporter and the polypeptide of the present invention is herein sometime referred to as "NTT" . The invention also relates to inhibiting the action of such polypeptides.
  • synaptic transmission An essential property of synaptic transmission is the rapid termination of action following neurotransmitter release.
  • neurotransmitters including catecholamines, serotonin, and certain amino acids (e.g., 7-aminobutyric acid (GABA), glutamate, and glycine)
  • GABA 7-aminobutyric acid
  • glutamate glutamate
  • glycine 7-aminobutyric acid
  • Inhibition or stimulation of neurotransmitter uptake provides a means for modulating the strength of the synaptic action by regulating the available levels of endogenous transmitters.
  • Neurotransmitter transporters are membrane-bound polypeptides which uptake neurotransmitters into the pre-synaptic neuron after the neurotransmitters have crossed the synaptic cleft and acted upon the post-synaptic neuron.
  • Neurotransmitters can be excitatory, such as glutamate, or inhibitory such as GABA.
  • Affinity neurotransmitter transport is thought to terminate the overall process of synaptic transmission (Iver ⁇ en, L.L., Br. J. Pharmacol. 41:571-591 (1971)). Recently, cDNAs encoding more than ten different neurotransmitter transporters have been cloned and seguenced. The family of these genes could be divided into three subfamilies, including the GABA and taurine transporters (Liu, Q.R., et al., Proc. Natl. Acad. Sci.
  • the amino acid sequence of each member is 60-80% identical to the other members within a subfamily and about 40% identical to members between the two subfamilies (Liu, Q.R., et al., Proc. Natl. Acad. Sci. USA, 89:6639-6643 (1992)).
  • Amino acid transporters such as the glycine transporter and proline transporter, share about 40-45% homology with all members of the neurotransmitter transporter ⁇ uperfamily. Sequence homology among the members of the neurotransmitter transporter family give clear indication that they evolved from a common ancestral gene. Moreover, partial genomic cloning of several neurotransmitter transporters reveal that in all of them the first intron in the reading frame is located in an identical position (id. ) .
  • a GABA A transporter was the first neurotransmitter system to be cloned and expressed (Guastella, J., et al., Science 249:1303-1306 (1990)) and is one of a family of neurotransmitter transporters cloned within the last year. Recently, a serotonin transporter cDNA has been disclosed in PCT WO 93/08261.
  • NTT novel mature polypeptide which is herein referred to as NTT, as well as fragments, analogs and derivatives thereof.
  • the polypeptide of the present invention is of human origin.
  • polynucleotides (DNA or RNA) which encode such polypeptides.
  • a process for producing such polypeptide by recombinant techniques there is provided.
  • agonists which increase the affinity of NTT for its substrate, and which may be used to treat Amyotrophic Lateral Sclerosis, pain and stroke.
  • antagonist/inhibitors which may be used to prevent the uptake of neurotransmitters by NTT, which may be used therapeutically, for example, in the treatment of depression, anxiety and epilepsy, as well as other neurologic or psychiatric disorders.
  • Figure 1 shows the cDNA sequence and corresponding deduced amino acid sequence of the mature NTT polypeptide.
  • the standard one-letter abbreviation for amino acids is used.
  • an isolated nucleic acid polynucleotide which encodes for the mature polypeptide having the deduced amino acid sequence of Figure 1 or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. 75713 on March 18, 1994.
  • the polynucleotide of this invention was discovered in a cDNA library derived from a human fetal brain. It is structurally related to the neurotransmitter transporter family. It contains an open reading frame encoding a protein of about 727 amino acid residues. The protein exhibits the highest degree of homology to a rat neurotransmitter transporter (NT74) with 94% identity and 96% similarity over the entire amino acid sequence.
  • NT74 rat neurotransmitter transporter
  • the polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA.
  • the DNA may be double-stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand.
  • the coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1 or that of the deposited clone or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same, mature polypeptide as the DNA of Figure 1 or the deposited cDNA.
  • the polynucleotide which encodes for the mature polypeptide of Figure 1 or for the mature polypeptide encoded by the deposited cDNA may include: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding sequence such as a leader or secretory sequence or a proprotein sequence; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' of the coding sequence for the mature polypeptide.
  • polynucleotide encoding a polypeptide encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.
  • the present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figure 1 or the polypeptide encoded by the cDNA of the deposited clone.
  • the variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide.
  • the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure 1 or the same mature polypeptide encoded by the cDNA of the deposited clone as well as variants of such polynucleotides which variants encode for a fragment, derivative or analog of the polypeptide of Figure 1 or the polypeptide encoded by the cDNA of the deposited clone.
  • Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.
  • the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in Figure 1 or of the coding sequence of the deposited clone.
  • an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptide.
  • the polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptide of the present invention.
  • the marker sequence may be a hexa-histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, is used.
  • the HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al., Cell, 37:767 (1984)).
  • the present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 50% and preferably 70% identity between the sequences.
  • the present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides .
  • stringent conditions means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences.
  • the polynucleotides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which retain substantially the same biological function or activity as the mature polypeptide encoded by the cDNA of Figure 1 or the deposited cDNA.
  • the deposit( ⁇ ) referred to herein will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organi ⁇ m ⁇ for purpo ⁇ e ⁇ of Patent Procedure. These deposit ⁇ are provided merely a ⁇ convenience to tho ⁇ e of ⁇ kill in the art and are not an admi ⁇ ion that a deposit is required under 35 U.S.C. ⁇ 112.
  • the sequence of the polynucleotides contained in the deposited materials, a ⁇ well as the amino acid sequence of the polypeptides encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with any description of sequences herein.
  • a license may be required to make, u ⁇ e or ⁇ ell the depo ⁇ ited materials, and no ⁇ uch licen ⁇ e i ⁇ hereby granted.
  • the pre ⁇ ent invention further relate ⁇ to an NTT polypeptide which ha ⁇ the deduced amino acid ⁇ equence of Figure 1 or which has the amino acid sequence encoded by the deposited cDNA, as well a ⁇ fragments, analogs and derivative ⁇ of such polypeptide.
  • fragment when referring to the polypeptide of Figure 1 or that encoded by the deposited cDNA, mean ⁇ a polypeptide which retain ⁇ e ⁇ entially the ⁇ ame biological function or activity as such polypeptide.
  • an analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
  • the polypeptide of the . present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide.
  • the fragment, derivative or analog of the polypeptide of Figure 1 or that encoded by the deposited cDNA may be (i) one in which one or more of the amino acid residues are sub ⁇ tituted with a conserved or non-conserved amino acid re ⁇ idue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residue ⁇ includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acid ⁇ are fused to the mature polypeptide, such a ⁇ a leader or secretory sequence or a sequence which is employed for purification of the mature polypeptide or a proprotein sequence.
  • a conserved or non-conserved amino acid re ⁇ idue preferably a conserved
  • polypeptide ⁇ and polynucleotide ⁇ of the pre ⁇ ent invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
  • isolated means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring) .
  • a naturally-occurring polynucleotide or polypeptide present in a living animal is not isolated, but the ⁇ ame polynucleotide or polypeptide, separated from some or all of the coexisting material ⁇ in the natural ⁇ y ⁇ te , is i ⁇ olated.
  • Such polynucleotide ⁇ could be part of a vector and/or ⁇ uch polynucleotide ⁇ or polypeptide ⁇ could be part of a compo ⁇ ition, and still be isolated in that such vector or composition is not part of it ⁇ natural environment.
  • the pre ⁇ ent invention al ⁇ o relate ⁇ to vector ⁇ which include polynucleotide ⁇ of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant technique ⁇ .
  • Ho ⁇ t cell ⁇ are genetically engineered (tran ⁇ duced or tran ⁇ formed or tran ⁇ fected) with the vector ⁇ of thi ⁇ invention which may be, for example, a cloning vector or an expre ⁇ ion vector.
  • the vector may be, for example, in the form of a pla ⁇ mid, a viral particle, a phage, etc.
  • the engineered ho ⁇ t cell ⁇ can be cultured in conventional nutrient media modified a ⁇ appropriate for activating pro oter ⁇ , selecting transformant ⁇ or amplifying the NTT gene ⁇ .
  • the culture condition ⁇ such as temperature, pH and the like, are tho ⁇ e previously used with the host cell ⁇ elected for expression, and will be apparent to the ordinarily skilled artisan.
  • the polynucleotides of the pre ⁇ ent invention may be employed for producing polypeptide ⁇ by recombinant techniques.
  • the polynucleotide may be included in any one of a variety of expression vectors for expre ⁇ ing a polypeptide.
  • Such vector ⁇ include chromo ⁇ omal, nonchromo ⁇ omal and synthetic DNA ⁇ equence ⁇ , e.g., derivative ⁇ of SV40; bacterial pla ⁇ mid ⁇ ; phage DNA; baculovirus; yeast pla ⁇ mid ⁇ ; vector ⁇ derived from combination ⁇ of pla ⁇ mid ⁇ and phage DNA, viral DNA ⁇ uch a ⁇ vaccinia, adenoviru ⁇ , fowl pox virus, and pseudorabie ⁇ .
  • any other vector may be u ⁇ ed a ⁇ long a ⁇ it i ⁇ replicable and viable in the host.
  • the appropriate DNA sequence may be inserted into the vector by a variety of procedure ⁇ .
  • the DNA sequence is in ⁇ erted into an appropriate re ⁇ triction endonuclea ⁇ e ⁇ ite( ⁇ ) by procedures known in the art. Such procedure ⁇ and others are deemed to be within the scope of those skilled in the art.
  • the DNA sequence in the expres ⁇ ion vector is operatively linked to an appropriate expres ⁇ ion control sequence(s) (promoter) to direct mRNA ⁇ ynthesis.
  • expres ⁇ ion control sequence(s) promoter
  • a ⁇ representative example ⁇ of ⁇ uch promoter ⁇ there may be mentioned: LTR or SV40 promoter, the E. coli. lac or trp. the phage lambda P L promoter and other promoter ⁇ known to control expre ⁇ ion of gene ⁇ in prokaryotic or eukaryotic cells or their viru ⁇ e ⁇ .
  • the expre ⁇ ion vector al ⁇ o contain ⁇ a ribo ⁇ ome binding ⁇ ite for tran ⁇ lation initiation and a tran ⁇ cription terminator.
  • the vector may al ⁇ o include appropriate ⁇ equence ⁇ for amplifying expre ⁇ ion.
  • the expre ⁇ ion vector ⁇ preferably contain one or more ⁇ electable marker gene ⁇ to provide a phenotypic trait for ⁇ election of tran ⁇ formed ho ⁇ t cell ⁇ ⁇ uch a ⁇ dihydrofolate reducta ⁇ e or neomycin re ⁇ i ⁇ tance for eukaryotic cell culture, or ⁇ uch a ⁇ tetracycline or ampicillin re ⁇ i ⁇ tance in E. coli.
  • the vector containing the appropriate DNA ⁇ equence a ⁇ hereinabove described, a ⁇ well as an appropriate promoter or control sequence, may be employed to transform an appropriate ho ⁇ t to permit the host to expres ⁇ the protein.
  • a ⁇ repre ⁇ entative example ⁇ of appropriate ho ⁇ t ⁇ there may be mentioned: bacterial cell ⁇ , ⁇ uch a ⁇ E. coli. Streptomyce ⁇ . Salmonella typhimurium; fungal cell ⁇ , ⁇ uch a ⁇ yea ⁇ t; in ⁇ ect cells such as Drosophila and Sf9; animal cells such a ⁇ CHO, HEK 293, COS or Bowe ⁇ melanoma; plant cell ⁇ , etc.
  • the ⁇ election of an appropriate ho ⁇ t i ⁇ deemed to be within the ⁇ cope of tho ⁇ e ⁇ killed in the art from the teachings herein.
  • the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above.
  • the constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation.
  • the con ⁇ truct further compri ⁇ e ⁇ regulatory ⁇ equence ⁇ , including, for example, a promoter, operably linked to the sequence.
  • suitable vectors and promoter ⁇ are known to tho ⁇ e of ⁇ kill in the art, and are commercially available.
  • the following vector ⁇ are provided by way of example.
  • Bacterial pQE70, pQE60, pQE-9 (Qiagen), pb ⁇ , pDIO, phage ⁇ cript, p ⁇ iX174, pblue ⁇ cript SK, pb ⁇ k ⁇ , pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia).
  • Eukaryotic pWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia) .
  • any other pla ⁇ mid or vector may be u ⁇ ed a ⁇ long a ⁇ they are replicable and viable in the ho ⁇ t.
  • Promoter region ⁇ can be ⁇ elected from any desired gene using CAT (chloramphenicol tran ⁇ fera ⁇ e) vector ⁇ or other vector ⁇ with ⁇ electable marker ⁇ .
  • Two appropriate vector ⁇ are PKK232-8 and PCM7.
  • Particular named bacterial promoter ⁇ include lad, lacZ, T3, T7, gpt, lambda P R , P L and trp.
  • Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retroviru ⁇ , and mou ⁇ e metallothionein-I. Selection of the appropriate vector and promoter i ⁇ well within the level of ordinary ⁇ kill in the art.
  • the present invention relates to ho ⁇ t cell ⁇ containing the above-de ⁇ cribed constructs.
  • the ho ⁇ t cell can be a higher eukaryotic cell, ⁇ uch a ⁇ a mammalian cell, or a lower eukaryotic cell, ⁇ uch as a yea ⁇ t cell, or the ho ⁇ t cell can be a prokaryotic cell, ⁇ uch as a bacterial cell.
  • Introduction of the construct into the host cell can be effected by, for example, calcium pho ⁇ phate tran ⁇ fection, DEAE-Dextran mediated transfection, or electroporation. (Davi ⁇ , L., Dibner, M. , Battey, I., Ba ⁇ ic Method ⁇ in Molecular Biology, (1986)).
  • the con ⁇ truct ⁇ in ho ⁇ t cell ⁇ can be u ⁇ ed in a conventional manner to produce the gene product encoded by the recombinant ⁇ equence.
  • the polypeptide ⁇ of the invention can be ⁇ ynthetically produced by conventional peptide ⁇ ynthe ⁇ izer ⁇ .
  • Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cell ⁇ under the control of appropriate promoter ⁇ .
  • Cell-free tran ⁇ lation ⁇ ystems can al ⁇ o be employed to produce ⁇ uch protein ⁇ u ⁇ ing RNA ⁇ derived from the DNA con ⁇ truct ⁇ of the pre ⁇ ent invention.
  • Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic host ⁇ are de ⁇ cribed by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), the di ⁇ clo ⁇ ure of which i ⁇ hereby incorporated by reference.
  • Enhancers are ci ⁇ -acting element ⁇ of DNA, u ⁇ ually about from 10 to 300 bp that act on a promoter to increa ⁇ e it ⁇ transcription. Examples including the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late ⁇ ide of the replication origin, and adenoviru ⁇ enhancer ⁇ .
  • recombinant expre ⁇ ion vector ⁇ will include origin ⁇ of replication and ⁇ electable marker ⁇ permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence.
  • Such promoter ⁇ can be derived from operon ⁇ encoding glycolytic enzyme ⁇ ⁇ uch a ⁇ 3- pho ⁇ phoglycerate kina ⁇ e (PGK), ⁇ -factor, acid pho ⁇ phata ⁇ e, or heat shock proteins, among others.
  • the heterologou ⁇ ⁇ equence can encode a fusion protein including an N-terminal identification peptide imparting de ⁇ ired character- i ⁇ tic ⁇ , e.g., stabilization or simplified purification of expres ⁇ ed recombinant product.
  • Useful expression vectors for bacterial use are constructed by in ⁇ erting a ⁇ tructural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter.
  • the vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host.
  • Suitable prokaryotic ho ⁇ t ⁇ for tran ⁇ formation include E. coli.
  • useful expression vectors for bacterial u ⁇ e can compri ⁇ e a ⁇ electable marker and bacterial origin of replication derived from commercially available pla ⁇ mid ⁇ compri ⁇ ing genetic element ⁇ of the well known cloning vector pBR322 (ATCC 37017).
  • Such commercial vector ⁇ include, for example, pKK223-3 (Pharmacia Fine Chemicals, Upp ⁇ ala, Sweden) and GEM1 (Promega Biotec, Madi ⁇ on, WI, USA).
  • the ⁇ e pBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expressed.
  • the ⁇ elected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cell ⁇ are cultured for an additional period.
  • Microbial cell ⁇ employed in expre ⁇ ion of protein ⁇ can be di ⁇ rupted by any convenient method, including freeze-thaw cycling, ⁇ onication, mechanical di ⁇ ruption, or u ⁇ e of cell lysing agents, such methods are well know to those ⁇ killed in the art.
  • Variou ⁇ mammalian cell culture systems can also be employed to expres ⁇ recombinant protein.
  • mammalian expression ⁇ y ⁇ tem ⁇ include the COS-7 line ⁇ of monkey kidney fibrobla ⁇ t ⁇ , de ⁇ cribed by Gluzman, Cell, 23:175 (1981), and other cell line ⁇ capable of expre ⁇ ing a compatible vector, for example, the C127, 3T3, CHO, HEK 293, HeLa and BHK cell line ⁇ .
  • Mammalian expre ⁇ ion vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequence ⁇ , and 5' flanking nontranscribed sequences. DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic element ⁇ .
  • the NTT polypeptide ⁇ can be recovered and purified from recombinant cell culture ⁇ by method ⁇ including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography hydroxylapatite chromatography and lectin chromatography. Protein refolding ⁇ tep ⁇ can be used, a ⁇ nece ⁇ sary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.
  • HPLC high performance liquid chromatography
  • the polypeptides of the present invention may be a naturally purified product, or a product of chemical synthetic procedure ⁇ , or produced by recombinant technique ⁇ from a prokaryotic or eukaryotic ho ⁇ t (for example, by bacterial, yea ⁇ t, higher plant, in ⁇ ect and mammalian cell ⁇ in culture).
  • a prokaryotic or eukaryotic ho ⁇ t for example, by bacterial, yea ⁇ t, higher plant, in ⁇ ect and mammalian cell ⁇ in culture.
  • the polypeptides of the present invention may be glyco ⁇ ylated or may be non-glyco ⁇ ylated.
  • Polypeptide ⁇ of the invention may al ⁇ o include an initial methionine amino acid re ⁇ idue.
  • the pre ⁇ ent invention al ⁇ o provide ⁇ a method for identifying neurotransmitters which interact with the NTT polypeptides of the pre ⁇ ent invention.
  • the method for determining whether a neurotransmitter is translocated from the synaptic cleft into the pre-synaptic neuron by NTT comprise ⁇ tran ⁇ fecting a cell population with the appropriate vector expre ⁇ ing the NTT ⁇ uch that the cell will now expre ⁇ NTT.
  • Variou ⁇ neurotran ⁇ mitter ⁇ are then radio-labelled, e.g., tritiated, and incubated with the transfected cell to identify which neurotransmitter ⁇ are tran ⁇ ported into the cell.
  • a neurotran ⁇ mitter i ⁇ identified compound ⁇ can be ⁇ creened to identify tho ⁇ e which ⁇ pecifically interact with NTT and either increa ⁇ e NTT' ⁇ affinity to uptake its neurotransmitter, e.g., an agonist, or decrease its ability to uptake a neurotransmitter, e.g., an antagonist/inhibitor.
  • This method comprise ⁇ tran ⁇ forming ho ⁇ t cell ⁇ with a vector of the present invention such that the NTT polypeptide i ⁇ expre ⁇ ed in that ho ⁇ t, incubating the ho ⁇ t cell ⁇ with the natural neurotran ⁇ mitter of NTT which ha ⁇ been labelled by a detectable marker sequence (e.g., radiolabel or a non-isotopic label such as biotin) and the potential compound and determining whether tran ⁇ location of the neurotran ⁇ mitter into the cell i ⁇ either inhibited or increased.
  • a detectable marker sequence e.g., radiolabel or a non-isotopic label such as biotin
  • excitatory or inhibitory neurotransmitter ⁇ have important clinical ⁇ ignificance.
  • glutamate i ⁇ an excitatory neurotran ⁇ mitter and it ⁇ presence in the synaptic cleft can be toxic to neurons. This neuronal toxicity has been found to play a significant role in Amyotrophic Lateral Sclerosis or "ALS".
  • ALS Amyotrophic Lateral Sclerosis
  • glutamate is released into the synaptic cleft and are toxic to neuronal cell ⁇ .
  • an agonist of NTT may be employed to stimulate the uptake of neurotransmitters and therefore alleviate these above-mentioned conditions.
  • the NTT polypeptides of the present invention may be administered by expres ⁇ ion of ⁇ uch polypeptides in vivo , which is often referred to as "gene therapy.”
  • Gene therapy is similar to the application of an NTT agonist, however, in gene therapy a polynucleotide of the present invention is administered such that the cellular machinery of the host expre ⁇ ses the NTT of the pre ⁇ ent invention to facilitate uptake of neurotransmitters where that is desired, for example in ALS, stroke and general pain.
  • cell ⁇ from a patient may be engineered with a polynucleotide . (DNA or RNA) encoding a polypeptide ex vivo , with the engineered cells then being targeted to the neuronal cells of a patient where expre ⁇ ion of NTT and tran ⁇ location of neurotran ⁇ mitters are desired.
  • a polynucleotide DNA or RNA
  • cell ⁇ may be engineered by procedure ⁇ known in the art by use of a retroviral particle containing RNA encoding a polypeptide of the present invention.
  • cells may be engineered in vivo for expre ⁇ ion of a polypeptide in vivo by, for example, procedures known in the art.
  • a producer cell for producing a retroviral particle containing RNA encoding the polypeptide of the present invention may be administered to a patient for engineering cell ⁇ in vivo and expression of the polypeptide in vivo .
  • the expres ⁇ ion vehicle for engineering cells may be other than a retrovirus, for example, an adenovirus which may be used to engineer cells in vivo after combination with a suitable delivery vehicle.
  • the present invention is also directed to antagonist/inhibitors of the polypeptides of the present invention, in addition to tho ⁇ e identified by utilizing the above-de ⁇ cribed ⁇ creening method.
  • Antagoni ⁇ t ⁇ include an antibody again ⁇ t the NTT polypeptide or, in some case ⁇ , an oligonucleotide which bind to the NTT making it inacce ⁇ ible to it ⁇ natural neurotran ⁇ mitter allowing the concentration of the neurotran ⁇ mitter in the ⁇ ynaptic cleft to increa ⁇ e.
  • Inhibitor ⁇ include anti ⁇ en ⁇ e construct ⁇ prepared u ⁇ ing antisen ⁇ e technology.
  • Anti ⁇ en ⁇ e technology can be u ⁇ ed to control gene expre ⁇ ion through triple-helix formation or antisen ⁇ e DNA or RNA, both of which methods are ba ⁇ ed on binding of a polynucleotide to DNA or RNA.
  • the 5' coding portion of the polynucleotide ⁇ equence which encode ⁇ the mature polypeptide ⁇ of the present invention, i ⁇ u ⁇ ed to de ⁇ ign an antisen ⁇ e RNA oligonucleotide of from about 10 to 40 base pairs in length.
  • a DNA oligonucleotide is de ⁇ igned to be complementary to a region of the gene involved in tran ⁇ cription (triple helix - see Lee et al. , Nucl. Acids Res., 6:3073 (1979); Cooney et al, Science, 241:456 (1988); and Dervan et al. , Science, 251: 1360 (1991)), thereby preventing tran ⁇ cription and the production of NTT.
  • the antisen ⁇ e RNA oligonucleotide hybridize ⁇ to the mRNA in vivo and block ⁇ tran ⁇ lation of the mRNA molecule into the NTT (anti ⁇ en ⁇ e - Okano, J. Neurochem.
  • oligonucleotides described above can al ⁇ o be delivered to cell ⁇ ⁇ uch that the anti ⁇ en ⁇ e RNA or DNA may be expre ⁇ ed in vivo to inhibit production of NTT.
  • the antagonist/inhibitors may be u ⁇ ed to treat depre ⁇ sion, anxiety, epilepsy and other neurological and psychiatric disorder ⁇ .
  • Defect ⁇ in neurotran ⁇ mitter tran ⁇ port systems result in increased or decreased concentrations of neurotran ⁇ mitter in the ⁇ ynaptic cleft, re ⁇ ulting in improperly stimulated receptors.
  • depression is a ⁇ ociated with decrea ⁇ ed relea ⁇ e of norepinephrine and/or serotonin in the brain. Therefore, inhibiting NTT from translocating its neurotran ⁇ mitter into the pre ⁇ ynaptic neuron would allow these neurotransmitters to interact more frequently with their receptors.
  • administration of the antagoni ⁇ t/inhibitor ⁇ may be employed to alleviate the condition ⁇ mentioned above.
  • the antagoni ⁇ t/inhibitor ⁇ may be employed in a compo ⁇ ition with a pharmaceutically acceptable carrier.
  • the pre ⁇ ent invention al ⁇ o relate ⁇ to an assay for identifying potential antagonist/inhibitor ⁇ ⁇ pecific to NTT.
  • An example of such an as ⁇ ay compri ⁇ e ⁇ preparing a synaptosomal preparation from the hypothalamu ⁇ of a mammal. Such a preparation i ⁇ a " ⁇ ealed" neuron where the end of the neuron i ⁇ pinched off. The ⁇ ynaptosomal preparation is then incubated with tritiated neurotran ⁇ mitter and a potential antagonist. The degree of uptake of neurotransmitter is then mea ⁇ ured to determine if the antagoni ⁇ t i ⁇ effective.
  • compositions e.g., agonist or antagonist/inhibitor compound ⁇ , of the present invention, may be employed in combination with a suitable pharmaceutical carrier.
  • a suitable pharmaceutical carrier include ⁇ but i ⁇ not limited to ⁇ aline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof.
  • a carrier include ⁇ but i ⁇ not limited to ⁇ aline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof.
  • the formulation should suit the mode of administration.
  • the invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredient ⁇ of the pharmaceutical compo ⁇ ition ⁇ of the invention.
  • a ⁇ ociated with ⁇ uch container( ⁇ ) can be a notice in the form pre ⁇ cribed by a governmental agency regulating the manufacture, u ⁇ e or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
  • the polypeptides of the present invention may be employed in conjunction with other therapeutic compounds.
  • compositions may be administered in an effective amount to effectively increase the affinity of NTT for it ⁇ neurotran ⁇ mitter or inhibit NTT from translocating its neurotransmitter, and thereby alleviate the abnormal conditions as ⁇ ociated with exce ⁇ concentration ⁇ of neurotran ⁇ mitter in the ⁇ ynaptic cleft or concentration ⁇ of neurotransmitter which are too low, as the case may be.
  • the sequence ⁇ of the pre ⁇ ent invention are also valuable for chromosome identification.
  • the sequence is specifically targeted to and can hybridize with a particular location on an individual human chromo ⁇ ome.
  • Few chromo ⁇ ome marking reagent ⁇ ba ⁇ ed on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location.
  • the mapping of DNAs to chromo ⁇ ome ⁇ according to the pre ⁇ ent invention i ⁇ an important first ⁇ tep in correlating tho ⁇ e ⁇ equences with genes associated with disease.
  • sequence ⁇ can be mapped to chromo ⁇ ome ⁇ by preparing PCR primer ⁇ (preferably 15-25 bp) from the cDNA.
  • the ⁇ e primer ⁇ are then u ⁇ ed for PCR ⁇ creening of somatic cell hybrids containing individual human chromo ⁇ ome ⁇ . Only those hybrid ⁇ containing the human gene corre ⁇ ponding to the primer will yield an amplified fragment.
  • mapping of somatic cell hybrids is a rapid procedure for as ⁇ igning a particular DNA to a particular chromosome.
  • sublocalization can be achieved with panels of fragments from specific chromosome ⁇ or pool ⁇ of large genomic clones in an analogous manner.
  • Other mapping strategie ⁇ that can ⁇ imilarly be u ⁇ ed to map to it ⁇ chromo ⁇ ome include in situ hybridization, pre ⁇ creening with labeled flow- ⁇ orted chromo ⁇ ome ⁇ and pre ⁇ election by hybridization to con ⁇ truct chromo ⁇ ome ⁇ pecific-cDNA librarie ⁇ .
  • Fluore ⁇ cence in situ hybridization (FISH) of a cDNA clone ⁇ to a metapha ⁇ e chromo ⁇ omal spread can be used to provide a precise chromosomal location in one step.
  • This technique can be u ⁇ ed with cDNA as short as 500 or 600 bases; however, clones larger than 2,000 bp have a higher likelihood of binding to a unique chromosomal location with sufficient signal intensity for simple detection.
  • FISH requires u ⁇ e of the clone ⁇ from which the EST was derived, and the longer the better. For example, 2,000 bp is good, 4,000 is better, and more than 4,000 is probably not necessary to get good result ⁇ a rea ⁇ onable percentage of the time.
  • thi ⁇ technique see Verma et al., Human Chromosomes: a Manual of Basic Technique ⁇ , Perga on Press, New York (1988).
  • the phy ⁇ ical position of the sequence on the chromosome can be correlated with genetic map data.
  • genetic map data are found, for example, in V. McKusick, Mendelian Inheritance in Man (available on line through John ⁇ Hopkin ⁇ Univer ⁇ ity Welch Medical Library) .
  • the relationship between genes and di ⁇ ease ⁇ that have been mapped to the same chromosomal region are then identified through linkage analysi ⁇ (coinheritance of physically adjacent genes).
  • a cDNA preci ⁇ ely localized to a chromosomal region as ⁇ ociated with the di ⁇ ea ⁇ e could be one of between 50 and 500 potential causative genes. (This a ⁇ ume ⁇ 1 megaba ⁇ e mapping re ⁇ olution and one gene per 20 kb) .
  • Compari ⁇ on of affected and unaffected individual ⁇ generally involves first looking for ⁇ tructural alteration ⁇ in the chromo ⁇ ome ⁇ , ⁇ uch a ⁇ deletion ⁇ or translocations that are visible from chromosome ⁇ pread ⁇ or detectable u ⁇ ing PCR based on that cDNA sequence. Ultimately, complete sequencing of genes from several individuals is required to confirm the presence of a mutation and to distingui ⁇ h mutations from polymorphisms.
  • the polypeptide ⁇ , their fragment ⁇ or other derivative ⁇ , or analogs thereof, or cell ⁇ expressing them can be used as an immunogen to produce antibodies thereto.
  • These antibodies can be, for example, polyclonal or monoclonal antibodies.
  • the pre ⁇ ent invention al ⁇ o include ⁇ chimeric, ⁇ ingle chain, and humanized antibodie ⁇ , a ⁇ well a ⁇ Fab fragments, or the product of an Fab expre ⁇ ion library. Various procedures known in the art may be used for the production of such antibodies and fragments.
  • Antibodie ⁇ generated again ⁇ t the polypeptide ⁇ corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptide ⁇ into an animal or by admini ⁇ tering the polypeptide ⁇ to an animal, preferably a nonhuman.
  • the antibody ⁇ o obtained will then bind the polypeptide ⁇ it ⁇ elf.
  • Such antibodie ⁇ can then be u ⁇ ed to i ⁇ olate the polypeptide from tissue expressing that polypeptide.
  • Example ⁇ include the hybridoma technique (Kohler and Mil ⁇ tein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBV-hybridoma technique to produce human monoclonal antibodie ⁇ (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Lis ⁇ , Inc., pp. 77-96) .
  • “Plasmids” are designated by a lower case p preceded and/or followed by capital letters and/or number ⁇ .
  • the starting pla ⁇ mid ⁇ herein are either commercially available, publicly available on an unre ⁇ tricted ba ⁇ i ⁇ , or can be con ⁇ tructed from available pla ⁇ mid ⁇ in accord with published procedure ⁇ .
  • equivalent pla ⁇ mid ⁇ to those described are known in the art and will be apparent to the ordinarily skilled arti ⁇ an.
  • “Digestion” of DNA refer ⁇ to catalytic cleavage of the DNA with a re ⁇ triction enzyme that act ⁇ only at certain ⁇ equence ⁇ in the DNA.
  • the various re ⁇ triction enzyme ⁇ u ⁇ ed herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan.
  • analytical purpo ⁇ es typically 1 ⁇ g of plasmid or DNA fragment i ⁇ u ⁇ ed with about 2 unit ⁇ of enzyme in about 20 ⁇ l of buffer solution.
  • isolating DNA fragments for plasmid con ⁇ truction typically 5 to 50 ⁇ g of DNA are dige ⁇ ted with 20 to 250 unit ⁇ of enzyme in a larger volume.
  • buffers and sub ⁇ trate amount ⁇ for particular re ⁇ triction enzymes are specified by the manufacturer.
  • Incubation time ⁇ of about 1 hour at 37°C are ordinarily u ⁇ ed, but may vary in accordance with the supplier's in ⁇ truction ⁇ .
  • After dige ⁇ tion the reaction i ⁇ electrophore ⁇ ed directly on a polyacrylamide gel to i ⁇ olate the de ⁇ ired fragment.
  • Oligonucleotides refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strand ⁇ which may be chemically synthesized. Such synthetic oligonucleotide ⁇ have no 5' pho ⁇ phate and thu ⁇ will not ligate to another oligonucleotide without adding a phosphate with an ATP in the pre ⁇ ence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.
  • Ligase refers to the process of forming phosphodie ⁇ ter bonds between two double stranded nucleic acid fragment ⁇ (Maniatis, T., et al.. Id., p. 146). Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units to T4 DNA ligase ("ligase”) per 0.5 ⁇ g of approximately equimolar amount ⁇ of the DNA fragment ⁇ to be ligated.
  • ligase T4 DNA ligase
  • the DNA ⁇ equence encoding for NTT ATCC # 75713 i ⁇ initially amplified u ⁇ ing PCR oligonucleotide primer ⁇ corre ⁇ ponding to the 5' and ⁇ equence ⁇ of the proce ⁇ ed NTT protein (minus the signal peptide ⁇ equence) and the vector ⁇ equence ⁇ 3' to the NTT gene. Additional nucleotide ⁇ corre ⁇ ponding to NTT were added to the 5' and 3' ⁇ equence ⁇ re ⁇ pectively.
  • the 5' oligonucleotide primer ha ⁇ the ⁇ equence GACTAAAGCTTGGCATCAATGCCGAAGAAC contain ⁇ a Hind III restriction enzyme site followed by 18 nucleotide ⁇ of NTT coding ⁇ equence.
  • the 3' sequence GAACTTCTAGAGCAGTGGTCACAGCTCAG contains complementary sequences to Xba I site and i ⁇ followed by 18 nucleotide ⁇ of NTT ⁇ equence.
  • the restriction enzyme sites correspond to the re ⁇ triction enzyme ⁇ ites on the bacterial expre ⁇ ion vector pQE-9. (Qiagen, Inc. 9259 Eton Avenue, Chat ⁇ worth, CA, 91311).
  • pQE-9 encode ⁇ antibiotic re ⁇ istance (Amp r ) , a bacterial origin of replication (ori), an IPTG- regulatable promoter operator (P/O), a ribo ⁇ ome binding ⁇ ite (RBS), a 6-Hi ⁇ tag and re ⁇ triction enzyme sites.
  • pQE-9 was then dige ⁇ ted with Hind III and Xba I.
  • the amplified ⁇ equence ⁇ were ligated into pQE-9 and were in ⁇ erted in frame with the ⁇ equence encoding for the hi ⁇ tidine tag and the RBS.
  • the ligation mixture wa ⁇ then u ⁇ ed to tran ⁇ form E.
  • M15/rep4 available from Qiagen under the trademark M15/rep 4 by the procedure de ⁇ cribed in Sambrook, J. et al.. Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Pre ⁇ , (1989). M15/rep4 contain ⁇ multiple copie ⁇ of the pla ⁇ mid pREP4, which expre ⁇ e ⁇ the lad repre ⁇ or and also confers kanamycin resi ⁇ tance (Kan r ) . Tran ⁇ formant ⁇ are identified by their ability to grow on LB plates and ampicillin/kanamycin resistant colonies were selected. Pla ⁇ mid DNA wa ⁇ i ⁇ olated and confirmed by re ⁇ triction analysis.
  • Clones containing the desired construct ⁇ were grown overnight (0/N) in liquid culture in LB media ⁇ upplemented with both Amp (100 ug/ml) and Kan (25 ug/ml).
  • the O/N culture i ⁇ u ⁇ ed to inoculate a large culture at a ratio of 1:100 to 1:250.
  • the cell ⁇ were grown to an optical den ⁇ ity 600 (O.D. 600 ) of between 0.4 and 0.6.
  • IPTG "I ⁇ opropyl-B-D- thiogalacto pyranoside" wa ⁇ then added to a final concentration of 1 mM. IPTG induce ⁇ by inactivating the lad repre ⁇ or, clearing the P/0 leading to increased gene expre ⁇ ion.
  • NTT wa ⁇ eluted from the column in 6 molar guanidine HCI pH 5.0 and for the purpo ⁇ e of renaturation adjusted to 3 molar guanidine HCI, lOOmM sodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized). After incubation in thi ⁇ solution for 12 hour ⁇ the protein wa ⁇ dialyzed to 10 mmolar ⁇ odium pho ⁇ phate.
  • the expre ⁇ sion of plasmid, NTT HA is derived from a vector pcDNAl/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resi ⁇ tance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation ⁇ ite.
  • the HA tag correspond to an epitope derived from the influenza hemagglutinin protein a ⁇ previou ⁇ ly de ⁇ cribed (I. Wilson, H. Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37, 767).
  • the infusion of HA tag to our target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
  • the plasmid con ⁇ truction ⁇ trategy is described as follows:
  • the DNA sequence encoding for NTT was constructed by PCR on the original EST cloned using two primers: the 5' primer GACTAAGATCTGCCACCATGCCGAAGAACAGCAAAGTG contains a Bgl II site followed by 21 nucleotides of NTT coding ⁇ equence starting from the initiation codon; the 3' sequence GAACTGATATCGCAGTGGTCACAGCTCAG contains complementary sequence ⁇ to EcoR V site, tran ⁇ lation ⁇ top codon, and the last 18 nucleotides of the NTT coding sequence. Therefore, the PCR product contains a Bgl II site, NTT coding sequence followed by a tran ⁇ lation termination ⁇ top codon, and an EcoR V site.
  • the ligation mixture was tran ⁇ formed into E. coli strain SURE (available from Stratagene Cloning Systems, 11099 North Torrey Pines Road, La Jolla, CA 92037) the transformed culture was plated on ampicillin media plates and resistant colonie ⁇ were ⁇ elected. Pla ⁇ mid DNA was isolated from transformant ⁇ and examined by re ⁇ triction analysis for the presence of the correct fragment.
  • RNAzolTM B sy ⁇ tem Biotecx Labora- torie ⁇ . Inc. 6023 South Loop Ea ⁇ t, Houston, TX 77033.
  • the labeled DNA wa ⁇ purified with a Select-G-50 column. (5 Prime - 3 Prime, Inc. 5603 Arapahoe Road, Boulder, CO 80303).
  • the filter wa ⁇ then hybridized with radioactive labeled full length MIP-2 gene at 1,000,000 cpm/ml in 0.5 M NaP0 4 , pH 7.4 and 7% SDS overnight at 65°C.
  • the filter wa ⁇ After wa ⁇ h twice at room temperature and twice at 60"C with 0.5 x SSC, 0.1% SDS, the filter wa ⁇ then expo ⁇ ed at -70°C overnight with an inten ⁇ ifying ⁇ creen.
  • ADDRESSEE CARELLA, BYRNE, BAIN, GILFILLAN,
  • CCGTGTCCTA CAAGAAGGCC CGCATGATGA AGGACATCTC CAACCTGGAG GAGAACGATG 2280
  • a ⁇ p A ⁇ n Val lie Met Thr Val Ly ⁇ Glu A ⁇ p Gin Phe Ser Ala Leu

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Neurology (AREA)
  • Public Health (AREA)
  • Biomedical Technology (AREA)
  • Neurosurgery (AREA)
  • Pain & Pain Management (AREA)
  • Psychiatry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Anesthesiology (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Biochemistry (AREA)
  • Cardiology (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Disclosed is a neurotransmitter transporter protein and DNA (RNA) encoding such protein. Also provided is a procedure for producing such polypeptide by recombinant techniques. The procedure for producing antagonists/inhibitors against such polypeptide is also provided. Such antagonist/inhibitors may be used to inhibit the action of neurotransmitter transporter protein for treatment of depression, anxiety or epilepsy.

Description

NEUROTRANSMITTER TRANSPORTER
This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptide of the present invention is a neurotransmitter transporter and the polypeptide of the present invention is herein sometime referred to as "NTT" . The invention also relates to inhibiting the action of such polypeptides.
An essential property of synaptic transmission is the rapid termination of action following neurotransmitter release. For many neurotransmitters, including catecholamines, serotonin, and certain amino acids (e.g., 7-aminobutyric acid (GABA), glutamate, and glycine), rapid termination of synaptic action is achieved by the uptake of the transmitter into the presynaptic terminal and surrounding glial cells by neurotransmitter transporters (Bennett, et al., Life Sci. 15:1045-1056 (1974)). Inhibition or stimulation of neurotransmitter uptake provides a means for modulating the strength of the synaptic action by regulating the available levels of endogenous transmitters. Neurotransmitter transporters are membrane-bound polypeptides which uptake neurotransmitters into the pre-synaptic neuron after the neurotransmitters have crossed the synaptic cleft and acted upon the post-synaptic neuron. Neurotransmitters can be excitatory, such as glutamate, or inhibitory such as GABA.
Affinity neurotransmitter transport is thought to terminate the overall process of synaptic transmission (Iverεen, L.L., Br. J. Pharmacol. 41:571-591 (1971)). Recently, cDNAs encoding more than ten different neurotransmitter transporters have been cloned and seguenced. The family of these genes could be divided into three subfamilies, including the GABA and taurine transporters (Liu, Q.R., et al., Proc. Natl. Acad. Sci. USA (in press), (1992)), the amino acid (glycine and proline) transporters (Fremeau, Jr., R.T., et al., Neuron, 8:915-926 (1992)), and the catecholamine transporters (Pacholczyk, T., et al., Nature, 350:350-354 (1991)). The general structure of all these gene products is very similar. They contain twelve potential transmembrane helices and an extended external loop with 3-4 glycosylation sites between membrane segments 3 and 4. The calculated molecular weights of the transporters is about 70 kDa and both their C- and N-terminal peripheral peptides contain about 40 amino acids and may be located on the cytoplasmic side of the membrane. In GABA and catecholamine transporter subfamilies, the amino acid sequence of each member is 60-80% identical to the other members within a subfamily and about 40% identical to members between the two subfamilies (Liu, Q.R., et al., Proc. Natl. Acad. Sci. USA, 89:6639-6643 (1992)). Amino acid transporters, such as the glycine transporter and proline transporter, share about 40-45% homology with all members of the neurotransmitter transporter εuperfamily. Sequence homology among the members of the neurotransmitter transporter family give clear indication that they evolved from a common ancestral gene. Moreover, partial genomic cloning of several neurotransmitter transporters reveal that in all of them the first intron in the reading frame is located in an identical position (id. ) .
A GABAA transporter was the first neurotransmitter system to be cloned and expressed (Guastella, J., et al., Science 249:1303-1306 (1990)) and is one of a family of neurotransmitter transporters cloned within the last year. Recently, a serotonin transporter cDNA has been disclosed in PCT WO 93/08261.
In accordance with one aspect of the present invention, there is provided a novel mature polypeptide which is herein referred to as NTT, as well as fragments, analogs and derivatives thereof. The polypeptide of the present invention is of human origin.
In accordance with another aspect of the present invention, there are provided polynucleotides (DNA or RNA) which encode such polypeptides. In accordance with yet a further aspect of the present invention, there is provided a process for producing such polypeptide by recombinant techniques.
In accordance with yet a further aspect of the present invention, there are provided agonists which increase the affinity of NTT for its substrate, and which may be used to treat Amyotrophic Lateral Sclerosis, pain and stroke.
In accordance with a further aspect of the present invention, there are provided antibodies against such NTT polypeptides.
In accordance with yet another aspect of the present invention, there are provided antagonist/inhibitors which may be used to prevent the uptake of neurotransmitters by NTT, which may be used therapeutically, for example, in the treatment of depression, anxiety and epilepsy, as well as other neurologic or psychiatric disorders.
These and other aspects of the present invention should be apparent to those skilled in the art from the teachings herein.
The following drawings are illustrative of embodiments of the invention and are not meant to limit the scope of the invention as encompassed by the claims.
Figure 1 shows the cDNA sequence and corresponding deduced amino acid sequence of the mature NTT polypeptide. The standard one-letter abbreviation for amino acids is used. In accordance with an aspect of the present invention, there is provided an isolated nucleic acid (polynucleotide) which encodes for the mature polypeptide having the deduced amino acid sequence of Figure 1 or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. 75713 on March 18, 1994.
The polynucleotide of this invention was discovered in a cDNA library derived from a human fetal brain. It is structurally related to the neurotransmitter transporter family. It contains an open reading frame encoding a protein of about 727 amino acid residues. The protein exhibits the highest degree of homology to a rat neurotransmitter transporter (NT74) with 94% identity and 96% similarity over the entire amino acid sequence.
The polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA. The DNA may be double-stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand. The coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1 or that of the deposited clone or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same, mature polypeptide as the DNA of Figure 1 or the deposited cDNA.
The polynucleotide which encodes for the mature polypeptide of Figure 1 or for the mature polypeptide encoded by the deposited cDNA may include: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding sequence such as a leader or secretory sequence or a proprotein sequence; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' of the coding sequence for the mature polypeptide.
Thus, the term "polynucleotide encoding a polypeptide" encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.
The present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figure 1 or the polypeptide encoded by the cDNA of the deposited clone. The variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide.
Thus, the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure 1 or the same mature polypeptide encoded by the cDNA of the deposited clone as well as variants of such polynucleotides which variants encode for a fragment, derivative or analog of the polypeptide of Figure 1 or the polypeptide encoded by the cDNA of the deposited clone. Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.
As hereinabove indicated, the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in Figure 1 or of the coding sequence of the deposited clone. As known in the art, an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptide.
The polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptide of the present invention. The marker sequence may be a hexa-histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, is used. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al., Cell, 37:767 (1984)).
The present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 50% and preferably 70% identity between the sequences. The present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides . As herein used, the term "stringent conditions" means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences. The polynucleotides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which retain substantially the same biological function or activity as the mature polypeptide encoded by the cDNA of Figure 1 or the deposited cDNA.
The deposit(ε) referred to herein will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organiεmε for purpoεeε of Patent Procedure. These depositε are provided merely aε convenience to thoεe of εkill in the art and are not an admiεεion that a deposit is required under 35 U.S.C. §112. The sequence of the polynucleotides contained in the deposited materials, aε well as the amino acid sequence of the polypeptides encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with any description of sequences herein. A license may be required to make, uεe or εell the depoεited materials, and no εuch licenεe iε hereby granted.
The preεent invention further relateε to an NTT polypeptide which haε the deduced amino acid εequence of Figure 1 or which has the amino acid sequence encoded by the deposited cDNA, as well aε fragments, analogs and derivativeε of such polypeptide. The termε "fragment," "derivative" and "analog" when referring to the polypeptide of Figure 1 or that encoded by the deposited cDNA, meanε a polypeptide which retainε eεεentially the εame biological function or activity as such polypeptide. Thus, an analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
The polypeptide of the. present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide.
The fragment, derivative or analog of the polypeptide of Figure 1 or that encoded by the deposited cDNA may be (i) one in which one or more of the amino acid residues are subεtituted with a conserved or non-conserved amino acid reεidue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residueε includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acidε are fused to the mature polypeptide, such aε a leader or secretory sequence or a sequence which is employed for purification of the mature polypeptide or a proprotein sequence. Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein. The polypeptideε and polynucleotideε of the preεent invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
The term "isolated" means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring) . For example, a naturally-occurring polynucleotide or polypeptide present in a living animal is not isolated, but the εame polynucleotide or polypeptide, separated from some or all of the coexisting materialε in the natural εyεte , is iεolated. Such polynucleotideε could be part of a vector and/or εuch polynucleotideε or polypeptideε could be part of a compoεition, and still be isolated in that such vector or composition is not part of itε natural environment.
The preεent invention alεo relateε to vectorε which include polynucleotideε of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniqueε.
Hoεt cellε are genetically engineered (tranεduced or tranεformed or tranεfected) with the vectorε of thiε invention which may be, for example, a cloning vector or an expreεεion vector. The vector may be, for example, in the form of a plaεmid, a viral particle, a phage, etc. The engineered hoεt cellε can be cultured in conventional nutrient media modified aε appropriate for activating pro oterε, selecting transformantε or amplifying the NTT geneε. The culture conditionε, such as temperature, pH and the like, are thoεe previously used with the host cell εelected for expression, and will be apparent to the ordinarily skilled artisan.
The polynucleotides of the preεent invention may be employed for producing polypeptideε by recombinant techniques. Thus, for example, the polynucleotide may be included in any one of a variety of expression vectors for expreεεing a polypeptide. Such vectorε include chromoεomal, nonchromoεomal and synthetic DNA εequenceε, e.g., derivativeε of SV40; bacterial plaεmidε; phage DNA; baculovirus; yeast plaεmidε; vectorε derived from combinationε of plaεmidε and phage DNA, viral DNA εuch aε vaccinia, adenoviruε, fowl pox virus, and pseudorabieε. However, any other vector may be uεed aε long aε it iε replicable and viable in the host.
The appropriate DNA sequence may be inserted into the vector by a variety of procedureε. In general, the DNA sequence is inεerted into an appropriate reεtriction endonucleaεe εite(ε) by procedures known in the art. Such procedureε and others are deemed to be within the scope of those skilled in the art.
The DNA sequence in the expresεion vector is operatively linked to an appropriate expresεion control sequence(s) (promoter) to direct mRNA εynthesis. Aε representative exampleε of εuch promoterε, there may be mentioned: LTR or SV40 promoter, the E. coli. lac or trp. the phage lambda PL promoter and other promoterε known to control expreεεion of geneε in prokaryotic or eukaryotic cells or their viruεeε. The expreεεion vector alεo containε a riboεome binding εite for tranεlation initiation and a tranεcription terminator. The vector may alεo include appropriate εequenceε for amplifying expreεεion.
In addition, the expreεεion vectorε preferably contain one or more εelectable marker geneε to provide a phenotypic trait for εelection of tranεformed hoεt cellε εuch aε dihydrofolate reductaεe or neomycin reεiεtance for eukaryotic cell culture, or εuch aε tetracycline or ampicillin reεiεtance in E. coli.
The vector containing the appropriate DNA εequence aε hereinabove described, aε well as an appropriate promoter or control sequence, may be employed to transform an appropriate hoεt to permit the host to expresε the protein.
Aε repreεentative exampleε of appropriate hoεtε, there may be mentioned: bacterial cellε, εuch aε E. coli. Streptomyceε. Salmonella typhimurium; fungal cellε, εuch aε yeaεt; inεect cells such as Drosophila and Sf9; animal cells such aε CHO, HEK 293, COS or Boweε melanoma; plant cellε, etc. The εelection of an appropriate hoεt iε deemed to be within the εcope of thoεe εkilled in the art from the teachings herein.
More particularly, the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above. The constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation. In a preferred aspect of thiε embodiment, the conεtruct further compriεeε regulatory εequenceε, including, for example, a promoter, operably linked to the sequence. Large numbers of suitable vectors and promoterε are known to thoεe of εkill in the art, and are commercially available. The following vectorε are provided by way of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pbε, pDIO, phageεcript, pεiX174, pblueεcript SK, pbεkε, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia). Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia) . However, any other plaεmid or vector may be uεed aε long aε they are replicable and viable in the hoεt.
Promoter regionε can be εelected from any desired gene using CAT (chloramphenicol tranεferaεe) vectorε or other vectorε with εelectable markerε. Two appropriate vectorε are PKK232-8 and PCM7. Particular named bacterial promoterε include lad, lacZ, T3, T7, gpt, lambda PR, PL and trp. Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retroviruε, and mouεe metallothionein-I. Selection of the appropriate vector and promoter iε well within the level of ordinary εkill in the art.
In a further embodiment, the present invention relates to hoεt cellε containing the above-deεcribed constructs. The hoεt cell can be a higher eukaryotic cell, εuch aε a mammalian cell, or a lower eukaryotic cell, εuch as a yeaεt cell, or the hoεt cell can be a prokaryotic cell, εuch as a bacterial cell. Introduction of the construct into the host cell can be effected by, for example, calcium phoεphate tranεfection, DEAE-Dextran mediated transfection, or electroporation. (Daviε, L., Dibner, M. , Battey, I., Baεic Methodε in Molecular Biology, (1986)).
The conεtructε in hoεt cellε can be uεed in a conventional manner to produce the gene product encoded by the recombinant εequence. Alternatively, the polypeptideε of the invention can be εynthetically produced by conventional peptide εyntheεizerε.
Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cellε under the control of appropriate promoterε. Cell-free tranεlation εystems can alεo be employed to produce εuch proteinε uεing RNAε derived from the DNA conεtructε of the preεent invention. Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hostε are deεcribed by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), the diεcloεure of which iε hereby incorporated by reference.
Tranεcription of the DNA encoding the polypeptideε of the preεent invention by higher eukaryotes is increased by inserting an enhancer εequence into the vector. Enhancers are ciε-acting elementε of DNA, uεually about from 10 to 300 bp that act on a promoter to increaεe itε transcription. Examples including the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late εide of the replication origin, and adenoviruε enhancerε. Generally, recombinant expreεεion vectorε will include originε of replication and εelectable markerε permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence. Such promoterε can be derived from operonε encoding glycolytic enzymeε εuch aε 3- phoεphoglycerate kinaεe (PGK), α-factor, acid phoεphataεe, or heat shock proteins, among others. The heterologous structural sequence iε aεεembled in appropriate phase with translation initiation and termination εequenceε, and preferably, a leader εequence capable of directing εecretion of translated protein into the periplasmic space or extracellular medium. Optionally, the heterologouε εequence can encode a fusion protein including an N-terminal identification peptide imparting deεired character- iεticε, e.g., stabilization or simplified purification of expresεed recombinant product.
Useful expression vectors for bacterial use are constructed by inεerting a εtructural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter. The vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host. Suitable prokaryotic hoεtε for tranεformation include E. coli. Bacillus εubtilis. Salmonella typhimurium and various εpecieε within the genera Pεeudomonaε, Streptomyceε, and Staphylococcuε, although otherε may alεo be employed aε a matter of choice.
Aε a repreεentative but nonlimiting example, useful expression vectors for bacterial uεe can compriεe a εelectable marker and bacterial origin of replication derived from commercially available plaεmidε compriεing genetic elementε of the well known cloning vector pBR322 (ATCC 37017). Such commercial vectorε include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppεala, Sweden) and GEM1 (Promega Biotec, Madiεon, WI, USA). Theεe pBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expressed.
Following transformation of a suitable host εtrain and growth of the hoεt εtrain to an appropriate cell denεity, the εelected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cellε are cultured for an additional period.
Cellε are typically harveεted by centrifugation, diεrupted by phyεical or chemical meanε, and the reεulting crude extract retained for further purification. Microbial cellε employed in expreεεion of proteinε can be diεrupted by any convenient method, including freeze-thaw cycling, εonication, mechanical diεruption, or uεe of cell lysing agents, such methods are well know to those εkilled in the art.
Variouε mammalian cell culture systems can also be employed to expresε recombinant protein. Examples of mammalian expression εyεtemε include the COS-7 lineε of monkey kidney fibroblaεtε, deεcribed by Gluzman, Cell, 23:175 (1981), and other cell lineε capable of expreεεing a compatible vector, for example, the C127, 3T3, CHO, HEK 293, HeLa and BHK cell lineε. Mammalian expreεεion vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequenceε, and 5' flanking nontranscribed sequences. DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elementε.
The NTT polypeptideε can be recovered and purified from recombinant cell cultureε by methodε including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography hydroxylapatite chromatography and lectin chromatography. Protein refolding εtepε can be used, aε neceεsary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.
The polypeptides of the present invention may be a naturally purified product, or a product of chemical synthetic procedureε, or produced by recombinant techniqueε from a prokaryotic or eukaryotic hoεt (for example, by bacterial, yeaεt, higher plant, inεect and mammalian cellε in culture). Depending upon the hoεt employed in a recombinant production procedure, the polypeptides of the present invention may be glycoεylated or may be non-glycoεylated. Polypeptideε of the invention may alεo include an initial methionine amino acid reεidue.
The preεent invention alεo provideε a method for identifying neurotransmitters which interact with the NTT polypeptides of the preεent invention. The method for determining whether a neurotransmitter is translocated from the synaptic cleft into the pre-synaptic neuron by NTT compriseε tranεfecting a cell population with the appropriate vector expreεεing the NTT εuch that the cell will now expreεε NTT. Variouε neurotranεmitterε are then radio-labelled, e.g., tritiated, and incubated with the transfected cell to identify which neurotransmitterε are tranεported into the cell.
Once a neurotranεmitter iε identified compoundε can be εcreened to identify thoεe which εpecifically interact with NTT and either increaεe NTT'ε affinity to uptake its neurotransmitter, e.g., an agonist, or decrease its ability to uptake a neurotransmitter, e.g., an antagonist/inhibitor. This method compriseε tranεforming hoεt cellε with a vector of the present invention such that the NTT polypeptide iε expreεεed in that hoεt, incubating the hoεt cellε with the natural neurotranεmitter of NTT which haε been labelled by a detectable marker sequence (e.g., radiolabel or a non-isotopic label such as biotin) and the potential compound and determining whether tranεlocation of the neurotranεmitter into the cell iε either inhibited or increased. By measuring the amount of neurotransmitter inside the cell, one skilled in the art could determine if the compound is an effective agonist or antagonist.
The presence of excitatory or inhibitory neurotransmitterε have important clinical εignificance. For example, glutamate iε an excitatory neurotranεmitter and itε presence in the synaptic cleft can be toxic to neurons. This neuronal toxicity has been found to play a significant role in Amyotrophic Lateral Sclerosis or "ALS". Further, during a stroke excessive concentrations of glutamate are released into the synaptic cleft and are toxic to neuronal cellε. Moreover, although the cauεe of general pain iε unknown, it iε believed that pain is characterized by the releaεe of neurotranεmitterε into the synaptic cleft in the brain. Accordingly, an agonist of NTT may be employed to stimulate the uptake of neurotransmitters and therefore alleviate these above-mentioned conditions.
The NTT polypeptides of the present invention may be administered by expresεion of εuch polypeptides in vivo , which is often referred to as "gene therapy." Gene therapy is similar to the application of an NTT agonist, however, in gene therapy a polynucleotide of the present invention is administered such that the cellular machinery of the host expreεses the NTT of the preεent invention to facilitate uptake of neurotransmitters where that is desired, for example in ALS, stroke and general pain.
For example, cellε from a patient may be engineered with a polynucleotide . (DNA or RNA) encoding a polypeptide ex vivo , with the engineered cells then being targeted to the neuronal cells of a patient where expreεεion of NTT and tranεlocation of neurotranεmitters are desired. Such methods are well-known in the art. For example, cellε may be engineered by procedureε known in the art by use of a retroviral particle containing RNA encoding a polypeptide of the present invention.
Similarly, cells may be engineered in vivo for expreεεion of a polypeptide in vivo by, for example, procedures known in the art. As known in the art, a producer cell for producing a retroviral particle containing RNA encoding the polypeptide of the present invention may be administered to a patient for engineering cellε in vivo and expression of the polypeptide in vivo . These and other methodε for adminiεtering a polypeptide of the preεent invention by εuch method εhould be apparent to thoεe εkilled in the art from the teachings of the present invention. For example, the expresεion vehicle for engineering cells may be other than a retrovirus, for example, an adenovirus which may be used to engineer cells in vivo after combination with a suitable delivery vehicle.
The present invention is also directed to antagonist/inhibitors of the polypeptides of the present invention, in addition to thoεe identified by utilizing the above-deεcribed εcreening method. Antagoniεtε include an antibody againεt the NTT polypeptide or, in some caseε, an oligonucleotide which bind to the NTT making it inacceεεible to itε natural neurotranεmitter allowing the concentration of the neurotranεmitter in the εynaptic cleft to increaεe.
Inhibitorε include antiεenεe constructε prepared uεing antisenεe technology. Antiεenεe technology can be uεed to control gene expreεεion through triple-helix formation or antisenεe DNA or RNA, both of which methods are baεed on binding of a polynucleotide to DNA or RNA. For example, the 5' coding portion of the polynucleotide εequence, which encodeε the mature polypeptideε of the present invention, iε uεed to deεign an antisenεe RNA oligonucleotide of from about 10 to 40 base pairs in length. A DNA oligonucleotide is deεigned to be complementary to a region of the gene involved in tranεcription (triple helix - see Lee et al. , Nucl. Acids Res., 6:3073 (1979); Cooney et al, Science, 241:456 (1988); and Dervan et al. , Science, 251: 1360 (1991)), thereby preventing tranεcription and the production of NTT. The antisenεe RNA oligonucleotide hybridizeε to the mRNA in vivo and blockε tranεlation of the mRNA molecule into the NTT (antiεenεe - Okano, J. Neurochem. , 56:560 (1991); Oligodeoxynucleotideε aε Antisense Inhibitors of Gene Expression, CRC Presε, Boca Raton, FL (1988)). The oligonucleotides described above can alεo be delivered to cellε εuch that the antiεenεe RNA or DNA may be expreεεed in vivo to inhibit production of NTT.
In theεe wayε, the antagonist/inhibitors may be uεed to treat depreεsion, anxiety, epilepsy and other neurological and psychiatric disorderε. Defectε in neurotranεmitter tranεport systems result in increased or decreased concentrations of neurotranεmitter in the εynaptic cleft, reεulting in improperly stimulated receptors. For example, it has been postulated that depression is aεεociated with decreaεed releaεe of norepinephrine and/or serotonin in the brain. Therefore, inhibiting NTT from translocating its neurotranεmitter into the preεynaptic neuron would allow these neurotransmitters to interact more frequently with their receptors. Accordingly, administration of the antagoniεt/inhibitorε may be employed to alleviate the conditionε mentioned above. The antagoniεt/inhibitorε may be employed in a compoεition with a pharmaceutically acceptable carrier.
The preεent invention alεo relateε to an assay for identifying potential antagonist/inhibitorε εpecific to NTT. An example of such an asεay compriεeε preparing a synaptosomal preparation from the hypothalamuε of a mammal. Such a preparation iε a "εealed" neuron where the end of the neuron iε pinched off. The εynaptosomal preparation is then incubated with tritiated neurotranεmitter and a potential antagonist. The degree of uptake of neurotransmitter is then meaεured to determine if the antagoniεt iε effective.
The compounds, e.g., agonist or antagonist/inhibitor compoundε, of the present invention, may be employed in combination with a suitable pharmaceutical carrier. Such compositionε compriεe a therapeutically effective amount of the polypeptide, and a pharmaceutically acceptable carrier or excipient. Such a carrier includeε but iε not limited to εaline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation should suit the mode of administration.
The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredientε of the pharmaceutical compoεitionε of the invention. Aεεociated with εuch container(ε) can be a notice in the form preεcribed by a governmental agency regulating the manufacture, uεe or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration. In addition, the polypeptides of the present invention may be employed in conjunction with other therapeutic compounds.
The pharmaceutical compositions may be administered in an effective amount to effectively increase the affinity of NTT for itε neurotranεmitter or inhibit NTT from translocating its neurotransmitter, and thereby alleviate the abnormal conditions asεociated with exceεε concentrationε of neurotranεmitter in the εynaptic cleft or concentrationε of neurotransmitter which are too low, as the case may be.
The sequenceε of the preεent invention are also valuable for chromosome identification. The sequence is specifically targeted to and can hybridize with a particular location on an individual human chromoεome. Moreover, there iε a current need for identifying particular εiteε on the chromoεome. Few chromoεome marking reagentε baεed on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location. The mapping of DNAs to chromoεomeε according to the preεent invention iε an important first εtep in correlating thoεe εequences with genes associated with disease.
Briefly, sequenceε can be mapped to chromoεomeε by preparing PCR primerε (preferably 15-25 bp) from the cDNA. Computer analyεiε of the cDNA iε uεed to rapidly εelect primerε that do not εpan more than one exon in the genomic DNA, thuε complicating the amplification proceεε. Theεe primerε are then uεed for PCR εcreening of somatic cell hybrids containing individual human chromoεomeε. Only those hybridε containing the human gene correεponding to the primer will yield an amplified fragment.
PCR mapping of somatic cell hybrids is a rapid procedure for asεigning a particular DNA to a particular chromosome. Using the preεent invention with the same oligonucleotide primers, sublocalization can be achieved with panels of fragments from specific chromosomeε or poolε of large genomic clones in an analogous manner. Other mapping strategieε that can εimilarly be uεed to map to itε chromoεome include in situ hybridization, preεcreening with labeled flow-εorted chromoεomeε and preεelection by hybridization to conεtruct chromoεome εpecific-cDNA librarieε.
Fluoreεcence in situ hybridization (FISH) of a cDNA cloneε to a metaphaεe chromoεomal spread can be used to provide a precise chromosomal location in one step. This technique can be uεed with cDNA as short as 500 or 600 bases; however, clones larger than 2,000 bp have a higher likelihood of binding to a unique chromosomal location with sufficient signal intensity for simple detection. FISH requires uεe of the cloneε from which the EST was derived, and the longer the better. For example, 2,000 bp is good, 4,000 is better, and more than 4,000 is probably not necessary to get good resultε a reaεonable percentage of the time. For a review of thiε technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniqueε, Perga on Press, New York (1988).
Once a sequence has been mapped to a precise chromoεomal location, the phyεical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found, for example, in V. McKusick, Mendelian Inheritance in Man (available on line through Johnε Hopkinε Univerεity Welch Medical Library) . The relationship between genes and diεeaseε that have been mapped to the same chromosomal region are then identified through linkage analysiε (coinheritance of physically adjacent genes).
Next, it iε neceεεary to determine the differences in the cDNA or genomic sequence between affected and unaffected individuals. If a mutation is observed in some or all of the affected individuals but not in any normal individuals, then the mutation iε likely to be the cauεative agent of the diεeaεe.
With current reεolution of phyεical mapping and genetic mapping techniqueε, a cDNA preciεely localized to a chromosomal region asεociated with the diεeaεe could be one of between 50 and 500 potential causative genes. (This aεεumeε 1 megabaεe mapping reεolution and one gene per 20 kb) .
Compariεon of affected and unaffected individualε generally involves first looking for εtructural alterationε in the chromoεomeε, εuch aε deletionε or translocations that are visible from chromosome εpreadε or detectable uεing PCR based on that cDNA sequence. Ultimately, complete sequencing of genes from several individuals is required to confirm the presence of a mutation and to distinguiεh mutations from polymorphisms.
The polypeptideε, their fragmentε or other derivativeε, or analogs thereof, or cellε expressing them can be used as an immunogen to produce antibodies thereto. These antibodies can be, for example, polyclonal or monoclonal antibodies. The preεent invention alεo includeε chimeric, εingle chain, and humanized antibodieε, aε well aε Fab fragments, or the product of an Fab expreεεion library. Various procedures known in the art may be used for the production of such antibodies and fragments.
Antibodieε generated againεt the polypeptideε corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptideε into an animal or by adminiεtering the polypeptideε to an animal, preferably a nonhuman. The antibody εo obtained will then bind the polypeptideε itεelf. In thiε manner, even a εequence encoding only a fragment of the polypeptideε can be uεed to generate antibodieε binding the whole native polypeptideε. Such antibodieε can then be uεed to iεolate the polypeptide from tissue expressing that polypeptide.
For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Exampleε include the hybridoma technique (Kohler and Milεtein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBV-hybridoma technique to produce human monoclonal antibodieε (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Lisε, Inc., pp. 77-96) .
Techniqueε deεcribed for the production of εingle chain antibodieε (U.S. Patent 4,946,778) can be adapted to produce εingle chain antibodies to immunogenic polypeptide products of this invention.
The present invention will be further described with reference to the following examples; however, it is to be understood that the present invention is not limited to such examples. All partε or amountε, unleεε otherwiεe εpecified, are by weight.
In order to facilitate underεtanding of the following exampleε certain frequently occurring methodε and/or termε will be described.
"Plasmids" are designated by a lower case p preceded and/or followed by capital letters and/or numberε. The starting plaεmidε herein are either commercially available, publicly available on an unreεtricted baεiε, or can be conεtructed from available plaεmidε in accord with publiεhed procedureε. In addition, equivalent plaεmidε to those described are known in the art and will be apparent to the ordinarily skilled artiεan.
"Digestion" of DNA referε to catalytic cleavage of the DNA with a reεtriction enzyme that actε only at certain εequenceε in the DNA. The various reεtriction enzymeε uεed herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan. For analytical purpoεes, typically 1 μg of plasmid or DNA fragment iε uεed with about 2 unitε of enzyme in about 20 μl of buffer solution. For the purpose of isolating DNA fragments for plasmid conεtruction, typically 5 to 50 μg of DNA are digeεted with 20 to 250 unitε of enzyme in a larger volume. Appropriate buffers and subεtrate amountε for particular reεtriction enzymes are specified by the manufacturer. Incubation timeε of about 1 hour at 37°C are ordinarily uεed, but may vary in accordance with the supplier's inεtructionε. After digeεtion the reaction iε electrophoreεed directly on a polyacrylamide gel to iεolate the deεired fragment.
Size separation of the cleaved fragments iε performed uεing 8 percent polyacrylamide gel deεcribed by Goeddel, D. et al . , Nucleic Acidε Res., 8:4057 (1980).
"Oligonucleotides" refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strandε which may be chemically synthesized. Such synthetic oligonucleotideε have no 5' phoεphate and thuε will not ligate to another oligonucleotide without adding a phosphate with an ATP in the preεence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.
"Ligation" refers to the process of forming phosphodieεter bonds between two double stranded nucleic acid fragmentε (Maniatis, T., et al.. Id., p. 146). Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units to T4 DNA ligase ("ligase") per 0.5 μg of approximately equimolar amountε of the DNA fragmentε to be ligated.
Unleεε otherwiεe stated, transformation was performed as described in the method of Graham, F. and Van der Eb, A., Virology, 52:456-457 (1973).
Example 1 Bacterial Expresεion and Purification of NTT
The DNA εequence encoding for NTT, ATCC # 75713 iε initially amplified uεing PCR oligonucleotide primerε correεponding to the 5' and εequenceε of the proceεεed NTT protein (minus the signal peptide εequence) and the vector εequenceε 3' to the NTT gene. Additional nucleotideε correεponding to NTT were added to the 5' and 3' εequenceε reεpectively. The 5' oligonucleotide primer haε the εequence GACTAAAGCTTGGCATCAATGCCGAAGAAC containε a Hind III restriction enzyme site followed by 18 nucleotideε of NTT coding εequence. The 3' sequence GAACTTCTAGAGCAGTGGTCACAGCTCAG contains complementary sequences to Xba I site and iε followed by 18 nucleotideε of NTT εequence. The restriction enzyme sites correspond to the reεtriction enzyme εites on the bacterial expreεεion vector pQE-9. (Qiagen, Inc. 9259 Eton Avenue, Chatεworth, CA, 91311). pQE-9 encodeε antibiotic reεistance (Ampr) , a bacterial origin of replication (ori), an IPTG- regulatable promoter operator (P/O), a riboεome binding εite (RBS), a 6-Hiε tag and reεtriction enzyme sites. pQE-9 was then digeεted with Hind III and Xba I. The amplified εequenceε were ligated into pQE-9 and were inεerted in frame with the εequence encoding for the hiεtidine tag and the RBS. The ligation mixture waε then uεed to tranεform E. coli εtrain M15/rep 4 available from Qiagen under the trademark M15/rep 4 by the procedure deεcribed in Sambrook, J. et al.. Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Preεε, (1989). M15/rep4 containε multiple copieε of the plaεmid pREP4, which expreεεeε the lad repreεεor and also confers kanamycin resiεtance (Kanr) . Tranεformantε are identified by their ability to grow on LB plates and ampicillin/kanamycin resistant colonies were selected. Plaεmid DNA waε iεolated and confirmed by reεtriction analysis. Clones containing the desired constructε were grown overnight (0/N) in liquid culture in LB media εupplemented with both Amp (100 ug/ml) and Kan (25 ug/ml). The O/N culture iε uεed to inoculate a large culture at a ratio of 1:100 to 1:250. The cellε were grown to an optical denεity 600 (O.D.600) of between 0.4 and 0.6. IPTG ( "Iεopropyl-B-D- thiogalacto pyranoside") waε then added to a final concentration of 1 mM. IPTG induceε by inactivating the lad repreεεor, clearing the P/0 leading to increased gene expreεεion. Cells were grown an extra 3 to 4 hours. Cells were then harveεted by centrifugation. The cell pellet was solubilized in the chaotropic agent 6 Molar Guanidine HCI. After clarification, solubilized NTT waε purified from thiε solution by chromatography on a Nickel-Chelate column under conditions that allow for tight binding by proteins containing the 6-His tag. Hochuli, E. et al., J. Chromatography 411:177-184 (1984). NTT waε eluted from the column in 6 molar guanidine HCI pH 5.0 and for the purpoεe of renaturation adjusted to 3 molar guanidine HCI, lOOmM sodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized). After incubation in thiε solution for 12 hourε the protein waε dialyzed to 10 mmolar εodium phoεphate.
Example 2 Expreεεion of Recombinant NTT in COS cellε
The expreεsion of plasmid, NTT HA is derived from a vector pcDNAl/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resiεtance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation εite. A DNA fragment encoding the entire NTT precurεor and a HA tag fuεed in frame to its 3' end waε cloned into the polylinker region of the vector, therefore, the recombinant protein expreεεion iε directed under the CMV promoter. The HA tag correspond to an epitope derived from the influenza hemagglutinin protein aε previouεly deεcribed (I. Wilson, H. Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37, 767). The infusion of HA tag to our target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
The plasmid conεtruction εtrategy is described as follows:
The DNA sequence encoding for NTT, ATCC # 75713, was constructed by PCR on the original EST cloned using two primers: the 5' primer GACTAAGATCTGCCACCATGCCGAAGAACAGCAAAGTG contains a Bgl II site followed by 21 nucleotides of NTT coding εequence starting from the initiation codon; the 3' sequence GAACTGATATCGCAGTGGTCACAGCTCAG contains complementary sequenceε to EcoR V site, tranεlation εtop codon, and the last 18 nucleotides of the NTT coding sequence. Therefore, the PCR product contains a Bgl II site, NTT coding sequence followed by a tranεlation termination εtop codon, and an EcoR V site. The PCR amplified DNA fragment and the vector, pcDNAl/Amp, were digested with Bgl II and EcoR V. The ligation mixture was tranεformed into E. coli strain SURE (available from Stratagene Cloning Systems, 11099 North Torrey Pines Road, La Jolla, CA 92037) the transformed culture was plated on ampicillin media plates and resistant colonieε were εelected. Plaεmid DNA was isolated from transformantε and examined by reεtriction analysis for the presence of the correct fragment. For expression of the recombinant NTT, COS cellε were tranεfected with the expreεεion vector by DEAE-DEXTRAN method. (J. Sambrook, E. Fritεch, T. Maniatiε, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989)). The expresεion of the NTT HA protein waε detected by radiolabelling and i munoprecipitation method. (E. Harlow, D. Lane, Antibodieε: A Laboratory Manual, Cold Spring Harbor Laboratory Preεε, (1988)). Cellε were labelled for 8 hourε with 35S-cyεteine two days post tranεfection. Culture media were then collected and cellε were lyεed with detergent (RIPA buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50mM Triε, pH 7.5). (Wilεon, I. et al.. Id. 37:767 (1984)). Both cell lyεate and culture media were precipitated with a HA εpecific monoclonal antibody. Proteins precipitated were analyzed on 15% SDS-PAGE gels.
Example 3 Expression pattern of NTT in human tiεsue
Northern blot analyεiε waε carried out to examine the levelε of expreεεion of NTT in human tissues. Total cellular RNA sa pleε were iεolated with RNAzol™ B syεtem (Biotecx Labora- torieε. Inc. 6023 South Loop Eaεt, Houston, TX 77033). About lOμg of total RNA isolated from each human tissue specified waε separated on 1% agarose gel and blotted onto a nylon filter. (Sambrook, Fritsch, and Maniatiε, Molecular Cloning, Cold Spring Harbor Preεε, (1989)). The labeling reaction was done according to the Stratagene Prime-It kit with 50ng DNA fragment. The labeled DNA waε purified with a Select-G-50 column. (5 Prime - 3 Prime, Inc. 5603 Arapahoe Road, Boulder, CO 80303). The filter waε then hybridized with radioactive labeled full length MIP-2 gene at 1,000,000 cpm/ml in 0.5 M NaP04, pH 7.4 and 7% SDS overnight at 65°C. After waεh twice at room temperature and twice at 60"C with 0.5 x SSC, 0.1% SDS, the filter waε then expoεed at -70°C overnight with an intenεifying εcreen. The meεεage RNA for NTT iε abundant in brain.
Numerous modificationε and variationε of the preεent invention are poεεible in light of the above teachingε and, therefore, within the εcope of the appended claimε, the invention may be practiced otherwiεe than as particularly described.
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: LI, ET AL.
(ii) TITLE OF INVENTION: Neurotransmitter Transporter
(iii) NUMBER OF SEQUENCES: 2
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: CARELLA, BYRNE, BAIN, GILFILLAN,
CECCHI, STEWART S* OLSTEIN
(B) STREET: 6 BECKER FARM ROAD
(C) CITY: ROSELAND
(D) STATE: NEW JERSEY
(E) COUNTRY: USA
(F) ZIP: 07068
(V) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: 3.5 INCH DISKETTE
(B) COMPUTER: IBM PS/2
(C) OPERATING SYSTEM: MS-DOS
(D) SOFTWARE: WORD PERFECT 5.1
(Vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE: SUBMITTED HEREWITH
(C) CLASSIFICATION:
(Vii) PRIOR APPLICATION DATA
(A) APPLICATION NUMBER:
(B) FILING DATE:
(viii) ATTORNEY/AGENT INFORMATION: (A) NAME: FERRARO, GREGORY D.
(B) REGISTRATION NUMBER: 36,134
(C) REFERENCE/DOCKET NUMBER: 325800-118
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 201-994-1700
(B) TELEFAX: 201-994-1744
(2) INFORMATION FOR SEQ ID NO:l:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 2,486 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:
CGGAGGCAGG GAGTGAGGAG CGAGCGGAGT CGCGTGCGCC GGCGCGAGCT CCGGGTCGCC 60
CCAGCCCCAG CCGGGGGCCT GTGGCGGGGG AGGAGCTGTG CGTCCGCGAC CCGTCGGGA 120
TCGCAGCTGC TCGGCCGGAG TGCACGGGCC GAGTCTGCGC GACTACCCAC GCGTGACAGG 180
TCCCTGAATG AGAAGGAGCT GACAGCAGCT GAATTCCATC TTCTCTGTGT GCTGGGGAGC 240
AGGGCTACAC GGCCCAGGTG GCATCAATGC CGAAGAACAG CAAAGTGACC CAGCGTGAGC 300
ACAGCAGTGA GCATGTCACT GAGTCCGTGG CCGACCTGCT GGCCCTCGAG GAGCCTGTGG 360
ACTATAAGCA GAGTGTACTG AATGTGGCTG GTGAGGCAGG CGGCAAGCAG AAGGCGGTGG 420
AGGAGGAGCT GGATGCAGAG GACCGGCCGG CCTGGAACAG TAAGCTGCAG TACATCCTGG 480
CCCAGATTGG CTTCTCTGTG GGCCTCGGCA ACATCTGGAG GTTCCCCTAC CTGTGCCAGA 540
AAAATGGAGG AGGTGCTTAC CTGGTGCCCT ACCTGGTGCT GCTGATCATC ATCGGGATCC 600
CCCTCTTCTT CCTGGAGCTG GCTGTGGGTC AGAGGATCCG CCGCGGAAGC ATCGGTGTGT 660
GGCACTATAT ATGTCCCCGC CTGGGGGGGA TCGGCTTCTC CAGCTGCATA GTCTGTCTCT 720
TTGTGGGGCT GTATTATAAT GTGATCATCG GGTGGAGCAT CTTCTATTTC TTCAAGTCCT 780
TCCAGTACCC GCTGCCCTGG AGTGAATGTC CTGTCGTCAG GAATGGGAGC GTCGCAGTGG 840
TGGAGGCAGA GTGTGAAAAG AGCTCAGCCA CTACCTACTT CTGGTACCGA GAGGCTTTGG 900
ACATCTCTGA CTCCATCTCG GAGAGTGGGG GCCTCAACTG GAAGATGACC CTGTGCCTCC 960
TCGTGGTCTG GAGCATCGGG GGGATGGCTG TCGGTAAGGG CATCCAGTCC TCGGGGAAGG 1020
TGATGTATTT CAGCTCCCTC TTCCCCTACG TGGTGCTGGC CTGCTTCCTG GTCCGGGGGT 1080
TGTTGTTGCG AGGGGCAGTT GATGGCATCC TACACATGTT CACTCCCAAG CTGGTCAAGA 1140 TGCTGGACCC CCAGGTGTGG CGGGAGGTAG CTACCCAGGT CTTCTTTGGC TTGGGTCTGG 1200
GCTTTGGTGG TGTCATTGTC TTCTCCAGTT ACAATAAGCA GGACAACAAC TGCCACTTCG 1260
ATGGCGCCCT GGTGTCCTTC ATCAACTTCT TCACGTCAGT GTTGGCCACC CTCGTGGTGT 1320
TTGTTGTTTT GGGCTTCAAG GCCAACATCA TGAATGAGAA GTGTGTGGTC GAGAATGCTG 1380
AGAAAATCCT AGGGTACCTT AACACCAACG TCCTGAGCCG GGACCTCATC CCACCCCACG 1440
TCAACTTCTC CCACCTGACC ACAAAGGACT ACATGGAGAT GGACAATGTC ATCATGACCG 1500
TGAAGGAGGA CCAGTTCTCA GCCCTGGGCC TTGACCCCTG CCTTCTGGAG GACGAGCTGG 1560
ACAAGTCCGT GCAGGGCACA GGCCTGGCCT TCATCGCCTT CACTGAGGCC ATGACGCACT 1620
TCCCCACCTC CCCGTTCTGG TCCGTCATGT TCTTCTTGAT GCTTATCAAC CTGGGCCTGG 1680
GCAGCATGAT CGGGACCATG GCAGGCATCA CCACGCCCAT CATCGACACC TCCAAGGTGC 1740
CCAAGGAGAT GTTCACAGTG GGCTGCTGTG TCTTTACATT CCTCGTGGGA CTGTTGTTCG 1800
TCCAGCGCTC CGGAAACTAC TTTGTCACCA TGTTCGATGA CTACTCAGCC ACGCTGCCAC 1860
TCACTCTCAT CGTCATCCTT GAGAACATCG CTGTGGCCTG GATTTATGGA CCCAAGAAGT 1920
TCATGCAGGA GCTGACGGAG ATGCTGGGCT TCCGCCCCTA CCGCTTCTAT TTCTACATGT 1980
GGAAGTTCGT GTCTCCACTA TGCATGGCTG TGCTCACCAC AGCCAGCATC ATCCAGCTGG 2040
GGGTCACGCC CCCGGCCTAC AGCGCCTGGA TCAAGGAGGA GGCTGCCGAG CGCTACCTGT 2100
ATTTCCCCAA CTGGCCCATG GCACTCCTGA TCACCCTCAT CGTCGTGGCG ACGCTGCCCA 2160
TCCCTGTGGT GTTCGTCCTG CGGCACTTCC ACCTGCTCTC TGATGGCTCC AACACCCTCT 2220
CCGTGTCCTA CAAGAAGGCC CGCATGATGA AGGACATCTC CAACCTGGAG GAGAACGATG 2280
AGACCCGCTT CATCCTCAGC AAGGTGCCCA GTGAGGCACC TTCCCCCATG CCCACTCACC 2340
GTTCCTATCT GGGGCCCGGC AGCACATCAC CCCTGGAGAC CAGCTGGAAC CCCAATGGAC 2400
CCTATGGGCG CGGCTACCTG CTGGCCAGCA CCCCTGAGTC TGAGCTGTGA CCACTGCCCA 2460
AGCCCATGCC CGCTCTCCCC CCACCG 2486
(2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 727 AMINO ACIDS
(B) TYPE: AMINO ACID
(C) STRANDEDNESS:
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: PROTEIN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
Met Pro Lyε Aεn Ser Lyε Val Thr Gin Arg Glu Hiε Ser Ser Glu
5 10 15
His Val Thr Glu Ser Val Ala Asp Leu Leu Ala Leu Glu Glu Pro
20 25 30 Val Asp Tyr Lyε Gin Ser Val Leu Aεn Val Ala Gly Glu Ala Gly
35 40 45
Gly Lyε Gin Lyε Ala Val Glu Glu Glu Leu Aεp Ala Glu Aεp Arg
50 55 60
Pro Ala Trp Aεn Ser Lyε Leu Gin Tyr lie Leu Ala Gin lie Gly
65 70 75
Phe Ser Val Gly Leu Gly Asn lie Trp Arg Phe Pro Tyr Leu Cys
80 85 90
Gin Lys Aεn Gly Gly Gly Ala Tyr Lys Val Pro Tyr Leu Val Leu
95 100 105
Leu lie lie lie Gly lie Pro Leu Phe Phe Leu Glu Leu Ala Val
110 115 120
Gly Gin Arg lie Arg Arg Gly Ser lie Gly Val Trp His Tyr lie
125 130 135
Cys Pro Arg Leu Gly Gly lie Gly Phe Ser Ser Cys lie Val Cys
140 145 150
Leu Phe Val Gly Leu Tyr Tyr Aεn Val lie lie Gly Trp Ser lie
155 160 165
Phe Tyr Phe Phe Lyε Ser Phe Gin Tyr Pro Leu Pro Trp Ser Glu
170 175 180
Cys Pro Val Val Arg Asn Glu Ser Val Ala Val Val Glu Ala Glu
185 190 195
Cyε Glu Lyε Ser Ser Ala Thr Thr Tyr Phe Trp Tyr Arg Glu Ala
200 205 210
Leu Aεp lie Ser Aεp Ser lie Ser Glu Ser Gly Gly Leu Asn Trp
215 220 225
Lys Met Thr Leu Cys Leu Leu Val Val Trp Ser lie Gly Gly Met
230 235 240
Ala Val Gly Lys Gly lie Gin Ser Ser Gly Lyε Val Met Tyr Phe
245 250 255
Ser Ser Leu Phe Pro Tyr Val Val Leu Ala Cyε Phe Leu Val Arg
260 265 270
Gly Leu Leu Leu Arg Gly Ala Val Aεp Gly lie Leu His Met Phe
275 280 285
Thr Pro Lys Leu Val Lys Met Leu Asp Pro Gin Val Trp Arg Glu
290 295 300 Val Ala Thr Gin Val Phe Phe Gly Leu Gly Leu Gly Phe Gly Gly
305 310 315 Val lie Val Phe Ser Ser Tyr Aεn Lyε Gin Asp Asn Aεn Cyε Hiε
320 325 330
Phe Aεp Gly Ala Leu Val Ser Phe lie Aεn Phe Phe Thr Ser Val
335 340 345
Leu Ala Thr Leu Val Val Phe Val Val Leu Gly Phe Lyε Ala Asn
350 355 360 lie Met Asn Glu Lys Cyε Val Val Glu Aεn Ala Glu Lyε lie Leu
365 370 375
Gly Tyr Leu Aεn Thr Aεn Val Leu Ser Arg Aεp Leu lie Pro Pro
380 385 390
Hiε Val Aεn Phe Ser Hiε Leu Thr Thr Lyε Aεp Tyr Met Glu Met
395 400 405
Aεp Aεn Val lie Met Thr Val Lyε Glu Aεp Gin Phe Ser Ala Leu
410 415 420
Gly Leu Aεp Pro Cyε Leu Leu Glu Asp Glu Leu Asp Lys Ser Val
425 430 435
Gin Gly Thr Gly Leu Ala Phe He Ala Phe Thr Glu Ala Met Thr
440 445 450
His Phe Pro Thr Ser Pro Phe Trp Ser Val Met Phe Phe Leu Met
455 460 465
Leu He Aεn Leu Gly Leu Gly Ser Met He Gly Thr Met Ala Gly
470 475 480
He Thr Thr Pro He He Aεp Thr Ser Lyε Val Pro Lyε Glu Met
485 490 495
Phe Thr Val Gly Cyε Cys Val Phe Thr Phe Leu Val Gly Leu Leu
500 505 510
Phe Val Gin Arg Ser Gly Asn Tyr Phe Val Thr Met Phe Asp Aεp
515 520 525
Tyr Ser Ala Thr Leu Pro Leu Thr Leu He Val He Leu Glu Aεn
530 535 540
He Ala Val Ala Trp He Tyr Gly Pro Lyε Lys Phe Met Gin Glu
545 550 555 Leu Thr Glu Met Leu Gly Phe Arg Pro Tyr Arg Phe Tyr Phe Tyr
560 565 570 Met Trp Lyε Phe Val Ser Pro Leu Cyε Met Ala Val Leu Thr Thr
575 580 585
Ala Ser He He Gin Leu Gly Val Thr Pro Pro Ala Tyr Ser Ala
590 595 600
Trp He Lys Glu Glu Ala Ala Glu Arg Tyr Leu Tyr Phe Pro Asn
605 610 615
Trp Pro Met Ala Leu Leu He Thr Leu He Val Val Ala Thr Leu
620 625 630
Pro He Pro Val Val Phe Val Leu Arg His Phe Hiε Leu Leu Ser
635 640 645
Aεp Gly Ser Aεn Thr Leu Ser Val Ser Tyr Lyε Lyε Ala Arg Met
650 655 660
Met Lyε Aεp He Ser Aεn Leu Glu Glu Asn Aεp Glu Thr Arg Phe
665 670 675
He Leu Ser Lys Val Pro Ser Glu Ala Pro Ser Pro Met Pro Thr
680 685 690
His Arg Ser Tyr Leu Gly Pro Gly Ser Thr Ser Pro Leu Glu Thr
695 700 705
Ser Trp Asn Pro Aεn Gly Pro Tyr Gly Arg Gly Tyr Leu Leu Ala
710 715 720
Ser Thr Pro Glu Ser Glu Leu
725

Claims

WHAT IS CLAIMED IS:
1. An isolated polynucleotide selected from the group consiεting of:
(a) a polynucleotide encoding an NTT polypeptide having the deduced amino acid εequence of Figure 1 or a fragment, analog or derivative of εaid polypeptide;
(b) a polynucleotide encoding an NTT polypeptide having the amino acid sequence encoded by the cDNA contained in ATCC Deposit No. 75713 or a fragment, analog or derivative of said polypeptide.
2. The polynucleotide of Claim 1 wherein the polynucleotide is DNA.
3. The polynucleotide of Claim 1 wherein the polynucleotide is RNA.
4. The polynucleotide of Claim 1 wherein the polynucleotide is genomic DNA.
5. The polynucleotide of Claim 2 wherein said polynucleotide encodeε an NTT having the deduced amino acid εequence of Figure 1.
6. The polynucleotide of Claim 2 wherein εaid polynucleotide encodes an NTT polypeptide encoded by the cDNA of ATCC Deposit No. 75713.
7. The polynucleotide of Claim 1 having the coding sequence for NTT as εhown in Figure 1.
8. The polynucleotide of Claim 2 having the coding εequence for NTT deposited aε ATCC Deposit No. 75713.
9. A vector containing the DNA of Claim 2.
10. A host cell genetically engineered with the vector of Claim 9.
11. A process for producing a polypeptide comprising: expresεing from the host cell of Claim 10 the polypeptide encoded by said DNA.
12. A procesε for producing cellε capable of expreεεing a polypeptide co priεing genetically engineering cellε with the vector of Claim 9.
13. An iεolated DNA hybridizable to the DNA of Claim 2 and encoding a polypeptide having NTT activity.
14. A polypeptide εelected from the group conεiεting of (i) an NTT polypeptide having the deduced amino acid εequence of Figure 1 and fragments, analogs and derivativeε thereof and (ii) an NTT polypeptide encoded by the cDNA of ATCC Depoεit No. 75713 and fragmentε, analogs and derivatives of εaid polypeptide.
15. The polypeptide of Claim 14 wherein the polypeptide iε NTT having the deduced amino acid εequence of Figure 1.
16. An antibody againεt the polypeptide of claim 14.
17. An antagoniεt/inhibitor againεt the polypeptide of claim 14.
18. An agoniεt for the polypeptide of claim 14.
19. A method for the treatment of a patient having need of an agoniεt to NTT compriεing: administering to the patient a therapeutically effective amount of the agonist of claim 18.
20. A method for the treatment of a patient having need to inhibit NTT compriεing: adminiεtering to the patient a therapeutically effective amount of the antagoniεt/inhibitor of Claim 17.
21. A pharmaceutical compoεition compriεing the polypeptide of Claim 14 and a pharmaceutically acceptable carrier.
22. A method of adminiεtering a therapeutically effective amount of the NTT polypeptide compriεing providing to a patient DNA encoding said polypeptide and expressing said polypeptide in vivo .
23. A method of εcreening compoundε to identify compoundε which interact with NTT which compriεeε: tranεfor ing mammalian cellε with a vector containing a polynucleotide encoding NTT; labelling the natural neurotranεmitter of NTT; incubating the cellε, the labelled NTT and a compound; determining the effectiveneεε of tranεlocation of the neurotranεmitter into the cellε by NTT; and identifying the compound aε being either an antagoniεt or an agoniεt to NTT.
PCT/US1994/005363 1994-05-16 1994-05-16 Neurotransmitter transporter WO1995031539A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
JP7529590A JPH10500299A (en) 1994-05-16 1994-05-16 Neurotransmitter transporter
AU69125/94A AU6912594A (en) 1994-05-16 1994-05-16 Neurotransmitter transporter
PCT/US1994/005363 WO1995031539A1 (en) 1994-05-16 1994-05-16 Neurotransmitter transporter
US08/424,424 US5759854A (en) 1994-05-16 1994-05-16 Neurotransmitter transporter
EP94917383A EP0759978A4 (en) 1994-05-16 1994-05-16 Neurotransmitter transporter
US09/923,444 US20020015980A1 (en) 1994-05-16 2001-08-08 Neurotransmitter transporter

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/US1994/005363 WO1995031539A1 (en) 1994-05-16 1994-05-16 Neurotransmitter transporter

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US08/424,424 Continuation-In-Part US5759854A (en) 1994-05-16 1994-05-16 Neurotransmitter transporter

Publications (1)

Publication Number Publication Date
WO1995031539A1 true WO1995031539A1 (en) 1995-11-23

Family

ID=22242563

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1994/005363 WO1995031539A1 (en) 1994-05-16 1994-05-16 Neurotransmitter transporter

Country Status (4)

Country Link
EP (1) EP0759978A4 (en)
JP (1) JPH10500299A (en)
AU (1) AU6912594A (en)
WO (1) WO1995031539A1 (en)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997048724A2 (en) * 1996-02-21 1997-12-24 Nps Pharmaceuticals, Inc. Human metabotropic glutamate receptor
EP0881290A2 (en) * 1997-05-27 1998-12-02 Smithkline Beecham Plc Neurotransmitter transporter HPDDV78
WO2001019854A2 (en) * 1999-09-15 2001-03-22 Smithkline Beecham P.L.C. Neurotransmitter transporter
WO2001053496A1 (en) * 2000-01-21 2001-07-26 Biodoor Gene Technology Ltd. Shanghai Novel polypeptide---human sodium neuro:transmitter cotransporter protein 8,43 and polynucleotide encoding it
GB2365432A (en) * 2000-05-19 2002-02-20 Glaxo Group Ltd Neurotransmitter transporter polypeptide
WO2002020757A2 (en) * 2000-09-05 2002-03-14 Applera Corporation Isolated human transporter proteins, nucleic acid molecules encoding human transporter proteins, and uses thereof
WO2002029049A2 (en) * 2000-10-05 2002-04-11 Bayer Aktiengesellschaft Regulation of human sodium-dependent monoamine transporter
WO2002029048A2 (en) * 2000-10-05 2002-04-11 Bayer Aktiengesellschaft Regulation of human sodium-dependent neurotransmitter transporter
US7033790B2 (en) 2001-04-03 2006-04-25 Curagen Corporation Proteins and nucleic acids encoding same

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
BIOCHIMICA ET BIOPHYSICA ACTA, Volume 1154, Number 2, VAN WINKLE, "Endogenous Amino Acid Transport Systems and Expression of Mammalian Amino Acid Transport Proteins in Xenopus Oocytes", pages 157-172. *
BIOESSAYS, Volume 15, Number 5, issued May 1993, CLARK et al., "Amino Acid Neurotransmitter Transporters: Structure, Function and Molecular Diversity", pages 323-332. *
FEBS LETTERS, Volume 315, Number 2, issued January 1993, LIU et al., "A Rat Brain cDNA Encoding the Neurotransmitter Transporter with an Unusual Structure", pages 114-118. *
JOURNAL OF BIOLOGICAL CHEMISTRY, Volume 267, Number 29, issued 15 October 1992, BORDEN et al., "Molecular Heterogeneity of the Gamma-Aminobutyric Acid (GABA) Transport System", pages 21098-21104. *
JOURNAL OF NEUROCHEMISTRY, Volume 62, Number 2, issued 1994, EL MESTIKAWY et al., "Characterization of an Atypical Member of the Na+/CI-Dependent Transporter Family: Chromosomal Localization and Distribution in GABAergic and Glutamatergic Neurons in the Rat Brain", pages 445-455. *
MOLECULAR BRAIN RESEARCH, Volume 16, issued 1992, UHL et al., "Neurotransmitter Transporter Family cDNAs in a Rat Midbrain Library: 'Orphan Transporters' Suggest Sizable Structural Variations", pages 353-359. *
See also references of EP0759978A4 *
TRENDS IN PHARMACOLOGICAL SCIENCES, Volume 13, issued December 1992, UHL et al., "Transporter Explosion: Update On Uptake", pages 421-425. *

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997048724A2 (en) * 1996-02-21 1997-12-24 Nps Pharmaceuticals, Inc. Human metabotropic glutamate receptor
WO1997048724A3 (en) * 1996-02-21 1998-03-26 Nps Pharma Inc Human metabotropic glutamate receptor
EP0881290A2 (en) * 1997-05-27 1998-12-02 Smithkline Beecham Plc Neurotransmitter transporter HPDDV78
EP0881290A3 (en) * 1997-05-27 1999-12-22 Smithkline Beecham Plc Neurotransmitter transporter HPDDV78
WO2001019854A3 (en) * 1999-09-15 2001-08-02 Smithkline Beecham Plc Neurotransmitter transporter
WO2001019854A2 (en) * 1999-09-15 2001-03-22 Smithkline Beecham P.L.C. Neurotransmitter transporter
WO2001053496A1 (en) * 2000-01-21 2001-07-26 Biodoor Gene Technology Ltd. Shanghai Novel polypeptide---human sodium neuro:transmitter cotransporter protein 8,43 and polynucleotide encoding it
GB2365432A (en) * 2000-05-19 2002-02-20 Glaxo Group Ltd Neurotransmitter transporter polypeptide
WO2002020757A2 (en) * 2000-09-05 2002-03-14 Applera Corporation Isolated human transporter proteins, nucleic acid molecules encoding human transporter proteins, and uses thereof
WO2002020757A3 (en) * 2000-09-05 2003-03-13 Applera Corp Isolated human transporter proteins, nucleic acid molecules encoding human transporter proteins, and uses thereof
WO2002029049A2 (en) * 2000-10-05 2002-04-11 Bayer Aktiengesellschaft Regulation of human sodium-dependent monoamine transporter
WO2002029048A2 (en) * 2000-10-05 2002-04-11 Bayer Aktiengesellschaft Regulation of human sodium-dependent neurotransmitter transporter
WO2002029048A3 (en) * 2000-10-05 2002-11-14 Bayer Ag Regulation of human sodium-dependent neurotransmitter transporter
WO2002029049A3 (en) * 2000-10-05 2002-11-28 Bayer Ag Regulation of human sodium-dependent monoamine transporter
US7033790B2 (en) 2001-04-03 2006-04-25 Curagen Corporation Proteins and nucleic acids encoding same

Also Published As

Publication number Publication date
JPH10500299A (en) 1998-01-13
EP0759978A4 (en) 1997-12-29
EP0759978A1 (en) 1997-03-05
AU6912594A (en) 1995-12-05

Similar Documents

Publication Publication Date Title
AU696764C (en) Vascular endothelial growth factor 2
EP0822984A1 (en) Human tumor necrosis factor receptors
EP0735818A1 (en) MACROPHAGE INFLAMMATORY PROTEINS-3, -4 AND -1 Sg(g)
WO1995019985A1 (en) Haemopoietic maturation factor
WO1996039515A9 (en) Human vascular endothelial growth factor 2
WO1995024466A1 (en) Transforming growth factor alpha h1
EP0792278A1 (en) Tumor necrosis factor-gamma
WO1996013603A1 (en) INTERLEUKIN-1 β CONVERTING ENZYME LIKE APOPTOSIS PROTEASE-3 AND 4
WO1995024414A1 (en) Fibroblast growth factor-10
WO1996028546A1 (en) Human tumor necrosis factor receptor
WO1996001896A1 (en) Connective tissue growth factor-2
EP0770086A1 (en) Macrophage migration inhibitory factor-3
EP0759978A1 (en) Neurotransmitter transporter
EP0750626A1 (en) Corpuscles of stannius protein, stanniocalcin
EP0770141A1 (en) INTERLEUKIN-1 $g(b) CONVERTING ENZYME LIKE APOPTOSIS PROTEASE-1 AND 2
EP0764204A1 (en) HUMAN OXALYL-CoA DECARBOXYLASE
WO1995024474A1 (en) Bone morphogenic protein-10
WO1995031537A9 (en) HUMAN OXALYL-CoA DECARBOXYLASE
US5759854A (en) Neurotransmitter transporter
WO1996003415A1 (en) Human potassium channel 1 and 2 proteins
WO1996006862A1 (en) Gabaa receptor epsilon subunit
EP0787149A1 (en) POLYNUCLEOTIDE ENCODING C5a RECEPTOR
AU684539C (en) Macrophage inflammatory proteins-3, -4 and -1 Gamma
WO1996011259A1 (en) TGF-β1, ACTIVIN RECEPTORS 1 AND 3
WO1996015222A1 (en) HUMAN MutT2

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 08424424

Country of ref document: US

AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA CN JP KR NZ US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 1994917383

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1994917383

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: CA

WWW Wipo information: withdrawn in national office

Ref document number: 1994917383

Country of ref document: EP