Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
  • C07K14/71—Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
  • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
  • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
  • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
  • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
  • A61K47/6415—Toxins or lectins, e.g. clostridial toxins or Pseudomonas exotoxins
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2319/00—Fusion polypeptide

Definitions

• This invention is related to the preparation and use of cytotoxic conjugates.
• substantially monogenous preparations of cytotoxic conjugates, homogeneous compositions of cytotoxic conjugates and methods for preparing such cytotoxic conjugates are provided.
• One goal in pharmacology is to design specific agents that act with high specific activity only on targeted cells or tissues. This aim is of particular importance, for example, in the design of agents for treatments of diseases, such as neoplastic disease and diseases of viral origin, in which the ratio of toxic dose to therapeutic dose is very low and the dosage must be minimized. Numerous approaches to achieving this goal have been developed. Among these are the use of agents, such as growth factors, that act only on specific cells, and the use of toxins that are relatively non-toxic unless delivered intracellularly. Fibroblast growth factors and fibroblast growth factor receptors
• FGF fibroblast growth factor
• Acidic and basic FGF which were the first members of the FGF family that were characterized, are about 55% identical at the amino acid level and are highly conserved among species.
• Basic FGF has a molecular weight of approximately 16 kD, is acidic and temperature sensitive and has a high isoelectric point.
• Acidic FGF has an acidic isoelectric point.
• the other members of the FGF family have subsequently been identified on the basis of amino acid sequence homologies with aFGF and bFGF and common physical and biological properties, including the ability to bind to one or more FGF receptors.
• Basic FGF, int-2, hst-1 /K-FGF, FGF-5, hst- 2/FGF-6 and FGF-8 are oncogenes.
• bFGF is expressed in melanomas
• int-2 is expressed in mammary tumor virus
• hst-1 /K-FGF is expressed in angiogenic tumors.
• Acidic FGF, bFGF, KGF and FGF-9 are expressed in normal cells and tissues.
• FGFs exhibit a mitogenic effect on a wide variety of mesenchymal, endocrine and neural cells. They are also important in differentiation and development. Of particular interest is their stimulatory effect on collateral vascularization and angiogenesis. Such effects have stimulated considerable interest in FGFs as therapeutic agents, for example, as pharmaceuticals for wound healing, neovascularization, nerve regeneration and cartilage repair. In addition to potentially useful proliferative effects, FGF-induced mitogenic stimulation may, in some instances, be detrimental. For example, cell proliferation and angiogenesis are an integral aspect of tumor growth.
• Members of the FGF family, including bFGF are thought to play a pathophysiological role, for example, in tumor development, rheumatoid arthritis, proliferative diabetic retinopathies and other complications of diabetes.
• FGFs are mediated by high affinity receptor tyrosine kinases on the cell surface membranes or FGF-responsive cells (see, e.g., Imamura et aL (1988) Biochem. Biophvs. Res. Comm. 155:583-590; Huang et a_L (1 986) J. Biol. Chem. 261 :9568-9571 , which are incorporated herein by reference).
• Lower affinity receptors also play a role in mediating FGF activities.
• the high affinity receptor proteins which are single chain polypeptides with molecular weights ranging from 1 10 to 1 50 kD, depending on cell type, constitute a family of structurally related FGF receptors.
• Ribosome-inactivating proteins Ribosome-inactivating-proteins (RIPs), which include ricin, abrin and saporin, are plant proteins that catalytically inactivate eukaryotic ribosomes. Some RIPs, such as the toxins abrin and ricin, contain two constituent chains: a cell-binding chain that mediates binding to cell surface receptors and internalizing the molecule; and a chain responsible for toxicity. Such RIPs are type II RIPs. Single chain RIPs, such as the saporins, do not have a cell-binding chain. As a result, unless internalized, they are substantially less toxic to whole cells than the RIPs that have two chains.
• RIPS inactivate ribosomes by interfering with the protein elongation step of protein synthesis.
• the RIP saporin hereinafter also referred to as SAP
• SAP has been shown to inactivate 60S ribosomes by cleavage of the n-glycosidic bond of the adenine at position 4324 in the rat 28S ribosomal RNA (rRNA).
• the particular region in which A 4324 is located in the rRNA is highly conserved among prokaryotes and eukaryotes.
• a 4324 in 28S rRNA corresponds to A 2660 in Escherichia coli ( ⁇ coli) 23S rRNA.
• SAP-6 is the most active and abundant, representing 7% of total seed proteins.
• Saporin is very stable, has a high isoelectric point, does not contain carbohydrates, and is resistant to denaturing agents, such as sodium dodecyl sulfate (SDS), and a variety of proteases.
• SDS sodium dodecyl sulfate
• the amino acid sequences of several saporin-6 isoforms from seeds are known and there appear to be families of saporin RIPs differing in few amino acid residues. Because saporin is a type I RIP, it does not possess a cell-binding chain.
• Cytotoxic conjugates Cytotoxins, such as saporin and ricin A chain, have been covalently linked to cell surface binding proteins to produce cytotoxic chemical conjugates or have been linked to antibodies to produce immunotoxins that are targeted to, and internalized by, specific cells.
• bFGF basic fibroblast growth factor
• FGF-SAP conjugates have been used to treat restenosis (see, e.g.. International Patent Application No. WO 92/1 1872, which is based on U.S. Application Serial No. 07/637,074; see, also U.S. Patent No. 5,308,622) and other FGF-mediated disorders. Treatment is effected by local or intravenous administration of a therapeutically effective amount of the FGF conjugate following, for example, balloon angioplasty. Basic FGF-SAP conjugates also have shown promise as agents for the treatment of certain tumors.
• FGF-SAP The growth of melanomas and other tumors that express receptors to which FGFs bind can be inhibited by FGF-SAP (see, e.g., published International Application WO 92/0491 8, which is based on U.S. Application Serial No. 07/585,319, filed 9/19/90; published International Application No. WO 92/0491 8, which is based on U.S. Patent Application Serial No. 07/585,319; and Beitz et aL. (1992) Cancer Research 52:227-230).
• Conjugates are often synthesized by the use of reactive sulfhydryls either found naturally, as in the case of ricin A chain, in the cytotoxic moiety and the targeting moiety.
• sulfhydryls are introduced into the cytotoxic agent using a chemical coupling agent so that conjugation is possible for antibodies and for RIPs, such as SAP, that are devoid of native or available sulfhydryls.
• the chemistry of conjugation gives rise to various structures, resulting in a heterogeneous population of products that are difficult to separate from each other.
• These structures can include conjugates containing more than one RIP attached to the targeting moiety, more than one targeting moiety attached to the RIP, or more than one RIP attached to more than one targeting moiety.
• the resulting structures also form aggregates because of interactions among the conjugates, particularly among free sulfhydryls in the conjugates. Because of the difficulties encountered in separating the resulting conjugates with different structures, heterogeneous mixtures are often used in experiments and even therapeutic applications.
• bFGF is conjugated via a cysteine residue to saporin, which is first derivatized with N-succinimdyl-3(2-pyridyldithio)propionate (SPDP).
• Basic FGF has at least two cysteines available for reaction with SPDP-derivatized saporin. Consequently, reaction of the bFGF with the SPDP-derivatized SAP results in an array of molecules, which probably differ with respect to biologically relevant properties and may not be ideal for jn vivo applications.
• Gel electrophoresis and western blotting verify that a number of higher molecular weight species are formed.
• the species contain SAP to FGF ratios of 0.5, 1 , 2 and other oligomeric combinations. There is very little information on the relative activities of the various constituents of the heterogeneous population, though it has been reported that polymeric RIPs have increased non-specific toxicities.
• cytotoxic conjugates contain a polypeptide that is reactive with an FGF receptor (also referred to herein as an FGF protein), such as bFGF, linked to a cytotoxic agent.
• FGF receptor also referred to herein as an FGF protein
• bFGF FGF protein
• cytotoxic conjugates contain one molecule of FGF protein per molecule of cytotoxic agent.
• Polypeptides that are reactive with an FGF receptor include any molecule that reacts with FGF receptors on cells that bear FGF receptors and results in internalization of the linked cytotoxic agent.
• Particularly preferred polypeptides that are reactive with an FGF receptor include members of the FGF family of polypeptides, muteins of these polypetides, and chimeric or hybrid molecules that contain portions of any of these family members, as long as the resulting polypeptide binds to FGF receptors and internalizes a linked cytotoxic agent and the resulting preparation of cytotoxic conjugates that contain the FGF protein is monogenous (i.e. each conjugate in a preparation of such conjugates has the same molar ratio of FGF protein to cytotoxic agent).
• the cytotoxic agents include any molecule that, when internalized, is cytotoxic to eukaryotic cells. Such cytotoxic agents include, but are not limited to, ribosome inactivating proteins, inhibitors of DNA, RNA and/or protein synthesis and other metabolic inhibitors. In certain embodiments, the cytotoxic agent is a ribosome-inactivating protein (RIP), such as, for example, saporin, although other cytotoxic agents can also be advantageously used.
• RIP ribosome-inactivating protein
• the preparation may be produced by chemical means so that the resulting conjugates are chemical conjugates or using DNA encoding chimeric molecules to produce fusion proteins.
• the components of the conjugates may also be produced by expression of DNA or by chemical synthesis or any other method known to those of skill in this art.
• the conjugate can be represented by formula: (FGF) n -(cytotoxic agent) m , with the understanding that the FGF and cytotoxic agent may be linked in any order and through any appropriate linkage, as long as the resulting conjugate binds to an FGF receptor and internalizes the cytotoxic agent(s) in cells bearing an FGF receptor.
• FGF refers to the polypeptide reactive with an FGF receptor, n and m, which in monogenous preparations are integers, are the same or different, and are 1 to 6, preferably 1 to 4, and typically 1 or 2, and if m or n, or m and n are greater than 1 , then the conjugate may contain more than one cytotoxic agent and more than one FGF.
• Cytotoxic conjugates that contain a plurality of monomers of an FGF protein linked to the cytotoxic agent are also provided. These conjugates that contain several, typically two to about six, monomers can be produced by linking multiple copies of DNA encoding the FGF fusion protein, typically head-to-tail, under the transcriptional control of a single promoter region.
• the cytotoxic agent is linked to the polypeptide that is reactive with an FGF receptor by the methods provided herein.
• Each member of the resulting preparation of cytotoxic conjugate contains the same molar ratio of cytotoxic agent to polypeptide that is reactive with an FGF receptor.
• each conjugate contains one molecule of each of the constituents.
• the resulting conjugates do not form aggregates.
• Methods for the preparation of the cytotoxic agent such as a ribosome inactivating protein (RIP), including, but not limited to, saporin, and the FGF polypeptides and the monogenous preparation of cytotoxic conjugates that contains a defined molar ratio of each of the constituents are provided. These methods include chemical conjugation methods and methods that rely on recombinant production of the cytotoxic conjugates. The methods result in monogenous preparations of cytotoxic conjugates that can be used, in preferred embodiments, to prepare homogeneous compositions of monogenous cytotoxic conjugates.
• RIP ribosome inactivating protein
• the chemical method relies on several means to reduce the heterogeneity of the resulting cytotoxic conjugate and to avoid interactions among the conjugates that result in aggregate formation.
• the FGF portion of the conjugate is treated so that only one cysteine is available for reaction with the cytotoxic agent and the cytotoxic agent, if necessary, is derivatized and only a single species is selected for reaction with the modified FGF.
• the cytotoxic agent may also be modified to include a cysteine residue. The locus of the cysteine residue is selected such that the cysteine residue is available for conjugation with the available cysteine in the FGF polypeptide and the resulting conjugate is cytotoxic upon internalization by targeted eukaryotic cells.
• modified saporin is provided. Such modifications include, but are not limited to, the introduction of a Cys residue at or near the N-terminus. Saporin is modified by addition of a cysteine residue at the N-terminus-encoding portion of the DNA by addition of a Met-Cys. Saporin also has been modified herein by insertion of a cysteine at position 4 or 10 in place of the wild type residue. The resulting saporin can then be reacted with an available cysteine on an FGF to produce conjugates that are linked via the added Cys or Met-Cys on saporin.
• site-directed mutagenesis has been used to reduce the heterogeneity of the chemical conjugate by replacing one of the reactive cysteines in bFGF with a residue, such as serine, that does not alter the cytotoxicity of the resulting conjugate, and leaves only one cysteine available for reaction with the cytotoxic agent.
• the cytotoxic agent is a single species of derivatized SAP. Because there are slight charge differences among different derivatized SAP species that are produced upon the derivatization of SAP, it has been found herein that it is possible to isolate substantially pure mono-derivatized SAP.
• the saporin is modified at or near the N-terminus to include a cysteine residue, so that the resulting modified saporin can react with the FGF protein without further derivatization.
• the recombinant method relies on the expression of DNA that encodes an FGF protein, modified to remove all cysteines that contribute to aggregate formation, linked to DNA encoding the cytotoxic conjugate.
• DNA encoding the FGF polypeptide is mutagenized so that no cysteines are available in the resulting conjugate for interaction with other conjugates.
• the DNA encoding the modified FGF protein is linked directly to the DNA encoding the N-terminus of the saporin polypeptide or via one, preferably two, or more codons that encode a linking peptide or amino acid. The number of linking codons is selected such that the resulting DNA encodes a fusion protein that is cytotoxic to selected cells.
• the combination of the modified FGF protein and linked cytotoxic agent is prepared as a chimera, using recombinant DNA techniques.
• the fusion protein molecule is designed and produced in such a way that the FGF protein portion of the conjugate is available for recognition of its respective cell-surface receptor and can target the conjugate to cells containing its respective cell-surface receptor.
• the FGF protein is FGF that has been modified by replacement of the cysteine residues at positions 78 and 96 with serine residues.
• the resulting monogenous preparation of conjugates and homogeneous compositions of conjugates produced by any of the methods described herein can be used in pharmaceutical compositions to treat FGF-mediated pathophysiological conditions by specifically targeting to cells having FGF receptors and inhibiting proliferation of or causing death of the cells.
• pathophysiological conditions include, for example, tumor development, restenosis, Dupuytren's Contracture, certain complications of diabetes such as proliferative diabetic retinopathies, and rheumatoid arthritis.
• the treatment is effected by administering a therapeutically effective amount of the FGF conjugate, for example, in a physiologically acceptable excipient.
• the conjugate can be used to target cytotoxic agents into cells having FGF receptors, and to inhibit the proliferation of such cells.
• the resulting preparations of monogenous FGF conjugates or homogeneous compositions of conjugates may also be administered in conjunction with anti-tumor agents, such as cis-platin.
• anti-tumor agents such as cis-platin.
• Such combination therapy enhances the anti-tumor activity of the FGF-conjugates.
• administration of cis-platin in conjunction with an FGF-cytotoxic conjugate enhanced the anti-tumor activity of the FGF-cytotoxic conjugate.
• a method for inhibiting the proliferation of tumor cells that bear FGF receptors by administering a proliferation-inhibiting amount of a cytotoxic conjugate and a cytotoxic amount of cis-platin, in which the amounts of each are such that the combination of cytoxic conjugate and cjs-platin kills or inhibits the growth of the tumor cells, is provided.
• amino acids which occur in the various amino acid sequences appearing herein, are identified according to their well-known, three-letter or one-letter abbreviations.
• nucleotides which occur in the various DNA fragments, are designated with the standard single-letter designations used routinely in the art.
• cytotoxic agents include saporin, the ricins, abrin and other RIPs, Pseudomonas exotoxin. inhibitors of DNA, RNA or protein synthesis or other metabolic inhibitors that are known to those of skill in this art.
• Saporin is preferred, but other suitable RIPs include, but are not limited to, ricin, ricin A chain, maize RIP, gelonin, diphtheria toxin, diphtheria toxin A chain, trichosanthin, tritin, pokeweed antiviral protein (PAP), mirabilis antiviral protein (MAP), Dianthins 32 and 30, abrin, monordin, bryodin, shiga and others known to those of skill in this art.
• PAP pokeweed antiviral protein
• MAP mirabilis antiviral protein
• RIP is used herein to broadly include such cytotoxins, as well as other cytotoxic molecules that inhibit cellular metabolic process, including transcription, translation, biosynthetic or degradative pathways, DNA synthesis and other such process, or that kill cells.
• saporin aborin as SAP
• SAP saporin
• saporin refers to polypeptides having amino acid sequences found in the natural plant host Saponaria officinalis, as well as modified sequences, having amino acid substitutions, deletions, insertions or additions, which still express substantial ribosome-inactivating activity. Purified preparations of saporin are frequently observed to include several molecular isoforms of the protein. It is understood that differences in amino acid sequences can occur in saporin from different species as well as between saporin molecules from individual organisms of the same species.
• N-terminal extension refers to a peptide region that is linked to the amino terminus of a biologically active portion of a saporin polypeptide. As demonstrated herein, when saporin is produced by expressing DNA encoding in a host cell, it is expressed with an N-terminal extension. The N-terminal extension serves to render the saporin polypeptide portion of the saporin-containing protein either nontoxic to the host upon expression of the protein in the host or substantially less toxic to the host than the expression of a saporin polypeptide without an N-terminal extension. N-terminal extensions having as few as 2 amino acids, and up to many amino acids, are provided.
• the length of the N-terminal extension is not important as long as the resulting cytotoxic conjugate binds to cell surface receptors, internalizes the cytotoxic agent and is cytotoxic upon internalization, can be employed.
• the precise number for the upper limit can be determined empirically, using cytotoxicity assays, such as those exemplified herein, that are known to those of skill in this art.
• Presently preferred N-terminal extension regions are on the order of about 2 to 1 5 amino acids. Most preferred N-terminal extension regions are in the range of about 2 to about 10 amino acids.
• a modification that is effected substantially near the N-terminus of a cytotoxic agent, such as saporin, is generally effected within the first about ten residues of the protein.
• Such modifications include the addition or deletion of residues, such as the addition of a cysteine facilitate conjugation between the polypeptide reactive with an FGF receptor or fragment of the polypeptide and the cytotoxic moiety portion to form cytotoxic agents that contain a defined molar ratio, preferably a ratio of 1 : 1 , of cytotoxic agent and polypeptide reactive with an FGF receptor or fragment of the polypeptide.
• a mitotoxin is a cytotoxic molecule targeted to specific cells by a mitogen.
• cytotoxic agent refers to a molecule capable of inhibiting cell function.
• the agent may inhibit proliferation or may be toxic to cells.
• the term includes agents whose toxic effects are mediated only when transported into the cell and also those whose toxic effect is mediated at the cell surface.
• a variety of cytotoxic agents can be used and include those that inhibit protein synthesis and those that inhibit expression of certain genes essential for cellular growth or survival. Cytotoxic agents include those that result in cell death and those that inhibit cell growth, proliferation and/or differentiation.
• ligand refers to any polypeptide that is capable of binding to a cell-surface protein and is capable of facilitating the internalization of a ligand-containing fusion protein into the cell.
• Such ligands include growth factors, antibodies or fragments thereof, hormones, and other types of proteins.
• polypeptide reactive with an FGF receptor refers to any polypeptide that specifically interacts with an FGF receptor, preferably the high-affinity FGF receptor, and that is transported into the cell by virtue of its interaction with the FGF receptor.
• Polypeptides reactive with an FGF receptor are also referred to herein as FGF proteins.
• FGF proteins include members of the FGF family of peptides, including FGF- 1 through FGF-9, chimeras or hybrids of any of FGF-1 through FGF-9, or FGFs that have deletions (see, e.g.. Published International Application No. WO 90/02800, national stage applications, and patents based thereon) or insertions of amino acids, as long as the resulting peptide or protein specifically interacts with an FGF receptor and is internalized by virtue of this interaction.
• FGF refers to polypeptides having amino acid sequences of native FGF proteins, as well as modified sequences, having amino acid substitutions, deletions, insertions or additions in the native protein but retaining the ability to bind to FGF receptors and to be internalized.
• polypeptides include, but are not limited to, FGF-1 - FGF-9.
• bFGF should be generally understood to refer to polypeptides having substantially the same amino acid sequences and receptor-targeting activity as that of bovine bFGF or human bFGF or an acidic FGF.
• FGFs are also intended to encompass proteins isolated from natural sources as well as those made synthetically, as by recombinant means or possibly by chemical synthesis.
• FGF also encompasses muteins of FGF that possess the ability to target saporin to FGF-receptor expressing cells.
• Such muteins include, but are not limited to, those produced by replacing one or more of the cysteines with serine as herein or that have any other amino acids deleted or replaced as long as the resulting protein has the ability to bind to FGF-receptor bearing cells and internalize the linked cytotoxic agent.
• such muteins will have conservative amino acid changes, such as those set forth below in Table 1 .
• DNA encoding such muteins will, unless modified by replacement of degenerate codons, hybridize under conditions of at least low stringency to DNA encoding bFGF (SEQ ID NO. 12 and 13) or DNA encoding any of the FGF's set forth in SEQ ID. NOs. 24-32.
• DNA encoding an FGF peptide or polypeptide reactive with an FGF receptor refers to any of the DNA fragments set forth herein as coding such peptides, to any such DNA fragments known to those of skill in the art, any DNA fragment that encodes an FGF that binds to an FGF receptor and is internalized thereby and may be isolated from a human cell library using any of the preceding DNA fragments as a probe any DNA fragment that encodes any of the FGF peptides set forth in SEQ ID NOs. 24-32 (such DNA sequences are available in publicly accessible databases, such as DNA * (July, 1993 release from DNASTAR, Inc. Madison, Wl; see, also U.S. Patent No. 4,956,455, U.S. Patent No.
• FGF receptors refer to receptors that specifically interact with a member of the FGF family of proteins and transport it into the cell. Included among these are the receptors described in International Application No. WO 91 /00916, which is based on U.S. Patent Application Serial No.07/377,033; International Application No. WO 92/00999, which is based on U.S. Patent Application Serial No.07/549,587; International Application No. WO 90/05522; and International Application No. WO 92/12948; see, also Imamura (1988) Biochem. Biophvs. Res. Comm. 155:583-590 and Moscatelli (1987) J. Cell. Phvsiol. 131 :123-130.
• cytotoxic agent means to direct it to a cell that expresses a selected receptor by linking the agent to a polypeptide reactive with an FGF receptor. Upon binding to the receptor the saporin- containing protein is internalized by the cell and is cytotoxic to the cell.
• preparations of monogenous conjugates are preparations of conjugates in which each conjugate has the same, generally about 1 :1 , though not necessarily, molar ratio of targeting molecule to targeted agent.
• Monogenous conjugates are substantially identical in that they possess indistinguishable chemical and physical properties and generally preparations of such conjugates contain only one species of conjugate. It is, of course understood, that some variability among the species may be present and will be tolerated to the extent that the activity of each member of the conjugate is substantially the same.
• saporin that is expressed in bacterial hosts as provided herein may contain a mixture of species that differ at their N-terminus.
• each conjugate contains the same molar ratio of FGF protein to targeted agent, but each conjugate is not necessarily identical, but is substantially identical in that each conjugate has substantially the same biological activity.
• a homogeneous population or composition of conjugates means that the constituent members of the population or composition are monogenous and further do not form aggregates.
• secretion signal refers to a peptide region within the precursor protein that directs secretion of the precursor protein from the cytoplasm of the host into the periplasmic space or into the extracellular growth medium. Such signals may be either at the amino terminus or carboxyl terminus of the precursor protein. The preferred secretion signal is linked to the amino terminus of the N-terminal extension region.
• vector or plasmid refers to discrete elements that are used to introduce heterologous DNA into cells for either expression of the heterologous DNA or for replication of the cloned heterologous DNA. Selection and use of such vectors and plasmids are well within the level of skill of the art.
• expression vector includes vectors capable of expressing DNA fragments that are in operative linkage with regulatory sequences, such as promoter regions, that are capable of effecting expression of such DNA fragments.
• an expression vector refers to a recombinant DNA or RNA construct, such as a plasmid, a phage, recombinant virus or other vector that, upon introduction into an * appropriate host cell, results in expression of the cloned DNA.
• Appropriate expression vectors are well known to those of skill in the art and include those that are replicable in eukaryotic cells and/or prokaryotic cells and those that remain episomal or may integrate into the host cell genome.
• operative linkage or operative association of heterologous DNA to regulatory and effector sequences of nucleotides refers to the functional relationship between such DNA and such sequences of nucleotides.
• operative linkage of heterologous DNA to a promoter refers to the physical and functional relationship between the DNA and the promoter such that the transcription of such DNA is initiated from the promoter by an RNA polymerase that specifically recognizes, binds to and transcribes the DNA in reading frame.
• a promoter region refers to the portion of DNA of a gene that controls transcription of DNA to which it is operatively linked.
• a portion of the promoter region includes specific sequences of DNA that are sufficient for RNA polymerase recognition, binding and transcription initiation. This portion of the promoter region is referred to as the promoter.
• the promoter region includes sequences that modulate this recognition, binding and transcription initiation activity of the RNA polymerase. These sequences may be cis acting or may be responsive to trans acting factors. Promoters, depending upon the nature of the regulation, may be constitutive or regulated. For use herein, inducible promoters are preferred. The promoters are recognized by an RNA polymerase that is expressed by the host.
• RNA polymerase may be endogenous to the host or may be introduced by genetic engineering into the host, either as part of the host chromosome or on an episomal element, including a plasmid containing the DNA encoding the saporin- containing polypeptide.
• Most preferred promoters for use herein are tightly regulated such that, absent induction, the DNA encoding the saporin- containing protein is not expressed.
• a transcription terminator region has either (a) a subsegment that encodes a polyadenylation signal and polyadenylation site in the transcript, and/or (b) a subsegment that provides a transcription termination signal that terminates transcription by the polymerase that recognizes the selected promoter.
• the entire transcription terminator may be obtained from a protein-encoding gene, which may be the same or different from the gene, which is the source of the promoter.
• Preferred transcription terminator regions are those that are functional in EL coli. Transcription terminators are optional components of the expression systems herein, but are employed in preferred embodiments.
• transfection refers to the taking up of DNA or RNA by a host cell. Transformation refers to this process performed in a manner such that the DNA is replicable, either as an extrachromosomal element or as part of the chromosomal DNA of the host.
• Methods and means for effecting transfection and transformation are well known to those of skill in this art (see, e.g., Wigler et a ( 1979) Proc. Natl. Acad. Sci. USA 76: 1373- 1376; Cohen et al (1972) Proc. Natl. Acad. Sci. USA 69:21 10).
• biologically active refers to the ability of such polypeptide to inhibit protein synthesis by inactivation of ribosomes either in vivo or in vitro or to inhibit the growth of or kill cells upon internalization of the saporin-containing polypeptide by the cells.
• Preferred biologically active saporin polypeptides are those that are toxic to eukaryotic cells upon entering the cells.
• Such biological or cytotoxic activity may be assayed by any method known to those of skill in the art including, but not limited to, the jn vitro assays that measure protein synthesis and ]n vivo assays that assess cytotoxicity by measuring the effect of a test compound on cell proliferation or on protein synthesis. Particularly preferred, however, are assays that assess cytotoxicity in targeted cells.
• FGF-mediated pathophysiological condition refers to a deleterious condition characterized by or caused by proliferation of cells that are sensitive to bFGF mitogenic stimulation.
• Basic FGF-mediated pathophysiological conditions include, but are not limited to, certain tumors, rheumatoid arthritis, restenosis, Dupuytren's Contracture and certain complications of diabetes, such as proliferative retinopathy.
• substantially pure means sufficiently homogeneous to appear free of readily detectable impurities as determined by standard methods of analysis, such as thin layer chromatography (TLC), gel electrophoresis, high performance liquid chromatography (HPLC), used by those of skill in the art to assess such purity, or sufficiently pure such that further purification would not detectably alter the physical and chemical properties, such as enzymatic and biological activities, of the substance.
• TLC thin layer chromatography
• HPLC high performance liquid chromatography
• Methods for purification of the compounds to produce substantially chemically pure compounds are known to those of skill in the art.
• a substantially chemically pure compound may, however, be a mixture of stereoisomers. In such instances, further purification might increase the specific activity of the compound.
• isolated, substantially pure DNA refers to DNA fragments purified according to standard techniques employed by those skilled in the art (see, e.g., Maniatis et aL. (1 982) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY and Sambrook et aL. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.).
• hybridize under conditions of a specified stringency is used to describe the stability of hybrids formed between two single-stranded DNA fragments and refers to the conditions of ionic strength and temperature at which such hybrids are washed, following annealing under conditions of stringency less than or equal to that of the washing step.
• high, medium and low stringency encompass the following conditions or equivalent conditions thereto:
• medium stringency 0.2 x SSPE or SSC, 0.1 % SDS, 50°C
• low stringency 1 .0 x SSPE or SSC, 0.1 % SDS, 50°C.
• Equivalent conditions refer to conditions that select for substantially the same percentage of mismatch in the resulting hybrids. Additions of ingredients, such as formamide, Ficoll, and Denhardt's solution affect parameters such as the temperature under which the hybridization should be conducted and the rate of the reaction. Thus, hybridization in 5 X SSC, in 20% formamide at 42° C is substantially the same as the conditions recited above hybridization under conditions of low stringency.
• the recipes for SSPE, SSC and Denhardt's and the preparation of deionized formamide are described, for example, in Sambrook et aL (1989) Molecular Cloning. A Laboratory Manual, Cold Spring Harbor Laboratory Press, Chapter 8; see, Sambrook et aL., vol. 3, p. B.13, see, also, numerous catalogs that describe commonly used laboratory solutions).
• SSPE is pH 7.4 phosphate-buffered 0.18 NaCI.
• expression refers to the process by which nucleic acid is transcribed into mRNA and translated into peptides, polypeptides, or proteins. If the nucleic acid is derived from genomic DNA, expression may, if an appropriate eukaryotic host cell or organism is selected, include splicing of the mRNA.
• culture means a propagation of cells in a medium conducive to their growth, and all sub-cultures thereof.
• subculture refers to a culture of cells grown from cells of another culture (source culture), or any subculture of the source culture, regardless of the number of subculturings that have been performed between the subculture of interest and the source culture.
• source culture a culture of cells grown from cells of another culture (source culture), or any subculture of the source culture, regardless of the number of subculturings that have been performed between the subculture of interest and the source culture.
• reference to nucleic acids includes duplex DNA, single-stranded DNA, RNA in any form, including triplex, duplex or single- stranded RNA, anti-sense RNA, polynucleotides, oligonucleotides, single nucleotides and derivatives thereof.
• an effective amount of a compound for treating a particular disease is an amount that is sufficient to ameliorate, or in some manner reduce the symptoms associated with the disease. Such amount may be administered as a single dosage or may be administered according to a regimen, whereby it is effective. The amount may cure the disease but, typically, is administered in order to ameliorate the symptoms of the disease. Repeated administration may be required to achieve the desired amelioration of symptoms.
• pharmaceutically acceptable salts, esters or other derivatives of the conjugates include any salts, esters or derivatives that may be readily prepared by those of skill in this art using known methods for such derivatization and that produce compounds that may be administered to animals or humans without substantial toxic effects and that either are pharmaceutically active or are prodrugs.
• a prodrug is a compound that, upon ]n vivo administration, is metabolized or otherwise converted to the biologically, pharmaceutically or therapeutically active form of the compound.
• the pharmaceutically active compound is modified such that the active compound will be regenerated by metabolic processes.
• the prodrug may be designed to alter the metabolic stability or the transport characteristics of a drug, to mask side effects or toxicity, to improve the flavor of a drug or to alter other characteristics or properties of a drug.
• treatment means any manner in which the symptoms of a condition, disorder or disease are ameliorated or otherwise beneficially altered. Treatment also encompasses any pharmaceutical use of the compositions herein.
• amelioration of the symptoms of a particular disorder by administration of a particular pharmaceutical composition refers to any lessening, whether permanent or temporary, lasting or transient that can be attributed to or associated with administration of the composition.
• ED 50 refers to the concentration at which 50% of the cells are killed following incubation, generally for 72-hours or other specified time period, with a toxin, such as FGF-SAP.
• ID 50 refers to the concentration of saporin-containing protein required to inhibit protein synthesis in treated cells to 50% of the protein synthesis in the absence of the protein.
• DNA encoding the FGF polypeptide may be isolated, synthesized or obtained from commercial sources (the amino acid sequences of FGF-1 - FGF-9 are set forth in SEQ ID NOs. 24-32; DNA sequences may be based on these amino acid sequences or may be those that are known to those of skill in this art (see, e.g., DNA* (July, 1993 release from DNASTAR, Inc. Madison, Wl); see, also U.S. Patent No. 4,956,455, U.S. Patent No. 5,126,323, U.S. Patent No. 5, 1 55,21 7, U.S. Patent No. 4,868.1 13, published International Application WO/90/08771 (and the corresponding U.S.
• Mutation may be effected by any method known to those of skill in the art, including site-specific or site-directed mutagenesis of DNA encoding the protein and the use of DNA amplification methods using primers to introduce and amplify alterations in the DNA template.
• Site-specific mutagenesis is typically effected using a phage vector that has single- and double-stranded forms, such as M13 phage vectors, which are well-known and commercially available.
• Other suitable vectors that contain a single- stranded phage origin of replication may be used (see, e.g., Veira et aL. (1987) Meth. Enzvmol. 1 5:3).
• site-directed mutagenesis is performed by preparing a single-stranded vector that encodes the protein of interest (i.e., a member of the FGF family or a cytotoxic molecule, such as a saporin).
• An oligonucleotide primer that contains the desired mutation within a region of homology to the DNA in the single-stranded vector is annealed to the vector followed by addition of a DNA polymerase, such as EL coli polymerase I Klenow fragment, which uses the double stranded region as a primer to produce a heteroduplex in which one strand encodes the altered sequence and the other the original sequence.
• the heteroduplex is introduced into appropriate bacterial cells and clones that include the desired mutation are selected.
• the resulting altered DNA molecules may be expressed recombinantly in appropriate host cells to produce the modified protein.
• Suitable conservative substitutions of amino acids are known to those of skill in this art and may be made generally without altering the biological activity of the resulting molecule. Those of skill in this art recognize that, in general, single amino acid substitutions in non-essential regions of a polypeptide do not substantially alter biological activity (see, e.g., Watson et aL Molecular Biology of the Gene, 4th Edition, 1 987, The Bejacmin/Cummings Pub. co., p.224).
• the cytotoxic agent Saporin and other ribosome inactivating proteins are the preferred cytotoxic agent for use herein. Any cytotoxic agent that, when internalized inhibits or destroys cell growth, cell proliferation or other essential cell functions may be used herein. Such cytotoxic agents are considered to be functionally equivalent to the RIPs described herein, and include, but are not limited to, saporin, the ricins, abrin and other RIPs, Pseudomonas exotoxin, inhibitors of DNA, RNA or protein synthesis or other metabolic inhibitors that are known to those of skill in this art.
• Saporin is preferred, but other suitable RIPs include, but are not limited to, ricin, ricin A chain, maize RIP, gelonin, diphtheria toxin, diphtheria toxin A chain, trichosanthin, tritin, pokeweed antiviral protein (PAP), mirabilis antiviral protein (MAP), Dianthins 32 and 30, abrin, monordin, bryodin, shiga and others known to those of skill in this art (see, e.g., Barbieri et aL. (1982) Cancer Surveys 1 :489-520 and European published patent application No. 0466 222, incorporated herein by reference, which provide lists of numerous RIPs and their sources; see, also, U.S. Patent No. 5,248,608 to Walsh et aL., which provides a RIP from maize).
• the selected cytotoxic agent is, if necessary, derivatized to produce a group reactive with a cysteine on the selected FGF. If derivatization results in a mixture of reactive species, a mono-derivatized form of the cytotoxic agent is isolated and is then conjugated to the mutated FGF.
• a. Isolation of saporin and DNA encoding saporin Saporin is preferred herein.
• the saporin polypeptides include any of the isoforms of saporin that may be isolated from Saponaria officinalis or related species or modified form that retain cytotoxic activity. In particular, such modified saporin may be produced by modifying the DNA encoding the protein (see, e.g.. International PCT Application Serial No.
• any such protein, or portion thereof, that, when conjugated to FGF as described herein, that exhibits cytotoxicity in standard jn vitro or in vivo assays within at least about an order of magnitude of the saporin conjugates described herein is contemplated for use herein.
• the SAP used herein includes any protein that is isolated from natural sources or that is produced by recombinant expression (see, e.g., copending International PCT Application Serial No. PCT/US93/05702, filed on June 14, 1 993, which is a continuation-in-part of United States '
• DNA encoding SAP or any cytotoxic agent may be used in the recombinant methods provided herein.
• the DNA may be modified to include cysteine codon.
• the codon may be inserted into any locus that does not reduce or reduces by less than about one order of magnitude the cytotoxicity of the resulting protein may be selected. Such locus may be determined empirically by modifying the protein and testing it for cytotoxicity in an assay, such as a cell-free protein synthesis assay. The preferred loci in
• SAP for insertion of the cysteine residue is at or near the N-terminus
• Host organisms include those organisms in which recombinant production of heterologous proteins have been carried out, such as, but not limited to, bacteria (for example, E. coli), yeast (for example, Saccharo- myces cerevisiae and Pichia pastoris), mammalian cells, insect cells.
• bacteria for example, E. coli
• yeast for example, Saccharo- myces cerevisiae and Pichia pastoris
• mammalian cells insect cells.
• Presently preferred host organisms are strains of bacteria. Most preferred host organisms are strains of JE-, coli. c. Methods for recombinant production of saporin
• the DNA encoding the cytotoxic agent, such as saporin protein is introduced into a plasmid in operative linkage to an appropriate promoter for expression of polypeptides in a selected host organism.
• the presently preferred saporin proteins are saporin proteins that have been modified by addition of a Cys residue or replacement of a non-essential residue at or near the amino- or carboxyl terminus of the saporin with Cys. Saporin, such as that of SEQ ID NO.
• the DNA fragment encoding the saporin may also include a protein secretion signal that functions in the selected host to direct the mature polypeptide into the periplasm or culture medium.
• the resulting saporin protein can be purified by methods routinely used in the art, including, methods described hereinafter in the Examples.
• suitable host cells preferably bacterial cells, and more preferably J con cells
• methods applicable for culturing said cells containing a gene encoding a heterologous protein are generally known in the art. See, for example, Sambrook et al. (1 989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
• the DNA construct encoding the saporin protein is introduced into the host cell by any suitable means, including, but not limited to transformation employing plasmids, viral, or bacterial phage vectors, transfection, electroporation, lipofection, and the like.
• the heterologous DNA can optionally include sequences, such as origins of replication that allow for the extrachromosomal maintenance of the saporin-containing plasmid, or can be designed to integrate into the genome of the host (as an alternative means to ensure stable maintenance in the host).
• Positive transformants can be characterized by Southern blot analysis (Sambrook et aL. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY) for the site of DNA integration; Northern blots for inducible-promoter-responsive saporin gene expression; and product analysis for the presence of saporin- containing proteins in either the cytoplasm, periplasm, or the growth media.
• the desired saporin-containing protein is produced by subjecting the host cell to conditions under which the promoter is induced, whereby the operatively linked DNA is transcribed.
• such conditions are those that induce expression from the E, coli lac operon.
• the plasmid containing the DNA encoding the saporin- containing protein also includes the lac operator (0) region within the promoter and may also include the lac I gene encoding the lac repressor protein (see, e.g.. Muller-Hill et aL (1968) Proc. Natl. Acad. Sci. USA 59: 1259-12649).
• the lac repressor represses the expression from the lac promoter until induced by the addition of IPTG in an amount sufficient to induce transcription of the DNA encoding the saporin-containing protein.
• the expression of saporin in . coli is, thus accomplished in a two- stage process.
• a culture of transformed J coli cells is grown under conditions in which the expression of the saporin-containing protein within the transforming plasmid, preferably a encoding a saporin, such as described in Example 4, is repressed by virtue of the lac repressor.
• cell density increases.
• the second stage commences by addition of IPTG, which prevents binding of repressor to the operator thereby inducing the lac promoter and transcription of the saporin-encoding DNA.
• the promoter is the T7 RNA polymerase promoter, which may be linked to the lac operator and the EL coli host strain includes DNA encoding T7 RNA polymerase operably linked to the lac operator and a promoter, preferably the lacUV ⁇ promoter.
• the presently preferred plasmid is pET 1 1 a (NOVAGEN, Madison, Wl), which contains the T7lac promoter, T7 terminator, the inducible E coli lac operator, and the lac repressor gene.
• the plasmid pET 1 5b (NOVAGEN, Madison, Wl), which contains a His-TagTM leader sequence (Seq. ID No.
• T7 RNA polymerase for use in purification with a His column and a thrombin cleavage site that permits cleavage following purification over the column, the T7-lac promoter region and the T7 terminator, has been used herein for expression of saporin.
• Addition of IPTG induces expression of the T7 RNA polymerase and the T7 promoter, which is recognized by the T7 RNA polymerase.
• Transformed strains which are of the desired phenotype and genotype, are grown in fermentors by suitable methods well known in the art. In the first, or growth stage, expression hosts are cultured in defined minimal medium lacking the inducing condition, preferably IPTG.
• the inducer preferably IPTG
• IPTG-responsive promoter a promoter region that contains lac operator
• the resulting saporin-containing protein can be suitably isolated from the other fermentation products by methods routinely used in the art, e.g., using a suitable affinity column as described in Example 1 .E-F and 2.D; precipitation with ammonium sulfate; gel filtration; chromatography, preparative flat-bed iso-electric focusing; gel electrophoresis, high performance liquid chromatography (HPLC); and the like.
• a method for isolating saporin is provided in EXAMPLE 1 (see, also Lappi et aL. (1 985) Biochem. Biophvs. Res. Commun. 129:934-942).
• the expressed saporin protein is isolated from either the cytoplasm, periplasm, or the cell culture medium (see, discussion below B.1 .b below and see, e.g., EXAMPLE 4 for preferred methods and saporin proteins).
• the DNA construct is introduced into a plasmid for expression in a desired host.
• the host is a bacterial host.
• the sequences of nucleotides in the plasmids that are regulatory regions, such as promoters and operators, are operationally associated with one another for transcription of the sequence of nucleotides that encode a saporin-containing protein.
• the sequence of nucleotides encoding the saporin-containing protein may also include DNA encoding a secretion signal, whereby the resulting peptide is a precursor of saporin.
• the resulting processed saporin protein which if not processed such that the resulting protein is identical to a native saporin, retains the cytotoxic activity of the native saporin protein, may be recovered from the periplasmic space or the fermentation medium.
• the DNA plasmids also include a transcription terminator sequence.
• the promoter regions and transcription terminators are each independently selected from the same or different genes.
• the plasmids used herein preferably include a promoter in operable association with the DNA encoding the saporin-containing protein and are designed for expression of proteins in a bacterial host. It has been found that tightly regulatable promoters are preferred for expression of saporin. Suitable promoters for expression of saporin-containing proteins are widely available and are well known in the art. Inducible promoters or constitutive promoters that are linked to regulatory regions are preferred. Such promoters include, but are not limited to, the T7 phage promoter and other T7-like phage promoters, such as the T3, T5 and SP6 promoters, the trp, Ipp, and lac promoters, such as the lacUV ⁇ , from E.
• coli the P10 or polyhedron gene promoter of baculovirus/insect cell expression systems and inducible promoters from other eukaryotic expression systems.
• promoters are inserted in a plasmid in operative linkage with a control region such as the lac operon.
• Preferred promoter regions are those that are inducible and functional in EL coli.
• suitable inducible promoters and promoter regions include, but are not limited to: the EL coli lac operator responsive to isopropyl ?-D-thiogalactopyranoside (IPTG; see, et aL.
• the plasmids also preferably include a selectable marker gene or genes that are functional in the host.
• a selectable marker gene includes any gene that confers a phenotype on bacteria that allows transformed bacterial cells to be identified and selectively grown from among a vast majority of untransformed cells.
• Suitable selectable marker genes for bacterial hosts include the ampicillin resistance gene (Amp r ), tetracycline resistance gene (Tc r ) and the kanamycin resistance gene (Kan r ). The kanamycin resistance gene is presently preferred.
• the preferred plasmids also include DNA encoding a signal for secretion of the operably saporin-containing protein.
• Secretion signals suitable for use are widely available and are well known in the art. Prokaryotic and eukaryotic secretion signals functional in EL coli may be employed. The presently preferred secretion signals include, but are not limited to, those encoded by the following EL coli genes: ompA, ompT, ompF, ompC, beta-lactamase, and alkaline phosphatase, and the like (von Heijne (1985) J. Mol. Biol. 184:99-105). In addition, the bacterial pelB gene secretion signal (Lei et aL (1987) J.
• Bacteriol. 169:4379 Bacteriol. 169:4379
• the phoA secretion signal, and the cek2 functional in insect cell may be employed.
• the most preferred secretion signal is the . coli ompA secretion signal.
• Other prokaryotic and eukaryotic secretion signals known to those of skill in the art may also be employed (see, e.g.. von Heijne (1985) J. Mol. Biol. 184:99-105).
• one of skill in the art can substitute secretion signals that are functional in either yeast, insect or mammalian cells to secrete saporin-containing proteins from those cells.
• coli cells include the pET expression vectors (see, U.S patent 4,952,496; available from NOVAGEN, Madison, Wl).
• Such plasmids include pET 1 1 a, which contains the T7lac promoter, T7 terminator, the inducible JE coli lac operator, and the lac repressor gene; pET 12a-c, which contains the T7 promoter, T7 terminator, and the . coli ompT secretion signal; and pET 15b (NOVAGEN, Madison, Wl), which contains a His-TagTM leader sequence (Seq. ID No. 36) for use in purification with a His column and a thrombin cleavage site that permits cleavage following purification over the column; the T7-lac promoter region and the T7 terminator.
• His-TagTM leader sequence Seq. ID No. 36
• plasmids include the pKK plasmids, particularly pKK 223-3, which contains the TAC promoter, (available from Pharmacia; see also, Brosius et aL (1984) Proc.. Natl. Acad. Sci. 81 :6929: Ausubel et jaL, Current Protocols in Molecular Biology; U.S. Patent Nos. 5,122,463, 5,173,403, 5,187,1 53, 5,204,254, 5,212,058, 5,212,286, 5,21 5,907, 5,220,01 3, 5,223,483, and 5,229,279), which contain the TAC promoter.
• Plasmid pKK has been modified by disruption of the ampicillin resistance marker gene by digestion with Seal and insertion of a kanamycin resistance cassette (purchased from Pharmacia; obtained from pUC4K, see, e.g., Vieira et aL (1 982) Gene 19:259-268: and U.S. Patent No. 4,71 9,179) cut with Hindi to remove the EcoRI sticky ends and produce blunt ends.
• Baculovirus vectors such as a pBlueBac (also called pJVETL and derivatives thereof) vector, particularly pBlueBac III, (see, e.g., U.S. Patent Nos.
• the pBlueBaclll vector is a dual promoter vector and provides for the selection of recombinants by blue/white screening as this plasmid contains the ⁇ - galactosidase gene (lacZ) under the control of the insect recognizable ETL promoter and is inducible with IPTG.
• a DNA construct is inserted into a baculovirus vector pBluebac III (INVITROGEN, San Diego, CA) and then co- transfected with wild type virus into insect cells Spodoptera frugiperda (sf 9 cells; see, e.g.. Luckow et aL (1988) Bio/technology 6:47-55 and U.S. Patent No. 4,745,051 ).
• plN-lllompA plasmids include the plN-lllompA plasmids (see, U.S. Patent No. 4,575,013 to Inouye; see, also, Duffaud et aL (1987) Meth. Enz. 153:492-507), such as plN-lllompA2 .
• the plN-lllompA plasmids include an insertion site for the heterologous DNA (the DNA encoding a saporin- containing protein) linked for transcriptional expression in reading phase with four functional fragments derived from the lipoprotein gene of , coli.
• the plasmids also include a DNA fragment coding for the signal peptide of the ompA protein of ⁇ __ coli, positioned such that the desired polypeptide is expressed with the ompA signal peptide at its amino terminus, thereby allowing efficient secretion across the cytoplasmic membrane.
• the plasmids further include DNA encoding a specific segment of the EL coli lac promoter-operator, which is positioned in the proper orientation for transcriptional expression of the desired polypeptide, as well as a separate functional E. coli lad gene encoding the associated repressor molecule that, in the absence of lac operon inducer, interacts with the lac promoter-operator to prevent transcription therefrom.
• Expression of the desired polypeptide is under the control of the lipoprotein (Ipp) promoter and the lac promoter-operator, although transcription from either promoter is normally blocked by the repressor molecule.
• the repressor is selectively inactivated by means of an inducer molecule thereby inducing transcriptional expression of the desired polypeptide from both promoters.
• the DNA fragment is replicated in bacterial cells, preferably in E. coli.
• the preferred DNA fragment also includes a bacterial origin of replication, to ensure the maintenance of the DNA fragment from generation to generation of the bacteria. In this way, large quantities of the DNA fragment can be produced by replication in bacteria.
• Preferred bacterial origins of replication include, but are not limited to, the f1 -ori and col E1 origins of replication.
• Preferred hosts contain chromosomal copies of DNA encoding T7 RNA polymerase operably linked to an inducible promoter, such as the lacUV promoter (see, U.S. Patent No. 4,952,496).
• Such hosts include, but are not limited to, lysogens EL coJi strains HMS1 74(DE3)pLysS, BL21 (DE3)pLysS, HMS174(DE3) and BL2KDE3). Strain BL2KDE3) is preferred.
• the pLys strains provide low levels of T7 lysozyme, a natural inhibitor of T7 RNA polymerase.
• the DNA fragments provided may also contain a gene coding for a repressor-protein.
• the repressor-protein is capable of repressing the transcription of a promoter that contains sequences of nucleotides to which the repressor-protein binds. The promoter can be derepressed by altering the physiological conditions of the cell.
• the alteration can be accomplished by the addition to the growth medium of a molecule that inhibits, for example, the ability to interact with the operator or with regulatory proteins or other regions of the DNA or by altering the temperature of the growth media.
• Preferred repressor-proteins include, but are not limited to, the E. coli. lad repressor responsive to IPTG induction, the temperature sensitive cl857 repressor, and the like. The E. coli la repressor is preferred.
• DNA encoding full-length bFGF or the bFGF muteins has been linked to DNA encoding the mature saporin protein and introduced into the pET vectors, including pET-1 1 a and pET-12a expression vectors (NOVAGEN, Madison, Wl), for intracellular and periplasmic expression, respectively, of
• FGF-SAP fusion proteins exhibit cytotoxic activity and appear to be at least as potent as the chemically conjugated
• FGF-SAP preparations The resulting bFGF-fusion proteins are highly cytotoxic when internalized by targeted cells.
• B Synthesis of monogenous preparations of cytotoxic conjugates and homogeneous populations of cytotoxic conjugates
• the problem of heterogeneity of compositions and preparations of cytotoxic FGF conjugates has been addressed in several ways herein.
• the first method relies on chemical conjugation and the second method relies on recombinant DNA technology.
• the methods herein are described with respect to bFGF and SAP. It is understood, however, that the same methods may be used to modify and prepare homogeneous populations of conjugates of any member of the FGF family with SAP, modified SAP, or any other cytotoxic agent. 1.
• the FGF protein is modified and then linked to the cytotoxic agent. Chemical conjugation must be used if the cytotoxic agent is other than a peptide or protein, such as a non- peptide drug. a. Selection of the FGF protein To reduce the heterogeneity of preparations of FGF protein- containing chemical conjugates, the FGF protein is modified by deleting or replacing a site(s) on the FGF that causes the heterogeneity. Such sites are typically cysteine residues that, upon folding of the protein, remain available for interaction with other cysteines or for interaction with more than one cytotoxic molecule per molecule of FGF peptide.
• cysteine residues do not include any cysteine residue that are required for proper folding of the FGF peptide or for retention of the ability to bind to an FGF receptor and internalize.
• cysteine residues For chemical conjugation, one cysteine residue that, in physiological conditions, is available for interaction, is not replaced because it is used as the site for linking the cytotoxic moiety.
• the resulting modified FGF is conjugated with a single species of cytotoxic conjugate. Any protein that is reactive with an FGF receptor may be used herein. In particular any of FGF-1 - FGF-9 may be modified for use herein or reacted with a cytotoxic reagent, such that the resulting conjugate is monogenous.
• FGF-1 has cysteines at positions 31 , 98 and 132; FGF-2 has cysteines at positions 34, 78, 96 and 101 ; FGF-3 has cysteines at positions 50 and 1 1 5; FGF-4 has cysteines at positions 88 and 1 55; FGF-5 has cysteines at positions 1 9, 93, 1 60 and 202; FGF-6 has cysteines at positions 80 and 147; FGF-7 has cysteines at positions 1 8, 23, 32, 46, 71 , 133 and 137; FGF-8 has cysteines at positions 10, 19, 109 and 127; and FGF-9 has cysteines at positions 68 and 134.
• the cysteine residues from each of FGF-1 - FGF-9 that appear to be essential for retention of biological activity and that should not deleted or replaced are as follows: TABLE 2
• the FGF peptides may be modified as described below.
• the contribution of each cysteine to the ability to bind to FGF receptors may be determined empirically.
• Each cysteine residue may be systematically replaced with a conservative amino acid change (see Table 1 , above) or deleted.
• the resulting mutein is tested for the requisite biological activity, the ability to bind to FGF receptors and internalize linked cytotoxic moieties. If the mutein retains this activity, then the cysteine residue is not required. Additional cysteines are systematically deleted and replaced and the resulting muteins are tested for activity. In this manner the minimum number and identity of the cysteines needed to retain the ability to bind to an FGF receptor and internalize may be determined.
• FGF-1 FGF-1
• SEQ ID NO. 26-32 FGF-3 - FGF-9, respectively
• cysteine residues are identified. Comparison among the amino acid sequences of FGF-1 -FGF-9 reveals that one Cys is conserved among FGF family of peptides (see Table 2). These cysteine residues may be required for secondary structure and should be altered. These residues should not be replaced. Each of the remaining cysteine residues may be systematically deleted and/or replaced by a serine residue or other residue that would not be expected to alter the structure of the protein. The resulting peptide is tested for biological activity.
• cysteine residue is necessary for retention of biological activity it is not deleted; if it is not necessary, then it is preferably replaced with a serine or other residue selected so that it does not alter the secondary structure of the resulting protein.
• Modification of the FGF protein for chemical conjugation The polypeptide reactive with an FGF receptor is modified by removing one or more reactive cysteines that are not required for receptor binding, but that are available for reaction with appropriately derivatized cytotoxic agent, so that the resulting FGF protein has only one cysteine residue available for conjugation with the cytotoxic agent. Other cysteine residues are removed and, preferably, replaced with an amino acid that does not substantially alter the biological activity of the resulting mutant FGF.
• the resulting mutant FGF is then tested for retention of the ability to target a cytotoxic agent to a cell that expresses an FGF receptor and to internalize the cytotoxic agent into such cells. Retention of proliferative activity is indicative, though not definitive, of the retention of such activities. Proliferative activity may be measured by any suitable proliferation assay, such as the assay, exemplified below, that measures the increase in cell number of adrenal capillary endothelial cells.
• modified or mutant FGFs may exhibit reduced or no prolifera- tive activity, but may be suitable for use herein, if they retain the ability to target a linked cytotoxic agent to cells bearing receptors to which the unmodified FGF binds and result in internalization of the cytotoxic moiety.
• FGF-3, FGF-4 and FGF-6 have only two cysteines, for purposes of chemical conjugation, preferably neither cysteine is deleted or replaced, unless another residue, preferably one near either terminus, is replaced with a cysteine.
• cysteine With respect to the other FGF family members, at least one cysteine must remain available for conjugation with the cytotoxic conjugate and probably two cysteines, but at least the cysteine residues set forth in Table 2.
• a second cysteine may be required to form a disulfide bond.
• any FGF peptide that has more than three cysteines is be modified for chemical conjugation by deleting or replacing the other cysteine residues.
• FGF peptides that have three cysteine residues are modified by elimination of one cysteine, conjugated to a cytotoxic moiety and tested for the ability to bind to FGF receptors and internalize the cytotoxic moiety.
• two muteins of basic FGF for chemical conjugation have been produced (preparation of muteins for recombinant expression of the conjugate is described below).
• DNA, obtained from pFC80 (see, copending International PCT Application Serial No. PCT/US93/05702, which is a continuation-in-part of United States Application Serial No. 07/901 ,718; see also, SEQ ID NO. 1 2) encoding basic FGF has been mutagenized.
• cysteine 78 of basic FGF to serine [C78SJFGF) or cysteine 96 to serine ([C96SJFGF) produced two mutants that retain virtually complete proliferative activity of native basic FGF as judged by the ability to stimulate endothelial cell proliferation in culture.
• the activities of the two mutants and the native protein do not significantly differ as assessed by efficacy or maximal response. Sequence analysis of the modified DNA verified that each of the mutants has one codon for cysteine converted to that for serine.
• the resulting mutein FGF or unmodified FGF is reacted with a single species of cytotoxic agent.
• the bFGF muteins have been reacted with a single species of derivatized saporin (mono-derivatized saporin) thereby resulting in monogenous preparations of FGF-SAP conjugates and homogeneous compositions of FGF-SAP chemical conjugates.
• the resulting chemical conjugate does not aggregate and retains the requisite biological activities.
• SAP may be derivatized or modified such that it includes a cysteine residue for conjugation to the FGF protein.
• SAP is derivatized by reaction with SPDP. This results in a heterogeneous population.
• SAP that is derivatized by SPDP to a level of 0.9 moles pyridine-disulfide per mole of SAP includes a population of non-derivatized, mono-derivatized and di-derivatized SAP.
• Ribosome-inactivating proteins which are overly derivatized with SPDP, may lose activity because of reaction with sensitive lysines (Lambert et al (1988) Cancer Treat. Res. 37: 175-209).
• the quantity of non-derivatized SAP in the preparation of the non-purified material can be difficult to judge and this may lead to errors in being able to estimate the correct proportion of derivatized SAP to add to the reaction mixture.
• Recombinant expression of saporin DNA includes a sequence of nucleotides encoding a saporin polypeptide and an N-terminal extension sequence linked to the amino terminus of the saporin.
• the N-terminal extension permits expression of saporin in a bacterial host. If saporin is linked to DNA encoding an FGF peptide, then the N-terminal extension is not necessary, but may be included and contain from about one up to 20-30 amino acid residues or more, if desired, and as long as the resulting saporin peptide retains cytotoxic activity.
• Suitable N-terminal extension regions may be substantially neutral and lack any biological function other than rendering the saporin polypeptide nontoxic or less toxic to the host in which it is expressed.
• the specific amino acid makeup of the N-terminal extension region does not appear to be critical for rendering the saporin-containing protein nontoxic or less toxic to the host upon expression of the protein.
• the N-terminal extension region is susceptible to cleavage by eukaryotic intracellular proteases, either by general intracellular degradation or by site-specific proteolytic processing of a proteolytic signal sequence such that, upon internalization, the N-terminal extension region of the saporin-containing fusion protein is cleaved or degraded by a cellular eukaryotic protease, which renders the single-fragment saporin protein biologically active, resulting in cell death (see, e.g., copending U.S. Application 08/ , , filed concurrently herewith).
• the DNA molecules provided herein encode saporin that has substantially the same amino acid sequence and ribosome-inactivating activity as that of saporin-6 (SO-6), including any of four isoforms, which have heterogeneity at amino acid positions 48 and 91 (see, e.g., Maras et aL (1990) Biochem. Internat. 21 :631 -638 and Barra et aL (1991 ) Biotechnol. Appl. Biochem. 13:48-53 and SEQ ID NOs. 3-7).
• saporin polypeptides include other members of the multi-gene family coding for isoforms of saporin-type RIP's including SO-1 and SO-3 (Fordham-Skelton et aL (1 990) Mol. Gen. Genet. 221 : 134-138).
• SO-2 see, e.g., U.S. Application Serial No. 07/885,242, which corresponds to GB 2,216,891 ; see, also, Fordham-Skelton et aL (1991 ) Mol. Gen. Genet. 229:460-466
• SO-4 see, e.g., GB 2,194,241 B; see, also, Lappi et aL (1985) Biochem. Biophvs.
• SO-4 which includes the N-terminal 40 amino acids set forth in SEQ ID NO. 33, is isolated from the leaves of Saponaria officinalis by extraction with 0.1 M phosphate buffer at pH 7, followed by dialysis of the supernatant against sodium borate buffer, pH 9, and selective elution from a negatively charged ion exchange resin, such as Mono S (Pharmacia Fine Chemicals, Sweden) using gradient of 1 to 0.3 M. NaCI and first eluting chromatographic fraction that has SAP activity. The second eluting fraction is SO-5.
• the saporin polypeptides exemplified herein include those having substantially the same amino acid sequence as those listed in SEQ ID NOs 3-7.
• the isolation and expression of the DNA encoding these proteins is described in Example 1 .
• the saporin can be modified by the introduction of a cysteine residue into the SAP such that the resulting modified saporin protein reacts with the FGF protein to produce a monogenous cytotoxic conjugate that binds to FGF receptors on eukaryotic cells and is cytotoxic upon internalization by such cells.
• Preferred loci for introduction of a cysteine residue include the N-terminus region, preferably within about one to twenty residues from the N-terminus of the cytotoxic agent, such as SAP.
• DNA encoding SAP has been modified by inserting a DNA encoding Met-Cys (ATG TGT or ATG TGC) at the N-terminus immediately adjacent to the codon for first residue of the mature protein.
• Muteins in which a cysteine residue has been added at the N- terminus and muteins in which the amino acid at position 4 or 10 has been replaced with cysteine have been prepared by modifying the DNA encoding saporin (see, EXAMPLE 4).
• the modified DNA may be expressed and the resulting saporin protein purified, as described herein for expression and purification of the resulting SAP.
• the modified saporin can then be reacted with the modified FGF to form disulfide linkages between the single exposed cysteine residue on the FGF and the cysteine residue on the modified SAP.
• the modified DNA may be expressed and the resulting saporin protein purified, as described herein for expression and purification of the resulting SAP.
• the modified saporin can then be reacted with the modified FGF to form disulfide linkages between the single exposed cysteine residue on the FGF and the cysteine residue on the modified SAP.
• cytotoxic conjugate as a fusion protein by expression of DNA encoding the modified FGF protein linked to DNA encoding the cytotoxic agent, as described below. 2. Recombinant production of cytotoxic conjugates containing modified FGF
• Preparations containing the fusion proteins may be rendered more homogeneous by modifying the FGF and/or the targeted agent to prevent interactions between each conjugate, such as via unreacted cysteines.
• Expression of DNA encoding a fusion of an FGF protein linked to the cytotoxic agent results in a monogenous preparation of cytotoxic conjugates. Such population may, however, form aggregates.
• Preparations containing the fusion proteins may be rendered more homogeneous by modifying the FGF and/or the cytotoxic agent to prevent interactions between each conjugate, such as via unreacted cysteines.
• cysteines of the FGF peptide that are not required for biological activity are deleted or replaced; and for use in the chemical conjugation methods herein, all except for one of these cysteines, which will be used for chemical conjugation to the cytotoxic agent ,are deleted or replaced.
• cysteines including each of the cysteine residues set forth in Table 2
• cysteines set forth in Table 2 are required for retention of the requisite biological activity of the FGF peptide.
• FGF peptides that have more than two cysteines are modified by replacing the remaining cysteines with serines. The resulting muteins may be tested for the requisite biological activity.
• FGF peptides such as FGF-3, FGF-4 and FGF-6, that have two cysteines can be modified by replacing the second cysteine, which is not listed in Table 2, and the resulting mutein used as part of a construct containing DNA encoding the cytotoxic agent linked to the FGF-encoding DNA.
• the construct is expressed in a suitable host cell and the resulting protein tested for the ability to bind to FGF receptors and internalize the cytotoxic agent.
• conjugates containing bFGF muteins in which Cys 78 and Cys 96 have been replaced with serine residues have been prepared.
• the resulting conjugates are at least as active as recombinant conjugates that have wild type FGF components and at least as active as chemical conjugates of FGF.
• the recombinantly produced conjugates are less toxic, and thus, can, if necessary, be administered in higher dosages.
• DNA encoding the FGF protein is modified so that, upon expression, the resulting FGF portion of the fusion protein does not include any cysteines available for reaction.
• DNA encoding an FGF polypeptide is linked to DNA encoding a saporin polypeptide.
• the DNA encoding the FGF polypeptide is modified in order to remove the translation stop codon and other transcriptional or translational stop signals that may be present and to remove or replace DNA encoding the available cysteines.
• the DNA is then ligated to the DNA encoding the saporin polypeptide directly or via a spacer region of one or more codons between the first codon of the saporin and the last codon of the FGF.
• the size of the spacer region is any length as long as the resulting conjugate exhibits cytotoxic activity upon internalization by a target cell.
• spacer regions of from about one to about seventy-five to ninety codons are preferred.
• DNA encoding FGF peptides and/or the amino acid sequences FGFs are known to those of skill in this art (see, e.g.. SEQ ID NOs. 24-32).
• DNA may be prepared synthetically based on the amino acid sequence or known DNA sequence of an FGF or may be isolated using methods known to those of skill in the art or obtained from commercial or other sources known to those of skill in this art.
• DNA encoding virtually all of the FGF family of peptides is known.
• human aFGF Jaye et a_L (1986) Science 233:541 -545
• bovine bFGF Abraham et aL (1 986) Science 233:545-548
• human bFGF Abraham et al. (1986) EMBO J. 5:2523- 2528
• FGF-3, FGF-7 and FGF-9 are known (see, also, U.S. Patent No. 5,1 55,214; U.S. Patent No. 4,956,455; U.S. Patent No. 5,026,839; and U.S. Patent No. 4,994,559, the DNASTAR database, and references discussed above and below).
• the amino acid sequence of an exemplary mammalian bFGF isolated from bovine pituitary tissue is also known (see, e.g., in Esch et aL. (1985) Proc. Natl. Acad. Sci. USA 82:6507-651 1 : and U.S. Patent No. 4,956,455).
• the isolated mammalian basic FGF protein is typically a 146-residue polypeptide having a molecular weight of about 16 kD, and a pl of about 9.6; it may be expressed with an amino terminal extension of about 9 residues so that the resulting protein has a molecular weight of about 18 kD.
• Such DNA may then be mutagenized using standard methodologies to delete or delete and replace any cysteine residues, as describe herein, that are responsible for aggregate formation. If necessary, the identity of cysteine residues that contribute to aggregate formation may be determined empirically, by deleting and/or deleting and replacing a cysteine residue and ascertaining whether the resulting FGF with the deleted cysteine form aggregates in solutions containing physiologically acceptable buffers and salts.
• any FGF protein in addition to basic FGF (bFGF) and acidic FGF (aFGF), including HST, INT/2, FGF-5, FGF-6, KGF(FGF-7), FGF-8, and FGF-9 (see, e ⁇ , Baird et aL (1989) Brit. Med. Bull 45:438-452; Tanaka et al. (1992) Proc. Natl. Acad. Sci. USA 89:8928- 8932; Miyamoto et aL (1993) Mol. Cell. Biol. 13:4251 -4259: see, also, the data base, DNA * (July, 1993 release from DNASTAR, Inc.
• FGF-1 - FGF-9 amino acid sequences of FGF-1 - FGF-9, respectively
• All of the FGF proteins induce mitogenic activity in a wide variety of normal diploid mesoderm- derived and neural crest-derived cells and this activity is mediated by binding to an FGF cell surface receptor followed by internalization. Binding to an FGF receptor followed by internalization are the activities required for an FGF protein to be suitable for use herein.
• FGF mitogenic activity which reflects the ability to bind to FGF receptors and to be internalized, is the ability to stimulate proliferation of cultured bovine aortic endothelial cells, as described in Gospodarowicz et . ⁇ L (1982) J. Biol. Chem. 257:12266-12278: Gospodarowicz et aL (1976) Proc. Natl. Acad. Sci. USA 73:4120-4124.
• the DNA encoding the resulting modified FGF-SAP can be inserted into a plasmid and expressed in a selected host, as described above, to produce monogenous preparations of FGF-SAP and homogeneous compositions containing monogenous FGF-SAP.
• modified FGF-SAP chimera or modified FGF- cytotoxic agent chimera can be inserted into a single plasmid in operative linkage with one promoter. When expressed, the resulting protein will be an FGF-SAP multimer. Typically two to six copies of the chimera are inserted, preferably in a head to tail fashion, into one plasmid.
• DNA encoding human bFGF-SAP having SEQ ID NO. 1 2 has been mutagenized as described in the Examples using splicing by overlap extension (SOE). Another preferred coding region is set forth in SEQ ID NO.
• nucleotides 1 - 465 nucleotides 1 - 465.
• the DNA is modified by replacing the cysteines at positions 78 and 96 with serine.
• FGF in the FGF-SAP encoding DNA (SEQ ID NO. 12) were converted to serine codons by SOE.
• SOE serine codons
• Each application of the SOE method uses two amplified oligonucleotide products, which have complementary ends as primers and which include an altered codon at the locus at which the mutation is desired, to produce a hybrid product.
• a second amplification reaction that uses two primers that anneal at the non-overlapping ends amplify the hybrid to produce DNA that has the desired alteration.
• Cytotoxic conjugates agents can be prepared either by chemical conjugation, recombinant DNA technology, or combinations of recombinant expression and chemical conjugation. The methods herein are described with particular reference to bFGF and saporin. It is understood, however, that the same methods may be used to prepare and use conjugates of any member of the FGF family with SAP, modified SAP, or any other cytotoxic agent as described herein.
• the resulting plasmids have been and can be transformed into bacterial hosts including BL21 , BL231 (DE3) + pLYS S, HMS175(DE3), HMS175(DE3) + pLYS S (NOVAGEN, Madison, Wl) and N4830(cl857) (see, Gottesman et aL (1980) J. Mol. Biol. 140:57-75, commercially available from PL Biochemicals, Inc, also, see, e.g., U.S. Patent Nos.
• N4830 harbors a heavily deleted phage lambda prophage carrying the mutant c1 857 temperature sensitive repressor and an active N gene.
• mice demonstrate that the FGF conjugates exhibit anti-tumor activity.
• weekly intravenous injections in mice, with established SK-Mel-5 xenografts, of wild-type bFGF-SAP conjugates (total dose 125 / g/kg) over four weeks resulted in a mean tumor volume that was 49% of the control volume.
• Modification of the weekly regiment to include cis-platin (5 mg/kg intraperitoneally once per week on the day following FGF-SAP treatment) resulted in a mean tumor volume at sixty days that was 23% of the controls.
• the combined treatment resulted in complete tumor remission in 10% of the treated mice.
• Conjugates produced herein have been injected into such mice and appear to be less toxic than heterogeneous preparations of chemical conjugates. Certain of the conjugates provided herein have also been shown to exhibit anti-tumor activity in such mice.
• FPFS1 and CCFS1 were administered to mice, with established HT-1 197 (a human bladder carcinoma cell line) xenografts. Each treatment resulted in significant inhibition of tumor growth throughout the 61 days of the study.
• 0.1 or 0.5 //g/kg/week of FPFS1 with and without 0.5 mg/kg cisplatin is administered to mice with established human prostate carcinoma cell tumors.
• the chemical conjugate and fusion protein bFGF-SAP provided herein may also be used for the treatment of restenosis.
• FGF conjugates have an anti-proliferative effect on smooth muscle cells in rabbit balloon injury models of restenosis (see, also U.S. Patent No. 5,308,622, which is based on allowed U.S. Application Serial No. 07/91 5,056, which describes the use of FGF-cytotoxic conjugates for the treatment of restenosis).
• E. Formulation and administration of pharmaceutical compositions The conjugates herein may be formulated into pharmaceutical compositions suitable for topical, local, intravenous and systemic application. Effective concentrations of one or more of the conjugates are mixed with a suitable pharmaceutical carrier or vehicle.
• concentrations or amounts of the conjugates that are effective requires delivery of an amount, upon administration, that ameliorates the symptoms or treats the disease.
• the compositions are formulated for single dosage administration.
• Therapeutically effective concentrations and amounts may be determined empirically by testing the conjugates in known in. vitro and jn vivo systems, such as those described here; dosages for humans or other animals may then be extrapolated therefrom.
• the re ⁇ sulting mixture may be a solution, suspension, emulsion or the like. The form of the resulting mixture depends upon a number of factors, including the intended mode of administration and the solubility of the conjugate in the selected carrier or vehicle.
• the effective concentration is sufficient for ameliorating the symptoms of the disease, disorder or condition treated and may be empirically determined based upon in. vitro and/or in vivo data, such as the data from the mouse xenograft model. If necessary, pharmaceuti ⁇ cally acceptable salts or other derivaives of the conjugates may be prepared.
• Pharmaceutical carriers or vehicles suitable for administration of the conjugates provided herein include any such carriers known to those skilled in the art to be suitable for the particular mode of administration.
• the conjugates may be formulated as the sole pharmaceutically active ingredient in the composition or may be combined with other active ingredients.
• the conjugates can be administered by any appropriate route, for example, orally, parenterally, intravenously, intradermally, subcutaneously, or topically, in liquid, semi-liquid or solid form and are formulated in a manner suitable for each route of administration.
• Preferred modes of administration depend upon the indication treated. Dermatological and ophthalmologic indications will typically be treated locally; whereas, tumors and restenosis, will typically be treated by systemic, intradermal or intramuscular, modes of administration.
• the conjugate is included in the pharmaceutically acceptable carrier in an amount sufficient to exert a therapeutically useful effect in the absence of undesirable side effects on the patient treated. It is understood that the number and degree of side effects depends upon the condition for which the conjugates are administered. For example, certain toxic and undesirable side effects are tolerated when treating life-threatening illnesses, such as tumors, that would not be tolerated when treating disorders of lesser consequence.
• the concentration of conjugate in the composition will depend on absorption, inactivation and excretion rates thereof, the dosage schedule, and amount administered as well as other factors known to those of skill in the art.
• a therapeutically effective dosage should produce a serum concentration of active ingredient of from about 0.1 ng/ml to about 50-100 //g/ml.
• the pharmaceutical compositions typically should provide a dosage of from about 0.01 mg to about 100 - 2000 mg of conjugate, depending upon the conjugate selected, per kilogram of body weight per day.
• a daily dosage of about between 0.05 and 0.5 mg/kg should be sufficient. It is understood that the amount to administer will be a function of the conjugate selected, the indication treated, and possibly the side effects that will be tolerated.
• the active ingredient may be administered at once, or may be divided into a number of smaller doses to be administered at intervals of time. It is understood that the precise dosage and duration of treatment is a function of the disease being treated and may be determined empirically using known testing protocols or by extrapolation from iri vivo or in vitro test data. It is to be noted that concentrations and dosage values may also vary with the severity of the condition to be alleviated. It is to be further understood that for any particular subject, specific dosage regimens should be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions, and that the concentration ranges set forth herein are exemplary only and are not intended to limit the scope or practice of the claimed compositions.
• Solutions or suspensions used for parenteral, intradermal, subcutaneous, or topical application can include any of the following components: a sterile diluent, such as water for injection, saline solution, fixed oil, polyethylene glycol, glycerine, propylene glycol or other synthetic solvent; antimicrobial agents, such as benzyl alcohol and methyl parabens; antioxidants, such as ascorbic acid and sodium bisulfite; chelating agents, such as ethylenediaminetetraacetic acid (EDTA); buffers, such as acetates, citrates and phosphates; and agents for the adjustment of tonicity such as sodium chloride or dextrose.
• a sterile diluent such as water for injection, saline solution, fixed oil, polyethylene glycol, glycerine, propylene glycol or other synthetic solvent
• antimicrobial agents such as benzyl alcohol and methyl parabens
• antioxidants such as ascorbic acid and sodium bisul
• parental preparations can be enclosed in ampules, disposable syringes or multiple dose vials made of glass, plastic or other suitable material.
• suitable carriers include physiological saline or phosphate buffered saline (PBS), and solutions containing thickening and solubilizing agents, such as glucose, polyethylene glycol, and polypropylene glycol and mixtures thereof.
• PBS physiological saline or phosphate buffered saline
• Liposomal suspensions may also be suitable as pharmaceutically acceptable carriers. These may be prepared according to methods known to those skilled in the art.
• the conjugates may be prepared with carriers that protect them against rapid elimination from the body, such as time release formulations or coatings.
• Such carriers include controlled release formulations, such as, but not limited to, implants and microencapsulated delivery systems, and biodegradable, biocompatible polymers, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, polyorthoesters, polylactic acid and others. Methods for preparation of such formulations are known to those skilled in the art.
• the conjugates may be formulated for local or topical application, in the form of gels, creams, and lotions and for intracisternal or intraspinal application. Such solutions may be formulated as 0.01 % -10% isotonic solutions, pH about 5-7, with appropriate salts.
• the conjugates may be formulated as aerosols for topical application (see, e.g., U.S. Patent Nos. 4,044,126, 4,414,209, and 4,364,923).
• the conjugate should be provided in a composition that protects it from the acidic environment of the stomach.
• the composition can be formulated in an enteric coating that maintains its integrity in the stomach and releases the active compound in the intestine.
• the composition may also be formulated in combination with an antacid or other such ingredient.
• Oral compositions will generally include an inert diluent or an edible carrier and may be compressed into tablets or enclosed in gelatin capsules.
• the active compound or compounds can be incorporated with excipients and used in the form of tablets, capsules or troches.
• Pharmaceutically compatible binding agents and adjuvant materials can be included as part of the composition.
• the tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder, such as microcrystalline cellulose, gum tragacanth and gelatin; an excipient such as starch and lactose, a disintegrating agent such as, but not limited to, alginic acid and corn starch; a lubricant such as, but not limited to, magnesium stearate; a glidant, such as, but not limited to, colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; and a flavoring agent such as peppermint, methyl salicylate, and fruit flavoring.
• a binder such as microcrystalline cellulose, gum tragacanth and gelatin
• an excipient such as starch and lactose, a disintegrating agent such as, but not limited to, alginic acid and corn starch
• a lubricant such as, but not limited to, magnesium stearate
• the dosage unit form When the dosage unit form is a capsule, it can contain, in addition to material of the above type, a liquid carrier such as a fatty oil.
• dosage unit forms can contain various other materials which modify the physical form of the dosage unit, for example, coatings of sugar and other enteric agents.
• the conjugates can also be administered as a component of an elixir, suspension, syrup, wafer, chewing gum or the like.
• a syrup may contain, in addition to the active compounds, sucrose as a sweetening agent and certain preservatives, dyes and colorings and flavors.
• the active materials can also be mixed with other active materials that do not impair the desired action, or with materials that supplement the desired action, such as cis-platin for treatment of tumors.
• the compounds may be packaged as articles of manufacture containing packaging material, one or more conjugates or compositions as provided herein within the packaging material, and a label that indicates the indication for which the conjugate is provided.
• Bacterial Strains JE coJi strain JA221 (Ipp- hdsM + trpE5 leuB6 lacY recA1 F'[lacl q lac + pro "1" ]) is publicly available from the American Type Culture Collection (ATCC), Rockville, MD 20852, under the accession number ATCC 33875. (JA221 is also available from the Northern Regional Research Center (NRRL), Agricultural Research Service, U.S. Department of Agriculture, Peoria, IL 61604, under the accession number NRRL B-1521 1 ; see, also, U.S. Patent No. 4,757,013 to Inouye; and Nakamura et aL (1979) Cell 18:1 109-1 1 17.) Strain INV1 ⁇ is commercially available from Invitrogen, San Diego, CA.
• the primer 5'-CTGCAGAATTCGCATGGATCCTGCTTCAAT-3' corresponds to the "antisense” strand of saporin and complements the coding sequence of saporin starting from the last 5 nucleotides of the DNA encoding the carboxyl end of the mature peptide. Use of this primer introduced a translation stop codon and an EcoRI restriction site after the sequence encoding mature saporin.
• One cycle included a denaturation step (94°C for 1 min.), an annealing step (60°C for 2 min.), and an elongation step (72°C for 3 min.). After 30 cycles, a 10 ⁇ aliquot of each reaction was run on a 1 .5% agarose gel to verify the correct structure of the amplified product.
• the amplified DNA was digested with EcoRI and subcloned into EcoR l-restricted M1 3mp18 (NEW ENGLAND BIOLABS, Beverly, MA; see, also, Yanisch-Perron et aL. (1985), "Improved M13 phage cloning vectors and host strains: Nucleotide sequences of the M1 3mp1 8 and pUC1 9 vectors", Gene 33: 103). Single-stranded DNA from recombinant phages was sequenced using oligonucleotides based on internal points in the coding sequence of saporin (see, Bennati et aL (1989) Eur. J. Biochem. 183:465-470).
• M1 3mp1 8 derivatives were sequenced and compared. Of the nine sequenced clones, five had unique sequences, set forth as SEQ ID NOs 3-7, respectively.
• the clones were designated M13mp18-G4, -G1 , -G2, -G7, and -G9. Each of these clones contains all of the saporin coding sequence and 45 nucleotides of DNA encoding the native saporin N-terminal leader peptide.
• M13 mp18-G4 containing the SEQ ID NO. 3 clone from Example 1 .B.2.
• the ligation was accomplished such that the DNA encoding saporin, including the N-terminal extension, was fused to the leader peptide segment of the bacterial ompA gene.
• the resulting plasmid pOMPAG4 contains the Ipp promoter
• the plasmid also includes the E. coli lac repressor gene (lac I).
• lac I The M1 3 mp18-G1 , -G2, -G7, and -G9 clones obtained from Example 1 .B.2, containing SEQ ID NOs.
• plasmids 4-7 are digested with EcoR I and ligated into EcoR I digested plN-lllompA2 as described for M13 mp1 8-G4 above in this example.
• the resulting plasmids labeled pOMPAGI , pOMPAG2, pOMPAG7, pOMPA9, are screened, expressed, purified, and characterized as described for the plasmid pOMPAG4.
• INV1 ⁇ competent cells were transformed with pOMPAG4 and cultures containing the desired plasmid structure were grown further in order to obtain a large preparation of isolated pOMPAG4 plasmid using methods described in Example 1 .A.2.
• the pOMPAG4 transformed EL coli cells were grown under conditions in which the expression of the saporin-containing protein is repressed by the lac repressor to an O.D. in or at the end of the log phase of growth after which IPTG was added to induce expression of the saporin- encoding DNA.
• the periplasmic fraction from Example 1 .D. was dialyzed against borate-buffered saline (BBS: 5 mM boric acid, 1 .25 mM borax, 145 mM sodium chloride, pH 8.5).
• BBS borate-buffered saline
• the dialysate was loaded onto an immunoaffinity column (0.5 x 2 cm) of anti-saporin antibodies, obtained as described in Lappi et al., Biochem. Biophvs. Res. Comm., 129: 934-942 (1985), bound to Affi-gel 10 and equilibrated in BBS at a flow rate of about 0.5 ml/min.
• the column was washed with BBS until the absorbance at 280 nm of the flow-through was reduced to baseline.
• the column containing the antibody bound saporin was eluted with 1 .0 M acetic acid and 0.5 ml fractions were collected in tubes containing 0.3 ml of 2 M ammonium hydroxide, pH 10.
• the fractions were analyzed by ELISA (see, e.g., Sambrook et aL (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY).
• the peak fraction of the ELISA was analyzed by Western blotting as described in Example 1 .A.2 and showed a single band with a slightly higher molecular weight than native saporin.
• the fractions that contained saporin protein, as determined by the ELISA were then pooled for further purification.
• the recombinantly produced saporin can be separated by size and one of the five polypeptides used to produce the conjugates.
• the RIP activity of recombinant saporin was compared to the RIP activity of native SAP in an in. vitro assay measuring cell-free protein synthesis in a nuclease-treated rabbit reticulocyte lysate (Promega).
• Samples of immunoaffinity-purified saporin, obtained in Example 1 .E.1 . were diluted in PBS and 5 ⁇ of sample was added on ice to 35 ⁇ of rabbit reticulocyte lysate and 10 /I of a reaction mixture containing 0.5 ⁇ of Brome Mosaic Virus RNA, 1 mM amino acid mixture minus leucine, 5 //Ci of tritiated leucine and 3 ⁇ of water.
• Assay tubes were incubated 1 hour in a 30°C water bath. The reaction was stopped by transferring the tubes to ice and adding 5 ⁇ of the assay mixture, in triplicate, to 75 ⁇ of 1 N sodium hydroxide, 2.5% hydrogen peroxide in the wells of a Millititer HA 96-well filtration plate (Millipore). When the red color had bleached from the samples, 300 //I of ice cold 25% trichloroacetic acid (TCA) were added to each well and the plate left on ice for another 30 min. Vacuum filtration was performed with a Millipore vacuum holder. The wells were washed three times with 300 ⁇ of ice cold 8% TCA. After drying, the filter paper circles were punched out of the 96-well plate and counted by liquid scintillation techniques. The IC 50 for the recombinant and native saporin were approximately
• recombinant saporin-containing protein has full protein synthesis inhibition activity when compared to native saporin.
• Bacterial Strains and Plasmids coH strains BL2KDE3), BL21 (DE3)pLysS, HMS174(DE3) and HMS174(DE3)pLysS were purchased from NOVAGEN, Madison, Wl. P smid pFC80, described below, has been described in the WIPO International Patent Application No. WO 90/02800, except that the bFGF coding sequence in the plasmid designated pFC80 herein has the sequence set forth as SEQ ID NO 1 2, nucleotides 1 -465.
• the plasmids described herein may be prepared using pFC80 as a starting material or, alternatively, by starting with a fragment containing the CM ribosome binding site (SEQ ID NO 15) linked to the FGF-encoding DNA (SEQ ID NO 12).
• the restriction and modification enzymes employed here are commercially available in the U.S. Native SAP, chemically conjugated bFGF-SAP and rabbit polyclonal antiserum to SAP and FGF were obtained as described in Lappi et al., Biochem. Biophys. Res. Comm., 129: 934-942 (1985) and Lappi et al., Biochem. Biophvs.. Res. Comm., 160: 917-923 (1989).
• the pET System Induction Control was purchased from NOVAGEN, Madison, Wl.
• the sequencing of the different constructions was done using the Sequenase kit of United States Biochemical Corporation (version 2.0).
• Plasmid pFC80 is a derivative of pDS20 (see, e.g.. Duester et aL (1982) CeH 30:855-864; see also U.S. Patent Nos. 4,914,027, 5,037,744, 5,100,784, and 5,187,261 ; see, also, PCT International Application No. WO 90/02800; and European Patent Application No.
• Plasmid pKG1800 includes the 2880 bp EcoR l-Pvu II of pBR322 that contains the contains the ampicillin resistance gene and an origin of replication.
• Plasmid pFC80 was prepared from pDS20 by replacing the entire oalK gene with the FGF-encoding DNA of SEQ ID NO. 12, inserting the trp promoter (SEQ ID NO. 14) and the bacteriophage lambda CH ribosome binding site (SEQ. ID No. 15; see, e.g., Schwarz et aL (1978) Nature 272:410) upstream of and operatively linked to the FGF-encoding DNA.
• the Trp promoter can be obtained from plasmid pDR720 (Pharmacia PL Biochemicals) or synthesized according to SEQ ID NO. 14.
• Plasmid pFC80 contains the 2880 bp EcoR l-BamH I fragment of plasmid pSD20, a synthetic Sal l-Nde I fragment that encodes the Trp promoter region (SEQ ID NO. 14):
• the FGF-encoding DNA was removed from pFC80 by treating it as follows.
• the pFC80 plasmid was digested by Hga I and SaJ I, which produces a fragment containing the Cll ribosome binding site linked to the
• SEQ ID NO 9 contains 1 nucleotide between the FGF carboxy terminal serine codon and a Nco I restriction site, and it replaced the following wild type FGF encoding DNA having SEQ ID NO 10: GCT AAG AGC TGA CCA TGG AGA.
• FGFM13 The mutagenized region of FGFM13 contained the correct sequence (SEQ ID NO 1 1 ).
• Plasmid pFS92 (also designated PZ1A)
• Plasmid FGFM13 was cut with Nco I and Sac I to yield a fragment containing the Cll ribosome binding site linked to the bFGF coding sequence with the stop codon replaced.
• the M13mp1 8 derivative mpNG4 containing the saporin coding sequence was also cut with restriction endonucleases Nco I and Sac I, and the bFGF coding fragment from FGFM13 was inserted by ligation to DNA encoding the fusion protein bFGF-SAP into the M13mp18 derivative to produce mpFGF-SAP, which contains the Cll ribosome binding site linked to the FGF-SAP fusion gene.
• the sequence of the fusion gene is set forth in SEQ ID NO 12 and indicates that the FGF protein carboxy terminus and the saporin protein amino terminus are separated by 6 nucleotides (SEQ ID NOs 12 and 13, nts 466-471 ) that encode two amino acids Ala Met.
• Plasmid mpFGF-SAP was digested with Xba I and EcoR I and the resulting fragment containing the bFGF-SAP coding sequence was isolated and ligated into plasmid pET-1 1 a (available from NOVAGEN, Madison, Wl; for a description of the plasmids see U.S. Patent No. 4,952,496; see, also Studier et aL (1990) Meth. Enz. 185:60-89: Studier et aL (1986) J. Mol. Biol. 189:1 13-130: Rosenberg et aL (1987) Gene 56: 125-135) that had also been treated with EcoR I and Xba I. The resulting plasmid was designated pFS92. It was renamed PZ1 A.
• Plasmid pFS92 (or PZ1 A) contains DNA the entire basic FGF protein (SEQ ID NO 12), a 2-amino acid long connecting peptide, and amino acids 1 to 253 of the mature SAP protein. Plasmid pFS92 also includes the Cll ribosome binding site linked to the FGF-SAP fusion protein and the T7 promoter region from pET-1 1 a.
• E ⁇ coN strain BL21 (DE3)pLysS (NOVAGEN, Madison Wl) was , transformed with pFS92 according to manufacturer's instructions and the methods described in Example 2.A.2. b. Plasmid PZ1B
• Plasmid pFS92 was digested with EcoR I, the ends repaired by adding nucleoside triphosphates and Klenow DNA polymerase, and then digested with Nde I to release the FGF-encoding DNA without the Cll ribosome binding site. This fragment was ligated into pET 1 1 a, which had been BamH I digested, treated to repair the ends, and digested with Nde I. The resulting plasmid was designated PZ1 B.
• PZ1 B includes the T7 transcription terminator and the pET-1 1 a ribosome binding site.
• E. coli strain BL2KDE3 (NOVAGEN, Madison Wl) was transformed with PZ1 B according to manufacturer's instructions and the methods described in Example 2.A.2. c. Plasmid PZ1 C
• Plasmid PZ1 C was prepared from PZ1 B by replacing the ampicillin resistance gene with a kanamycin resistance gene. d. Plasmid PZ1D Plasmid pFS92 was digested with EcoR I and Nde I to release the
• PZ1 D includes DNA encoding the OMP T secretion signal operatively linked to DNA encoding the fusion protein.
• E. coli strains BL2KDE3), BL21 (DE3)pLysS, HMS174(DE3) and HMS174(DE3)pLysS were transformed with PZ1 D according to manufacturer's instructions and the methods described in Example 2.A.2.
• bFGF-SAP fusion protein recombinant bFGF-SAP protein
• bFGF-SAP fusion protein recombinant bFGF-SAP protein
• pFS92 plasmid-containing bacterial cells strain BL21 (DE3)pLysS
• IPTG Sigma Chemical, St. Louis, MO
• BL21 (DE3)pLysS cells at 30° C instead of 37° C improves yields.
• the cells are grown at 30° C they are grown to an OD 600 of 1 .5 prior to induction. Following induction, growth is continued for about 2 to 2.5 hours at which time the cells are harvested by centrifugation. The pellet was resuspended in lysis solution (45-60 ml per 16 g of pellet; 20 mM TRIS, pH 7.4, 5 mM EDTA, 10% sucrose, 1 50 mM NaCI, lysozyme, 100 / g/ml, aprotinin, 10 //g/ml, leupeptin, 10 //g/ml, pepstatin A,
• LB medium containing ampicillin 100 //g/ml were inoculated with a fresh glycerol stock of PZ1 B.
• Cells were grown at 30° C in an incubator shaker to an OD 600 of 0.7 and stored overnight at 4° C. The following day the cells were pelleted and resuspended in fresh LB medium (no ampicillin). The cells were divided into 5 1 -liter batches and grown at 30° C in an incubator shaker to an OD 600 of 1 .5.
• IPTG SIGMA CHEMICAL, St. Louis, MO
• the cell pellet was resuspended in ice cold 1 .0 M Tris pH 9.0. 2 mM EDTA.
• the resuspended material is kept on ice for another 20-60 minutes and then centrifuged to separate the periplasmic fraction (supernatant) from the intracellular fraction (pellet).
• the number of living cells was determined by measuring the incorporation and conversion of the commonly available dye MTT supplied as a part of the Promega kit. Fifteen ⁇ of the MTT solution was added to each well, and incubation was continued for 4 hours. Next, 100 //I of the standard solubilization solution supplied as a part of the Promega kit was added to each well. The plate was allowed to stand overnight at room temperature and the absorbance at 560 nm was read on an ELISA plate reader (Titertek Multiskan PLUS, ICN, Flow, Costa Mesa, CA).
• the chemical FGF-SAP conjugate has an ID 50 of 0.3 nM
• the bFGF-SAP fusion protein has a similar ID 50 of 0.6 nM
• unconjugated SAP which is unable to bind to the cell surface, has an ID 50 of 200 nM. Therefore, when internalized, the bFGF-SAP fusion protein appears to have approximately the same cytotoxic activity as the chemically conjugated FGF-SAP.
• Reagents Restriction and modification enzymes were purchased from BRL (Gaithersburg, MD), Stratagene (La Jolla, CA) and New England Biolabs (Beverly, MA).
• Native SAP, chemically conjugated basic FGF-SAP and rabbit polyclonal antiserum to SAP and basic FGF were obtained from BRL (Gaithersburg, MD), Stratagene (La Jolla, CA) and New England Biolabs (Beverly, MA).
• Native SAP, chemically conjugated basic FGF-SAP and rabbit polyclonal antiserum to SAP and basic FGF were obtained from BRL (Gaithersburg, MD), Stratagene (La Jolla, CA) and New England Biolabs (Beverly, MA).
• Native SAP, chemically conjugated basic FGF-SAP and rabbit polyclonal antiserum to SAP and basic FGF were obtained from BRL (Gaithersburg, MD), Stratagene (La Jolla, CA) and New England Biolabs (Beverly, MA).
• Saponaria officinalis see, e.g., Stirpe et a (1983) Biochem. J. 216:617- 625). Briefly, the seeds were extracted by grinding in 5 mM sodium phosphate buffer, pH 7.2 containing 0.14 M NaCI, straining the extracts through cheesecloth, followed by centrifugation at 28,000 g for 30 min to produce a crude extract, which was dialyzed against 5 mM sodium phosphate buffer, pH 6.5, centrifuged and applied to CM-cellulose (CM 52, Whatman, Maidstone, Kent, U.K.). The CM column was washed and SO-6 was eluted with a 0-0.3 M NaCI gradient in the phosphate buffer.
• CM-cellulose CM 52, Whatman, Maidstone, Kent, U.K.
• Plasmid pFC80 containing the basic FGF coding sequence, was a gift of Drs. Paolo Sarmientos and Antonella Isacchi of Farmitalia Carlo Erba (Milan, Italy). Plasmid pFC80, has been described in WIPO International Patent Application No. WO 90/02800 and co-pending International PCT Application Serial No. PCT/US93/05702 (published as WO 93/25688), which are herein incorporated in their entirety by reference. The sequence of DNA encoding bFGF in pFC80 is that set forth in copending International PCT Application Serial No. PCT/US93/05702 and in SEQ ID NO. 1 2. The construction of pFC80 is set forth above in Example 2.
• SDS Sodium dodecyl sulphate
• Cysteine to serine substitutions were made by oligonucleotide- directed mutagenesis using the Amersham (Arlington Heights, IL) m vitro- mutagenesis system 2.1 . Oligonucleotides encoding the new amino acid were synthesized using a 380B automatic DNA synthesizer (Applied Biosystems, Foster City, CA).
• mutagenesis The oligonucleotide used for m vitro mutagenesis of cysteine 78 was AGGAGTGTCTGCTAACC (SEQ ID NO. 16), which spans nucleotides 225- 241 of SEQ ID NO. 12.
• the oligonucleotide for mutagenesis of cysteine 96 was TTCTAAATCGGTTACCGATGACTG (SEQ ID NO. 17), which spans nucleotides 279-302 of SEQ ID NO. 1 2.
• the mutated replicative form DNA was transformed into E. coli strain JM109 and single plaques were picked and sequenced for verification of the mutation.
• the FGF mutated gene was then cut out of M13, ligated into the expression vector pFC80, which had the non-mutated form of the gene removed, and transformed into E. coli strain JM109. Single colonies were picked and the plasmids sequenced to verify that the mutation was present. Plasmids with correct mutation were then transformed into the L. coli strain FICE 2 and single colonies from these transformations were used to obtain the mutant basic FGFs. An excellent level of expression, approximately 20 mg per liter of fermentation broth, was achieved. 2. Purification of mutagenized FGF
• Cells were grown overnight in 20 ml of LB broth containing 100 //g/ml ampicillin. The next morning the cells were pelleted and transferred to 500 ml of M9 medium with 100 g/ml ampicillin and grown for 7 hours. The cells were pelleted and resuspended in lysis solution (10 mM TRIS, pH 7.4, 1 50 mM NaCI, lysozyme, 10 //g/mL, aprotinin, 10 /g/mL, leupeptin, 10 //g/mL, pepstatin A, 10 / g/mL and 1 mM PMSF; 45-60 ml per 16 g of pellet) and incubated while stirring for 1 hour at room temperature.
• lysis solution 10 mM TRIS, pH 7.4, 1 50 mM NaCI, lysozyme, 10 //g/mL, aprotinin, 10 /g/mL, leupeptin, 10 //g/mL, pepstatin A, 10
• Extract volumes (40 ml) were diluted to 50 ml with 10 mM TRIS, pH 7.4 (buffer A). Pools were loaded onto a 5 ml Hi-Trap heparin-Sepharose column (Pharmacia, Uppsala, Sweden) equilibrated in 150 mM sodium chloride in buffer A.
• Saporin (SAP; 49 mg) at a concentration of 4.1 mg/ml was dialyzed against 0.1 M sodium phosphate, 0.1 M sodium chloride, pH 7.5. A 1 .1 molar excess (563 ⁇ g in 156 ⁇ of anhydrous ethanol) of SPDP (Pharmacia, Uppsala, Sweden) was added and the reaction mixture immediately agita ⁇ ted and put on a rocker platform for 30 minutes. The solution was then dialyzed against the same buffer. An aliquot of the dialyzed solution was examined for extent of derivatization according to the Pharmacia instruction sheet. The extent of derivatization was 0.86 moles of SPDP per mole of SAP. During these experiments, another batch of SAP was derivatized using an equimolar quantity of SPDP in the reaction mixture with a resulting 0.79 molar ratio of SPDP to SAP.
• Derivatized SAP (32.3 mg) was dialyzed in 0.1 M sodium borate, pH 9.0 and applied to a Mono S 16/10 column equilibrated with 25 mM so ⁇ dium chloride in dialysis buffer. A gradient of 25 mM to 125 mM sodium chloride in dialysis buffer was run to elute SAP and derivatized SAP. The flow rate was 4.0 ml/min. and 4 ml fractions were collected. Aliquots of fractions were assayed for protein concentration (BCA Protein Assay, Pierce Chemical, Chicago, IL) and for pyridylthione released by reducing agent.
• BCA Protein Assay Pierce Chemical, Chicago, IL
• SAP was modified by addition of a cysteine residueat the N-terminus-encoding portion of the DNA or the addition of a cysteine at position 4 or 10.
• the resulting saporin is then reacted with an available cysteine on an FGF to produce conjugates that are linked via the added Cys or Met-Cys on saporin.
• Modified SAP has been prepared by modifying DNA encoding the saporin by inserting DNA encoding Met-Cys or Cys at position -1 or by replacing the He or the Asp codon within 10 or fewer residues of the N- terminus.
• the resulting DNA has been inserted into pET1 1 a and pET1 5b and expressed in BL21 cells.
• the resulting saporin proteins are designated FPS1 (saporin with Cys at -1 ), FPS2 (saporin with Cys at position 4) and FPS3 (saporin with Cys at position 10).
• a plasmid that encodes FPS1 and that has been for expression of FPS1 has been designated PZ50B.
• Plasmids that encode FPS2 and that have been used for expression of FPS2 have been designated PZ51 B (pET1 1 a-based plasmid) and PZ51 E (pet1 5b- based plasmid). Plasmids that encode FPS3 and that have been used for expression of FPS3 have been designated PZ52B (pET1 1 a-based plasmid) and PZ52E (pet15b-based plasmid).
• PZ51 B pET1 1 a-based plasmid
• PZ51 E pet1 5b- based plasmid
• Plasmids that encode FPS3 and that have been used for expression of FPS3 have been designated PZ52B (pET1 1 a-based plasmid) and PZ52E (pet15b-based plasmid).
• Plasmid PZ1 B (designated PZ1 B1 ) described in Example 2 was used as the DNA template.
• Primer #2 - Antisense primer complements the coding sequence of saporin spanning nucleotides 547-567 of SEQ ID NO. 12 and contains a BamHI site: CAGGTTTGGATCCTTTACGTT (SEQ ID NO. 35)
• PZIB1 DNA was amplified by PCR as follows using the above primers.
• PZ1 B DNA (1 ⁇ ) was mixed in a final volume of 100 //I containing 10 mM Tris-HCI (pH 8.3), 50 mM KCI, 0.01 % gelatin, 2 mM MgCI 2 , 0.2 mM dNTPs, 0.8 ⁇ g of each primer.
• 2.5 U Taql DNA polymerase (Boehringer Mannheim) was added and the mixture was overlaid with 30 ⁇ of mineral oil (Sigma). Incubations were done in a DNA Thermal Cycler (Ericomp).
• One cycle included a denaturation step (94°C for 1 min.), an annealing step (60°C for 2 min.), and an elongation step (72°C for 3 min.). After 35 cycles, a 10 ⁇ aliquot of each reaction was run on a 1 .5% agarose gel to verify the correct structure of the amplified product.
• the amplified DNA was gel purified and digested with Ndel and BamHI and subcloned into Ndel and BamHI-digested pZ1 B1 .
• This digestion and subcloning step removed the FGF-encoding DNA and 5' portion of SAP up to the BamHI site at nucleotides 555-560 (SEQ ID No. 1 2) and replaced this portion with DNA encoding a saporin molecule that contains a cysteine residue at position -1 relative to the start site of the native mature SAP protein.
• the resulting plasmid is designated pZ50B1 .
• C Preparation of saporin with a cysteine residue at position 4 or 10 of the native protein
• constructs were designed to introduce a cysteine residue at position 4 or 10 of the native protein by replacing the isoleucine residue at position 4 or the asparagine residue at position 10 with cysteine.
• SAP was amplified by polymerase chain reaction (PCR) from the parental plasmid pZ1 B1 encoding the FGF-SAP fusion protein.
• PCR polymerase chain reaction
• Primer #2 - Antisense primer complements the coding sequence of saporin spanning nucleotides 547-567 of SEQ ID NO. 12 and contains a BamHI site (SEQ ID NO. 35): CAGGTTTGGATCCTTTACGTT.
• the PCR reactions were performed as described above, using the following cycles: denaturation step 94°C for 1 min, annealing for 2 min at 60°C, and extension for 2 min at 72°C for 35 cycles.
• the amplified DNA was gel purified, digested with Ndel and BamHI, and subcloned into Ndel and BamHI digested pZ1 B1 . This digestion removed the FGF and 5' portion of SAP (up to the newly added BamHI) from the parental FGF-SAP vector (pZ1 B1 ) and replaced this portion with a SAP molecule containing a CYS at position 4 or 10 relative to the start site of the native mature SAP protein.
• the resulting plasmids are designated pZ51 B1 and pZ52B1 , respectively.
• D Cloning of DNA encoding SAP mutants in vector pET15b
• the initial step in this construction was the mutagenesis of the internal BamHI site at nucleotides 555-560 (SEQ ID NO. 12) in pZ1 B1 by PCR using a sense primer corresponding to nucleotides 543-570 (SEQ ID NO. 12) but changing the G at nucleotide 555 (the third position in the Lys codon) to an A.
• the complement of the sense primer was used as the antisense primer.
• the PCR reactions were conducted as in B above.
• PCR product One ⁇ of the resulting PCR product was used in a second PCR reaction using the same sense oligonucleotide as in B., above, in order to introduce a Ndel site and a Cys codon onto the 5' end of the saporin-encoding DNA.
• the antisense primer was complementary to the 3' end of the saporin protein and encoded a BamHI site for cloning and a stop codon (SEQ ID NO. 37): GGATCCGCCTCGTTTGACTACTT.
• the resulting plasmid was digested with Ndel/BamHI and inserted into pET1 5b (NOVAGEN, Madison, Wl), which has a His-TagTM leader sequence (SEQ ID NO. 36), that had also been digested Ndel/BamHI.
• SAP-Cys-4 and Sap-Cys-10 mutants were similarly inserted into pET1 5b using SEQ ID Nos. 38 and 39, respectively as the sense primers and SEQ ID NO. 37 as the antisense primer.
• DNA encoding unmodified SAP (EXAMPLE 1 ) can be similarly inserted into a pet15b or petl 1 A and expressed as described below for the modified SAP-encoding DNA.
• Lysis buffer (20 mM NaP0 4 , pH 7.0, 5 mM EDTA, 5 mM EGTA, 1 mM DTT, 0.5 / g/ml leupeptin, 1 //g/ml aprotinin, 0.7 //g/ml pepstatin) was added to the rSAP cell paste (produced from pZ50B1 in BL21 cells, as described above) in a ratio of 1 .5 ml buffer/g cells. This mixture was evenly suspended via a Polytron homogenizer and passed through a microfluidizer twice.
• the resulting lysate was centrifuged 50,000 rpm for 45 min.
• the supernatant was diluted with SP Buffer A (20 mM NaP0 4 , 1 mM EDTA, pH 7.0) so that the conductivity was below 2.5 mS/cm.
• the diluted lysate supernatant was then loaded onto a SP-Sepharose column, and a linear gradient of 0 to 30% SP Buffer B (1 M NaCI, 20 mM NaP0 4 , 1 mM EDTA, pH 7.0) in SP Buffer A with a total of 6 column volumes was applied. Fractions containing rSAP were combined and the resulting rSAP had a purity of greater than 90%.
• a buffer exchange step was used here to get the SP eluate into a buffer containing 50 mM NaB0 3 , 1 mM EDTA, pH 8.5 (S Buffer A). This sample was then applied to a Resource S column (Pharmacia, Sweden) pre- equilibrated with S Buffer A. Pure rSAP was eluted off the column by 10 column volumes of a linear gradient of 0 to 300 mM NaCI in SP Buffer A. The final rSAP was approximately 98% pure and the overall yield of rSAP was about 50% (the amount of rSAP in crude lysate was determined by ELISA).
• Cytotoxicity experiments were performed with the Promega (Madison, Wl) CellTiter 96 Cell Proliferation/Cytotoxicity Assay.
• Cell types used were SK-Mel-28, human melanoma Swiss 3T3 mouse fibroblasts (from Dr. Pamela Maher, La Jolla, CA), B16F10, mouse melanoma, PA-1 , human ovarian carcinoma (from Dr. Julie Beitz, Roger Williams Hospital, Buffalo RI), and baby hamster kidney (BHK) [obtained from the American Type Culture Collection (ATCC)]. 2500 cells were plated per well.
• reaction mixture was passed over a HiTrap heparin-Sepharose column (1 ml) equilibrated with 0.15 M sodium chloride in buffer A at a flow rate of 0.5 ml/min. The column was washed with 0.6 M NaCI and 1 .0 M NaCI in buffer A and the product eluted with 2.0 M NaCI in buffer A. Fractions (0.5 ml) were analyzed by gel electrophoresis and absorbance at 280 nm.
• Peak tubes were pooled and dialyzed versus 10 mM sodium phosphate, pH 7.5 and applied to a Mono-S 5/5 column equilibrated with the same buffer. A 10 ml gradient between 0 and 1 .0 M sodium chloride in equilibration buffer was used to elute the product. Purity was determined by gel electrophoresis and peak fractions were pooled. The yield for [C78SJFGF-SAP was 1 .6 mg (60% with respect to starting amount of [C78S1FGF) and was 0.96 mg [C96SJFGF-SAP (35%). Virtually 100% of the mutant FGFs reacted with mono-derivatized
• Coomassie staining and Western blotting of the purified proteins showed a prominent band at a molecular weight of about 48,000, corresponding to the combined molecular weights of SAP and bFGF.
• a much lighter band at a slightly lower molecular weight was detected and attributed to the described mobility of an artifact produced by the high isoelectric point (10.5) (Gelfi et aL (1987) J. Biochem. Biophys. Meth. 15:41 -48) of SAP that causes a smearing in SDS gel electrophoresis (see, e.g.. Lappi et al. (1985) Biochem. Biophvs. Res. Commun. 129:934-942).
• CYS-(-D) that was cloned and expressed in BL21 cells and isolated as described in EXAMPLE 4 was coupled to [C96S]FGF using (5,5'-dithiobis- (2-nitrobenzoic acid)) DTNB also called Ellman's reagent.
• the rSAP and [C96S]FGF were each treated with 10 mM dithiothreitol (DTT), incubated for 1 h at room temperature, and the DTT was removed by gel filtration in conjugation buffer (0.1 M NaP0 4 , 100 NaCI and 1 mM EDTA, pH 7.5). A 100-fold molar excess of DTNB was added to the rSAP, incubated for 1 h at room temperature.
• DTT dithiothreitol
• CCFS1 Heterogeneous FGF-SAP
• mutant FGF-SAPs are also potently cytotoxic to these cells.
• [C78SJFGF-SAP and [C96S]FGF-SAP each have an ED 50 comparable to the heterogeneous chemically conjugates, indicting that mutant FGFs are able to internalize SAP to virtually the same extent as the heterogeneous FGF-SAP.
• CCFS4 was tested in the jn vitro cytotoxicity assay and its activity is at least as good to the wild-type chemical conjugate (CCFS1 ).
• Plasmid PZ1 B (designated PZ1 B1 ) described in Example 2 was used as the DNA template.
• the primers were prepared as follows: (2) Primers
• PZ1 B1 DNA 100 ng was mixed (final volume of 100 //I upon addition of the Taq polymerase) with primer #1 (50 ⁇ M); primer #2 (50 //M), 10 mM Tri-HCI (pH 8.3), 50 mM KCI, 0.01 % gelatin, 2 mM MgCI 2 , 0.2 mM dNTPs.
• primer #3 50 /M
• primer #4 50 / M
• Each reaction mixture was heated to 95° C for 5 min, 0.5 U Taql DNA polymerase (1 //I; Boehringer Mannheim) was added and the mixture was overlaid with 100 //I of mineral oil (Perkin Elmer Cetus). Incubations were done in a DNA Thermal Cycler (Ericomp). Each cycle included a denaturation step (95°C for 1 min.), an annealing step (60°C for 1 .5 min.), and an elongation step (75°C for 3 min.). After 20 cycles, the reaction mixture was incubated at 75° C for 10 minutes for a final elongation. The products were resolved on a 2% agarose gel and DNA of the correct size (247 bp and 250 bp) was purified. The ends were repaired by adding nucleoside triphosphates and Klenow DNA polymerase.
• the resulting reaction mixture was heated to 95° C for 5 min, 0.5 U Taql DNA polymerase (1 //I; Boehringer Mannheim) was added and the mixture was overlaid with 100 //I of mineral oil (Perkin Elmer Cetus). Incubations were done in a DNA Thermal Cycler (Erricomp). Each cycle included a denaturation step (95°C for 1 min.), an annealing step (60°C for 1 .5 min.), and an elongation step (75°C for 3 min.), followed, after 20 cycles, by a final elongation step at 75° C for 10 minutes.
• Erricomp DNA Thermal Cycler
• CTCATCCGTAACAGATTTAGAAGCCA (SEQ ID NO. 23).
• FGFC78S-SAP-encoding DNA 100 ng was mixed (final volume of 100 ⁇ upon addition of the Taq polymerase) with primer #1 (50 //M); primer #5 (50 //M), 10 mM Tri-HCI (pH 8.3), 50 mM KCI, 0.01 % gelatin, 2 mM MgCI 2 and 0.2 mM dNTPs.
• primers #4 and #6 50 //M final concentration of each were used instead of primers #1 and #5.
• Each reaction mixture was heated to 95° C for 5 min, 0.5 U Taql DNA polymerase (1 //l;Boehringer Mannheim) was added and the mixture was overlaid with 100 //I of mineral oil (Perkin Elmer Cetus). Incubations were done in a DNA Thermal Cycler (Ericomp). Each cycle included a denaturation step (95°C for 1 min.), an annealing step (60°C for 1 .5 min.), and an elongation step (75°C for 3 min.) for 20 cycles, followed by a final elongation step at 75° C for 10 minutes. The products were resolved on a 2% agarose gel and DNA of the correct size (297 bp and 190 bp) was purified. The ends were repaired by adding nucleoside triphosphates and Klenow DNA polymerase.
• the product of reactions D and E (100 ng of each) were mixed (final volume of 100 //L upon addition of Taq polymerase) with primers #1 and #4 and amplified as described above.
• the amplified product resolved on a 1 .5% agarose gel and the correct size fragment (465 bp) was purified.
• the resulting product, DNA that encodes FGFC78/96S-SAP had Ndel and Ncol ends. It was digested with Ndel and Ncol and ligated into Ndel/Ncol- digested PZ1 B1 and into Ndel/Ncol-digested PZ1 C1 (PZIC described in Example 2 above). The resulting constructs were designated PZ2B1 and PZ2C1 , respectively.
• FPFS4 recombinant FGFC78/96S-SAP protein
• LB medium containing ampicillin 100 g/ml were inoculated with a fresh glycerol stock of PZ1 B.
• Cells were grown at 30° C in an incubator shaker to an OD 600 of 0.7 and stored overnight at 4° C. The following day the cells were pelleted and resuspended in fresh LB medium (no ampicillin). The cells were divided into 5 1 -liter batches and grown at 30° C in an incubator shaker to an OD 600 of 1 .5.
• IPTG SIGMA CHEMICAL, St. Louis, MO
• PZ2C1 In order to grow PZ2C1 , prior to induction, the cells were grown in medium containing kanamycin (50//g/ml) in place of ampicillin.
• the cytotoxicity of the mutein FGF-SAP produced from PZ2B1 (FPFS4) w?s assessed on SK MEL 28 cells and was at least equivalent to the activity of the wild type FGF-SAP chemical conjugate, and recombinant FGF-SAP produced from PZ1 B1 .
• Wild-type chemical conjugate bFGF-SAP was supplied in Dulbecco's phosphate buffered saline (PBS) at a concentration of 1 .0 mg/ml.
• Fusion protein bFGF-SAP in E ⁇ . coli was supplied in Dulbecco's PBS at a concentration of 9.0 mg/ml.
• Basic FGF was supplied in Dulbecco's PBS at a concentration of 1 .0 mg/ml.
• Saporin was supplied in Dulbecco's PBS (0.01 M Phosphate, 0.14 M NaCI, pH 7.4) at a concentration of 1 .0 mg/ml. All dilutions were made in Dulbecco's PBS with 0.1 % bovine serum albumin (NB 1005-18).
• mice Female Balb/c nu/nu athymic mice (Roger Williams Hospital Animal Facility, Buffalo, RI), 8-12 weeks old, were maintained in an aseptic environment. Sixty-three animals were selected for the study, and body weights ranged from 25-30 grams the day prior to dosing.
• PA-1 human ovarian teratocarcinoma cells were obtained from the American Type Culture Collection (Rockville, MD; ATCC accession no. CRL1572) were grown in modified Eagle's medium supplemented with 10% fetal calf serum.
• mice received a subcutaneous injection of tumor cells (approximately 2 x 10 6 PA-1 human ovarian teratocarcinoma cells/mouse) in the right rear flank. (7) Tumor Size Measurements
• Dosing material was prepared by mixing the test material with appropriate volumes of PBS/0.1 % BSA to achieve the final doses.
• mice received four weekly IV injections (250-300 ul) into the tail vein on days 5, 12, 19 and 26 with day 1 designated as the day that the tumor cells were injected into the mice. Doses were individualized for differences in body weight.
• tumors were measured prior to injection of the test material and at bi-weekly intervals for 61 days. Tumors from animals in all groups were approximately 55-60 mm 3 on day 5 when treatment began.
• the vehicle-treated group (PBS with 0.1 % BSA) showed a 50-fold increase in tumor volume over the 61 days of the study.
• the other control groups demonstrated similar levels of tumor growth: the SAP control group showed a 30-fold increase, the bFGF control group showed a 50-fold increase, and the bFGF plus SAP group showed a 50-fold increase in tumor volume. In all the control groups, the rate of growth of the tumor was fairly consistent over the 61 -day period.
• the 0.5 //g/kg/week fusion protein bFGF-SAP group showed significant suppression of tumor growth to day 26 when tumors were at 71 % of controls. There was no statistical difference between tumor volumes in the 0.5 / g/kg/week wild-type chemical conjugate bFGF-SAP and fusion protein bFGF-SAP groups at 30 days. A statistical comparison of the two 50 //g/kg/week treatment groups was not done because there were only two surviving animals in the fusion protein bFGF-SAP group.
• MOLECULE TYPE DNA (genomic)
• ANTI-SENSE NO
• MOLECULE TYPE DNA (genomic)
• ANTI-SENSE YES
• MOLECULE TYPE DNA (genomic)
• MOLECULE TYPE DNA (genomic)
• GCT ATA CTT TTT CTT CCA ATG TCT GCT AAG AGC GCC ATG GTC ACA TCA 480 Ala He Leu Phe Leu Pro Met Ser Ala Lys Ser Ala Met Val Thr Ser 145 150 155 160
• GCT ATA CTT TTT CTT CCA ATG TCT GCT AAG AGC GCC ATG GTC ACA TCA 480 Ala He Leu Phe Leu Pro Met Ser Ala Lys Ser Ala Met Val Thr Ser 145 150 155 160
• MOLECULE TYPE DNA (genomic)
• MOLECULE TYPE DNA (genomic)
• MOLECULE TYPE DNA (genomic)
• MOLECULE TYPE DNA (genomic)
• MOLECULE TYPE DNA (genomic)
• MOLECULE TYPE DNA (genomic)
• MOLECULE TYPE DNA (genomic)
• MOLECULE TYPE DNA (genomic)
• MOLECULE TYPE DNA (genomic)
• MOLECULE TYPE DNA (genomic)
• ANTI-SENSE YES

Priority Applications (3)

Applications Claiming Priority (4)

Publications (1)

Family

ID=26796629

Family Applications (1)

Country Status (5)

Cited By (20)

Families Citing this family (2)

Citations (4)

• 1994
  • 1994-07-27 JP JP7505960A patent/JPH09503751A/ja active Pending
  • 1994-07-27 WO PCT/US1994/008511 patent/WO1995003831A1/en not_active Application Discontinuation
  • 1994-07-27 CA CA002168647A patent/CA2168647A1/en not_active Abandoned
  • 1994-07-27 EP EP94924508A patent/EP0712314A1/en not_active Withdrawn
  • 1994-07-27 AU AU74756/94A patent/AU7475694A/en not_active Abandoned

Patent Citations (4)

Non-Patent Citations (5)

Also Published As

Similar Documents

Legal Events