WO1995009235A1 - Modeles de souris immunodeficientes pour analyser la pathogenese de maladies humaines et l'efficacite et la toxicite des traitements utilises - Google Patents

Modeles de souris immunodeficientes pour analyser la pathogenese de maladies humaines et l'efficacite et la toxicite des traitements utilises Download PDF

Info

Publication number
WO1995009235A1
WO1995009235A1 PCT/US1994/010957 US9410957W WO9509235A1 WO 1995009235 A1 WO1995009235 A1 WO 1995009235A1 US 9410957 W US9410957 W US 9410957W WO 9509235 A1 WO9509235 A1 WO 9509235A1
Authority
WO
WIPO (PCT)
Prior art keywords
human
cells
mouse
hiv
mice
Prior art date
Application number
PCT/US1994/010957
Other languages
English (en)
Other versions
WO1995009235A9 (fr
Inventor
Harris Goldstein
Tobias R. Kollmann
Original Assignee
Albert Einstein College Of Medicine Of Yeshiva University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Albert Einstein College Of Medicine Of Yeshiva University filed Critical Albert Einstein College Of Medicine Of Yeshiva University
Publication of WO1995009235A1 publication Critical patent/WO1995009235A1/fr
Publication of WO1995009235A9 publication Critical patent/WO1995009235A9/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0271—Chimeric vertebrates, e.g. comprising exogenous cells

Definitions

  • This invention relates to immunodeficient mice transplanted with human tissue and/or engrafted with human cells and methods of producing and utilizing the transplanted animals as models for the pathogenesis of human disease, such as AIDS.
  • This invention is directed to the development of a mouse chimeric for both human and mouse hematopoietic systems.
  • the chimeric mouse of this invention has human fetal tissue and/or cells transplanted or engrafted therein which results in the re-population of the mouse peripheral lymphoid compartment with a sufficient number of human T-cells, human monocytes or combination thereof to support HIV infection following intraperitoneal inoculation of HIV-1 into the mouse.
  • the chimeric mouse of this invention is capable of tolerating human tissue, which allows for the maturation and function of implanted human tissues and/or cells.
  • HIV human immunodeficiency virus
  • Immune deficient mice include scid, bnx, Rag-1 and Rag-2 mice. Homozygous scid mice (scid/ scid) were first identified fortuitously by Bosma in breeding experiments with CB-17 mice to develop i munoglobulin heavy chain mouse strains. Bosma, et al. (1983), Nature 301:527-530. Over the years a large number of experiments have indicated that the defect in immunoglobulin production is inherited and due to a mutation in a gene carried on mouse chromosome 16. Bosma, et al. (1991), Ann. Rev. Immunol. 9:323-350.
  • the scid gene plays an important role in the lymphoid differentiation program and mutations in the gene prevent gene rearrangement and the subsequent production of mature T and B-cells.
  • All other hematopoietic lineages including natural killer (NK) cells and macrophages are normal.
  • the mice have a very small thymus containing a few immature thymocytes.
  • the action of this gene product is not restricted to normal lymphoid development since scid mice have a generalized radiation repair defect that renders the animals at least two times more sensitive to the effects of ⁇ - radiation. Fulop, et al. (1990), Nature 347:479-482;
  • cytokines like interleukin- 2 (IL-2) and interferon (IFN) which are easily stimulated by bacterial or viral infection. Because their hematopoietic microenvironment is normal these mice are easily reconstituted with syngeneic cells with sublethal radiation conditioning. Fulop, et al. (1986), J. Immunol. 136:4438-4443. As a result they have provided important models for studying many aspects of lymphoid differentiation. Bosma, et al. Ibid. .
  • the immunodeficiency of homozygous Rag-1 and Rag-2 mice is similar to that of scid mice in that the homozygous Rag-1 and Rag-2 mutations interrupt genes involved in both T- and B- cell development and such mutations result in interference with maturation of both B- and T-cells.
  • Momberts, et al., (1992), Cell, 68:869-877 produced mice homozygous for a mutation in the Rag-1 gene, which is thought to play a role in the regulation or catalysis of V(D)J recombination.
  • the Rag-1 deficient mice do not have mature B- or T-lymphocytes, presumably as a result of loss of a common reco binase that is active in precursors of both B- and T-cells.
  • mice homozygous for the Rag-2 mutation fail to generate mature T- or B-lymphocytes as a result of a complete lack of ability to initiate the V(D)J recombination process, leading to a severe combined immune deficient phenotype. Shinkai, et al. (1992), Cell 8_8.855-867.
  • the etiology of the congenital immunodeficiency of bnx mice differs from that of scid and Rag-1 and Rag-2 mice.
  • the bnx strain was derived by crossing congenitally athymic nude mice with NK cell-deficient beige mice and LAK cell-deficient xid mice.
  • bnx mice also have a severe Ig deficiency due to the combined effect of a marked decrease in the numbers of helper T-cells and in the number of T-cell-independent B-cells.
  • human T-cells could initially be detected at a level of about 10% of the mononuclear cells in the peripheral circulation beginning 4 weeks after IV injection of fetal liver cells (10 7 cells) . This level was maintained for 6 weeks after which no human cells could be detected. The rapid increase and then decline of T-cells implied that engraftment was occurring as a wave of T-cell differentiation.
  • the human fetal thymus was implanted several weeks prior to the injection of fetal liver cells, presumably to allow for vascularization. After injection of fetal liver the implanted thymus grew in size and developed many aspects of the normal architecture of a normal age-matched fetal thymus. By using different HLA typed donors for the thymus and fetal liver, evidence was presented suggesting that the fetal liver cells homed to the thymus, differentiated, and passed into the peripheral circulation.
  • SCID-hu constructs are made by surgical implantation of interactive human organ systems into the immunodeficient CB-17 scid mouse.
  • One goal of any particular SCID-hu construct has been to provide an animal system that allows direct observation of normal and abnormal functions within the transplanted human tissue as a model of the same functions within intact human organs.
  • SCID-hu mice transplanted with human liver or thymus tissue have human T-cells been maintained in significant numbers in the peripheral blood of the animals or in mouse lymphoid and hematopoietic organs, such as the lymph nodes, spleen or bone marrow. Consequently, previous SCID-hu mice have not been useful for peripheral blood studies in such diseases as AIDS, for example.
  • mice have been successfully engrafted with human bone marrow by infusion of human bone marrow following sub-lethal irradiation of the mice (Dick, et al. (1991), Immunol. Rev., 124:25-43; Kamel-Reid, et al. (1988), Science, 242:1706-1709).
  • Post-transplant treatment with human cytokines significantly increased bone marrow engraftment of irradiated scid mice with human myeloid and erythroid progenitors, as well as engraftment with B-cells after infusion with human bone marrow cells (Lapid ⁇ t, et al. (1992), Science, 255:1137-1141).
  • the present invention provides a murine B-cell and T-cell deficient (BTCD) mouse chimeric for human B-cells and T-cells and having human T-cells and/or monocytes in its peripheral lymphoid compartment in sufficient quantity to enable HIV-1 infection, for example, following intraperitoneal inoculation of HIV-1 into the mouse.
  • BTCD murine B-cell and T-cell deficient
  • This invention also provides a chimeric mouse having and supporting a functional and viable human stromal microenvironment in which human hematopoietic cell maturation occurs.
  • This invention also provides a chimeric mouse having a high proportion of T-cells, B-cells and/or monocytes of human origin in its peripheral blood, spleen and lymph nodes.
  • This invention provides a chimeric mouse capable of expressing human cytokines.
  • This invention provides a method for constructing chimeric mice capable of being infected with HIV-1 via intraperitoneal inoculation of HIV-1. This invention also provides a method for assaying the in vivo dissemination of HIV-1.
  • This invention also provides a screening method for determining the efficacy of anti-HIV-1 drug, anti-HIV-1 immunotherapy or hematopoietic drug or treatment.
  • This invention provides a screening method for determining the toxicity of anti-HIV-1 drug, anti-HIV-1 therapy, hematopoietic drug or therapy or the efficacy of bone marrow transplantation.
  • This invention also provides a method of assessing the induction of the expression of human cytokines during disease progression in a chimeric mouse and during hematopoeisis.
  • This invention also provides a method for amplifying human bone marrow cells for transplantation in a human.
  • This invention provides a model for studying gene therapy in human stem and/or progenitor cells.
  • This invention also provides a method for generating human monoclonal antibodies.
  • the present invention is accomplished in connection with one aspect thereof by the construction of a chimeric mouse (hereinafter referred to as BTCD-hu2) having in its peripheral lymphoid compartment a sufficient number of human T-cells, monocytes or combination thereof which enables HIV-l infection of the mouse following intraperitoneal inoculation of HIV-l into the mouse.
  • BTCD-hu2 mouse has a proportion of T-cells of human origin in its peripheral blood in the range of from at least 5% to about 10%.
  • the BTCD-hu2 mouse has transplanted under each kidney capsule human fetal thymus tissue interspersed with human fetal liver tissue.
  • the BTCD-hu2 mouse is a BTCD-huCombo mouse (as hereinafter defined) .
  • the bone marrow of the BTCD-hu2 mouse contains a proportion of CD45+ cells in the range of from at least about 10% to about 40% and the mouse peripheral lymphoid compartment contains at least about 5% to about 40% CD45+ cells.
  • the BTCD-hu2 mouse also has human fetal spleen, intestine and lung tissues implanted therein.
  • a method of constructing BTCD-hu2 mice capable of being infected with HIV-l via intraperitoneal inoculation of HIV-l.
  • the method includes implanting alternating pieces of human fetal liver and human fetal thymus tissue under at least one kidney capsule of the mice.
  • a method of constructing BTCD-hu2 mice engrafted with human bone marrow cells includes sublethally irradiating T- cell and B-cell deficient mice and inoculating pre-cultured human cells obtained from fetal bone marrow into the irradiated mice.
  • the B-cell and T- cell deficient mice that are engrafted with human fetal bone marrow are BTCD-hu mice.
  • the method provides for the engraftment of precultured adherent cells.
  • a method for assaying the in vivo dissemination of HIV-l in a BTCD-hu2 mouse which includes the steps of a) inoculating a sufficient quantity of HIV-l into the peritoneal cavity of a BTCD-hu2 mouse to cause HIV-l infection and b) detecting HIV-l in a human implant or human graft of the BTCD-hu2 mouse and in the peripheral lymphoid compartment of the BTCD-hu2 mouse.
  • a screening method for determining the efficacy of an anti-HIV-1 drug or anti-HIV-1 therapy which includes the steps of a) administering to an HIV-l infected BTCD-hu2 mouse an anti-HIV- 1 drug or anti-HIV-1 therapy, b) assaying the peripheral lymphoid compartment of the HIV-l infected mouse or human fetal tissue implant for the presence of HIV-l and c) determining the efficacy of the drug or therapy on HIV-l infection in said mouse.
  • a screening method for determining the toxicity of an anti-HIV-1 drug or anti-HIV-1 therapy which comprises a) administering to an HIV-l infected BTCD-hu2 mouse an anti-HIV-1 drug or anti-HIV-1 therapy, and b) assaying the peripheral lymphoid compartment or human fetal tissue implant of the HIV-l infected BTCD-hu2 mouse for a change in the quantity or type of human T-cells, monocytes, or combination thereof and d) determining the toxicity of the drug or treatment.
  • a method of assessing the efficacy of bone marrow transplantation which includes the steps of engrafting a B- cell and T-cell deficient mouse with human bone marrow cells and determining the degree of engraftment of the mouse.
  • a method of amplifying human bone marrow cells prior to implantation of the bone marrow cells in a human patient which includes the steps of engrafting a BTCD-huBM (as hereinafter defined) or BTCD-huCombo (as hereinafter defined) mouse with human bone marrow cells obtained from the patient or a donor, allowing the mouse to recover for about six to eight weeks and recovering human bone marrow cells from the mouse.
  • a method for generating human monoclonal antibodies which includes the steps of a) inoculating a BTCD-hu2 mouse, having transplanted therein human fetal spleen tissue, human fetal lymph node tissue or a combination thereof, and containing human B-cells and antigen presenting cells with a sufficient amount of antigen to cause the mouse to generate antigen-specific antibodies, b) collecting B-cells from the peripheral blood of said mouse;
  • step (e) optionally, transforming B-cells from step (b) with Epstein Barr Virus; d) fusing the B-cells from step (b) or step (c) with a permissive myeloma cell line, to thereby produce a hybridoma; e) isolating antibody producing cells produced in step (d) ; and f) purifying monoclonal antibody produced by the antibody producing cells of step (e) .
  • BCD-hu2 mouse or mice
  • a mouse or mice deficient for murine B-cells and T- cells but which is chimeric for human B-cells, T-cells and/or monocytes.
  • SCID-hu mouse or mice
  • SCID-hu2 mouse which is genetically a SCID/SCID mouse (or mice) into which human fetal tissue has been implanted, resulting in a mouse having a sufficient number of human T-cells circulating in its peripheral lymphoid compartment to allow intraperitoneal inoculation of HIV-l and subsequent HIV-l infection of the mouse.
  • SCID-BM mouse (or mice) is used hereinafter to describe a BTCD-hu2 mouse (or mice) of this invention which is genetically a scid/scid mouse (or mice) having a sufficient number of human monocytes circulating in its peripheral ly phoid compartment to allow HIV-l infection by intraperitoneal inoculation of HIV-l.
  • peripheral lymphoid compartment includes the lymph nodes, spleen, peripheral blood and peritoneal exudate cells of an animal.
  • intraperitoneal inoculation means inoculation into the peritoneal cavity and excludes inoculation into the transplanted material within the intraperitoneal cavity.
  • TCID 50 is used herein to mean the lowest dilution of supernatant of an HIV-l tissue culture that is capable of infecting at least one half of appropriate quadruplicate tissue culture cells.
  • substantially contact means sufficient contact between at least two surfaces of implanted fetal tissue to provide an environment capable of sustaining implanted human fetal tissue in a BTCD-hu2 mouse during the natural life of the mouse. Contact between at least two surfaces is determined by the volume of tissue implanted per volume of kidney capsule.
  • Figure 1 is a series of immunofluorescence profiles which were obtained by three-color flow cytometry of lymphocytes isolated from the peripheral blood (A and B) , spleen (C and D) and lymph nodes (E and F) of SCID-hu mice.
  • Figures 1A, IB, 1C, ID, IE and IF reflect the profiles obtained from analysis of 6 SCID-hu mice.
  • Figure 2 shows the immunofluorescence profiles obtained by three-color flow cytometry of mononuclear cells isolated by peritoneal lavage from the peritoneal cavities of SCID-hu mice.
  • Figure 2A is the profile of the expression of human CD45+ and CD4+
  • Figure 2B is the profile of the expression of CD45+ and CD8+.
  • Figures 2A and 2B reflect the profiles obtained from analysis of 3 SCID-hu mice.
  • Figure 3 shows the results of immunofluorescence profiles obtained by three-color flow cytometry of pooled lymphocytes isolated from the peripheral blood, spleen and lymph nodes of SCID-hu mice analyzed for the expression of human CD4 (hatched boxes) , CD8 (solid bars) and the indicated TCR V/3 gene. The data are representative of that obtained from analysis of 3 SCID-hu mice.
  • Figure 4 is an autoradiograph of a Southern blot of PCR amplified DNA or cDNA.
  • HIV-l gag DNA was detected in SCID-hu mice infected with HIV-l by intraimplant (Fig. 4A) or by intraperitoneal inoculation (Fig. 4B) .
  • HIV-l gag RNA was detected after intraimplant (Fig. 4C) or intraperitoneal inoculation (Fig. 4D)
  • HIV tat/rev mRNA was detected after intraimplant (Fig. 4E) and intraperitoneal inoculation (Fig. 4F) .
  • Figure 5 is an autoradiograph of a Southern blot of PCR amplified DNA from peritoneal exudate cells obtained from the peritoneal cavity of SCID-hu mice following HIV-l infection one week (lane 1) or four weeks (lane 2) after intraperitoneal injection and probed with SK19.
  • Figure 6 is a photograph of ethidium bromide stained 1.5% NuSieve/0.5% agarose gels showing the amplification products of reverse transcriptase-polymerase chain reaction (RT-PCR) using various cytokine specific primers from various tissues of SCID-hu mice following HIV-l intraperitoneal inoculation.
  • RT-PCR reverse transcriptase-polymerase chain reaction
  • Figure 7 is a series of bar graphs showing human cytokine expression in SCID-hu mice and HIV-l infected SCID-hu mice.
  • Figure 8 is a bar graph showing the percentage of human CD45+ cells in the bone marrow, lymph nodes, spleen and peripheral blood of SCID-huBM mice engrafted with uncultured or cultured human fetal bone marrow (HFBM) cells.
  • Figure 9 is a bar graph showing the effect of transplantation of adherent HFBM cells versus non-adherent HFBM cells on engraftment of irradiated SCID mice. The mean percentage of cells expressing human CD45+ are shown.
  • Figure 10 is a bar graph showing the temporal distribution of HFBM cells injected into irradiated SCID mice.
  • the presence of human CD45+CD34+CD10- was assessed in the peripheral blood and bone marrow of BTCD-huBM mice by three- color flow cytometry and the data are expressed as the mean percentage of mice analyzed.
  • Figures 11A, 11B and 11C, 11D, HE, 11F, 11G 11H and HI are dot histograms of flow cytometric analysis of cells isolated from the bone marrow of a SCID mouse (HA, 11D, 11G) , a normal human fetus (11B, HE and HH) and a SCID-huBM mouse (HC, HF and HI) for the expression of human CD45 (HA, HB and HC) , CD34 (HD, HE and HF) and slgM (HG, HH, HI).
  • Figures 12A, 12B, 12C and 12D are immunofluorescence profiles obtained by three-color flow cytometry of pure and mixed populations of human PBMC and SCID mouse bone marrow cells using anti-human CD45.
  • Figures 13A, 13B and 13C are graphs showing the percentage of human CD45+, CD45+CD34+CD10- CD45+CD34+CD10+, CD45+CD34-CD10+, CD45+CD20+sIgM and CD45+CD20+CDsIgM present in the (A) bone marrow, (B) spleen and (C) peripheral blood of individual BTCD-huBM mice. The mean percentage for each group is represented by a solid bar.
  • Figure 14 is a graph showing the percentage of human
  • FIGS. 15A and 15B are autoradiographs of the RT-PCR amplification products of RNA extracted from human fetal bone marrow cells (Fig. 15A) and mouse spleen cells (Fig. 15B) using species-specific primer pairs.
  • Figure 16 is a Western blot showing HIV-l protein recognition by human IgG antibodies present in the serum of an HIV-l infected BTCD-hu mouse also implanted with human spleen tissue.
  • human/mouse chimerae are created by transplanting congenitally immunodeficient mice lacking both B-cells and T-cells (BTCD mice) , such as C.B-17 scid/ scid mice, bnx mice, RAG-1 deficient or Rag-2 deficient mice with fetal human tissue and/or cells.
  • BTCD mice congenitally immunodeficient mice lacking both B-cells and T-cells
  • the recipient animals lack functional B-cells and T-cells but are tolerant for xenografts.
  • the resulting chimeric mice are referred to herein as BTCD-hu2 mice.
  • the BTCD-hu2 mouse is genetically deficient for murine B- cells and T-cells.
  • the mouse is made chimeric for human immune system cells by transplanting human cells and/or tissue, such as, for example, human fetal thymus and fetal liver tissue, precultured or fresh human fetal bone marrow cells, or combinations thereof into the mouse.
  • human cells and/or tissue such as, for example, human fetal thymus and fetal liver tissue, precultured or fresh human fetal bone marrow cells, or combinations thereof into the mouse.
  • the BTCD-hu2 mouse is capable of sustaining the transplanted human tissue throughout the life of the mouse.
  • the BTCD-hu2 mouse also contains a sufficient number of circulating HIV-l infectable cells to allow HIV-l infection of the transplanted human tissue and/or cells following peripheral inoculation of the mouse with HIV-l.
  • the HIV-l infectable cells present in the BTCD-hu2 mouse include human T-cells, and/or monocytes, the latter of which include circulating immature mononuclear phagocytes, macrophages, (i.e., highly differentiated mononuclear phagocytes) , or combinations thereof.
  • the BTCD- hu2 mice of this invention may also contain human B-cells and/or other human immune system cells. The particular repertoire of human immune system cells present in the BTCD- hu2 mouse is dependent upon the specific human tissue and/or cells that have been transplanted into the mouse.
  • the BTCD-hu mouse is genetically deficient for murine B- and T-cells but as a result of transplantation of human fetal liver and thymus tissue into the mouse kidney capsule the BTCD-hu mouse has significant numbers of circulating human B- and T-cells in the mouse peripheral compartment, spleen, lymph nodes and transplanted human tissue.
  • BTCD-hu2 mouse Another example of a BTCD-hu2 mouse is the BTCD-huBM mouse, which is obtained by transplanting and engrafting cultured human fetal bone marrow cells into a genetically murine B- and T-cell deficient mouse. Such transplantation results in significant levels of circulating human B-cells and monocytes in the mouse peripheral compartment and bone marrow.
  • BTCD-hu2 mouse Another example of a BTCD-hu2 mouse is the BTCD-huCombo mouse, which is obtained by transplanting and engrafting cultured human fetal bone marrow cells and transplanting human fetal liver and thymus tissue under the kidney capsule of a genetically murine B- and T-cell deficient mouse.
  • the BTCD- huCombo mouse has significant numbers of circulating human B- and T-cells and human monocytes in its peripheral compartment.
  • the BTCD-hu2 mice of this invention can be infected with HIV-l following peripheral inoculation. These mice can also be infected with other human pathogens due to the presence of human transplanted cells or tissues.
  • the specific amount of pathogen necessary to cause infection of the human tissue can be determined by standard techniques for determining infectious dose or lethal dose.
  • the amount of HIV-l necessary to cause infection via peripheral infection is generally in the range of from about 80 to 800 TCID 50 (tissue culture infectious dose) .
  • the murine B-cell and T-cell deficient mice that can be transplanted with human cells and/or tissues as described above include, for example, homozygous scid, bnx, Rag-1 and Rag-2 mice, and may include other genetically B- and T-cell deficient mice.
  • the BTCD-huBM mouse, according to the invention contains both human and mouse hematopoietic progenitor cells and the stromal microenvironment in which human stem cells, lymphoid and myeloid precursor cells can mature and function.
  • mice Testing candidate antiviral agents in inbred laboratory mice is desirable because a vast body of knowledge has been accumulated regarding murine genetics, immunology, cytokines, and metabolism, and because many immunological reagents and cytokines are available. Breeding can be accomplished easily because mice have a short generation time. The small size of these animals greatly facilitates drug studies, especially if only limited amounts of investigational compounds are available for analysis. This latter point is especially important for drug development from natural product sources. Furthermore, the small size of mice also assures relatively low housing costs.
  • the host range of HIV-l is limited to humans, chimpanzees, and Gibbon apes. Neither murine cells nor mice can be infected by HIV-l.
  • the present invention provides a murine model system wherein disseminated HIV-l infection occurs for testing antiretroviral therapy, even though HIV-l is unable to replicate in mice.
  • chimeric BTCD-hu animals have been developed that permit prolonged survival and significant increase in the number of human T-cells in the peripheral blood of these mice, which can sustain HIV-l replication in the mouse spleen, lymph node and peripheral blood, as well as in the thymic implant, following exposure to HIV-l. This mouse offers several uses and advantages over other animal model systems.
  • the present method of generating test animals provides an animal that is useful in studying the pathophysiological events following HIV infection. It is crucial to evaluate therapeutic interventions directed to HIV- 1 in vivo using HIV-l freshly isolated from patients. This is because HIV-l functions differently following in vitro passage in tissue culture. This was dramatically demonstrated by the contrast between the potent effect of recombinant CD4 in blocking HIV-l infection in the test tube and its minimal effect when given to patients (Daar E. S., and Ho D. D.
  • the present animal model also provides a method for identifying and isolating unique cytokines important in the growth and maturation of human thymus and T lymphocytes. Involution of the thymus in later years has been associated with the decline of the immune system associated with age that may lead to cancer and autoimmune diseases. Unique human cytokines have been detected in vivo in the present BTCD-hu mice. This mouse should provide a means of assessing these novel thymic growth factors and may prove useful as a way of "recharging" the immune system in later life.
  • human/mouse chimerae were created by transplanting congenitally immunodeficient mice lacking both B-cells and T-cells (BTCD mice) such as C.B.-17 scid/ scid mice with human thymus and liver tissue.
  • the recipient animals lack functional murine T-cells and B-cells.
  • recipient scid/scid or SCID mice
  • the deficiency in B-cells and T-cells is due to a faulty VDJ recombinase mechanism.
  • mice provide both human hematopoietic progenitor cells and the stromal microenvironment in which human T-cell maturation occurs. These mice can be infected with HIV-l intraperitoneally.
  • Several experimental systems previously have been established using either fetal organ grafts or peripheral blood leukocytes from normal adult human donors. Prolonged graft survival was observed in both systems, however, the number of human T-cells in the peripheral blood was so low as to make the mice unusable for virus inoculation other than by directly inoculating virus into the transplanted tissue. As a result it was not possible to study the normal in vivo dissemination of virus into the various organs and physiological systems.
  • HIV-l infection was restricted to the human thymus and/or liver implant.
  • HIV-l infection of these mice could only be accomplished using clinical isolates of HIV-l.
  • Laboratory strains of HIV-l failed to cause infection in these mice, despite the ability of laboratory strains of HIV-l to infect humans, which has been demonstrated by the accidental HIV infection of at least two researchers with laboratory strains of HIV-l (McCune, et al. , (1991), Immunol. Rev. 124:45-61).
  • Previously human/mouse chimerae were created by transplanting human fetal tissues originating from liver, thymus, lymph nodes or bone as follows. Thymic and hepatic tissue were transplanted under the renal capsule, lymph nodes were transplanted into the mammary fat pads and human bone fragments were transplanted subcutaneously. However, as noted above, the resulting chimeric mice, i.e. containing both human thymus and hepatic tissue continuously produced human T-cells and the human tissue grew well, but the mean value of peripheral blood lymphocytes was only 0.7%. Krowka, et al.. Ibid . Moreover, only very low levels of human lymphocytes were detected in mouse spleen or lymph nodes.
  • the present invention provides a method for preparing BTCD-hu mice having significantly increased numbers of human peripheral blood T-cells and in which human T-cells are detectable in mouse spleen, lymph nodes and peritoneal cavity as well as in the transplanted human tissue, thus allowing for inoculation of HIV intraperitoneally, or by inoculation into the mouse rectum (peripherally) rather than by direct inoculation into transplanted human tissue.
  • the present method involves the implantation of alternating human fetal thymic and human fetal liver tissue under the kidney capsule of BTCD mice, such as scid /scid mice or homozygous Rag-1 deficient or Rag-2 deficient mice.
  • the resulting BTCD-hu mice are physiologically distinct from recipient BTCD mice in that the BTCD-hu mice are capable of producing and maintaining circulating human T-cells.
  • the present BTCD-hu mice provide a functional and viable stromal microenvironment in which human T-cell maturation occurs.
  • the implanted human tissue is supported by the mouse and is capable of growth and remains functional throughout the life of the BTCD-hu mouse. In general, implanted human tissue increases in size about 100 fold in the BTCD-hu mice.
  • Human fetal tissue for implantation is preferably derived from fetuses that are electively aborted at about gestational week 12 to about gestational week 22, preferably gestational week 17 to gestational week 21.
  • Human fetal tissue is dissected free of surrounding connective tissue preferably within approximately 30 minutes of abortion.
  • the specified organs, i.e. liver and thymus are washed and separated into ice cold Dulbecco's Physiologically Balanced Salts (PBS) and kept on ice from then on. Each organ is rinsed several times with ice cold sterile PBS. Intactness and sterility of the human fetal liver are critical.
  • the human fetal thymus in its capsule, is dissected away from the sternum and the heart. During this procedure the connective tissue capsule is left intact to reduce exposure of the thymus to a non-sterile environment. The thymus is then washed in ice cold, sterile PBS several times. Afterwards the capsule is dissected away from the thymus and the organ is cut into small pieces, such as 0.3cm 3 pieces (as many as required for the mice to be implanted for the same reasons mentioned above for liver) along the grossly visible lines of thymic lobules, minimizing damage to the tissue. These pieces are kept on ice in PBS until implantation.
  • the human fetal thymus and liver pieces described above are cut on ice into pieces of from about 0.5 mm 3 to about 2.0 mm 3 , preferably about 0.75 to about 1.25 mm 3 and most preferably into 1 mm 3 pieces.
  • a plurality of pieces such as, for example, about 7 to about 12 pieces and preferably about 10 1mm 3 pieces each of thymic and liver tissue are loaded into a cannula, preferably a 16 gauge cannula whose tip has been manually rounded and shortened. It is important to load liver and thymus alternately to maximize the contact interphase between the liver and thymus tissue, which is critical for survival and growth of the implant.
  • the total volume of fetal tissue implanted is in the range of about 0.5cm 3 to about 1cm 3 , depending on the size of the particular mouse kidney capsule.
  • the amount of tissue implanted provides for contact between the alternating pieces of human fetal liver and kidney.
  • Human fetal spleen and/or human fetal intestine can also be similarly dissected and co-transplanted with human fetal liver and thymus tissue.
  • fetal spleen co- transplanta-tion a plurality of tissue pieces of from about 0.4 to 1 cm 3 are transplanted to provide about 10 - 50X10 6 spleen cells.
  • intestine tissue is cut into pieces of about 3 x 5 cm and a plurality of pieces is co-transplanted with human fetal liver and thymus tissue.
  • the fetal tissue is transplanted into BTCD mice, preferably mice that are six to eight weeks old.
  • the mice are anesthetized with any commonly used anesthetic drug, such as, for example, pentobarbital at an amount of about 40-80 mg/kg.
  • An incision is made in the animal's right and left flanks and each kidney is exteriorized if both kidney capsules are to be implanted with tissue. Alternatively, a single kidney may be treated in this manner.
  • an incision of about 0.3mm to about 0.7mm, most preferably about 0.5mm is made at the tip of the lower kidney pole and the cannula inserted with its opening facing the kidney, after the kidney capsule is gently held up at the point of incision by an instrument, such as, for example, iris forceps.
  • the cannula is then inserted in a gliding fashion further underneath the kidney capsule until the opposite kidney pole is reached.
  • the opening of the cannula is turned to face first down and towards the kidney, and while angling the cannula end held in the hand past the midline of the kidney towards the dorsal side of the kidney, the inserted end of the cannula rises a short distance, for example, approximately 0.5mm underneath the kidney capsule.
  • the first tissue pieces are injected underneath the capsule.
  • the injected pieces serve to block their own way towards the incision of the capsule due to the strain exerted on the capsule by the angled, inserted cannula.
  • the cannula With the trocar kept fixed, the cannula is then pulled back a short distance, about 2mm, the opening turned up and towards the kidney while the angle of the cannula relative to the kidney is increased even further, to exert more strain on the capsule, thus preventing injected tissue pieces from being pushed out of the capsule incision.
  • the rest of the tissue is slowly injected, with several pieces of tissue gliding around the upper kidney pole and extending the capsule by about 3mm.
  • both kidneys are implanted in that manner, resulting in a heterogeneous system having human liver and thymus tissue interspersed throughout. While this method of implantation is most preferable, any method for implanting interspersed human fetal liver and fetal thymus tissue may be employed. Regardless of the method of implantation, the total amount of each tissue that is transplanted is from about 10 7 to about 10 8 hematolymphoid cells, preferably from about 2xl0 7 to about 5xl0 7 cells under each kidney capsule.
  • tissue be transplanted within 24 hours of pregnancy termination and most preferably, within 5 hours of termination.
  • the fresher the liver tissue the more successful the implant.
  • tissue be maintained so as to minimize tissue damage, such as by maintaining the tissue on ice and perfusing with PBS at all times prior to transplantation.
  • the peritoneal layers are approximated with sutures and the wound is closed.
  • all surgical procedures are performed in a laminar flow hood using sterile technique.
  • the mice are preferably provided antibiotic prophylaxis and housed in an environment that can be monitored for mouse pathogens.
  • the resulting BTCD-hu mice have detectable levels of human T-cells in the peripheral lymphoid compartment.
  • the peripheral lymphoid compartment includes the mouse peripheral blood, lymph nodes, peritoneal cells and spleen.
  • the BTCD-hu mice are capable of supporting long-term, multilineage human hematopoiesis, including differentiation of phenotypically normal and competent T-cells.
  • the levels of human T-cells in the BTCD-hu mice are sufficient to support disseminated HIV-l infection following intraperitoneal inoculation of HIV-l into the mouse.
  • BTCD-hu mice constructed in this manner contain peripheral blood lymphocytes containing at least about 3% to 10% human T-cells, preferably at least about 5% to about 7% human T- cells of the total number of peripheral blood lymphocytes.
  • human T- cells are composed of about 2 to 8% CD4+ T-cells and about 1 to 4% CD8+ T-cells. An amount of about 3% human T-cells in the peripheral blood is sufficient to allow HIV-l infection of a BTCD-hu2 mouse by intraperitoneal inoculation.
  • the BTCD-hu mice obtained by the present method can be used as a model for HIV infection by either direct inoculation of the human thymus/liver implant with HIV-l or by other routes, such as, for example, by inoculation of virus into the peritoneal cavity, or such as, into the rectum.
  • a tissue culture infectious dose TCID 50
  • an amount of about 8000 TCID 50 HIV-l in a volume of about 500 to about 1000 ⁇ l, preferably 800 ⁇ l is injected interperitoneally.
  • TCID 50 tissue culture infectious dose
  • an amount of about 8000 TCID 50 HIV-l in a volume of about 500 to about 1000 ⁇ l, preferably 800 ⁇ l is injected interperitoneally.
  • Approximately one month following HIV-l challenge it is possible to detect T-cell uptake of the virus and infection in the peripheral lymphoid organs and in the human tissue implant.
  • the present BTCD-hu mouse model for HIV-l infection provides a significant advance in the study of AIDS in that it provides a much more natural model for studying the initial stages of HIV infection and dissemination than does direct injection into implanted tissue. It is known that following exposure of an individual to an inoculum of HIV-l, an infectious cycle is initiated that leads to systemic dissemination of virions and infected cells into lymphoid organs. McCune, (1991), Cell, 64:351-363. The subsequent disease course may be determined by the sites to which HIV-l is seeded during the acute stage of infection. McCune, Ibid . ; Pantalleo, et al., (1993); New Eng. J. of Medicine, 328:327- 335.
  • HIV-l infected BTCD-hu mice can be assessed for HIV-l infection by any known method.
  • the titer of HIV-l infected mononuclear cells present in the peripheral blood, spleen, thymic implant or lymph node of the BTCD-hu mice can be ascertained, for example, by isolating peripheral blood mononuclear cells (PBMC) from infected BTCD-hu mice and culturing titered numbers of cells in the presence of uninfected human phytohe agglutinin (PHA)-activated PBMC until such time as the p24 antigen content of the culture supernatant can be quantitated.
  • PBMC peripheral blood mononuclear cells
  • PHA phytohe agglutinin
  • PCR polymerase chain reaction
  • RT-PCR reverse transcriptase PCR
  • the present BTCD-hu mouse is also useful as a model system for studying the pathophysiology of in utero versus intrapartu vertical transmission of HIV-l in humans.
  • HIV-l has been detected in fetal lymphoid organs (Mano, et al., (1991), AIDS Res. Hum. Retro. 7:337-341; Courgnaud, et al., (1991), AIDS Res. Hum. Retro.
  • T-cell precursor populations in the thymus including the immature "triple negative" CD3-CD4hi-CD8-T-cell precursors and the more mature CD4+CD8+ thy ocytes are susceptible to HIV-l infection (Schnittman, et al. (1992), Proc. Natl. Acad. Sci. USA 87:7727-7731).
  • Data obtained using the present mouse model indicate that human fetal thymus can become infected after peripheral exposure to HIV-l.
  • T- cells can migrate from the thymus and mediate peripheral dissemination of the HIV-l infection.
  • peripheral cells infected with HIV-l in utero may home to the thymus where they can infect thymocytes with HIV-l and thereby mediate subsequent infection of peripheral lymphoid tissues.
  • Examination of peripheral blood immediately after birth may not detect the high degree of HIV-l replication occurring in the thymus, spleen or lymph nodes. This is comparable to the dichotomy between the very active HIV-l infection observed in lymph nodes and the low degree of HIV-l infection seen in peripheral blood during the latent phase of HIV-l infection in adults (Pantallelo, et al., (1993), Science 362:355-358). Therefore, the present BTCD-hu mice will provide a model for studying the effects of prenatal and postnatal anti-HIV interventions on the prevention of vertical transmission of HIV-l.
  • cytokines such as TNF- ⁇ , TNF-/3, IL-2, IL-4 and IL-6 can modulate in vivo HIV-l infection (Pantalleo, et al., (1993), New Eng. J. Med., 328:327-335).
  • IL-2 and IL-4 have been shown to synergistically promote HIV-l replication in cultured thymocytes (Hays, et al. (1992), AIDS 6:265-272) and IL-6 secreted by thymic epithelial cells has been shown to up regulate HIV-l replication in chronically infected cells (Schnittman, et al., Ibid . ) .
  • the present BTCD-hu mouse provides a model system that enables the in vivo assessment of the function of peripheral human T-cells and the role of cytokines in HIV-l replication.
  • Human cytokine mRNA can be detected in human tissue implants as well as the periphery compartment of the BTCD-hu mice of this invention. Since expression by human T-cells of mRNA for various human cytokines can be monitored in the present BTCD- hu mice, the use of such techniques as human-specific RT-PCR, for example, will provide a valuable model for exploring the in vivo role of cytokines in HIV-l infection, or the role of cytokines in any retroviral infection under study in the BTCD- hu mouse system of this invention.
  • the present BTCD-hu mouse provides an animal model for studying the efficacy and toxicity of drugs and other clinical interventions useful in the treatment of AIDS.
  • an experimental drug or therapy can be administered to the infected animal.
  • the experimental drug or therapy can be administered prior to HIV- 1 inoculation of the present BTCD-hu mice.
  • the subsequent disease course is determined by examining the degree of disseminated HIV-l infection.
  • mice do not mount a murine immune response as a result of the B- and T-cell mutation, these mice may not be useful for studying the efficacy of AIDS vaccines.
  • these mice provide human lymphocytes in the mouse peripheral lymphoid compartment in sufficient numbers to allow HIV-l infection and are, therefore, useful for determining the efficacy and/or toxicity of anti-HIV-1 drugs or anti-HIV-1 therapies.
  • the present invention also provides a BTCD-hu2 mouse which has engrafted within the mouse bone marrow and lymphoid peripheral compartment human fetal bone marrow cells.
  • This mouse referred to herein as a BTCD-huBM mouse, contains in its peripheral lymphoid compartment B-cells, monocytes and macrophages, all of human origin.
  • BTCD-huBM mice provide a functional and viable stromal microenvironment in which human hematopoiesis occurs. The implanted human cells are supported by the mouse and remain functional throughout the life of the BTCD-huBM mouse.
  • Human fetal bone marrow (HFBM) cells for implantation are preferably derived from fetuses that are electively aborted at about gestational week 12 to about gestational week 24, preferably gestational week 18 to gestational week 23.
  • Human fetal bone marrow cells are obtained from the marrow cavities of the fetal bones, preferably fetal long bones, preferably within 5 hours of availability. The bone marrow cells are removed by lavaging the marrow cavities, for example, with phosphate buffered saline (PBS) followed by Ficoll-Hypaque density centrifugation.
  • PBS phosphate buffered saline
  • the interphase cells from the centrifugation are collected, washed in PBS, for example, and cultured at about 37°C, in the presence of about 5% C0 2 , in appropriate medium, such as, for example, RPMI with added antibiotics.
  • the cells obtained in this manner are cultured for about three to seven days, preferably about four days at which time the cells are harvested.
  • the adherent cells i.e., those cells that stick to the culture plate, are harvested with the non-adherent cells, i.e. those cells that are free floating in the culture medium prior to harvesting.
  • the adherent cells include human fetal bone marrow cells and stromal cells.
  • the harvested cells which preferably include adherent cells, are transplanted into BTCD mice, preferably mice that are six to eight weeks old.
  • the mice are subjected to sublethal irradiation about one hour prior to transplantation and then anesthetized with any commonly used anesthetic drug, such as, for example, pentobarbital at an amount of about 40 to 80 mg/kg.
  • the amount of irradiation used depends on the genetic defect causing immuno-deficiency in the mouse. For example, scid /scid mice are preferably irradiated with about 400cGy since these mice are radiation-repair deficient, whereas, bnx and RAG-1 and RAG-2 mice can withstand up to about 800 cGy.
  • the cultured cells are injected intravenously into the mice at a concentration of from about l x l ⁇ 6 to l x 10 8 , preferably 4 x 10 7 cells in a total volume of about 500 ml.
  • mice are preferably housed in an environment that can be monitored for mouse pathogens.
  • the resulting BTCD-huBM mice have significant engraftment of human cells in the mouse bone marrow. Furthermore, the mouse peripheral lymphoid compartment, which includes lymph nodes, peripheral blood, peritoneal cells and spleen, is also engrafted with human cells.
  • the BTCD-huBM mice are capable of supporting long-term, multilineage human hematopoiesis, including differentiation of phenotypically normal and competent B-cells, macrophages and monocytes. However, these mice do not contain human T-cells.
  • mice constructed in this manner contain at least about 10% to about 40% CD45+ cells in their bone marrow, preferably, at least about 25% CD45+ cells in the mouse bone marrow.
  • Mice engrafted in this manner also have a significant population of CD45+ cells in the peripheral blood and tissues of the peripheral lymphoid compartment.
  • the levels of CD45+ cells in the peripheral blood of BTCD-huBM mice is in the range of from about 10% to about 50%, preferably at least 15%.
  • the level of human monocytes present in the BTCD- huBM mice is sufficient to support HIV-l infection following intraperitoneal inoculation of the virus into the mouse even in the absence of human T-cells.
  • BTCD-hu2 mice of this invention that are chimeric for human bone marrow cells, i.e. the BTCD-BM mice above and the BTCD-hu Combo mice discussed below provide an excellent small animal model for studying human hematopoiesis, HIV-l infection and drug efficacy and safety. These animals are chimeric for human hematopoietic cells and maintain significant levels of human cells in the mouse peripheral lymphoid compartment without the need for human cytokine supplementation. The significant numbers of human precursor cells observed in the bone marrow of these mice may be due to pre-culturing of the human fetal bone marrow cells prior to transplantation.
  • pre-culturing the fetal bone marrow cells increases the adherence between hematopoietic precursor cells and stromal cells such that both types of cells engraft together, thereby creating a human microenvironment for the engrafted human bone marrow cells. It is also possible that pre-culturing effects the stromal cells making them somewhat more adherent, such that they are more readily engrafted along with the bone marrow cells and may aid the bone marrow cells in engrafting. It is also possible that the mouse bone marrow can become engrafted with the human stromal precursor cells present in the adherent population, and provide species-specific maturation signals to the human progenitor cells.
  • transplantation of HFBM cells may uniquely lead to engraftment of the bone marrow with donor stromal cells even though transplantation with pediatric or adult bone marrow cells does not. This may be due to the presence in human fetal bone marrow of pluripotent bone marrow cells that can differentiate into hematopoietic precursors and stromal cells (Huang, et al. (1992) Nature, 360: 745-749) .
  • Another possible explanation for the role of the adherent cells in enhancing the degree of engraftment is that this population is markedly enriched for human hematopoietic progenitor cells that adhere to stromal cells (Coulombel, et al., (1983),
  • BTCD-hu2 mice that are co-implanted with human fetal spleen tissue are useful for developing human monoclonal antibodies, to investigate the primary and secondary response of human lymphoid tissues to infection or antigenic stimulus and to test vaccines directed to human specific pathogens.
  • BTCD-huBM and BTCD-huCombo mice of this invention The maturation of human B-cells and monocytes occurs in the bone marrow of the BTCD-huBM and BTCD-huCombo mice of this invention in the complete absence of exogenous human cytokines. Furthermore, engraftment of the bone marrow is associated with reconstitution of the peripheral lymphoid compartment of these mice with human B-cell and monocytes.
  • BTCD-huBM mice constructed in this fashion combined with species-specific reverse transcriptase polymerase chain reaction, (RTPCR) provide a valuable model for examining factors that stimulate or inhibit the in vivo maturation of human B-cells and monocytes.
  • RTPCR species-specific reverse transcriptase polymerase chain reaction
  • Ineffective hematopoiesis may result from a direct effect of HIV-l on stem/progenitor cells, stromal cells or mature cells present in the bone marrow. This effect may be mediated by infection of cells by HIV-l, a direct toxic effect of HIV-l encoded proteins, or by the HIV-1-mediated suppression of stimulatory cytokines or induction of suppressive cytokines.
  • These BTCD- huBM and BTCD-huCombo mice may be useful for studying the in vivo HIV-l infection of human monocytes and B-cells. Since human hematopoiesis occurs in the mouse bone marrow and the peripheral lymphoid compartment.
  • the BTCD- huBM and BTCD-huCombo mice may be useful in screening the potential effectiveness of various interventions to reverse the negative effects of HIV-l on hematopoiesis.
  • the BTCD-hu2 mouse of this invention may also have transplanted therein human fetal thymus and human fetal liver tissue in addition to engrafted human fetal bone marrow cells.
  • the resulting mouse hereinafter referred to as a BTCD-huCombo mouse, has a full complement of human peripheral blood T- cells, B-cells, macrophages and monocytes, all of which are detectable in the mouse spleen, lymph nodes and peritoneal cavity, as well as in the transplanted human tissue.
  • the BTCD-huCombo mouse may be prepared by the implantation of alternating human fetal thymic and human fetal liver tissue under the kidney capsule of a BTCD mouse and the engraftment of pre-cultured human fetal bone marrow cells in the bone marrow and peripheral compartment of the mouse. The transplantation and engraftment procedures are carried out separately.
  • the order in which these procedures is done should not significantly effect the success of the operation.
  • the procedure for implanting alternating human fetal thymus and human fetal liver tissue into a BTCD mouse is the same as that for constructing a BTCD-hu mouse. After a sufficient amount of recovery time is provided, such as, from about four to about six weeks, the BTCD-hu mouse is engrafted with pre-cultured fetal bone marrow cells in the same manner used to construct the BTCD-huBM mouse.
  • the order of implanting human tissue and cells may be reversed and the tissues may be syngeneic or allogeneic to each other.
  • the resulting BTCD-huCombo mice have detectable levels of human T-cells, B cells, macrophages and monocytes in the mouse peripheral lymphoid compartment.
  • the BTCD-huCombo mice are capable of supporting long-term, multilineage human hematopoiesis, including differentiation of phenotypically normal and competent T-cells, B-cells and monocytes.
  • the levels of human T-cells and monocytes in the BTCD-huCombo mice are sufficient to support disseminated HIV-l infection following intraperitoneal inoculation of HIV-l into the mouse, as with the BTCD-hu mouse.
  • BTCD-huCombo mice constructed in this manner contain peripheral blood lymphocytes containing at least about 3% to 10% human T- cells, preferably at least about 5% to about 7% human T-cells.
  • T-cells are composed of about 2 to 8% CD4+ T-cells and about 1 to 4% CD8+ T-cells.
  • the percentages of B-cells, monocytes and macrophages in the peripheral compartment of BTCD-huCombo mice are similar to those observed in BTCD-huBm mice.
  • the construction of the BTCD-hu2 mice of this invention is successfully carried out by the present method in the absence of exogenous cytokines.
  • the BTCD-hu2 mice of this invention support the transplanted tissues and/or cells throughout the natural life span of the mouse without treatment with human cytokines. Moreover, maturation of human B-cells and monocytes occurs in the bone marrow of BTCD-huBM and BTCD-huCombo mice in the absence of exogenous human cytokines.
  • the BTCD-hu2 mice of this invention have detectable levels of human cytokine gene expression.
  • the BTCD-huBM and BTCD-huCombo mice have detectable levels of cytokine gene expression, such as, IL-3, IL-5, IL-6, IL-10, IL-7, LIF and M- CSF in the engrafted bone marrow.
  • IL-7 has been shown to induce the proliferation of human B-cell precursors (Saeland, et al. (1991)), Blood, 78:2229-2238; Moreau, et al. (1993), Blood, 82:2396-2405) and to permit the in vitro growth of human B-cell precursors (Wolf, et al., (1991), J.
  • LIF stimulates the growth of human hematopoietic progenitor cells in culture (Verfaillie, et al., (1991), Blood, 77:263-270).
  • the crucial role of LIF in the expansion of the hematopoietic precursor population has been indicated by the marked decrease in the number of stem cells observed in gene-targeted LIF-deficient mice (Escary, et al. 1993), Nature, 363:361-364).
  • M-CSF is a member of a group of cytokines that induces progenitor cells in the bone marrow to proliferate and differentiate (Metcalf, D. , (1985) , Science, 229:16).
  • human cytokines that play important roles in different stages of human hematopoiesis are expressed by cells present in the bone of the BTCD-huBM and BTCD-huCombo mice of this invention.
  • the BTCD-hu2 mice of the invention have detectable levels of human cytokine gene expression in both the transplanted human tissue and the peripheral compartment of the mouse.
  • the BTCD-huBM and BTCD-huCombo mice constructed by the above-described processes provide valuable animal models for examining factors that stimulate or inhibit the in vivo maturation of human B-cells and monocytes. Moreover, because these chimeric mice contain significant levels of peripheral blood monocytes and macrophages, they are useful as animal models of HIV-l infection, in the same manner as the BTCD-hu mouse. Furthermore, because T-cells are not detectable in BTCD-huBM mice, it is possible to utilize these mice to examine the in vivo pathophysiology of isolated HIV-l infection of human monocytes and thereby to evaluate the effectiveness of antiviral therapy on HIV-l infected monocytes.
  • the BTCD-hu2 mice are useful as animal models for studying the efficacy of bone marrow transplantation. These chimeric animals are useful for assessing the effectiveness of transplant-ing various types of cells, such as stem cells, and pre-treatment of transplanted cells. Moreover, these animals are useful in assessing the safety of new hematopoietic drugs or treatments, such as, for example, assessing the effect of a test drug for protecting bone marrow from irradiation treatment or evaluating the toxicity of a new drug to human myelolymphoid lineage cells by determining the degree of engraftment on the mouse. The degree of engraftment correlates with efficacy of the pre-treatment of cells on transplantation.
  • mice may provide a valuable model for assessing the effectiveness of in vivo gene therapy using human stem and precursor cells.
  • an attractive approach for treatment and prevention of HIV infection is by "intracellular immunization" (Baltimore, D. Nature 1988; 335:395-6). After transfection of cells with an expression vector coding for a protein or RNA capable of blocking the infectious cycle of HIV, the cell would be protected from HIV infection.
  • Several stages during the replication of HIV are potential targets for molecular intervention (Mitsuya, et al., Science 1990; 249:1533-1544).
  • hammerhead ribozymes can be designed that specifically cleave HIV gag RNA and thereby markedly reduce viral replication (Sarver, et al., Science 1990:247:1222-1225).
  • Recombinant retroviruses possessing a photropic host ranges provide vector systems that permit the stable integration of DNA into the cellular chromosome in a stable and heritable fashion (Danos, O., and
  • the BTCD-huBM and BTCD- huCombo mice of this invention can be used for in vivo screening of growth factors for the capacity of such factors to enhance production of myeloly phoid lineage cells. Such information can then be incorporated in the treatment of patients for ly phopenia or neutropenia which conditions often result in patients suffering from various and diverse disease processes, as well as from secondary effects of chemotherapy.
  • those BTCD-hu2 mice of this invention which contain human bone marrow engrafted therein, can also be used either to amplify the numbers of autologous human bone marrow cells prior to transplantation into a patient in need thereof or alternatively, as a source of allogenic human bone marrow stem cells for transplantation into a patient in need thereof.
  • the BTCD-huBM mouse is particularly suited for amplifying human bone marrow cells or providing a source of human bone marrow cells since these mice do not contain T-cells and thus, the problem of graft versus host disease which usually precludes the use of HLA-mismatched bone marrow transplantation in patients is avoided.
  • BTCD-huBM mice can be engrafted with bone marrow cells from a patient or donor and after an appropriate period of recovery and growth, the mouse is sacrificed and the human bone marrow cells are recovered from the engrafted mouse bones by lavaging with sterile PBS, for example.
  • the CD45+ cells are then purified from the obtained bone marrow cells.
  • the human bone marrow cells e.g., CD45+ can then be transplanted into the patient.
  • BTCD-huBM mice contain human B-cells and antigen presenting cells in their peripheral lymphoid compartment they can also serve as a source for generating human polyclonal antibodies to any antigen.
  • These mice can be inoculated with an antigen, such as, for example, HIV-gp 120 and after sufficient time, such as about 4 to 8 weeks, the antibodies can be collected and provided to a human patient in need thereof.
  • Human monoclonal antibodies may also be generated from vaccinated or actively infected BTCD-huBM or BTCD-huCombo mice by either fusing isolated Epstein Barr Virus (EBV) transformed human B-cells from such mice with appropriate myeloma cell lines (M.R. Posner, et al., J. Immunology, 146:4325-4332, 1991) or fusing non-EBV-transformed human B-cells from such mice with permissive human myeloma cell lines or mouse myeloma cell lines (D.F. Lake, et al., AIDS, 6:17-24, 1992).
  • Antibody producing cells can then be isolated and the monoclonal antibody purified by routine methodologies.
  • SCID-hu mice were prepared by implanting human fetal thymic and liver tissue into the kidney capsules of ⁇ cid/ ⁇ cid mice. Briefly, after the scid/scid mice were anesthetized with pentobarbital (40-80 mg/kg) , a 3 cm incision was made in the left and right flanks of the animal. The mouse kidney was held up with a hemostat and a 0.5 mm incision was made at the tip of each lower kidney pole. A cannula containing 10 1 mm 3 pieces each of alternating human fetal thymus and liver (hu- thy/liv) obtained from the same donor were implanted with a 16 gauge cannula under both kidney capsules.
  • the human tissue was obtained from human fetuses that had been electively terminated at from 17-21 weeks of gestation. Only human fetal liver pieces with an intact capsule were used in the implantation procedure in order to minimize autolysis and contamination by organisms invading underneath a ruptured capsule. The fetal gall bladder was dissected away from the liver, carefully avoiding any spill of its contents. Regions towards the edge of the liver that had capsule surrounding the tissue on both sides were cut into slices (0.5cm X 0.5cm X 0.5cm) and as many pieces as mice to be implanted were kept in PBS on ice until implantation. Liver slices large enough for implantation of two kidneys were cut out.
  • the human fetal thymus in its capsule, was dissected away from the sternum and the heart. During this procedure the connective tissue capsule was left intact to reduce exposure of the thymus to a non-sterile environment. The thymus was then washed in ice cold, sterile PBS several times. Afterwards the capsule was dissected away from the thymus and the organ was cut into 0.3 X 0.3 X 0.3cm pieces (as many as mice to be implanted) along the grossly visible lines of thy ic lobules, minimizing damage to the tissue. These pieces were kept on ice in PBS until implantation.
  • liver and thymus tissue were loaded into a 16 gauge cannula, whose tip had been manually rounded and shortened. Liver and thymus were alternately loaded to maximize the contact interphase between liver and thymus. That is, there is substantial contact between the surfaces of implanted tissue to provide an environment capable of sustaining the implant during the natural life of the mouse.
  • the fetal tissue was implanted into male (6-8 wk old) mice within 5 hours of availability.
  • the fetal gestational age was determined by foot length measurements.
  • the cannula was inserted through the incision in the kidney in a gliding fashion further underneath the kidney capsule until the opposite kidney pole was reached.
  • the opening of the cannula was turned to face first down and towards the kidney, and while angling the cannula end held in the hand past the midline of the kidney towards the dorsal side of the kidney, the inserted end of the cannula was raised approximately 0.5mm underneath the kidney capsule. At this point the first tissue pieces were injected underneath the capsule.
  • the tissue pieces blocked their own way towards the incision of the capsule due to the strain exerted on the capsule by the angled, inserted cannula.
  • the cannula was then pulled back about 2mm, the opening turned up and towards the kidney while the angle of the cannula relative to the kidney was increased even further, to exert more strain on the capsule, thus preventing injected tissue pieces from being pushed out of the capsule incision.
  • the rest of the tissue was slowly injected, with several pieces of tissue gliding around the upper kidney pole and extending the capsule by about 3mm.
  • the cannula was pulled out slowly while turning around its own axis to relieve the pressure and make room for more tissue.
  • the capsule colJLapsed- at the point of incision after being pulled out since the incision was made small enough to allow this.
  • Most of the tissue was injected at the opposite pole of the kidney. Both kidneys were implanted in that manner.
  • mice were started on trimethoprim/sulfamethoxazole antibiotic (TMS; Schein Pharmaceutical Inc., Port Washington, NY) prophylaxis and were housed in bonnetted isolator cages (Lab Products, Inc., Federalsburg, MD) in an environment that was monitored for mouse pathogens.
  • TMS trimethoprim/sulfamethoxazole antibiotic
  • mice were assayed for the presence of human T-cells in the peripheral compartment.
  • Mononuclear cells were harvested from the peripheral blood, spleens and lymph nodes of the SCID-hu mice and stained with PE-, FITC, or PerCP-conjugated mouse mAb to human CD4 (Leu 3a, Becton Dickinson, Mountain View, CA) , human CD8 (Leu 2a, Becton Dickinson), human CD3 (Leu 4, Becton Dickinson), or human CD45.
  • TCR V gene expression was analyzed by staining mononuclear cells with PerCP-conjugated mouse mAb to human CD4 (Leu 3a, Becton Dickinson) , PE-conjugated mouse mAb to human CD8 (Leu 2a, Becton Dickinson) , and FITC-conjugated mouse mAb to either TCR V/32, V05a, ⁇ 7 ⁇ 5b, V/35c, V06, V08, V/312, V ⁇ l9 or V ⁇ 2 (T-Cell Diagnostics).
  • the percentage of lymphocytes expressing human CD3 and CD45 was 5.4% in the peripheral blood (Fig. 1A) , 24.5% in the mouse spleen (Fig.
  • peritoneal exudate cells were harvested by peritoneal lavage with cold PBS. As determined by three-color flow cytometric analysis, 0.6% of the peritoneal exudate cells were human CD4+ cells (Fig. 2A) and 0.33% were human CD8+ cells (Fig. 2B) .
  • the diversity of the peripheral human T- cells present in the SCID-hu mice was assessed by examining their expression of TCR V/3 genes with a panel of mAb that cover about 30% of peripheral human T-cells. As shown in Figure 3, a diverse population of human TCR V / 3 subsets were observed in the periphery of SCID-hu mice.
  • HIV-1 28 was obtained following co-culture of PBMC isolated from a 2 year old HIV-l infected child with PHA-activated donor PBMC. The initial co- culture supernatant was harvested and co-cultured with PHA- activated PBMC to expand the quantity of HIV-1 28 . The secondary co-culture supernatant was harvested and aliquots were frozen in liquid nitrogen.
  • the tissue culture infective dose 50 (TCID 50 ) of the supernatant was determined by culturing titered dilutions of a thawed aliquot with phytohemagglutinin (PHA) activated donor PBMC (1.0 X 10 6 ) in a total volume of 2.0 ml of RPMI 1640 with fetal calf serum (FCS) (19% v/v) and IL-2(32 units/ml) .
  • PHA phytohemagglutinin
  • FCS fetal calf serum
  • IL-2(32 units/ml) IL-2(32 units/ml
  • mice were infected either by direct injection of 300 TCID 50 of HIV-1 28 in a volume of 30 ⁇ l into one hu-thy/liv implant or by intraperitoneal injection of 8,000 or 800 TCID 50 of HIV-1 28 in a volume of 800 ⁇ l.
  • the SCID-hu mice were assessed for disseminated HIV-l infection. Since hu-thy/liv was implanted in each kidney capsule of these SCID-hu mice, it was possible to assess whether HIV-l directly injected into the hu-thy/liv implanted in one kidney capsule could be systematically disseminated and infect the other hu-thy/liv implanted in the opposite kidney capsule.
  • HIV-l was isolated by co-culture of thymocytes from both hu-thy/liv implants, the spleens and PBMC of 5 SCID-hu mice one month after direct HIV-l inoculation into unilateral hu-thy/liv implants.
  • the degree of HIV-l infection present in the HIV-l injected hu-thy/liv implant, the uninjected hu- thy/liv in the opposite kidney, the spleen and PBMC were determined by quantitative coculture. HIV-l was isolated from as few as 320 thymocytes from both the injected and uninjected hu-thy/liv implants indicating the presence of over 3,125 TCID/10 6 cells (Table 1 and Table 2) .
  • HIV-l was also isolated from as few as 3,000 splenocytes reflecting the presence of at least 333 TCID/10 6 cells.
  • HIV-l was cocultured from PBMC obtained from the peripheral blood of these intraimplant injected SCID-hu mice.
  • T-cells that become infected with HIV-l in the hu-thy/liv implant can induce disseminated HIV-l infection of SCID-hu mice constructed as described above.
  • mice Three months after implantation under the renal capsule of scid mice, one hu-thy/liv implant in each of 5 SCID-hu mice was injected with 300 TCID 50 of HIV-1 28 . One month later, the mice were killed, mononuclear cells were isolated from the injected hu-thy/liv implant, the uninjected hu-thy/liv implanted in the opposite kidney, spleen, and peripheral blood, extensively washed and then the indicated number of mononuclear cells were co-cultured with PHA activated PBMC (1 X 10 6 ) . After 7 days of culture, an aliquot of the supernatant was harvested and assessed for the presence of p24 antigen. A positive value reflects the detection of greater than 100 pg/ml of p24 antigen in the co-culture supernatant.
  • HIV-l was inoculated into the peritoneal cavity of SCID-hu mice.
  • HIV-l was isolated by co-culture from the hu-thy/liv implants, and spleens of 5 of 5 SCID-hu mice injected with 8,000 TCID 50 , 1 of 2 SCID-hu mice injected with 800 TCID 50 and 0 of 2 SCID-hu mice injected with 80 TCID 50 .
  • the HIV-l isolated was not residual virus from the initial inoculation since no HIV-l was isolated by co-culture from the spleens of unimplanted SCID mice 1 month after injection with 8,000 TCID 50 of HIV-1 28 .
  • HIV-l infection in the hu-thy/liv implant was comparable to that which occurred after intraimplant infection of SCID-hu mice (Table 2) .
  • up to 25 TCID/10 6 cells were present in the spleens of intraperitoneally injected SCID-hu mice.
  • HIV-l infected cells can migrate from the periphery into the hu- thy/liv implant and infect human T-cells present in the implant.
  • SCID-hu mice were injected intraperitoneally with 8.0 X 10 4 TCID 50 of HIV-1 28 .
  • the mice were killed, and mononuclear cells were isolated from the hu-thy/liv implant, spleen and peripheral blood of the infected SCID-hu mice.
  • the cells were extensively washed and then the indicated number of mononuclear cells were co-cultured with PHA-activated PBMC (1 X 10 6 ) .
  • an aliquot of the supernatant was harvested and assessed for the presence of p24 antigen.
  • a positive value reflects the detection of greater than 100 pg/ml of p24 antigen in the co- culture supernatant.
  • mice were killed, mononuclear cells were isolated from the hu-thy/liv implant, the spleen, and the peripheral blood, extensively washed and, if sufficient cells were available, quantitative co-culture of the mononuclear cells with PHA-activated PBMC (1 x 10 6 ) was performed. After 7 days of culture, an aliquot of the supernatant was harvested and assessed for the presence of p24 antigen.
  • the coculture was considered positive if greater than 100 pg/ml of p24 antigen was detected in the supernatant.
  • the data are presented as TCID/10 6 mononuclear cells and a ">" indicates that the coculture was positive for the lowest number of added cells. HIV viral culture .
  • the titer of HIV-l infected mononuclear cells present in the peripheral blood, spleen, thymic implant or lymph node of the SCID-hu mice was determined.
  • Five-fold dilutions of PBMC ranging from 1 X 10 6 cells to 2 X 10 2 were cultured at 37°C in quadruplicate culture in 24 well culture plates with PHA- activated donor mononuclear cells (1.0 X 10 6 ) in a total volume of 2.0 ml of RPMI 1640 with added FCS (10% v/v) and IL- 2 (32 units/ml) .
  • FCS 10% v/v
  • IL- 2 32 units/ml
  • a positive value reflects the detection of greater than 100 pg/ml of p24 antigen in co-culture supernatant. Both clinical and laboratory strains of HIV-l were capable of infecting the SCID-hu mice, as shown in Table 5.
  • HIV-l DNA and RNA were assessed by PCR. Specifically, HIV-l DNA and RNA gag-encoded sequences and spliced tat/rev mRNA sequences were assessed by PCR.
  • Mononuclear cells from the SCID-hu mice were lysed in guanidine isothiocyanate (4 M) buffer, cellular DNA and RNA were separated by cesium chloride (5.7 M) density gradient centrifugation and precipitated with ethanol.
  • HIV-l DNA (1 ⁇ g) was amplified for 35 cycles with a primer pair specific for the gag gene segment (SK38/39) , electrophoresed through 1.5% NuSieve/0.5% SeaKem agarose (FMC, Rockland, ME) gel containing ethidium bromide, and the amplified product was detected under ultraviolet light. HIV-l RNA was detected by PCR amplification of reverse transcribed RNA (RT-PCR) .
  • RT-PCR reverse transcribed RNA
  • RNA (7 ⁇ g) in 1 ⁇ l of ddH 2 0 was mixed with 4 ⁇ l of 5X buffer (250 mM Tris-HCl, pH 8.3, 375 mM KC1, 15 mM MgCl 2 ) , 2 ⁇ l DTT (100 mM) , l ⁇ l of random hexamers (BRL-Gibco) and 5 ⁇ l mixed dNTPs (2 mM each) .
  • 5X buffer 250 mM Tris-HCl, pH 8.3, 375 mM KC1, 15 mM MgCl 2
  • 2 ⁇ l DTT 100 mM
  • l ⁇ l of random hexamers BBL-Gibco
  • HIV- 1 cDNA was amplified either with SK38/39 or a primer pair specific for tat /rev spliced mRNA sequences (TR-5/TR-3) . Specificity of the amplified product was confirmed by hybridization of a Southern blot of the amplified DNA and cDNA with a [7 "32 P]-ATP-labeled internal probe specific for the
  • SK38/39 product (SK19) or the TR-5/TR-3 product (TR-4) .
  • TR-4 the TR-5/TR-3 product
  • a given sample was regarded as positive if PCR amplification resulted in DNA product of the predicted size that hybridized to the specific internal probe. Positive and negative controls were included in all runs and to prevent contamination, suggested guidelines for PCR quality control were followed. Krone, et al., (1990), AIDS, 3:517-540.
  • RT-PCR the absence of residual DNA template was verified by the absence of an amplified product following PCR amplification of DNase-treated samples that had not been reverse transcribed.
  • HIV-l gag DNA was detected by SK38/39-primed PCR amplification in the hu-thy/liv implant, PBMC, spleen and lymph nodes of SCID-hu mice infected with HIV-l either by intraimplant injection (Fig. 4A) or by intraperitoneal inoculation (Fig. 4B) .
  • HIV-l gag RNA was detected by SK38/39-primed RT-PCR in the hu-thy/liv implant, PBMC, spleen and lymph nodes of SCID-hu mice infected with HIV-l either by intraimplant injection (Fig. 4C) or by intraperitoneal inoculation (Fig. 4D) .
  • tat /rev mRNA was detected by RT-PCR in the hu-thy/liv implant, PBMC, spleen and lymph nodes of SCID-hu mice infected with HIV-l either by intraimplant injection (Fig. 4E) or by intraperitoneal inoculation (Fig. 4F) .
  • No HIV-l DNA or cDNA was detected in SCID-hu mice that had not been infected with HIV-l (data not shown) .
  • the HIV-l DNA and cDNA detected was not from the initial inoculation since no HIV-l DNA and cDNA was detected in the spleens of unimplanted SCID mice 1 month after injection with 8,000 TCID 5o of HIV-1 28 (data not shown).
  • HIV-l Intestinal Inoculation of HIV-l into SCID-hu Mice .
  • the quantity of HIV-l in an initial co-culture supernatant was expanded as in Example 1. HIV-l was inoculated into the rectum of a SCID-hu mouse at dosage of 8000 TCID 50 .
  • HIV-l DNA was detected in the implanted human thymus and liver tissue.
  • cDNA (7 ⁇ g) was amplified by PCR with human- cytokine specific primers for 60 cycles of denaturation at 94°C for 1 minute, annealing at 65°C for 1 minute and extension at 72°C for 1 minute.
  • the presence of the target mRNA was indicated by the presence of an amplification product of the predicted size following fractionation of the PCR products by electrophoresis and ethidium bromide staining.
  • the primer pairs of each cytokine were selected from published DNA sequences based on previously described guidelines. Saiki, R.K. 1990, Amplification of genomic DNA.
  • TNF- ⁇ , TNF-/5 and IL-2 mRNA was increased in the PBMC (Fig. 7B) , lymph nodes (Fig. 7C) and spleens (Fig. 7D) of the HIV-l infected SCID-hu mice.
  • Fig. 7B lymph nodes
  • Fig. 7D spleens
  • TNF- ⁇ , TNF-/3 and IL-2 mRNA was detected in 1 of 8, 5 of 8 and 1 of 8 SCID-hu mice respectively, they were detected in 5 of 6, 6 of 6 and 3 of 6 HIV-l infected SCID-hu mice, respectively.
  • HFBM cells Human fetal bone marrow (HFBM) cells were obtained from 18 to 23 gestational week fetuses after the elective termination of pregnancy by lavaging the marrow cavities of the fetal long bones with PBS within 8 hours of availability followed by Ficoll-Hypaque density centrifugation.
  • the interphase cells were collected and washed twice in PBS, counted and either resuspended in PBS at 8 x 10 7 cells/ml (uncultured-HFBM cells) or cultured in RPMI 1640 with added FCS (10% v/v) , penicillin/streptomycin (100 U/ml) , and Gentamicin (500 ug/ml) at 4 x 10 6 cells/ml at 37°C (cultured- HFBM cells) . After 4 days of culture, the adherent and non- adherent cultured bone marrow cells were harvested, washed twice in PBS, counted and resuspsended at 8 x 10 7 cells/ml.
  • nonadherent cells were harvested by collecting the cells obtained after the culture flasks were washed with ice cold PBS and the adherent cells were obtained by gently scraping the culture flask with a cell scraper (Costar, Cambridge, MA) .
  • mice Six to eight week old C.B-17 scid /scid mice were exposed to sublethal irradiation with 400 cGy and within one hour were anaesthetized with Pentobarbital (40-80 mg/kg) and than injected intravenously with 4 x 10 7 uncultured HFBM cells or 4 x 10 7 cultured HFBM cells in a total volume of 500 ⁇ l. The resulting BTCD-huBM mice were assayed for the presence of mononuclear cells in the peripheral lymphoid compartment.
  • mice were sacrificed eight weeks after construction and the cells present in the bone marrow, lymph nodes, spleen and peripheral blood were assessed for their expression of the human leukocyte common antigen, CD45, which is present on human mononuclear cells at all states of differentiation.
  • CD45 human leukocyte common antigen
  • PerCP-conjugated mouse mAb to human CD45, FITC-conjugated mAb to human CD10, or CD20, and PC-conjugated mAb to human CD34 was obtained from Becton Dickinson (Mountain View, CA) ;
  • FITC- conjugated mAb to human CD13 and PE-conjugated, affinity purified (minimal crossreactivity) Fab'2 fragment to human Fc5 ⁇ -IgM, and FITC-conjugated, affinity purified (minimal crossreactivity) Fab'2 fragment to human Fc-IgG were obtained from Jackson Immunoresearch Laboratories, Inc. (West Grove, PA) ;
  • SCID-huBM mice were killed and mononuclear cells were obtained from the peripheral blood, lymph nodes and spleen.
  • Bone marrow cells were obtained by lavage of the mouse femurs with ice-cold PBS-NaN 3 . All cell suspensions were washed twice, counted and resuspended at 1 x 10 6 cells/ml in PBS-NaN 3 . Cells were treated with the indicated antibodies for 30 min. at 4°C and 10,000 events analyzed by FACS. Control HFBM cells were used to set gates for lymphoid (gate Rl) or myeloid (gate R2) cells.
  • Cut off values for the quadrants were set after compensation for PE versus FITC versus PerCP emission based on the analysis of single, double and triple staining of positive and negative control samples (human fetal bone marrow and C.B-17 mouse bone marrow, respectively) as well as appropriate FITC, PD or PerCP labeled isotype controls. All the antibodies used were species-specific and minimally cross-reactive as determined by performing the appropriate control experiments. As shown in Figure 1, pre-culturing HFBM cells significantly increased the engraftment of the mouse bone marrow with human cells (p ⁇ .0005).
  • the rate of migration of the human cells to the mouse bone marrow was assessed by examining the distribution of human CD45+ cells and CD34+CD10+ precursor cells 2 hours and 48 hours after intravenous infusion of irradiated SCID mice with cultured HFBM cells ( Figure 10) .
  • Minimal change was observed in the percentage of lymphocytes in the peripheral blood of SCID-huBM mice expressing human CD45+ cells detected at two hours (5.67%) or 48 hours (5.10%) after injection.
  • the population of human CD45+ cells in the bone marrow increased from 0% to 35%.
  • the temporal difference between repopulation of the peripheral blood and the bone marrow compartment with human cells there was also a qualitative difference.
  • a representative dot histogram of the flow cytometric analysis of cells isolated from the bone marrow of a SCID mouse, a normal human fetus, and a SCID-huBM mouse for the expression of human CD45, CDIO, CD20 and slgM is shown in Figures HA-llI.
  • the maturational state of human B-cells during the process of B-cell lineage commitment and differentiation in human fetal bone marrow can be sequentially divided based on expression of CD34, CDIO, CD20 and slgM into the most immature cells CD34+CD10-, followed by stage I- CD34+CD10+; stage II- CD34-CD10+CD20-sIgM-; and stage III-CD10+CD20+sIgM+ (Labien, et al., (1990), Leukemia, 4:354-358; Loken, et al. (1987), Blood, 70:1316) .
  • Figure 13 shows the distribution Of CD45+CD34+CD10-, CD45+CD34+CD10+, CD45+CD20+sIgM- and CD45+CD20+sIgM+ human lymphocytes in the bone marrow, peripheral blood and spleens of ten SCID-huBM mice.
  • a significant population of precursor CD34+CD10- cells were detected in the bone marrows (1.24% ⁇ 0.37) of the SCID-huBM mice and a smaller population of precursor CD34+CD10- cells were detected in the spleens (0.22% ⁇ 0.009).
  • pre-B-cells 8.66 ⁇ 1.63 over immature/mature B- cells (4.18 ⁇ 0.72)
  • pre-B-cells 8.13 ⁇ 1.88
  • pre-B-cells observed (1.55 ⁇ 0.72) .
  • RNA RNA was extracted with an equal volume of phenol:chloroform, precipitated with 70% ethanol at -70°C and resuspended in guanidine isothiocyanate buffer solution.
  • RNA was obtained by cesium chloride (5.7M) density gradient centrifugation, precipitated twice with ethanol, resuspended to a concentration of 1 ⁇ g/ml in double distilled-deionized, DEPC treated water, and then stored frozen (-70°C) .
  • RNA (7 ⁇ g) in 7 ⁇ l of ddH 2 0 was added to 4 ⁇ l of 5X buffer (250 mM Tris-HCl, pH 8.3/375 mM KC1/15 mM MgCl 2 ) , 2 ⁇ l DTT (100 mM) , 1 ⁇ l of random hexamers (BRL-Gibco) and 5 ⁇ l mixed dNTPs (2mM each) .
  • 5X buffer 250 mM Tris-HCl, pH 8.3/375 mM KC1/15 mM MgCl 2
  • RNA samples were mixed, heated to 65°C for 10 minutes, placed on ice for 5 minutes, 1 ⁇ l (200 units) of Superscript® reverse transcriptase (BRL-Gibco) was added, the reaction mixture was vortexed, briefly spun down, incubated at 37°C for 60 minutes and then placed on ice. After reverse transcription of total RNA extracted from the HFBM cells or the bone marrow cells of the SCID-huBM mice, cDNA was amplified by PCR with human cytokine specific primers for 60 cycles of denaturation at 94°C for 1 minute, annealing at 65°C for 1 minute and extension at 72°C for 1 minute.
  • Superscript® reverse transcriptase BRL-Gibco
  • the primers were designed so that the nucleotide sequence of the 3 • end was complementary to a human cytokine cDNA sequence absent on the mouse cytokine cDNA.
  • the primer pairs were designed to yield an amplification product that spanned exon- exon junctions to ensure that the PCR amplification product was derived form mRNA.
  • the presence of the target mRNA was indicated by the presence of an amplification product of the predicted size following fractionation of the PCR products by electrophoresis and ethidium bromide staining.
  • the primer pairs for each cytokine were selected from published DNA sequences based on previously described quidelines.
  • the nucleotide sequences for 5 ' and 3 * primers respectively were ⁇ 2-microgl ⁇ bulin ( ⁇ 2-MG) , TCTGGCCTTGAGGCTATCCAGCGT (SEQ ID NO: 1) and GTGGTTCACACGGCAGGCATACTC (SEQ ID NO: 2) ; IL-3, CCTTTGCCTTTGCTGGACTTCAAC (SEQ. ID NO: 13) and CAGTCAACCGTCCTTGATATGGATTGG (SEQ ID NO: 14);
  • IL-4 CTCACAGAGCAGAAGACTCTGTGC (SEQ ID NO: 5) and AAFCCCGCCAGGCCCCAGAGGTTCCT (SEQ ID NO 6); IL-5, TTGCTAGCTCTTGGAGCTGCC (SEQ ID NO: 15) and CTTGCAGGTAGTCTAGGAATTGGTTTACT (SEQ ID NO: 16); IL-6, TACATCCTCGACGGCATCTCAGCCC (SEQ ID NO: 7) and CTGGTTCTGTGCCTGCAGCTTCGTCAGC (SEQ ID NO: 8); IL-7, CTGTTGCCAGTAGCATCATCTGATTGTG (SEQ ID NO: 17) and CTTGCGAGCAGCACGGAATAAAAACAT (SEQ ID NO:18); IL-10, CTCCTGACTGGGGTGAAGGGCCAGCCCA (SEQ ID NO: 19) and AGTCGCCACCCTGATGTCTCAGTTTCGT (SEQ ID NO: 20) ; LIF, AACAACCTCATGAACCAGATCAGGAGC
  • the specificity of the PCR amplification was confirmed by demonstrating that the amplification product for each primer pair hybridized to an internal probe complementary to the predicted PCR amplification product following Southern blotting.
  • the specificity of each primer pair for human cDNA was verified by demonstrating that no amplification of the predicted product occurred after RT-PCR of RNA extracted from mouse tissue that expressed the corresponding mouse cytokine. All samples were analyzed by RT-PCR for the presence of mouse or human B2- icroglobulin to verify the integrity of the sample mRNA and the efficiency of subsequent reverse transcription. Positive and negative controls were included in all runs and suggested guidelines for PCR quality control were followed.
  • Example 7 Because the SCID-huBM mice of Example 7 did not receive exogenous human cytokines and cytokines play an important role in the regulation of hematopoiesis, it was investigated whether or not endogenous production of human cytokines associated with the regulation of human hematopoiesis occurred in the bone marrow of the SCID-huBM mice.
  • the expression of human cytokine mRNA was evaluated by RT-PCR with human mRNA- specific cytokine primers as described above. The results are shown in Table 6.
  • BTCD-huCombo mice were prepared by implanting six to eight week old scid/scid with human fetal thymus and liver tissue under the kidney capsules as in Example 1 and after a brief recovery of four to six weeks, the implanted mice were sublethally irradiated and inoculated with pre-cultured fetal bone marrow cells as in Example 8.
  • BTCD-huCombo mice were also prepared by first constructing BTCD-huBM mice as in Example 8 and then implanting synergenic human fetal thymus and human fetal liver tissue, which had been implanted temporarily into another BTCD mouse, under their kidney capsules following a four week recovery from the first procedure.
  • the BTCD-huCombo mice constructed in this manner were analyzed at eight weeks, sixteen weeks and three months later for the expression of human cell surface antigens by lymphocytes in the mouse peripheral blood. The results are shown in Table 7 and Table 8. The data are provided as percentage positive.
  • Table 8 The data in Table 8 indicate that BTCD-huCombo mice are repopulated with human B-cells (CD19) and T-cells (CD3, CD4 and CD8) three months after implantation and engrafting.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Environmental Sciences (AREA)
  • Cell Biology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Zoology (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Souris chimériques BTCD-hu2 destinées à l'étude de la pathogenèse de maladies humaines et à évaluer l'efficacité et la toxicité des traitements utilisés, produites par implantation de tissus de foie et de thymus de foetus humains sous la capsule du rein de souris présentant une déficience en lymphocytes T et B, par greffe de cellules de moelle osseuse f÷tale humaine sur des souris présentant une déficience en lymphocytes T et B et des combinaisons des deux. Les souris chimériques qui en résultent contiennent dans leur compartiment lymphoïde périphérique des lymphocytes T humains, des monocytes humains ou des combinaisons des deux en quantité suffisante pour supporter une infection par le VIH-1 à la suite de l'inoculation intrapéritonéale de VIH-1 chez lesdites souris.
PCT/US1994/010957 1993-09-28 1994-09-28 Modeles de souris immunodeficientes pour analyser la pathogenese de maladies humaines et l'efficacite et la toxicite des traitements utilises WO1995009235A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US12788093A 1993-09-28 1993-09-28
US127,880 1993-09-28
US25277394A 1994-06-02 1994-06-02
US252,773 1994-06-02

Publications (2)

Publication Number Publication Date
WO1995009235A1 true WO1995009235A1 (fr) 1995-04-06
WO1995009235A9 WO1995009235A9 (fr) 1995-05-04

Family

ID=26826051

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1994/010957 WO1995009235A1 (fr) 1993-09-28 1994-09-28 Modeles de souris immunodeficientes pour analyser la pathogenese de maladies humaines et l'efficacite et la toxicite des traitements utilises

Country Status (1)

Country Link
WO (1) WO1995009235A1 (fr)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996039498A1 (fr) * 1995-06-05 1996-12-12 Systemix, Inc. Modele animal reduit chimerique pour infection avec des virus tropes humains
WO1996039810A1 (fr) * 1995-06-07 1996-12-19 Novartis Ag Tissu hepatocellulaire humain chez des animaux chimeres presentant un deficit immunitaire
WO2001005955A2 (fr) * 1999-07-14 2001-01-25 The Board Of Trustees Of The Leland Stanford Junior University Animaux comprenant des tissus hepatocellulaires humains
US6525242B1 (en) 1999-11-02 2003-02-25 The University Of Connecticut Propagation of human hepatocytes in non-human mammals
US6995299B2 (en) 1999-11-02 2006-02-07 University Of Connecticut Propagation of human hepatocytes in non-human animals
CN115094089A (zh) * 2022-05-17 2022-09-23 武汉科技大学 一种抗hiv病毒药物评价动物模型的建立方法及其应用

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
CELL, Volume 64, issued 25 January 1991, McCUNE, "HIV-1: the Infective Process in Vivo", pages 351-363. *
JOURNAL OF EXPERIMENTAL MEDICINE, Volume 172, issued October 1990, NAMIKAWA et al., "Long-term Human Hematopoiesis in the SCID-hu Mouse", pages 1055-1063. *
JOURNAL OF IMMUNOLOGY, Volume 146, No. 11, issued 01 June 1991, KROWKA et al., "Human T Cells in the SCID-hu Mouse are Phenotypically Normal and Functionally Competent", pages 3751-3756. *
JOURNAL OF IMMUNOLOGY, Volume 146, No. 12, issued 15 June 1991, VANDEKERCKHOVE et al., "Clonal Analysis of the Peripheral T Cell Compartment of the SCID-hu Mouse", pages 4173-4179. *
SCIENCE, Volume 242, issued 23 December 1988, KAMEL-REID et al., "Engraftment of Immune-deficient Mice with Human Hematopoietic Stem Cells", pages 1706-1709. *
SCIENCE, Volume 242, issued 23 December 1988, NAMIKAWA et al., "Infection of the SCID-hu Mouse by HIV-1", pages 1684-1686. *
SCIENCE, Volume 251, issued 15 February 1991, MOSIER et al., "Human Immunodeficiency Virus Infection of Human-PBL-SCID-Mice", pages 791-794. *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996039498A1 (fr) * 1995-06-05 1996-12-12 Systemix, Inc. Modele animal reduit chimerique pour infection avec des virus tropes humains
WO1996039810A1 (fr) * 1995-06-07 1996-12-19 Novartis Ag Tissu hepatocellulaire humain chez des animaux chimeres presentant un deficit immunitaire
WO2001005955A2 (fr) * 1999-07-14 2001-01-25 The Board Of Trustees Of The Leland Stanford Junior University Animaux comprenant des tissus hepatocellulaires humains
WO2001005955A3 (fr) * 1999-07-14 2001-08-16 Univ Leland Stanford Junior Animaux comprenant des tissus hepatocellulaires humains
US6660905B1 (en) 1999-07-14 2003-12-09 The Board Of Trustees Of The Leland Stanford Junior University Mice comprising engrafted functional human hepatocytes
US6525242B1 (en) 1999-11-02 2003-02-25 The University Of Connecticut Propagation of human hepatocytes in non-human mammals
US6995299B2 (en) 1999-11-02 2006-02-07 University Of Connecticut Propagation of human hepatocytes in non-human animals
CN115094089A (zh) * 2022-05-17 2022-09-23 武汉科技大学 一种抗hiv病毒药物评价动物模型的建立方法及其应用
CN115094089B (zh) * 2022-05-17 2024-06-07 武汉科技大学 一种抗hiv病毒药物评价动物模型的建立方法及其应用

Similar Documents

Publication Publication Date Title
JP3753321B2 (ja) 異種細胞の生着、分化および増殖に適したマウスの作出方法、該方法により作出されたマウスならびにそのマウスの用途
Colucci et al. Differential requirement for the transcription factor PU. 1 in the generation of natural killer cells versus B and T cells
Maeda et al. Critical role of host γδ T cells in experimental acute graft-versus-host disease
CN102271702B (zh) 抗第三方中枢记忆性t细胞、产生其的方法及其在移植和疾病治疗中的用途
Karsunky et al. Developmental origin of interferon-α–producing dendritic cells from hematopoietic precursors
CN107254439A (zh) 增强自然杀伤细胞增殖和活性的方法
JP4236279B2 (ja) 異種移植に対する寛容性の発現のための代理寛容形成
SG176118A1 (en) Methods of producing humanized non-human mammals
Kollmann et al. Disseminated human immunodeficiency virus 1 (HIV-1) infection in SCID-hu mice after peripheral inoculation with HIV-1.
CN109661463A (zh) 从记忆t细胞生成的反抑细胞
JP4609855B2 (ja) ヒト由来免疫担当細胞の製造方法
WO1995009235A1 (fr) Modeles de souris immunodeficientes pour analyser la pathogenese de maladies humaines et l'efficacite et la toxicite des traitements utilises
WO1995009235A9 (fr) Modeles de souris immunodeficientes pour analyser la pathogenese de maladies humaines et l'efficacite et la toxicite des traitements utilises
Franco et al. Liver-derived T cell clones in autoimmune chronic active hepatitis: accessory cell function of hepatocytes expressing class II major histocompatibility complex molecules
US6455756B1 (en) Long term xenogeneic myeloid and lymphoid cell production in chimeric immunocompromised mice
EP0697875B1 (fr) Utilisation de cellules tall-104 modifiees pour traiter le cancer et les affections virales
Waer et al. Induction of transplantation tolerance in mice across major histocompatibility barrier by using allogeneic thymus transplantation and total lymphoid irradiation.
Koyanagi et al. Humanized mice for human retrovirus infection
Touraine Transplantation of fetal haemopoietic and lymphopoietic cells in humans, with special reference to in utero transplantation
US20060018885A1 (en) Methods for increasing HSC graft efficiency
Camacho et al. Intra-thymic/splenic engraftment of human T cells in HLA-DR1 transgenic NOD/scid mice
Patarca et al. Adoptive CD8+ T-cell immunotherapy of AIDS patients with Kaposi's sarcoma
Inaba Investigating the antibody-independent functions of B lymphocytes
Mukherjee et al. Primary Culture of Immunological Cells
Afkhami-Dastjerdian Characterization of plasmacytoid dendritic cells in the CD4C/HIV transgenic mouse model

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): CA JP

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

COP Corrected version of pamphlet

Free format text: PAGES 1/16-16/16,DRAWINGS,REPLACED BY NEW PAGES BEARING THE SAME NUMBER;DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: CA