WO1994023028A2 - Modified oligonucleotides having improved anti-influenza activity - Google Patents

Modified oligonucleotides having improved anti-influenza activity Download PDF

Info

Publication number
WO1994023028A2
WO1994023028A2 PCT/US1994/003454 US9403454W WO9423028A2 WO 1994023028 A2 WO1994023028 A2 WO 1994023028A2 US 9403454 W US9403454 W US 9403454W WO 9423028 A2 WO9423028 A2 WO 9423028A2
Authority
WO
WIPO (PCT)
Prior art keywords
influenza
oligonucleotide
gene
oligonucleotide according
phosphorothioate
Prior art date
Application number
PCT/US1994/003454
Other languages
French (fr)
Other versions
WO1994023028A3 (en
Inventor
Sudhir Agrawal
Jin-Yan Tang
Abeysinghe Padmapriya
Original Assignee
Hybridon, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US4075293A priority Critical
Priority to US08/040,752 priority
Application filed by Hybridon, Inc. filed Critical Hybridon, Inc.
Publication of WO1994023028A2 publication Critical patent/WO1994023028A2/en
Publication of WO1994023028A3 publication Critical patent/WO1994023028A3/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids

Abstract

The invention provides anti-influenza modified oligonucleotides that have greater efficacy in inhibiting influenza replication or propagation than previously described oligonucleotides. The greater efficacy arises from structural features such as chimeric or hybrid backbones, nuclease resistance-conferring terminal capping structures and/or self-complementary regions.

Description

MODIFIED OLIGONUCLEOTIDES HAVING IMPROVED ANTI-INFLUENZA ACTIVITY

This is a continuation-in-part of Ser. No. 07/909,069, filed July 2, 1992. This is also a continuation-in-part of

Ser. No. 07/918,239, filed July 23, 1992. This is also a continuation-in-part of Ser. No. 07/698,568, filed May 10,

1991.

BACKGROUND OF THE INVENTION Field Of The Invention

The invention relates to anti-sense oligonucleotides. More particularly, the invention relates to modified oligonucleotides that are capable of inhibiting replication or propagation of influenza virus.

Summary Of The Related Art

Influenza A virus is a membrane-enclosed virus whose genome is a segmented minus strand of RNA. The ten influenza virus genes are present on eight segments of the single- stranded RNA of strains A and B, and on seven segments of strain C. The segments are of varying sizes (ranging from 890 to 2341 nucleotides in length) and each is a template for synthesis' for a different mRNA. The influenza virus virion contains virus-specific RNA polymerases necessary for mRNA synthesis from these templates and, in the absence of such specific polymerases, the minus strand of influenza virus RNA is not infectious. Initiation of transcription of the mRNAs occurs when the influenza virus mRNA polymerase takes 12 to 15 nucleotides from the 5' end of a cellular mRNA or mRNA precursor and uses the borrowed oligonucleotide as a primer. Generally, the mRNAs made through this process encode only one protein. The M RNA and the NS RNA also encode spliced mRNAs, which results in production of two different proteins for each of these two segments. Influenza viruses infect humans and animals (e.g., pigs, birds, horses) and may cause acute respiratory disease. There have been numerous attempts to produce vaccines effective against influenza virus. None, however, have been completely successful, particularly on a long-term basis. This may be due, at least in part, to the segmented characteristic of the influenza virus genome, which makes it possible, through reassortment of the segments, for numerous forms to exist. For example, it has been suggested that there could be an interchange of RNA segment between animal and human influenza viruses, which would result in the introduction of new antigenic subtypes into both populations. Thus, a long-term vaccination approach has failed, due to the emergence of new subtypes (antigenic "shift") . In addition, the surface proteins of the virus, hemagglutinin and neuraminidase, constantly undergo minor antigenic changes (antigenic "drift") . This high degree of variation explains why specific immunity developed against a particular influenza virus does not establish protection against new variants. Hence, alternative antiviral strategies are needed. Although influenza B and C viruses cause less clinical disease than the A types, chemical antivirals should also be helpful in curbing infections caused by these agents.

Consequently, there is considerable interest in the development of anti-sense oligonucleotides that are capable of inhibiting the replication or propagation of influenza virus. Such anti-sense oligonucleotides hold the promise of providing broader protection against different strains of influenza, because they can be designed to hybridize to conserved regions of the influenza genome that are present in multiple strains of influenza virus.

Agrawal et al., U.S. Patent No. 5,194,428 the teachings of which are hereby incorporated by reference, discloses oligonucleotides having certain modified internucleotide linkages that are capable of inhibiting influenza replication by hybridizing to the influenza PB1 polymerase gene. Cowsert et al., 092/03454 (1992) discloses antisense oligonucleotides that inhibit influenza virus propagation by hybridizing to the influenza polymerase 1, 2 or 3, or the hemagglutinin, nucleoprotein, neuraminidase, matrix protein, or nonstructural protein gene, or to various splice junction sites or packaging sequences.

Pederson et al., U.S. Patent Nos. 5,149,797 and 5,XXX,XXX (Serial No. 07/839,472, allowed December 24, 1992), the teachings of which are hereby incorporated by reference, discloses chimeric mixed phosphate backbone oligonucleotides having RNase H activating segments adjacent to RNase H inactivating segments.

Thus, anti-sense oligonucleotides show promise as anti- influenza therapeutic agents. As with any such agents, however, there remains a need for improved agents that have even greater efficacy in inhibiting influenza virus replication or propagation. Such improved anti-sense oligonucleotides would be useful for studying which regions of the influenza virus genome are the best candidates for broad cross-strain inhibition as well as for use, and as anti- influenza therapeutic agents.

BRIEF SUMMARY OF THE INVENTION

The invention provides modified oligonucleotides having greater efficacy in inhibiting the replication or propagation of influenza virus than previously known oligonucleotides. These modified oligonucleotides are characterized by having a nucleotide sequence sufficiently complementary to an essential nucleic acid of influenza virus origin to hybridize to such influenza virus nucleic acid in a cell. In preferred embodiments, the essential nucleic acid is a portion of the PB1, 2 or 3 polymerase gene or to the hemagglutinin, nucleoprotein, neuraminidase, matrix protein, or nonstructural protein gene of influenza or to the various influenza splice junction sites or packaging sequences.

In various embodiments, modified oligonucleotides according to the invention have one or more type of modified internucleotide linkage. In a preferred embodiment, at least some of the modified internucleotide linkages are phosphorothioate or phosphorodithioate linkages. In certain preferred embodiments, phosphorothioate internucleotide linkages are present in a modified oligonucleotide that also contains other modified, i.e. nonphosphodiester, linkages. Preferably these other modified internucleotide linkages are alkylphosphonate or alkylphosphonothioate linkages. Most preferably, these other modified internucleotide linkages are present at or near one or both ends of the oligonucleotide. In additional preferred embodiments of modified oligonucleotides according to the invention, phosphorothioate or phosphorodithioate internucleotide linkages are present in an oligonucleotide having one or more modified nucleoside. Preferably, such modified nucleoside is a 2'-0 alkyl nucleoside. Most preferably, at least some modified nucleosides are present at or near one or both ends of the oligonucleotide.

In yet additional preferred embodiments of modified oligonucleotides according to the invention, phosphorothioate or phosphorodithioate internucleotide linkages are present in an oligonucleotide having an exonuclease resistance-conferring cap structure at one or both ends. Preferably, such a cap structure is present at least at the 31 end of the molecule. Such cap structures may also be present at one or both ends of all embodiments of modified oligonucleotides according to the invention and preferably are present at least at the 3' end of the oligonucleotide.

In further preferred embodiments of modified oligonucleotides according to the invention, phosphorothioate or phosphorodithioate internucleotide linkages are present in an oligonucleotide that is self-stabilized by having a self- complementary region involving nucleotides at or near one or both ends, and preferably at least at or near the 31 end, whereby the oligonucleotide forms a hairpin-like structure. Each of these modified oligonucleotides according to the invention provides greater efficacy in inhibiting replication or propagation of influenza than any known oligonucleotide or modified oligonucleotide that hybridizes to the same gene. Each of these modified oligonucleotides according to the invention may optionally also contain other modifications to the sugars or bases of the oligonucleotide and may also optionally have additional internucleotide linkages other than phosphorothioate, phosphorodithioate, alkylphosphonate or alkylphosphonothioate linkages.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows the nucleotide sequence of an influenza virus PBl (polymerase 1) gene, against which complementary antisense oligonucleotides can be prepared.

Figure 2 shows a self-stabilized anti-influenza modified oligonucleotide according to the invention.

Figure 3 shows an alternative form of a self-stabilized anti-influenza modified oligonucleotide according to the invention.

Figure 4 shows certain preferred cap structures that confer exonuclease resistance upon oligonucleotides.

Figure 5 shows in vivo nucleolytic degradation patterns for 5'-capped, 3'-capped and uncapped oligonucleotides.

Figure 6 shows DNA Polymerase I 3•-exonuclease degradation patterns for self-stabilized and non-self- stabilized oligodeoxynucleotide phosphodiesters.

Figure 7 shows DNA Polymerase I 3'-exonuclease degradation patterns for self-stabilized and non-self- stabilized oligodeoxynucleotide phosphorothioates. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

The invention relates to anti-sense oligonucleotides having anti-influenza activity. Modified oligonuclestides having in vivo activity against influenza are referred to herein as anti-influenza modified oligonucleotides. The invention provides anti-influenza modified oligonucleotides that have greater efficacy in inhibiting replication or propagation of influenza virus than known oligonucleotides or modified oligonucleotides that hybridize to the same gene. Modified oligonucleotides according to the invention have specific preferred characteristics that are discussed in greater detail for each preferred embodiment below. In addition to these characteristics, modified oligonucleotides according to the invention may optionally have additional ribonucleotide, 2'-substituted ribonucleotide, and/or deoxyribonucleotide monomers, any of which are connected together via 5* to 3' linkages which may include any of the internucleotide linkages known in the art. Preferably, such modified oligonucleotides may optionally contain phosphodiester, phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate, bridged phosphoramidate, bridged methylene phosphonate, bridged phosphorothioate and/or sulfone internucleotide linkages. Those skilled in the art will recognize that the synthesis of oligonucleotides containing any of these internucleotide linkages is well known to those skilled in the art, as is illustrated by articles by Uhlmann and Peyman, Chemical Reviews jK:543-584 (1990) and Schneider and Banner, Tetrahedron Lett. 3_1:335 (1990). Preferably, modified oligonucleotides according to the invention should contain from about 6 to about 100 monomers in total. Such modified oligonucleotides may also optionally contain modified nucleic acid bases and/or sugars, as well as added substituents, such as diamines, cholesteryl or other lipophilic groups.

Various preferred embodiments of modified oligonucleotides according to the invention are illustrated in Table I, below. Although these embodiments all have a nucleotide sequence from the same region of the influenza PBl polymerase gene, those skilled in the art will recognize that the anti-influenza efficacy of oligonucleotides having nucleotide sequences complementary to other essential nucleic acid sequences of influenza virus can also be enhanced by incorporating into such oligonucleotides the structural features of preferred embodiments of modified oligonucleotides according to the invention. For purposes of the invention, complementary means having a sequence that hybridizes to the essential nucleic acid sequence under physiological conditions. An essential nucleic acid sequence of influenza virus means a nucleic acid sequence that is required for replication or propagation of influenza virus. Such essential nucleic acid sequences can be from any known strain of influenza virus. For example such oligonucleotides can have other sequences from the influenza PBl polymerase gene

(polymerase 1), as shown in Table I of U.S. Patent No.

5,194,428, the teachings of which are hereby incorporated by reference. Indeed, any sequence from the influenza PBl

(polymerase 1) gene [SEQ. ID. No. 1] (see Figure 1) should serve as the basis for modified oligonucleotides according to the invention. Alternatively, sequences from other influenza sequences or genes can be used (see Table II) . As a practical matter, the structural features of preferred embodiments of modified oligonucleotides according to the invention should enhance the anti-influenza activity of any antisense oligonucleotide having a nucleotide sequence that hybridizes in a cell with any essential nucleic acid sequence of influenza virus.

Each preferred embodiment of modified oligonucleotides according to the invention is separately discussed in greater detail below. TABLE I

Modified Oligonucleotides Having Superior

Anti-Influenza Activity

Compound Sequence and Identification Structure ΓSEO. ID NO.l

CMPD A CAGAGCAAAATCATCAGAAGA1 [SEQ. ID NO.

2] CMPD B CAGAGCAAAATCATCAGAAGA2 [SEQ. ID NO.

3]

CMPD C CAGAGCAAAATCATCAGAAGA3 [SEQ. ID NO.

4]

CMPD D CAGAGCAAAATCATCAGAAGA3 [SEQ. ID NO.

5]

CMPD E CAGAGCAAAATCATCAGAAGA2 [SEQ. ID NO.

6]

CMPD F CAGAGCAAAATCATCAGAAGA2 [SEQ. ID NO.

7]

CMPD G CAGAGCAAAATCATCAGAAGA3 [SEQ. ID NO.

8]

CMPD H CAGAGCAAAATCATCAGAAGA3 [SEQ. ID NO.

9]

CMPD I CAGAGCAAAATCATCAGAAGA-C12 4 [SEQ. ID NO. 10]

CMPD J AGAGCAAAATCATCAGAAG3 [SEQ. ID NO.

12]

CMPD K GAGCAAAATCATCAGAA3 [SEQ. ID NO.

14]

CMPD L CAGAGCAAAATCATCAGAAGA3 [SEQ. ID NO. 15]

CMPD M CAGAGCAAAATCATCAGAAGATTCTGATGA5 [SEQ. ID NO. 16] All sequences shown 5' to 3• ; nonunderlined regions are oligonucleotide phosphorothioates. Underscoring represents nucleotides connected by methylphosphonate internucleotide linkage. Underscoring represents nucleotides connected by methylphosphonothioate linkage. Underscoring represents 2'-OMe nucleotides. C12 represents cap structure. Self-stabilized.

TABLE II Additional Anti-Influenza Oligonucleotide Potential Sequences

Sequence Target rSEO. ID. No.1

CTT TCC ATA TTG AAT ATA AT AUG segment 1 [SEQ. ID. No.17] polymerase 3

ACA TCC ATT CAA ATG GTT TG AUG segment 2 [SEQ. ID. No.18] polymerase 1 TCT TCC ATT TTG GAT CAG TA AUG segment 3 [SEQ. ID. No.19] polymerase 2 GCC TTC ATT TTG GTT GTT TT AUG segment 4 [SEQ. ID. No.20] hemagglutinin GAC GCC ATG ATT TTG ATG TC AUG segment 5 [SEQ. ID. No.21] nucleoprotein GGA TTC ATT TTA AAC CCC TG AUG segment 6 [SEQ. ID. No.22] neuraminidase AGA CTC ATC TTT CAA TAT CT AUG segment 7 [SEQ. ID. No.23] matrix protein GAT AGA GAG AAC GTA CGT TT left splice [SEQ. ID. No.24] junction segment 7 TCT GAT AGG CCT GCA AAT TT right splice [SEQ. ID. No.25] junction segment 7 GGA TCC ATT ATG TCT TTG TC AUG segment 8 [SEQ. ID. No.26] nonstructural protein CAT GTC GGT TAG GTA ACG CG splice branch [SEQ. ID. No.27] segment 8 GCA ATC TAC CTG AAA GCT TG right splice [SEQ. ID. No.28] junction segment 8 AGC AGT ATG TCC TGG AAG AG left splice [SEQ. ID. No.29] junction segment 8 AAA ACG ACC TTG TTT CTA CT packaging [SEQ. ID. No.30] sequence segment 1

AAA AAT GCC TTG TTC CTA CT packaging [SEQ. ID. No.31] sequence segment 2 AAA AGT ACC TTG TTT CTA CT packaging [SEQ. ID. No. 32] sequence segment 3

AAA ACA CCC TTG TTT CTA CT packaging [SEQ. ID. No. 33] sequence segment 4

AAA ATA CCC TTG TTT CTA CT packaging [SEQ. ID. No. 34] sequenc segment 5

AAA AAC TCC TTG TTT CTA CT packaging [SEQ. ID. No. 35] sequence segment 6

AAA ACT ACC TTG TTT CTA CT packaging [SEQ. ID. No.36] sequence segment 7

AAA ACA CCC TTG TTT CTA CT packaging [SEQ. ID. No. 37] sequence segment 8

In a first preferred embodiment, anti-influenza modified oligonucleotides according to the invention are in the form of a mixed backbone chimeric oligonucleotide having one or more regions of nucleotides connected by phosphorothioate or phosphorodithioateinternucleotide linkages ("phosphorothioate or phosphorodithioate region") as well as one or more regions of nucleotides connected by alkylphosphonate internucleotide linkages ("alkylphosphonate region") . In this embodiment, at least one alkylphosphonate region preferably includes nucleotides at or near the 5' end and/or the 3' end of the oligonucleotide. For purposes of the invention, "at or near the 5• or the 3' end of the oligonucleotide" means involving at least one nucleotide within about 5 nucleotides from the 5' or 3' end of the oligonucleotide. Preferably, the alkylphosphonate region comprises from about 2 to about 10 contiguous nucleotides connected by alkylphosphonate linkages. Preferably, the phosphorothioate or phosphorodithioate region comprises at least 3, and up to about 100 contiguous nucleotides connected by phosphorothioate or phosphorodithioate linkages. An example of an anti-influenza modified oligonucleotide according to this embodiment of the invention is shown in Table I as CMPD A.

Anti-influenza modified oligonucleotides according to this embodiment of the invention are synthesized by solid phase methods, alternating H-phosphonate chemistry and sulfur oxidation for phosphorothioate regions, and alkylphosphonamidate chemistry for alkylphosphonate regions. A preferred H-phosphonate approach is taught by Agrawal et al., U.S. Patent No. 5,149,798, the teachings of which are hereby incorporated by reference. Alkylphosphonamidite chemistry is well known in the art, as illustrated by Agrawal and Goodchild, Tetrahedron Lett. £5:3539-3542 (1987). Synthesis of phosphorodithioate-containing oligonucleotides is also well known in the art, as illustrated by U.S. Patent No. 5,151,510, the teachings of which are hereby incorporated by reference (See also, e.g.. Marshall and Caruthers, Science 259: 1564-1570 (1993) and references cited therein).

In a second preferred embodiment, anti-influenza modified oligonucleotides according to the invention are in the form of a mixed backbone chimeric oligonucleotide having one or more region of nucleotides connected by phosphorothioate or phosphorodithioate internucleotidelinkages ("phosphorothioate or phosphorodithioate region") , as well as one or more region of nucleotides connected by alkylphosphonothioate or arylphosphonothioate internucleotide linkages ("alkylphosphonothioate region") . In this embodiment, at least one alkylphosphonothioate region preferably includes nucleotides at or near the 5' end and/or the 3 ' end of the oligonucleotide. Preferably, the alkylphosphonothioate region comprises from about 2 to about 10 contiguous nucleotides connected by alkylphosphonothioate linkages. Preferably, the phosphorothioate or phosphorodithioate region comprises at least 3, and up to about 100 contiguous nucleotides connected by phosphorothioate or phosphorodithioate linkages. Examples of anti-influenza modified oligonucleotides according to this embodiment of the invention are shown in Table I as CMPD B, CMPD E and CMPD F.

Anti-influenza modified oligonucleotides according to this embodiment of the invention are synthesized by solid phase methods, alternating chemistries for each region to be synthesized. Phosphorothioate or phosphorodithioate regions are synthesized as described for the first embodiment. Alkylphosphonothioate regions are synthesized by coupling together two or more nucleosides via alkylphosphite linkages, then oxidatively thiolating the alkylphosphite linkages to produce alkylphosphonothioate linkages. This synthesis procedure is set forth in detail in Example 1.

In a third preferred embodiment, anti-influenza modified oligonucleotides according to the invention are in the form of a hybrid oligonucleotide having regions of deoxyribonucleotides ("deoxyribonucleotide regions") and regions of ribonucleotides or 2'-substituted ribonucleotides ("ribonucleotide regions") . Preferably, from about one to about all of the internucleotide linkages are phosphorothioate or phosphorodithioate linkages. Preferred 2'-substituted ribonucleotides are halo, amino, alkyl, aryl or lower alkyl (1-6 carbon atoms) substituted ribonucleotides, especially 2'- OMe-ribonucleotides. Preferably, at least some of the ribonucleotide regions include nucleotides present at or near the 51 end and/or the 3' end of the oligonucleotide. Most preferably, the ribonucleotide regions each comprise from about 2 and preferably from about 4 to about 100 contiguous ribonucleotides and/or 2•-substitute oligonucleotides. The deoxyribonucleotide regions are optional, and when present may contain from about 1 to about 100 contiguous deoxyribo¬ nucleotides. Examples of anti-influenza modified oligonucleotides according to this embodiment of the invention are shown in Table I as CMPD C, CMPD D, CMPD G, CMPD H, CMPD K, CMPD M and CMPD N. Anti-influenza modified oligonucleotides according to this embodiment of the invention are typically synthesized by solid phase methods, preferably by the H-phosphonate approach, using deoxynucleotide H-phosphonates for deoxyribonucleotide regions, and ribonucleotide or 2'-substituted ribonucleotide H-phosphonates for ribonucleotide regions.

In a fourth preferred embodiment, anti-influenza modified oligonucleotides according to the invention are in the form of an oligonucleotide having at its 5' and/or 3' end a cap structure that confers exonuclease resistance to the oligonucleotide. Such modified oligonucleotides preferably also have from 1 to about all modified (non-phosphodiester) internucleotide linkage. Preferred cap structures include those shown in Figure 4, as well as lower alkyl (C1-C12) or alcohol groups. Preferred modified internucleotide linkages include phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate, bridged phosphorothioate, sulfone, phosphorothioate and phosphorodithioate linkages.

Anti-influenza modified oligonucleotides according to this embodiment of the invention are synthesized according to procedures well known in the art (see e.g.. Uhlmann and Peyman, Chemical Reviews 9_0:543-584 (1990); Schneider and Banner, Tetrahedron Lett. 3_1:335 (1990)). For oligonucleotides having cap structures at the 3' end, the cap structure is reversibly attached to the solid support and is then coupled to the first nucleotide monomer in the synthesis scheme. For oligonucleotides having cap structures at the 51 end, the cap structure is coupled to the end of the oligonucleotide after addition of the last nucleotide monomer in the synthesis scheme.

In a fifth embodiment, anti-influenza modified oligonucleotides are self-stabilized by having a self- complementary region that hybridizes intra olecularly with the oligonucleotide to form an exonuclease resistant hairpin-like structure. Anti-influenza modified oligonucleotides according to this embodiment of the invention are generally characterized by having two regions: an influenza hybridizing region and a self-complementary region. The influenza hybridizing region has a nucleotide sequence that is complementary to an essential nucleic acid sequence of influenza virus. Preferably, this region has from about 6 to about 100 nucleotides. One form of this embodiment of the invention is shown in Figure 2. In this form, the influenza hybridizing region is shown as connected rectangular squares, and the self-complementary region is shown as connected circles. The complementary nucleic acid sequence in a target influenza messenger RNA molecule is represented by connected diamonds. Hydrogen bonding between nucleotides is indicated by dots. The oligonucleotide is stabilized, i.e.. rendered resistant to exonucleolytic degradation by base-pairing between the target hybridizing region and the self- complementary region and/or by base-pairing between complementary sequences within the self-complementary region. When the oligonucleotide encounters an influenza nucleic acid molecule having a complementary nucleic acid sequence, base- pairing between the influenza hybridizing region and the self- complementary region of the oligonucleotide is disrupted and replaced by base-pairing between the influenza hybridizing region of the oligonucleotide and the complementary nucleic acid sequence of the nucleic acid molecule. This disruption and replacement of base-pairing takes place because the intermolecular base-paired structure formed by the hybrid between the target nucleic acid sequence and the target hybridizing region is more thermodynamically stable than the intramolecular base-paired structure formed by the self- complementary oligonucleotide.

A second form of an oligonucleotide according to this embodiment of the invention operates in a similar way as the first form, but forms a different structure upon self- complementary base-pairing. This alternative form forms a hammer-like structure as shown in Figure 3. In this form, the self-complementary region contains oligonucleotide sequences that can base pair with other oligonucleotide sequences within the self-complementary region. The self-complementary region may also contain oligonucleotide sequences that are complementary to the influenza hybridizing region.

The second significant region of self-stabilized oligonucleotides according to the invention is the self- complementary region. The self-complementary region contains oligonucleotide sequences that are complementary to other oligonucleotide sequences within the oligonucleotide. These other oligonucleotide sequences may be within the influenza hybridizing region or within the self-complementary region, or they may span both regions. The complementary sequences form base pairs, resulting in the formation of a hairpin structure, as shown in Figure 2, or a hammer-like structure, as shown in Figure 3. Either the hairpin structure or the hammer-like structure can have loops resulting from non-base-paired nucleotides, as shown in Figure 2 for the hairpin structure, or can be devoid of such loops, as shown in Figure 3 for the hammer-like structure. The number of base-pairs to be formed by intra-molecular hybridization involving the self- complementary region may vary, but should be adequate to maintain a double-stranded structure so that the 3' end is not accessible to endonucleases. Generally, about 4 or more base- pairs will be necessary to maintain such a double-stranded structure. In a preferred embodiment, there are about 10 intramolecular base-pairs formed in the self-stabilized oligonucleotide, with the 10 base pairs being consecutive and involving the 3'-most nucleotides. Of course, the intra¬ molecular base-pairing can be so extensive as to involve every nucleotide of the oligonucleotide. Preferably, this will involve a self-complementary region of about 50 nucleotides or less.

Oligonucleotides according to this embodiment may have from 1 to about all modified internucleotide linkages, as described for the fourth embodiment. Preferably, at least either the influenza hybridizing region or the self- complementary region, and most preferably both, will contain from about 2 to about all nucleotides being coupled by phosphorothioate and/or phosphorodithioate linkages.

An example of an anti-influenza modified oligonucleotide according to this embodiment of the invention is shown in Table I as CMPD O.

Those skilled in the art will recognize that the features of the various preferred embodiments described above can be combined to produce additional embodiments that may have even greater anti-influenza activity. Thus, the invention contemplates anti-influenza modified oligonucleotides having every possible combination of chimeric features, hybrid features, cap structures and self-stabilizing character, all as described herein. Each of the preferred embodiments of the present invention has greater ability to inhibit influenza replication or propagation than anti-sense oligonucleotides of the prior art that hybridize to the same influenza mRNA. For example, U.S. Patent No. 5,194,428, teaches modified oligonucleotides that inhibit influenza virus replication. Among those modified oligonucleotides are oligonucleotide phosphorothioates that hybridize to the influenza PBl

(polymerase 1) gene. In the present study, an oligonucleotide phosphorothioate that hybridizes to the influenza PBl polymerase gene was tested for its ability to inhibit influenza virus replication in comparison with various preferred embodiments of the present invention. Each embodiment of the present invention tested demonstrated surprisingly improved efficacy in anti-influenza activity, relative to the oligonucleotide phosphorothioate that binds to the same site on the same gene. As shown in Table III, below, anti-influenza modified oligonucleotides according to the invention gave a reduction in the 50 per cent inhibitory concentration (IC50) ranging from 2 to nearly fifteen fold.

TABLE III

Anti-Influenza Activity Of Oligonucleotide

Oligonucleotide ICE0 fuσ/ml) X - F o 1 d Improvement

CAGAGCAAAATCATCAGAAGA1 3172

CMPD A N.T.

CMPD B 34 9.3

CMPD C 55 5.8

CMPD D 582 5.5

CMPD E N.T.

CMPD F 178 1.8

CMPD G 147 2.2

CMPD H 59 5.4

CMPD I 45 7.0

CMPD J 272 11.7

CMPD K 222 14.4

CMPD L 61 5.2

CMPD M 175 1.8

CMPD N 1042 3.0

CMPD 0 232 13.8

1 oligodeoxynucleotide phosphorothioate control

2 average of two experiments

Such oligonucleotides are useful for a variety of purposes. First, they can be used in studies to determine which influenza genes and sites within such genes provide the best ba≤is for anti-sense oligonucleotides having broad effectiveness against multiple strains of influenza virus. Second, they can be used to determine what structural features or combination of structural features provide the greatest effectiveness against influenza in vitro and m vivo. Finally, such oligonucleotides are useful as therapeutic agents for treating influenza infections. For such treatment, oligonucleotides may be administered intraperitoneally, intranasally, orally or anally. Preferably, such oligonucleotides will be administered at a concentration of from about 1 to about 50 mg/kg body weight.

The following examples are intended to further illustrate certain preferred embodiments of the invention and are not intended to be limiting in nature.

EXAMPLE 1

Synthesis Of A Chimeric Oligonucleotide Having Methylphosphonate And Phosphorothioate Regions

Chimeric oligonucleotides having methylphosphonate and phosphorothioate regions were synthesized using methylphosphonamindites for methylphosphonate regions and nucleoside H-phosphonates for phosphorothioate regions. Methylphosphonamidite synthesis was as follows:

Methylchloro-N, N-diisopropylaminosphophine was prepared by reaction of methyldichlorophosphine (51 mmol) with diisopropylamine (102 mmol) in ether at 15° under nitrogen. After removal of salt by filtration and evaporation of solvent, methylchloro-^N-diisopropylaminophosphine was obtained as an oil (48 mmol, 95% of theory) that was characterized by JH and 31P NMR and was stable at -20° for at least eight weeks. The product was reacted with the usual protected nucleosides in dichloromethane containing N, N- diisopropylethylamine at room temperature for 10-20 min. Aqueous work up and precipitation from ethyl acetate using pentane at -30β to -40° gave product as white solids in 80-90% yield. Products were pure by tic on silica in CH2C12:EtOAc:Et3N(9:9:2) and were characterized by XH and 31P NMR. These products were used in automated DNA synthesizer using the same conditions and program used for standard phosphoramidite reagents. Nucleotides were dissolved in acetonitile at a concentration of 33 mg/ml and activated with tetrazole. Synthesis on prepacked CPG support was performed using a coupling time of 1 minute.

Coupling efficiency was followed by the dmethoxytrityl assay and was found to be the same as for control syntheses run in parallel using phosphoramidites.

After coupling, the product was detriylated then cleaved from the support with NH4OH at room temperature for 2 hrs and deblocked using ethylenediamine: ethanol (1:1) at room temperature for 4 hrs. This basic treatment caused about 1% degradation of the internucldoside phosphonate group in a model study assayed by HPLC. H-phosphonate synthesis was as exemplified in U.S. Patent

No. 5,149,798, the teachings of which are hereby incorporated by reference. Then, the H-phosphonates were converted to phosphorthioates by oxidation with 0.2 M sulfur in carbon disulfide/pyridine/triethylamine (9:9:1 vol/vol) .

EXAMPLE 2

Synthesis Of A Chimeric Oligonucleotide Having Methylphosphonothioate And Phosphorothioate Regions

For preparing a modified oligonucleotide having regions of four contiguous nucleotide methylphosphonothioates at either end and a region of 12 contiguous oligonucleotide phosphorothioates in the middle, the following procedure on 8 micromole scale was used. A first monomer was pre-bound to a control pore glass (CPG) solid support. A second monomer, which was a deoxynucleotide methylphosphonamidite, was coupled to the first monomer using a standard amidite coupling cycle (see e.g.. Agrawal and Goodchild, Tetrahedron Lett. 28:3539- 3542 (1987)). In separate cycles, three more deoxynucleotide methylphoshonamidites were sequentially coupled to the growing chain. Then oxidative thiolation was carried out, using 1% Beaucage reagent (3H-l,2-benzodithiole-2-one) in acetonitrile for 5 minutes at ambient temperature to generate a CPG-bound pentanucleotide methylphosphonothioate. The next 12 monomers were added sequentially by the H-phosphonate approach of Agrawal and Zamecnik, U.S. Patent No. 5,149,798, the teachings of which are hereby incorporated by reference. Then, the H- phosphonates were converted to phosphorothioates by oxidation with 0.2 M sulfur in carbon disulfide/pyridine/ triethylamine (9:9:1 vol/vol) . The final four monomers, which were deoxynucleotide methylphosphonothioates, were added, then oxidatively thiolated as described above. The resulting oligonucleotide was deprotected at room temperature for 30 minutes in 0.5 ml ethylene diamine, then kept at room temperature for 6 hours with occasional stirring. Finally, the mixture was filtered and evaporated in vacuo to obtain a solid mass and the mass was dissolved in water and desalted on Sep Pak C18.

EXAMPLE 3

Resistance Of Oligonucleotides Having Methylphosphonothioate Linkages To Nucleolvtic Degradation

Oligonucleotides having 2-4 contiguous deoxynucleotide methylphosphonates at 3' ends and otherwise having all deoxynucleotide phosphodiesters were tested for their relative resistance to 3 exonucleolytic degradation compared with an oligonucleotide phosphodiester. For each oligonucleotide, 0.4

AjjβQ units of oligonucleotide was lyophilized, dissolved in 0.5 ml buffer (10 mM Tris, 10 mM MgCl2, pH 8.5) and mixed with 5 μl (1.5 milliunits) of snake venom phosphodiesterase. The mixture was incubated at 37°C in a thermally regulated cell and Ajgo was plotted against time. Increase in hyperchromicity was used as the indicator for oligonucleotide degradation. The results are shown in Table IV, below.

These results demonstrate that oligonucleotides having methylphosphonothioate linkages near the 3• end were far more stable than the oligonucleotide lacking such linkages. In addition, oligonucleotide stability increased with increasing numbers of methylphosphonothioate linkages (4 linkages»3 linkages> >2 linkages) .

TABLE IV Resistance Of Oligonucleotides To Nucleolytic Degradation

% increase in

Oligonucleotide t 1/2 (seconds) hyperchromicity

Oligonucleotide phosphodiester 44 22.56

Oligonucleotide with 210 24.58

2 3' terminal deoxynucleotide methylphosphonothioates

Oligonucleotide with 264 18

3 3' terminal deoxynucleotide methylphosphonothioates

Oligonucleotide with 401 15.54

4 3' terminal deoxynucleotide methylphosphonothioates

EXAMPLE 4

Synthesis Of A Hybrid Oligonucleotide Phosphorothioate Having Deoxyribonucleotide And 2'-OMe-Ribonucleotide Regions

Hybrid oligonucleotide phosphorothioateswere synthesized on CPG on a 5-6 μmole scale on an automated synthesizer (model

8700, Millipore, Milford, MA) using the H-phosphonate approach described in U.S. Patent No. 5,149,798, the teachings of which are hereby incorporated by reference.

Deoxyribonucleoside H-phosphonates were obtained from Millipore. 2'-OMe ribonucleotide H-phosphonates were synthesized by standard procedures. Segments of oligonucleotides containing 2'-OMe nucleoside were assembled by using 2'-OMe ribonucleoside H-phosphonates for the desired cycles. Similarly, segments of oligonucleotides containing deoxyribonucleosides were assembled by using deoxynucleoside H-phosphonates for the desired cycles. After assembly, CPG bound oligonucleotide H-phosphonate was oxidized with sulfur as described in Example 2 to generate the phosphorothioate linkage. Oligonucleotides were then deprotected in concentrated NH40H at 40°C for 48 hours.

Crude oligonucleotide (about 500 A260 units) was analyzed on reverse low pressure chromatography on a C18 reversed phase medium. The DMT group was removed by treatment with 80% aqueous acetic acid, then the oligonucleotides were dialyzed against distilled water and lyophilized. EXAMPLE 5

Relative Nuclease Resistance Of Hybrid Oligonucleotide Phosphorothioates

To test the relative nuclease resistance of various hybrid oligonucleotide phosphorothioates, the oligonucleotides were treated with snake venom phosphodiesterase (SVPD) . About 0.2 A260 units of oligos having no 2'-0Me-RNA region, or having 3 and 4 contiguous 2'-OMe ribonucleotides at 5• and 3' ends, respectively, or having all 2'-OMe nucleotides, were dissolved in 500 μl buffer (40 mM NH4C03, pH 4.0 + 20 mM MgCl2) , and mixed with 0.1 units SVPD. The mixture was incubated at 37°C for 420 minutes. After 0, 200 and 420 minutes, 165 μl aliquots were removed and analyzed using ion exchange HPLC. The oligonucleotide having all 2•-OMe-ribonucleotides was very resistant to SVPD, whereas the oligonucleotide having no 2'- OMe-ribonucleotides was digested almost to completion and the oligonucleotide having 5' and 3' terminal 2'-0Me-RNA regions was digested to 50%. An oligonucleotide phosphodiester was digested to about 80% in one minute using one tenth of the concentration of SVPD.

These results indicate that the presence of 2'-OMe ribonucleotides in an oligonucleotide phosphorothioate enhances resistance to exonucleolytic digestion and that this enhanced resistance increases when a larger proportion of 2'- OMe ribonucleotides are used. Due to the similar character and behavior of ribonucleotides, other 2'-substituted ribonucleotides and 2'-OMe ribonucleotides, these results also suggest that similar enhancement of nuclease resistance would be obtained for hybrid oligonucleotide phosphorothioates and/or phosphorodithioates having ribonucleotides, 2'- substituted ribonucleotides, or a mixture of ribonucleotides and 2-substituted ribonucleotides.

EXAMPLE 6

Synthesis Of An Oligonucleotide Phosphorothioate Having A 3' Cap Structure

Oligonucleoside phosphorothioates were synthesized on a

Model 8700 automated synthesizer (Milligen-Biosearch,

Burlington, MA) using H-phosphonate chemistry on controlled pore glass (CPG), followed by oxidation with 0.2 M sulfur in carbon disulfide/pyridine/triethylamine (9:9:1 vol/vol) . Synthesis was carried out on a 5-10 micromolar scale. Oligonucleoside phosphorothioates were purified by low pressure ion exchange chromatography (DEAE-cellulose, DE-50 Whatman) , followed by reverse phase chromatography (C18) and dialysis. 5'-capped oligonucleoside phosphorothioates were prepared by carrying out the last coupling, after the assembly of the required sequence, with N-Fmoc-0'-DMTr-3-amino-l,2- propanediol-H-phosphonate. The 5'-capped oligonucleoside H- phosphonate was then oxidized with sulfur. 3'-capped oligonucleoside phosphorothioates were assembled on N-Fmoc-0'- DMTr-3-amino-l,2-propanediol-CPG, followed by sulfur oxidation. Combination of these procedures was used to produce 3',5'-capped oligonucleoside phosphorothioates.

Alternatively, oligonucleoside phosphorothioates having other 3' or 5' cap structures, (see e.g.. Figure 4), are prepared by substituting the phosphonate or CPG-derivatized cap structures forthe N-Fmoc-0'-DMTr-3-amino-l,2-propanediol- H phosphonate or CPG in the capping procedure. Similarly, capped modified oligonucleotides other than oligonucleotide phosphorothioates are prepared in an analogous manner by appending the capping procedure to the appropriate synthetic procedure.

EXAMPLE 7

In Vivo Stability Of Oligonucleotide Phosphorothioates Having Terminal Cap Structures

Male CDC2F1 mice (average weight 20 grams) were treated by intravenous or intraperitoneal injection with a 30 mg/kg dose of radiolabelled oligonucleotides dissolved in 200 microlitres physiological saline. Each capped or uncapped oligonucleotide was administered to three mice. Urine was collected separately from each animal up to 24 hours post- dosing, then extracted with proteinase K. (2 mg/ml, final concentration) in 0.5% SDS, 10 mM 20 M Tris Cl (pH 7.6), 10 mM EDTA for one hour at 37°C, followed by phenol-chloroform extraction and ethanol precipitation. Recovered oligonucleotides were then analyzed by PAGE (20% polyacrylamide/7 M urea) followed by autoradiography. Radioactivity was also measure from cage rinse to account for urine spill. Twenty-four hours after dosing, about 30% of oligonucleoside phosphorothioates were excreted, whether capped or uncapped. Excreted uncapped and 5'-capped oligonucleoside phosphorothioates were extensively degraded, as shown in Figure 5. Excreted 3•-capped and 3• ,5'-capped oligonucleoside phosphorothioates, in contrast, demonstrated virtually no degradation. This indicates that in vivo degradation of oligonucleoside phosphorothioates excreted in urine is mediated by 3'-exonuclease activity which can be inhibited by adding a cap to the 3• hydroxyl group of the oligonucleotide.

EXAMPLE 8

Nuclease Resistance Of Self-Stabilized Oligonucleotide Phosphodiesters

The control oligonucleotide used for this study was an oligodeoxynucleotide phosphodiester without a self- complementary region. The test compound was identical, except that it had a 3' self complementary region of 10 nucleotides. To control for any size effects, another control oligodeoxynucleotide phosphodiester was used that was identical to the first control oligonucleotide except for having at its 3' end 10 mismatched nucleotides (T10) .

The oligonucleotides were tested for their relative resistance to 3' exonucleolytic degradation. For each oligonucleotide, 0.4 A^ units of oligonucleotide was lyophilized, dissolved in 0.5 ml buffer (10 mM Tris, 10 mM MgCl2, pH 8.5) and mixed with 5 μl (1.5 milliunits) of snake venom phosphodiesterase (SVPD) . The mixture was incubated at 37° C in a thermally regulated cell and A^ was plotted against time. Oligonucleotide degradation was measured as function of increase in hyperchromicity.

The results of these experiments are shown in Table V, below. These results demonstrate that self-stabilized olignoucleotide phosphodiesters according to the invention are far more resistant to 3' exonucleotlytic degradation than either oligonucleotide phosphodiesters or oligonucleotide phosphodiesters having a non-complementary tail.

In addition to the testing described above, the oligonucleotides were also subjected to DNA Polymerase I 3'- exonuclease digestion. As shown in Figure 6 the non-self- stabilized oligonucleotides were digested to completion in 30 minutes, whereas the self-stabilized oligonucleotide with a 10 nucleotide self-complementary region was only partly digested over 30 minutes. TABLE V SVPD Half-Life Of Oligonucleotides

Supplementary Region Half-Life For SVPD Digestion

Absent 75 seconds

10 nucleotides 950 seconds mismatched 75 seconds

EXAMPLE 9

Nuclease Resistance of Self-Stabilized Oligonucleotide Phosphorothioates

To test the relative nuclease resistance of self- stabilized and non-self-stabilized oligonucleotide phosphorothioates, a DNA Polymerase I 3'-exonuclease activity assay was used, because of the slow degradation of oligonucleotide phosphorothioates by SVPD.

All oligonucleotides were labelled at the 5-end with gamma-32P-ATP and kinase. To a solution of 40 pmole 5'- labelled oligonucleotide in 20 μl buffer (40 mM Tris HCl, pH 8.0,

10 mM MgCl2, 5 mM DTT, 50 mM KC1, 50 μg/ml BSA) , 5 units DNA polymerase I was added and incubated at 37° C. Aliquots of 4 μl were taken at 0, 30, 60, 120 minutes and were mixed with 6 μl stop solution (98% formamide, 10 mM EDTA, 0.1% xylene cyanol, 0.1% bromophenol blue). The samples were analyzed by 15% acrylamide gel (urea) and autoradiography. The results are shown in Figure 7. Oligonucleotide phosphorothioates having no self-complementary region or only mismatched nucleotides (T10) at the 3' end (as described in

Example 8 for oligonucleotide phosphodiesters) were digested to almost 50% within 4 hours. The oligonucleotide phosphorothioate having a 10 nucleotide self-complementary region was undegraded after 4 hours. Oligonucleotide phosphorothioates having 6 or 4 nucleotide self-complementary regions were also found to be stable. These results demonstrate that self-stabilized oligonucleotide phosphorothioates are far more resistant to nucleolytic degradation than are non-self-stabilized oligonucleotide phosphorothioates.

EXAMPLE 10 Anti-Influenza Activity Of Modified Oligonucleotides

MDCK canine kidney cells were seeded in Minimum Essential Medium (MEM) with non-essential amino acids (GIBCO BRL, Grand Island, New York) with 5% fetal bovine serum (Hyclone Laboratories, Logen, Utah), 0.1% NaHC03, at a concentration of 4 x 10δ cells/ml in 96 well tissue culture plates (Corning, Corning, New York) at 0.2 ml/well. The cells were incubated overnight to establish monolayers of cells. Growth medium was then removed and 0.1 ml of oligonucleotide at pre-selected concentrations in serum-free MEM containing 0.18% NaHC03 and 50 μg/ml gentamycin. This was done for each compound for each of 4 wells: 1 well as toxicity control and 3 wells as anti¬ viral tests. Three cell control wells and six virus control wells received 0.1 ml of serum-free MEM containing 0.18% NaHC08 and 50 μg/ml gentamycin. Within 10 minutes of addition of the oligonucleotide compounds, influenza A/NWS/33(H1N1) virus was added to each test well and virus control well in 0.1 ml MEM containing 0.18% NaHC03, 20 μg/ml trypsin, 2 μg/ml EDTA and 50 μg/ml gentamycin. Cell control and toxicity control wells received 0.1 ml of this same medium without virus.

Plates were incubated at 37° C in a humidified incubator with 5% C02, 95% air atmosphere. The cells were examined by microscopic observation for evidence of virus-specific cytopathic effect (CPE) and for morphological changes due to compound effect in non-infected toxicity controls. Virus CPE was graded on a scale of 0-4, with 4 being 95-100% CPE. The effective dose, 50% endpoint (ED60) was calculated by regression analysis of the mean CPE grade at each concentration of the compound where activity was seen to bracket the CPE grade that was 50% of that seen in the virus controls. Visible changes in the morphology of cells in toxicity control wells were graded by microscopic observation, using a scale from no toxicity (0%) to complete destruction of the cells (100%) in 20% increments. The cytotoxic dose, 50% endpoint (CDεo) was calculated by regression analysis of those toxicity grades bracketing the 50% endpoint, compared to the concentrations of compound used for those toxicity grades. A therapeutic index (TI) was calculated for each compound using the formula TI = CDB0/ED60. These results are shown in Table VI, below.

TABLE VI Anti-Influenza Activity Of Modified Oligonucleotides

CMPD ED50 (μq/ml) CDM fμq/ml) TI

A Not Tested

B 34.3 147 4.3

C 55 562 10

D 61 649 11

E Not Tested

F 178 261 1.5

G 147 649 4.4

H 59 562 9.5

I 45 750 17

J 175 750 4.3

K 22 825 38

L 32 422 13

M 23.7 383 16

Control1 440 422 <1.0

1Control is oligodeoxynucleotide phosphorothioate having the sequence 5» CAGAGCAAAATCATCAGAAGA 3 ' .

These results demonstrate that all of the preferred structural features of anti-influenza modified oligonucleotides according to the invention, i.e.. chimeric, hybrid, capped and self-stabilized features, are capable of improving the efficacy of antisense oligonucleotides in inhibiting influenza virus replication or propagation. These results further suggest that combinations of such structural features within an antisense oligonucleotide should have even greater efficacy.

EXAMPLE 11 Inhibition Of Various Strains Of Influenza Virus

By Anti-influenza Modified Oligonucleotides

To test whether anti-fluenza modified oligonucleotides according to the invention can inhibit other strains of influenza virus, the experiment described in Example 10 was repeated, using compound M against various influenza strains. The influenza strains chosen for this study were the HlNl strains A/NWS/33 and A/PR/8/34, the H3N2 strains A/Washington/897/80, A/Victoria/3/75 andA/Port Chalmers/1/73, and the H2N2 strain A2/Japan/305/57. The results were calculated as described in Example 10, and are shown in Table VII below.

TABLE VII Effect Of Compound M On Various Strains of Influenza

Influenza Strain ED£ CDH , fug/ml, TI

A/NWS/33 7.6 >100 >13

A/PR/8/34 >100 >100 ?

A2/Japan/305/57 61 >100 >1.6

A/Washington/897/80 6 >100 17

A/Victoria/3/75 6.2 >100 >16

A/Port Chalmers/1/7: J >100 >100

According to these results, compound M showed great efficacy in inhibiting three of the six strains of influenza tested and had some efficacy against a fourth strain. These results demonstrate that anti-influenza modified oligonucleotides according to the invention can be effective against multiple strains of influenza virus. To maximize the breadth of cross-strain efficacy, nucleotide sequences of various genes from several different influenza viruses can be compared and the most conserved nucleotide sequences can be used to prepare inhibitory oligonucleotides.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: HYBRIDON, INC. (ii) TITLE OF INVENTION: Novel Anti-Influenza Oligonucleotides (iii) NUMBER OF SEQUENCES: 37

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: Allegretti & Witcoff, Ltd.

(B) STREET: Ten South Wacker Drive

(C) CITY: Chicago

(D) STATE: Illinois

(E) COUNTRY: U.S.A.

(F) ZIP: 60606

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: Patentln Release #1.0, Version #1.25

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER:

(B) FILING DATE:

(C) CLASSIFICATION:

(viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: Michael S. Greenfield

(B) REGISTRATION NUMBER: 37,142

(C) REFERENCE/DOCKET NUMBER: 93,161-A

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: 312/715-1000

(B) TELEFAX: 617/715-1234

(2) INFORMATION FOR SEQ ID NO:l:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 2149 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:

AGCGAAAGCA GGCAAACCAT TTGAATGGAT GTCAATCCGA CTTTACTTTT CTTAAAAGTG 60 CCAGCACAAA ATGCTATAAG CACAACTTTC CCTTATACTG GAGACCCTCC TTACAGCCAT 120 GGGACAGGAA CAGGATACAC CATGGATACT GTCAACAGGA CACATCAGTA CTCAGAAAGG 180 GGAAGATGGA CAACAAACAC CGAAACTGGA GCACCGCAAC TCAACCCGAT TGATGGGCCA 240

CTGCCAGAAG ACAATGAACC AAGTGGTTAT GCCCAAACAG ATTGTGTATT GGAAGCAATG 300

GCCTTCCTTG AGGAATCCCA TCCTGGTATC TTTGAGACCT CGTGTCTTGA AACGATGGAG 360

GTTGTTCAGC AAACACGAGT GGACAAGCTG ACACAAGGCC GACAGACCTA TGACTGGACT 420

CTAAATAGGA ACCAGCCTGC TGCAACAGCA TTGGCCAACA CAATAGAAGT GTTCAGATCA 480

AATGGCCTCA CGGCCAATGA ATCCGGAAGG CTCATAGACT TCCTTAAGGA TGTAATGGAG 540

TCAATGAACA AAGAAGAAAT GGAGATCACA ACTCATTTTC AGAGAAAGAG ACGAGTGAGA 600

GACAATATGA CTAAGAAAAT GGTGACACAG AGAACAATAG GTAAAAGGAA GCAGAGATTG 660

AACAAAAGGA GTTATCTAAT TAGGGCATTG ACCCTGAACA CAATGACCAA AGATGCTGAG 720

AGAGGGAAGC TAAAACGGAG AGCAATTGCA ACCCCAGGGA TGCAAATAAG GGGGTTTGTA 780

TACTTTGTTG AGACACTAGC AAGGAGTATA TGTGAGAAAC TTGAACAATC AGGATTGCCA 840

GTTGGAGGCA ATGAGAAGAA AGCAAAGTTG GCAAATGTTG TAAGGAAGAT GATGACCAAT 900

TCTCAGGACA CTGAAATTTC TTTCACATCA CTGGAGATAA CACCAAATGG AACGAAAATC 960

AGAACCCTCG GATGTTTTTG GCCATGATCA CATATATAAC CAGAAATCAG CCCGAATGGT 1020

TCAGAAATGT TCTAAGTATT GCTCCAATAA TGTTCTCAAA CAAAATGGCG AGACTGGGAA 1080

AGGGGTACAT GTTTGAGAGC AAGAGTATTA AAATTAGAAC TCAAATACCT GCAGAAATGC 1140

TAGCAAGCAT CGATTTGAAA TACTTCAATG ATTCAACTAG AAAGAAGATT GAAAAAATCC 1200

GGCCGCTCTT AATAGATGGG ACTGCATCAT TGAGCCCTGG AATGATGATG GGCATGTTCA 1260

ATATGTTAAG TACTGTATTA GGCGTCTCCA TCCTGAATCT TGGACAAAAG AGACACACCA 1320

AGACTACTTA CTGGTGGGAT GGTCTTCAAT CTTCTGATGA TTTTGCTCTG ATTGTCAATG 1380

CACCCAATCA TGAAGGGATT CAAGCCGGAG TCAACAGGTT TTATCGAACC TGTAAGCTAC 1440

TTGGAATTAA TATGAGCAAG AAAAAGTCTT ACATAAACAG AACAGGTACA TTTGAATTCA 1500

CAAGTTTTTT CTATCGTTAT GGGTTTGTTG CCAATTTCAG CATGGAGCTT CCCAGCTTTG 1560

GGGTGTCTGG GATCAACGAG TCTGCGGACA TGAGTATTGG AGTTACTGTC ATCAAAAACA 1620

ATATGATAAA CAATGATCTT GGTCCAGCAA CCGCTCAAAT GGCCCTTCAG CTGTTCATCA 1680

AAGATTACAG GTACACGTAC CGCTGCCATA GAGGTGACAC ACAAATACAA ACCCGAAGAT 1740

CATTTGAAAT AAAGAAACTG TGGGAGCAAA CCCATTCCAA AGCTGGACTG CTGGTCTCCG 1800

ACGGAGGCCC AAATTTATAC AACATTAGAA ATCTCCACAT TCCTGAAGTC TGCTTGAAAT 1860

GGGAATTAAT GGATGAGGAT TACCAGGGGC GTTTATGCAA CCCACTGAAC CCATTTGTCA 1920

ACCATAAAGA CATTGAATCA GTGAACAATG CAGTGATAAT GCCAGCACAT GGTCCAGCCA 1980

AAAACATGGA GTATGATGCT GTTGCAACAA CACACTCCTG GATCCCCAAA AGAAATCGAT 2040

CCATCTTGAA TACAAGCCAA AGAGGAATAC TTGAAGATGA ACAAATGTAC CAAAAGTGCT 2100 GCAACTTATT TGAAAAATTC TTCCCCAGCA GTTCATACAG AAGACCAGT 2149

(2) INFORMATION FOR SEQ ID NO:2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

CAGAGCAAAA TCATCAGAAG A 21

(2) INFORMATION FOR SEQ ID NO:3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: YES

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:

CAGAGCAAAA TCATCAGAAG A 21

(2) INFORMATION FOR SEQ ID NO:4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:

CAGAGCAAAA TCATCAGAAG A 21 (2) INFORMATION FOR SEQ ID NO:3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:

CAGAGCAAAA TCATCAGAAG A 21

(2) INFORMATION FOR SEQ ID NO:4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:

CAGAGCAAAA TCATCAGAAG A 21

(2) INFORMATION FOR SEQ ID NO:5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:

CAGAGCAAAA TCATCAGAAG A 21

(2) INFORMATION FOR SEQ ID NO:6:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:

CAGAGCAAAA TCATCAGAAG A 21

(2) INFORMATION FOR SEQ ID NO:7:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:

CAGAGCAAAA TCATCAGAAG A 21 (2) INFORMATION FOR SEQ ID NO:8:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:

CAGAGCAAAA TCATCAGAAG A 21

(2) INFORMATION FOR SEQ ID NO:9:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:

CAGAGCAAAA TCATCAGAAG A 21

(2) INFORMATION FOR SEQ ID NO:10:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:

CAGAGCAAAA TCATCAGAAG A 21

(2) INFORMATION FOR SEQ ID NO:11:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 19 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:

AGAGCAAAAT CATCAGAAG 19

(2) INFORMATION FOR SEQ ID NO:12:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 19 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:

AGAGCAAAAT CATCAGAAG 19 (2) INFORMATION FOR SEQ ID NO:13:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 17 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:

GAGCAAAATC ATCAGAA 17

(2) INFORMATION FOR SEQ ID NO:14:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 17 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:

GAGCAAAATC ATCAGAA 17

(2) INFORMATION FOR SEQ ID NO:15:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:

CAGAGCAAAA TCATCAGAAG A 21

(2) INFORMATION FOR SEQ ID NO:16:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 30 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES ( i) SEQUENCE DESCRIPTION: SEQ ID NO:16:

CAGAGCAAAA TCATCAGAAG ATTCTGATGA 30

(2) INFORMATION FOR SEQ ID NO:17:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:

CTTTCCATAT TGAATATAAT 20 (2) INFORMATION FOR SEQ ID NO:18:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES ( i) SEQUENCE DESCRIPTION: SEQ ID NO:18:

ACATCCATTC AAATGGTTTG 20

(2) INFORMATION FOR SEQ ID NO:19:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:

TCTTCCATTT TGGATCAGTA 20

(2) INFORMATION FOR SEQ ID NO:20:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: YES (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:

GCCTTCATTT TGGTTGTTTT 20

(2) INFORMATION FOR SEQ ID NO:21:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:

GACGCCATGA TTTTGATGTC 20

(2) INFORMATION FOR SEQ ID NO:22:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:

GGATTCATTT TAAACCCCTG 20 (2) INFORMATION FOR SEQ ID NO:23:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:

AGACTCATCT TTCAATATCT 20

(2) INFORMATION FOR SEQ ID NO:24:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:

GATAGAGAGA ACGTACGTTT 20

(2) INFORMATION FOR SEQ ID NO:25:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:

TCTGATAGGC CTGCAAATTT 20

(2) INFORMATION FOR SEQ ID NO:26:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:

GGATCCATTA TGTCTTTGTC 20

(2) INFORMATION FOR SEQ ID NO:27:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:

CATGTCGGTT AGGTAACGCG 20 (2) INFORMATION FOR SEQ ID NO:28:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES ( i) SEQUENCE DESCRIPTION: SEQ ID NO:28:

GCAATCTACC TGAAAGCTTG 20

(2) INFORMATION FOR SEQ ID NO:29:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:

AGCAGTATGT CCTGGAAGAG 20

(2) INFORMATION FOR SEQ ID NO:30:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES ( i) SEQUENCE DESCRIPTION: SEQ ID NO:30:

AAAACGACCT TGTTTCTACT 20

(2) INFORMATION FOR SEQ ID NO:31:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:

AAAAATGCCT TGTTCCTACT 20

(2) INFORMATION FOR SEQ ID NO:32:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:

AAAAGTACCT TGTTTCTACT 20 (2) INFORMATION FOR SEQ ID NO:33:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:

AAAACACCCT TGTTTCTACT 20

(2) INFORMATION FOR SEQ ID NO:34:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:

AAAATACCCT TGTTTCTACT 20

(2) INFORMATION FOR SEQ ID NO:35:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:35:

AAAAACTCCT TGTTTCTACT 20

(2) INFORMATION FOR SEQ ID NO:36:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:

AAAACTACCT TGTTTCTACT 20

(2) INFORMATION FOR SEQ ID NO:37:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:

AAAACACCCT TGTTTCTACT 20

Claims

We claim:
1. An anti-influenza modified oligonucleotide comprising a nucleotide sequence that is complementary to an essential nucleic acid sequence of influenza virus, wherein the oligonucleotide iε a mixed backbone chimeric oligonucleotide comprising a phosphorothioate or phosphorodithioate region and an alkylphosphonate region.
2. The oligonucleotide according to claim 1, wherein an alkylphosphonate region is at or near the 5' or 3' end of the oligonucleotide.
3. The oligonucleotide according to claim 1, wherein an alkylphosphonate region comprises from about 2 to about 10 contiguous nucleotides connected by alkylphosphonate linkages.
4. The oligonucleotide according to claim 2 , wherein an alkylphosphonate region comprises from about 2 to about 10 contiguous nucleotides connected by alkylphosphonate linkages.
5. The oligonucleotide according to claim 1, wherein a phosphorothioate or phosphorodithioate region comprises from about 3 to about 100 contiguous nucleotides connected by phosphorothioate or phosphorodithioate linkages.
6. The oligonucleotide according to claim 2, wherein a phosphorothioate or phosphorodithioate region comprises from about 3 to about 100 contiguous nucleotides connected by phosphorothioate or phosphorodithioate linkages.
7. The oligonucleotide according to claim 3, wherein a phosphorothioate or phosphorodithioate region comprises from about 3 to about 100 contiguous nucleotides connected by phosphorothioate or phosphorodithioate linkages.
8. The oligonucleotide according to claim 4, wherein a phosphorothioate or phosphorodithioate region comprises from about 3 to about 100 contiguous nucleotides connected by phosphorothioate or phosphorodithioate linkages.
9. An anti-influenza modified oligonucleotide comprising a nucleotide sequence that is complementary to an essential nucleic acid sequence of influenza virus, wherein the oligonucleotide iε a mixed backbone chimeric oligonucleotide comprising a phosphorothioate or phosphorodithioate region and an alkylphosphonothioate region.
10. The oligonucleotide according to claim 10, wherein an alkylphosphonothioate region is at or near the 5' or 3' end of the oligonucleotide.
11. The oligonucleotide according to claim 9, wherein an alkylphosphonothioate region comprises from about 2 to about 10 contiguous nucleotides connected by alkylphosphonothioate linkages.
12. The oligonucleotide according to claim 10, wherein an alkylphosphonothioate region comprises from about 2 to about 10 contiguous nucleotides connected by alkylphosphonothioate linkages.
13. The oligonucleotide according to claim 9, wherein a phosphorothioate or phosphorodithioate region comprises from about 3 to about 100 contiguous nucleotides connected by phosphorothioate or phosphorodithioate linkages.
14. The oligonucleotide according to claim 10, wherein a phosphorothioate or phosphorodithioate region comprises from about 3 to about 100 contiguous nucleotides connected by phosphorothioate or phosphorodithioate linkages.
15. The oligonucleotide according to claim 11, wherein a phosphorothioate or phosphorodithioate region comprises from about 3 to about 100 contiguous nucleotides connected by phosphorothioate or phosphorodithioate linkages.
16. The oligonucleotide according to claim 12, wherein a phosphorothioate or phosphorodithioate region comprises from about 3 to about 100 contiguous nucleotides connected by phosphorothioate or phosphorodithioate linkages.
17. An anti-influenza modified oligonucleotide comprising a nucleotide sequence that is complementary to an essential nucleic acid sequence of influenza virus, wherein the oligonucleotide is a hybrid oligonucleotide comprising a deoxyribonucleotide region and a ribonucleotide region.
18. The oligonucleotide according to claim 17, further comprising from about 1 to about all phosphorothioate or phosphorodithioate internucleotide linkages.
19. The oligonucleotide according to claim 17, wherein a ribonucleotide region is at or near the 5' or 3' end of the oligonucleotide.
20. The oligonucleotide according to claim 17, wherein a ribonucleotide region comprises from about 2 to about 100 contiguous ribonucleotides.
21. The oligonucleotide according to claim 18, wherein a ribonucleotide region comprises from about 2 to about 100 contiguous ribonucleotideε.
22. The oligonucleotide according to claim 19, wherein a ribonucleotide region comprises from about 2 to about 100 contiguous ribonucleotides.
23. The oligonucleotide according to claim 17, wherein a deoxyribonucleotide region compriseε from about 0 to about 100 deoxyribonucleotides.
24. The oligonucleotide according to claim 18, wherein a deoxyribonucleotide region compriseε from about 0 to about 100 deoxyribonucleotides.
25. The oligonucleotide according to claim 19, wherein a deoxyribonucleotide region compriεeε from about 0 to about 100 deoxyribonucleotide .
26. The oligonucleotide according to claim 20, wherein a deoxyribonucleotide region compriεes from about 0 to about 100 deoxyribonucleotides.
27. The oligonucleotide according to claim 21, wherein a deoxyribonucleotide region comprises from about 0 to about 100 deoxyribonucleotides.
28. The oligonucleotide according to claim 22, wherein a deoxyribonucleotide region compriseε from about 0 to about 100 deoxyribonucleotides.
29. An anti-influenza modified oligonucleotide comprising a nucleotide sequence that is complementary to an esεential nucleic acid εequence of influenza viruε, wherein the oligonucleotide has at its 5• and/or 3' end a nuclease resiεtance conferring cap structure selected from the group consisting of the cap structureε εhown in Figure 4 and lower alkyl (C1-C12) or alcohol groupε, and wherein the oligonucleotide haε from 1 to about all modified internucleotide linkageε εelected from the group consiεting of phosphotrieεter, phoεphoramidate, εiloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate, bridged phosphorothioate, sulfone, phosphorothioate and phosphorodithioate linkages.
30. An anti-influenza modified oligonucleotide comprising an anti-influenza hybridizing region and a self- complementary region.
31. The oligonucleotide according to claim 30, wherein the influenza hybridizing region compriseε from about 6 to about 100 nucleotides that are complementary to an esεential nucleic acid εequence of influenza viruε.
32. The oligonucleotide according to claim 30, wherein the εelf-complementary region compriεeε from about 4 to about 50 nucleotideε that form intramolecular base pairs.
33. The oligonucleotide according to claim 30, wherein a self-complementary region is at or near the 5' or 3' end of the oligonucleotide.
34. The oligonucleotide according to claim 31, wherein a self-complementary region is at or near the 5' or 3' end of the oligonucleotide.
35. The oligonucleotide according to claim 32, wherein a self-complementary region is at or near the 51 or 3' end of the oligonucleotide.
36. The oligonucleotide according to claim 30, wherein from about 2 to about all nucleotideε are coupled by phoεphorothioate and/or phosphorodithioate internucleotide linkages.
37. The oligonucleotide according to claim 31, wherein from about 2 to about all nucleotides are coupled by phosphorothioate and/or phosphorodithioate internucleotide linkageε.
38. The oligonucleotide according to claim 32, wherein from about 2 to about all nucleotideε are coupled by phosphorothioate and/or phosphorodithioate internucleotide linkages.
39. The oligonucleotide according to claim 33, wherein from about 2 to about all nucleotides are coupled by phosphorothioate and/or phosphorodithioate internucleotide linkageε.
40. The oligonucleotide according to claim 34, wherein from about 2 to about all nucleotideε are coupled by phoεphorothioate and/or phosphorodithioate internucleotide linkages.
41. The oligonucleotide according to claim 35, wherein from about 2 to about all nucleotideε are coupled by phoεphorothioate and/or phoεphorodithioate internucleotide linkageε.
42. The oligonucleotide according to claim 1, wherein the eεsential nucleic acid sequence is selected from the group consiεting of influenza polymerase 3 gene, influenza polymerase 1 gene, influenza polymerase 2 gene, influenza hemaglutin gene, influenza nucleoprotein gene, influenza neuraminidase gene, influenza matrix protein gene, influenza left or right splice junctions of εegmentε 7 or 8, influenza splice branch of segment 8 and influenza packaging sequences of segment 1, 2, 3, 4, 5, 6, 7 or 8.
43. The oligonucleotide according to claim 9, wherein the eεεential nucleic acid εequence iε εelected from the group conεiεting of influenza polymeraεe 3 gene, influenza polymeraεe 1 gene, influenza polymeraεe 2 gene, influenza hemaglutin gene, influenza nucleoprotein gene, influenza neuraminidaεe gene, influenza matrix protein gene, influenza left or right εplice junctions of segmentε 7 or 8, influenza splice branch of segment 8 and influenza packaging εequences e»# mwm rt- : ** if 9 , 4« n« •< ▼ m* ■,
44. The oligonucleotide according to claim 17, wherein the eεεential nucleic acid εequence iε selected from the group consiεting of influenza polymerase 3 gene, influenza polymerase 1 gene, influenza polymerase 2 gene, influenza hemaglutin gene, influenza nucleoprotein gene, influenza neuraminidaεe gene, influenza matrix protein gene, influenza left or right εplice junctionε of εegmentε 7 or 8, influenza εplice branch of εegment 8 and influenza packaging εequences of segment 1, 2, 3, 4, 5, 6, 7 or 8.
45. The oligonucleotide according to claim 29, wherein the esεential nucleic acid εequence iε selected from the group consiεting of influenza polymeraεe 3 gene, influenza polymeraεe 1 gene, influenza polymeraεe 2 gene, influenza hemaglutin gene, influenza nucleoprotein gene, influenza neuraminidaεe gene, influenza matrix protein gene, influenza left or right εplice junctions of segments 7 or 8, influenza splice branch of segment 8 and influenza packaging sequences of segment 1, 2, 3, 4, 5, 6, 7 or 8.
46. The oligonucleotide according to claim 31, wherein the essential nucleic acid sequence is selected from the group consisting of influenza polymerase 3 gene, influenza polymerase 1 gene, influenza polymerase 2 gene, influenza hemaglutin gene, influenza nucleoprotein gene, influenza neuraminidase gene, influenza matrix protein gene, influenza left or right splice junctions of segments 7 or 8, influenza splice branch of segment 8 and influenza packaging sequences of segment 1, 2, 3, 4, 5, 6, 7 or 8.
PCT/US1994/003454 1993-03-31 1994-03-30 Modified oligonucleotides having improved anti-influenza activity WO1994023028A2 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US4075293A true 1993-03-31 1993-03-31
US08/040,752 1993-03-31

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
EP19940912901 EP0693123A1 (en) 1993-03-31 1994-03-30 Modified oligonucleotides having improved anti-influenza activity
JP52231794A JPH08510900A (en) 1993-03-31 1994-03-30 Modified oligonucleotides having improved anti-influenza activity
AU65270/94A AU6527094A (en) 1993-03-31 1994-03-30 Modified oligonucleotides having improved anti-influenza activity

Publications (2)

Publication Number Publication Date
WO1994023028A2 true WO1994023028A2 (en) 1994-10-13
WO1994023028A3 WO1994023028A3 (en) 1995-02-16

Family

ID=21912738

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1994/003454 WO1994023028A2 (en) 1993-03-31 1994-03-30 Modified oligonucleotides having improved anti-influenza activity

Country Status (7)

Country Link
EP (1) EP0693123A1 (en)
JP (1) JPH08510900A (en)
CN (1) CN1124980A (en)
AU (1) AU6527094A (en)
CA (1) CA2159350A1 (en)
NZ (1) NZ263985A (en)
WO (1) WO1994023028A2 (en)

Cited By (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996031600A1 (en) * 1995-04-03 1996-10-10 Hybridon, Inc. Method of modulating gene expression without depleting complement
US5565350A (en) * 1993-12-09 1996-10-15 Thomas Jefferson University Compounds and methods for site directed mutations in eukaryotic cells
WO1996032474A1 (en) * 1995-04-12 1996-10-17 Hybridon, Inc. Cooperative oligonucleotides
WO1996041812A1 (en) * 1995-06-09 1996-12-27 Isis Innovation Limited Oligonucleotide phosphorylation method and products
WO1997006662A2 (en) * 1995-08-17 1997-02-27 Hybridon, Inc. Inverted chimeric and hybrid oligonucleotides
WO1997011171A1 (en) * 1995-09-22 1997-03-27 Hybridon, Inc. Modified protein kinase a-specific oligonucleotides and methods of their use
WO1997038097A1 (en) * 1995-04-12 1997-10-16 Hybridon, Inc. Cooperative oligonucleotides
WO1998040479A1 (en) * 1997-03-12 1998-09-17 Hybridon, Inc. Modified protein kinase a-specific oligonucleotides and methods of their use
WO1998053073A1 (en) * 1997-05-16 1998-11-26 Plant Bioscience Limited A plant disease resistance signalling gene, materials and methods relating thereto
US5886165A (en) * 1996-09-24 1999-03-23 Hybridon, Inc. Mixed backbone antisense oligonucleotides containing 2'-5'-ribonucleotide- and 3'-5'-deoxyribonucleotides segments
WO2002008420A2 (en) * 2000-06-06 2002-01-31 Hybridon, Inc. A method of down-regulating gene expression
US6624293B1 (en) 1995-08-17 2003-09-23 Hybridon, Inc. Modified protein kinase A-specific oligonucleotides and methods of their use
US6645943B1 (en) 1994-10-25 2003-11-11 Hybridon, Inc. Method of down-regulating gene expression
US7074768B2 (en) 1995-08-17 2006-07-11 Idera Pharmaceuticals, Inc. Modified protein kinase A-specific oligonucleotides and methods of their use
WO2007053696A3 (en) * 2005-11-01 2008-01-17 Alnylam Pharmaceuticals Inc Rnai inhibition of influenza virus replication
EP2128248A1 (en) 2002-02-01 2009-12-02 Life Technologies Corporation Oligonucleotide compositions with enhanced efficiency
US7691996B2 (en) 1996-09-26 2010-04-06 Lakewood-Amedex Three component chimeric antisense oligonucleotides
WO2010090762A1 (en) 2009-02-04 2010-08-12 Rxi Pharmaceuticals Corporation Rna duplexes with single stranded phosphorothioate nucleotide regions for additional functionality
WO2011119887A1 (en) 2010-03-24 2011-09-29 Rxi Pharmaceuticals Corporation Rna interference in dermal and fibrotic indications
US8664189B2 (en) 2008-09-22 2014-03-04 Rxi Pharmaceuticals Corporation RNA interference in skin indications
US9074211B2 (en) 2008-11-19 2015-07-07 Rxi Pharmaceuticals Corporation Inhibition of MAP4K4 through RNAI
US9080171B2 (en) 2010-03-24 2015-07-14 RXi Parmaceuticals Corporation Reduced size self-delivering RNAi compounds
US9493774B2 (en) 2009-01-05 2016-11-15 Rxi Pharmaceuticals Corporation Inhibition of PCSK9 through RNAi
US10106793B2 (en) 2002-02-01 2018-10-23 Life Technologies Corporation Double-stranded oligonucleotides
US10131904B2 (en) 2008-02-11 2018-11-20 Rxi Pharmaceuticals Corporation Modified RNAi polynucleotides and uses thereof
US10184124B2 (en) 2010-03-24 2019-01-22 Phio Pharmaceuticals Corp. RNA interference in ocular indications

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0386563A1 (en) * 1989-03-09 1990-09-12 Bayer Ag Antisense-oligonucleotides for inhibiting the transactivator target sequence (TAR) and the synthesis of the transactivator protein (Tat) of HIV-I, and their use
WO1991012323A1 (en) * 1990-02-15 1991-08-22 Worcester Foundation For Experimental Biology Method of site-specific alteration of rna and production of encoded polypeptides
WO1991016902A1 (en) * 1990-04-30 1991-11-14 Hybridon, Inc. Inhibition of influenza virus replication by oligonucleotides
WO1992003454A1 (en) * 1990-08-14 1992-03-05 Isis Pharmaceuticals, Inc. Inhibition of influenza virus type a, ann arbor strain h2n2 by antisense oligonucleotides

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0386563A1 (en) * 1989-03-09 1990-09-12 Bayer Ag Antisense-oligonucleotides for inhibiting the transactivator target sequence (TAR) and the synthesis of the transactivator protein (Tat) of HIV-I, and their use
WO1991012323A1 (en) * 1990-02-15 1991-08-22 Worcester Foundation For Experimental Biology Method of site-specific alteration of rna and production of encoded polypeptides
WO1991016902A1 (en) * 1990-04-30 1991-11-14 Hybridon, Inc. Inhibition of influenza virus replication by oligonucleotides
WO1992003454A1 (en) * 1990-08-14 1992-03-05 Isis Pharmaceuticals, Inc. Inhibition of influenza virus type a, ann arbor strain h2n2 by antisense oligonucleotides

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
FEBS LETTERS, vol.232, no.1, May 1988, AMSTERDAM NL pages 96 - 98 ATABEKOV, K. ET AL. 'Site-specific enzymatic cleavage of TMV RNA directed by deoxyribo- and chimeric (deoxyribo-ribo)oligonucleotides' *
NUCLEIC ACIDS RESEARCH, vol.22, no.3, 11 February 1994, ARLINGTON, VIRGINIA US pages 453 - 456 ZHOU, L. ET AL. 'Synthesis of phosphorothioate-methylphosphonate oligonucleotide co-polymers' *

Cited By (59)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5871984A (en) * 1993-12-09 1999-02-16 Thomas Jefferson University Compounds and methods for site directed mutations in eukaryotic cells
US5565350A (en) * 1993-12-09 1996-10-15 Thomas Jefferson University Compounds and methods for site directed mutations in eukaryotic cells
US5756325A (en) * 1993-12-09 1998-05-26 Thomas Jefferson University Compounds and methods for site directed mutations in eukaryotic cells
US6936593B1 (en) 1994-10-25 2005-08-30 Hybridon, Inc. Method of down-regulating gene expression
US6645943B1 (en) 1994-10-25 2003-11-11 Hybridon, Inc. Method of down-regulating gene expression
US6608035B1 (en) 1994-10-25 2003-08-19 Hybridon, Inc. Method of down-regulating gene expression
WO1996031600A1 (en) * 1995-04-03 1996-10-10 Hybridon, Inc. Method of modulating gene expression without depleting complement
US6372427B1 (en) 1995-04-12 2002-04-16 Hybridon, Inc. Cooperative oligonucleotides
WO1996032474A1 (en) * 1995-04-12 1996-10-17 Hybridon, Inc. Cooperative oligonucleotides
WO1997038097A1 (en) * 1995-04-12 1997-10-16 Hybridon, Inc. Cooperative oligonucleotides
WO1996041812A1 (en) * 1995-06-09 1996-12-27 Isis Innovation Limited Oligonucleotide phosphorylation method and products
US6624293B1 (en) 1995-08-17 2003-09-23 Hybridon, Inc. Modified protein kinase A-specific oligonucleotides and methods of their use
EP1340765A3 (en) * 1995-08-17 2006-06-21 Idera Pharmaceuticals, Inc. Inverted chimeric and hybrid oligonucleotides
US7074768B2 (en) 1995-08-17 2006-07-11 Idera Pharmaceuticals, Inc. Modified protein kinase A-specific oligonucleotides and methods of their use
WO1997006662A3 (en) * 1995-08-17 1997-06-19 Hybridon Inc Inverted chimeric and hybrid oligonucleotides
WO1997006662A2 (en) * 1995-08-17 1997-02-27 Hybridon, Inc. Inverted chimeric and hybrid oligonucleotides
EP1340765A2 (en) * 1995-08-17 2003-09-03 Hybridon, Inc. Inverted chimeric and hybrid oligonucleotides
WO1997011171A1 (en) * 1995-09-22 1997-03-27 Hybridon, Inc. Modified protein kinase a-specific oligonucleotides and methods of their use
US5886165A (en) * 1996-09-24 1999-03-23 Hybridon, Inc. Mixed backbone antisense oligonucleotides containing 2'-5'-ribonucleotide- and 3'-5'-deoxyribonucleotides segments
US7691996B2 (en) 1996-09-26 2010-04-06 Lakewood-Amedex Three component chimeric antisense oligonucleotides
WO1998040479A1 (en) * 1997-03-12 1998-09-17 Hybridon, Inc. Modified protein kinase a-specific oligonucleotides and methods of their use
WO1998053073A1 (en) * 1997-05-16 1998-11-26 Plant Bioscience Limited A plant disease resistance signalling gene, materials and methods relating thereto
WO2002008420A3 (en) * 2000-06-06 2002-10-17 Hybridon Inc A method of down-regulating gene expression
WO2002008420A2 (en) * 2000-06-06 2002-01-31 Hybridon, Inc. A method of down-regulating gene expression
EP2924116A1 (en) 2002-02-01 2015-09-30 Life Technologies Corporation Double-stranded oligonucleotides
US9777275B2 (en) 2002-02-01 2017-10-03 Life Technologies Corporation Oligonucleotide compositions with enhanced efficiency
US10036025B2 (en) 2002-02-01 2018-07-31 Life Technologies Corporation Oligonucleotide compositions with enhanced efficiency
EP2213292A1 (en) 2002-02-01 2010-08-04 Life Technologies Corporation Double-stranded oligonucleotides
EP2213737A1 (en) 2002-02-01 2010-08-04 Life Technologies Corporation Double-stranded oligonucleotides
US9796978B1 (en) 2002-02-01 2017-10-24 Life Technologies Corporation Oligonucleotide compositions with enhanced efficiency
EP2351836A1 (en) 2002-02-01 2011-08-03 Life Technologies Corporation Double-stranded oligonucleotides
EP3415625A1 (en) 2002-02-01 2018-12-19 Life Technologies Corporation Double-stranded oligonucleotides
EP2455467A1 (en) 2002-02-01 2012-05-23 Life Technologies Corporation Double-stranded oligonucleotides
US10106793B2 (en) 2002-02-01 2018-10-23 Life Technologies Corporation Double-stranded oligonucleotides
EP2128248A1 (en) 2002-02-01 2009-12-02 Life Technologies Corporation Oligonucleotide compositions with enhanced efficiency
US8227188B2 (en) 2005-11-01 2012-07-24 Alnylam Pharmaceuticals, Inc. Enhancement of influenza gene expression
WO2007053696A3 (en) * 2005-11-01 2008-01-17 Alnylam Pharmaceuticals Inc Rnai inhibition of influenza virus replication
EP2202239A1 (en) * 2005-11-01 2010-06-30 Alnylam Pharmaceuticals Inc. RNAI inhibition of influenza virus replication
US10131904B2 (en) 2008-02-11 2018-11-20 Rxi Pharmaceuticals Corporation Modified RNAi polynucleotides and uses thereof
US8796443B2 (en) 2008-09-22 2014-08-05 Rxi Pharmaceuticals Corporation Reduced size self-delivering RNAi compounds
EP2949752A2 (en) 2008-09-22 2015-12-02 RXi Pharmaceuticals Corporation Reduced size self-delivering rnai compounds
US9303259B2 (en) 2008-09-22 2016-04-05 Rxi Pharmaceuticals Corporation RNA interference in skin indications
US9175289B2 (en) 2008-09-22 2015-11-03 Rxi Pharmaceuticals Corporation Reduced size self-delivering RNAi compounds
US10041073B2 (en) 2008-09-22 2018-08-07 Rxi Pharmaceuticals Corporation Reduced size self-delivering RNAi compounds
US8664189B2 (en) 2008-09-22 2014-03-04 Rxi Pharmaceuticals Corporation RNA interference in skin indications
US10138485B2 (en) 2008-09-22 2018-11-27 Rxi Pharmaceuticals Corporation Neutral nanotransporters
EP3336188A1 (en) 2008-09-22 2018-06-20 RXi Pharmaceuticals Corporation Reduced size self-delivering rnai compounds
US9938530B2 (en) 2008-09-22 2018-04-10 Rxi Pharmaceuticals Corporation RNA interference in skin indications
US9074211B2 (en) 2008-11-19 2015-07-07 Rxi Pharmaceuticals Corporation Inhibition of MAP4K4 through RNAI
US10167471B2 (en) 2009-01-05 2019-01-01 Rxi Pharmaceuticals Corporation Inhibition of PCSK9 through RNAI
US9493774B2 (en) 2009-01-05 2016-11-15 Rxi Pharmaceuticals Corporation Inhibition of PCSK9 through RNAi
US9745574B2 (en) 2009-02-04 2017-08-29 Rxi Pharmaceuticals Corporation RNA duplexes with single stranded phosphorothioate nucleotide regions for additional functionality
WO2010090762A1 (en) 2009-02-04 2010-08-12 Rxi Pharmaceuticals Corporation Rna duplexes with single stranded phosphorothioate nucleotide regions for additional functionality
US9963702B2 (en) 2010-03-24 2018-05-08 Rxi Pharmaceuticals Corporation RNA interference in dermal and fibrotic indications
US9080171B2 (en) 2010-03-24 2015-07-14 RXi Parmaceuticals Corporation Reduced size self-delivering RNAi compounds
WO2011119887A1 (en) 2010-03-24 2011-09-29 Rxi Pharmaceuticals Corporation Rna interference in dermal and fibrotic indications
US10240149B2 (en) 2010-03-24 2019-03-26 Phio Pharmaceuticals Corp. Reduced size self-delivering RNAi compounds
US10184124B2 (en) 2010-03-24 2019-01-22 Phio Pharmaceuticals Corp. RNA interference in ocular indications
US9340786B2 (en) 2010-03-24 2016-05-17 Rxi Pharmaceuticals Corporation RNA interference in dermal and fibrotic indications

Also Published As

Publication number Publication date
AU6527094A (en) 1994-10-24
EP0693123A1 (en) 1996-01-24
NZ263985A (en) 1997-07-27
CA2159350A1 (en) 1994-10-13
JPH08510900A (en) 1996-11-19
CN1124980A (en) 1996-06-19
WO1994023028A3 (en) 1995-02-16

Similar Documents

Publication Publication Date Title
EP2356129B1 (en) Substituted alpha-l-bicyclic nucleosides
US5837835A (en) Oligonucleotide N3&#39;-P5&#39; phosphoramidates: hybridization and nuclease resistance properties
CA2168409C (en) G cap-stabilized oligonucleotides
KR970005274B1 (en) Inhibition of influenza virus type a, ann arbor strain h2n2 by antisense oligonucleotides
US5635488A (en) Compounds having phosphorodithioate linkages of high chiral purity
EP0625192B1 (en) Nucleozymes
US5623065A (en) Gapped 2&#39; modified oligonucleotides
US5596091A (en) Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides
EP2285819B1 (en) Oligomeric compounds comprising neutrally linked terminal bicyclic nucleosides
US5276019A (en) Inhibitors for replication of retroviruses and for the expression of oncogene products
Griffey et al. 2 ‘-O-Aminopropyl ribonucleotides: a zwitterionic modification that enhances the exonuclease resistance and biological activity of antisense oligonucleotides
JP4267233B2 (en) Oligonucleotide n3 &#39;→ p5&#39; thiophosphoramidate: their synthesis and use
US5264423A (en) Inhibitors for replication of retroviruses and for the expression of oncogene products
CA2071446C (en) Synthetic catalytic oligonucleotide structures
US6369208B1 (en) Capped synthetic RNA, analogs, and aptamers
US6043352A (en) 2&#39;-O-Dimethylaminoethyloxyethyl-modified oligonucleotides
US5965720A (en) Oligonucleotide N3&#39;→P5&#39; phosphoramidates
US4958013A (en) Cholesteryl modified oligonucleotides
USRE38169E1 (en) Hyperstabilizing antisense nucleic acid binding agents
US5726297A (en) Oligodeoxyribonucleotide N3&#39; P5&#39; phosphoramidates
JP3558230B2 (en) Stabilized oligonucleotides and their use
US6028188A (en) Synthetic oligomers having chirally pure phosphonate internucleosidyl linkages mixed with non-phosphonate internucleosidyl linkages
US6958239B2 (en) Three component chimeric antisense oligonucleotides
EP0515511B1 (en) Method of site-specific alteration of rna and production of encoded polypeptides
US5681702A (en) Reduction of nonspecific hybridization by using novel base-pairing schemes

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 94192300.2

Country of ref document: CN

AK Designated states

Kind code of ref document: A2

Designated state(s): AT AU BB BG BR BY CA CH CN CZ DE DK ES FI GB GE HU JP KP KR KZ LK LU LV MG MN MW NL NO NZ PL PT RO RU SD SE SI SK TT UA US UZ VN

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2159350

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 263985

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 1994912901

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1994912901

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWW Wipo information: withdrawn in national office

Ref document number: 1994912901

Country of ref document: EP