CA2159350A1 - Modified oligonucleotides having improved anti-influenza activity - Google Patents

Modified oligonucleotides having improved anti-influenza activity

Info

Publication number
CA2159350A1
CA2159350A1 CA 2159350 CA2159350A CA2159350A1 CA 2159350 A1 CA2159350 A1 CA 2159350A1 CA 2159350 CA2159350 CA 2159350 CA 2159350 A CA2159350 A CA 2159350A CA 2159350 A1 CA2159350 A1 CA 2159350A1
Authority
CA
Canada
Prior art keywords
influenza
oligonucleotide
gene
phosphorothioate
oligonucleotide according
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
CA 2159350
Other languages
French (fr)
Inventor
Sudhir Agrawal
Jin-Yan Tang
Abeysinghe Padmapriya
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Idera Pharmaceuticals Inc
Original Assignee
Sudhir Agrawal
Jin-Yan Tang
Abeysinghe Padmapriya
Hybridon, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US4075293A priority Critical
Priority to US08/040,752 priority
Application filed by Sudhir Agrawal, Jin-Yan Tang, Abeysinghe Padmapriya, Hybridon, Inc. filed Critical Sudhir Agrawal
Publication of CA2159350A1 publication Critical patent/CA2159350A1/en
Application status is Abandoned legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids

Abstract

The invention provides anti-influenza modified oligonucleotides that have greater efficacy in inhibiting influenza replication or propagation than previously described oligonucleotides. The greater efficacy arises from structural features such as chimeric or hybrid backbones, nuclease resistance-conferring terminal capping structures and/or self-complementary regions.

Description

WOg4/~028 21S9 35 0 PCT~S94/03454 MODIFIED OLIGONUCL~ v~ HAVING IMPROVED
ANTI-INF~UENZA A~llvl~lY

This is a continuation-in-part of Ser. No. 07/909,069, filed July 2, 1992. This is also a continuation-in-part of Ser. No. 07/918,239, filed July 23, 1992. This is also a continuation-in-part of Ser. No. 07/698,568, filed May 10, 1991 .

R~R~-ROUND OF THE lN V~N'l'lON
Field Of The Invention The invention relates to anti-sense oligonucleotides.
More particularly, the invention relates to modified oligonucleotides that are capable of inhibiting replication or propagation of influenza virus.

summarY Of The Related Art Influenza A virus i8 a membrane-enclosed virus whose genome is a segmented minus strand of RNA. The ten influenza virus genes are present on eight segments of the single-stranded RNA of strains A and B, and on seven segments of ~o strain C. The segments are of varying sizes (ranging from 890 to 2341 nucleotides in length) and each i8 a template for synthesis for a different mRNA. The influenza virus virion contains virus-specific RNA polymerases necessary for mRNA
synthesis from these templates and, in the absence of such W094/~028 PCT~S94/03454 215935~ ~

specific polymerases, the minus strand of influenza virus RNA
is not infectious. Initiation of transcription of the mRNAs occurs when the influenza virus mRNA polymerase takes 12 to 15 nucleotides from the 5' end of a cellular mRNA or mRNA
precursor and uses the bo~Lowcd oligonucleotide as a primer.
Generally, the mRNAs made through this process encode only one protein. The ~ RNA and the NS RNA also encode spliced mRNAs, which results in production of two different proteins for each of these two segments.
Influenza viruses infect humans and ~n;r~ls (e.g., pigs, birds, horses) and may cause acute respiratory disease. There have been numerous attempts to produce vaccines effective against influenza virus. None, however, have been completely successful, particularly on a long-term basis. This may be due, at least in part, to the segmented characteristic of the influenza virus genome, which makes it possible, through reassortment of the segments, for numerous forms to exist.
For example, it has been suggested that there could be an interchange of RNA segment between animal and human influenza viruses, which would result in the introduction of new antigenic subtypes into both populations. Thus, a long-term vaccination approach has failed, due to the emergence of new subtypes (antigenic "shift"). In addition, the surface proteins of the virus, hemagglutinin and neuraminidase, constantly undergo minor antigenic changes (antigenic W094/~028 PCT~S94/03454 21593~0 "drift"). This high degree of variation explains why specific immunity developed against a particular influenza virus does not establish protection against new variants. Hence, alternative antiviral strategies are needed. Although influenza B and C viruses cause less clinical disease than the A types, chemical antivirals should also be helpful in curbing infections caused by these agents.
Consequently, there is considerable interest in the development of anti-sense oligonucleotides that are capable of inhibiting the replication or propagation of influenza virus.
Such anti-sense oligonucleotides hold the promise of providing broader protection against different strains of influenza, because they can be designed to hybridize to conserved regions of the influenza genome that are present in multiple strains ]5 of influenza virus.
Agrawal et al., U.S. Patent No. 5,194,428 the teachings of which are hereby incorporated by reference, discloses oligonucleotides having certain modified internucleotide linkages that are capable of inhibiting influenza replication ~o by hybridizing to the influenza PBl polymerase gene. Cowsert et al., W092/03454 (1992) discloses antisense oligonucleotides that inhibit influenza virus propagation by hybridizing to the influenza polymerase 1, 2 or 3, or the hemagglutinin, nucleoprotein, neuraminidase, matrix protein, or nonstructural -W094/~028 PCT~S94/03454 935~

_ 4 _ protein gene, or to various splice junction sites or packaging seq~ nc~c .
Pederson et al., U.S. Patent Nos. 5,149,797 and 5,XXX,XXX
(Serial No. 07/839,472, allowed December 24, 1992), the teachings of which are hereby incorporated by reference, discloses chimeric mixed phosphate backbone oligonucleotides having RNase H activating segments adjacent to RNase H
inactivating segments.
Thus, anti-sense oligonucleotides show promise as anti-influenza therapeutic agents. As with any such agents, however, there remains a need for improved agents that have even greater efficacy in inhibiting influenza virus replication or propagation. Such improved anti-sense oligonucleotides would be useful for studying which regions of the influenza virus genome are the best candidates for broad cross-strain inhibition as well as for use, and as anti-influenza therapeutic agents.

WOg4/~028 PCT~S94/03454 21S93~0 BRIEF STJMMARY OF THE lN v~ ON
~he invention provides modified oligonucleotides having greater efficacy in inhibiting the replication or propagation of influenza virus than previously known oligonucleotides.
These modified oligonucleotides are characterized by having a nucleotide sequence sufficiently complementary to an essential nucleic acid of influenza virus origin to hybridize to such influenza virus nucleic acid in a cell. In preferred embodiments, the essential nucleic acid is a portion of the PBl, 2 or 3 polymerase gene or to the hemagglutinin, nucleoprotein, neuraminidase, matrix protein, or nonstructural protein gene of influenza or to the various influenza splice junction sites or packaging sequences.
In various embodiments, modified oligonucleotides according to the invention have one or more type of modified internucleotide linkage. In a preferred emboA;~et, at least ~ome of the modified internucleotide linkages are phosphorothioate or phosphorodithioate linkages. In certain preferred embodiments, phosphorothioate internucleotide ~o linkages are present in a modified oligonucleotide that also contains other modified, i.e. nonphosphodiester, linkages.
Preferably these other modified internucleotide linkages are alkylphosphonate or alkylphosphonothioate linkages. Most preferably, these other modified internucleotide linkages are ~5 present at or near one or both ends of the oligonucleotide.

W094/~0~ PCT~S94/03454 .

In additional preferred embodiments of modified oligonucleotides according to the invention, phosphorothioate or phosphorodithioate internucleotide linkages are present in an oligonucleotide having one or more modified nucleoside.
Preferably, such modified nucleoside is a 2'-0 alkyl nucleoside. Most preferably, at least some modified nucleosides are present at or near one or both ends of the oligonucleotide.
In yet additional preferred embodiments of modified oligonucleotides according to the invention, phosphorothioate or phosphorodithioate internucleotide linkages are present in an oligonucleotide having an eYonllclease resistance-conferring cap structure at one or both ends. Preferably, such a cap structure is present at least at the 3' end of the molecule.
Such cap structures may also be present at one or both ends of all embodiments of modified oligonucleotides according to the invention and preferably are present at least at the 3' end of the oligonucleotide.
In further preferred embodiments of modified oligonucleotides according to the invention, phosphorothioate or phosphorodithioate internucleotide linkages are present in an oligonucleotide that is self-stabilized by having a self-complementary region involving nucleotides at or near one or both ends, and preferably at least at or near the 3' end, whereby the oligonucleotide forms a hairpin-like structure.

WOg4/23028 PCT~S941034~4 Each of these modified oligonucleotides according to the invention provides greater efficacy in inhibiting replication or propagation of influenza than any known oligonucleotide or modified oligonucleotide that hybridizeæ to the same gene.
Each of these modified oligonucleotides according to the invention may optionally also contain other modifications to the sugars or bases of the oligonucleotide and may also optionally have additional internucleotide linkages other than phosphorothioate, phosphorodithioate, alkylphosphonate or alkylphosphonothioate linkages.

W094/~028 PCT~S94/03454 ~5~

BRIEF DESCRIPTION OF '1~ DRAWINGS
Figure 1 shows the nucleotide sequence of an influenza virus PBl (polymerase 1) gene, against which complementary antisense oligonucleotides can ~e prepared.

Figure 2 shows a self-stabilized anti-influenza modified oligonucleotide according to the invention.

Figure 3 shows an alternative form of a self-stabilized anti-influenza modified oligonucleotide according to the invention.

Figure 4 shows certain preferred cap structures that confer exonuclease resistance upon oligonucleotides.

Figure 5 shows ln v'vo nucleolytic degradation patterns for 5'-capped, 3'-capped and uncapped oligonucleotides.

Figure 6 shows DNA Polymerase I 3'-exonuclease degradation patterns for self-stabilized and non-self-stabilized oligodeoxynucleotide phosphodiesters.

Figure 7 shows DNA Polymerase I 3'-exonuclease degradation patterns for self-stabilized and non-self-stabilized oligodeoxynucleotide phosphorothioates.

O W094/~028 PCT~S94/03454 2~350 g DE~ATT~n DESCRIPTION OF THE ~KK~ EMBODIMENTS
The invention relates to anti-sense oligonucleotides having anti-influenza activity. Modified oligonuclestides having in vivo activity against influenza are referred to herein as anti-influenza modified oligonucleotides. The invention provides anti-influenza modified oligonucleotides that have greater efficacy in inhibiting replication or propagation of influenza virus than known oligonucleotides or modified oligonucleotides that hybridize to the same gene.
Modified oligonucleotides according to the invention have specific preferred characteristics that are discussed in greater detail for each preferred embodiment below. In addition to these characteristics, modified oligonucleotides according to the invention may optionally have additional ribonucleotide, 2'-substituted ribonucleotide, and/or deoxyribonucleotide monomers, any of which are connected together via 5' to 3' linkages which may include any of the internucleotide linkages known in the art. Preferably, such modified oligonucleotides may optionally contain phosphodiester, phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate, bridged phosphoramidate, bridged methylene phosphonate, bridged phosphorothioate and/or sulfone internucleotide linkages. Those skilled in the art will W094/~028 PCT~S94/03454 ~
~1$93~i0.

.

recognize that the synthesis of oligonucleotides contA; n; ng any of these internucleotide linkages is well known to those skilled in the art, as i illustrated by articles by Uhl~nn and Peyman, Chemical Reviews 90:543-584 (1990) and Schneider and R~ r~ Tetrahedron Lett. 31:335 (1990). Preferably, modified oligonucleotides according to the invention should contain from about 6 to about lO0 monomers in total. Such modified oligonucleotides may also optionally contain modified nucleic acid bases and/or sugars, as well as added substituents, such as diamines, cholesteryl or other lipophilic groups.
Various preferred embodiments of modified oligonucleotides according to the invention are illustrated in Table I, below. Although these embodiments all have a nucleotide sequence from the same region of the influenza PBl polymerase gene, those skilled in the art will recognize that the anti-influenza efficacy of oligonucleotides having nucleotide se~lenc~s complementary to other essential nucleic acid sequences of influenza virus can also be enhanced by incorporating into such oligonucleotides the structural features of preferred embodiments of modified oligonucleotides according to the invention. For purposes of the invention, complementary means having a sequence that hybridizes to the essential nucleic acid sequence under physiological conditions. An essential nucleic acid sequence of influenza W094/~028 PCT~S94/03454 2~935~

virus means a nucleic acid sequence that is re~uired for replication or propagation of influenza virus. Such essential nucleic acid se~7~nceF can be from any known strain of influenza virus. For example such oligonucleotides can have other sequences from the influenza PBl polymerase gene (polymerase 1), as shown in Table I of U.S. Patent No.
5,194,428, the teachings of which are hereby incorporated by reference. Indeed, any sequence from the influenza PBl (polymerase 1) gene ~SEQ. ID. No. 1] (see Figure 1) should serve as the basis for modified oligonucleotides according to the invention. Alternatively, se~enc~ from other influenza se~enc ~ or genes can be used (see Table II). As a practical matter, the structural features of preferred embodiments of modified oligonucleotides according to the invention should enh~nc~ the anti-influenza activity of any antisense oligonucleotide having a nucleotide sequence that hybridizes in a cell with any essential nucleic acid se~uence of influenza virus.
Each preferred embodiment of modified oligonucleotides ~o according to the invention is separately discussed in greater detail below.

W094/~028 , PCT~S94/03454 ~1593SO

TABLE I
Modified Oliqonucleotides Havinq Superior Anti-Influenza Activity Com~ Sequence and Identification Structure r SEO. ID
NO.l CMPD A CAGAGrAAAATCATCAGAAGA1 ~SEQ. IDNO.
2]
CMPD B CAGAG~AAATCATCAGAAGA2 ~SEQ. IDNO.

3]
CMPD C CAGAG~AAATCATCAGAAGAS ~SEQ. IDNO.

4]
CMPD D CAGAGCA~A TCATCAGAAGA5 ~SEQ. IDNO.

5]
CMPD E CAGAG~AAAATcATrA~A~.A2 ~SEQ. IDNO.

6]
CMPD F CAGAGrAAAATCATCAGAAGA2 ~SEQ. IDNO.

7]
CMPD G CAGAG~AAbA~CATCAGAAGA~ ~SEQ. ID NO.

8]
CMPD H CAGAGr~AAATcAT~A~AA~ SEQ. IDNO.

9]
CMPD I CAGAG~AAAA~CATCA~-AAGA-Cl2~~SEQ. IDNO.

10]
CMPD J AGAG~AA~TCATCAGAAG3 ~SEQ. IDNO.
12]
CMPD K GAGCAAAA~CATCAGAA~ ~SEQ. IDNO.
14]
CMPD L CAGAGCAAAATCATCAGAAGA3 tSEQ. IDNo.
15]
CMPD M cAGAGr~AA~TcATrAGAAr-ATTcTGATGAs [SEQ. ID NO.
16]

W094/23028 ~ 5 9 3 5 0 PCT~S94/03454 O All se~lenc~ shown 5' to 3'; nonunderlined regions are oligonucleotide phosphorothioates.
1 Underscoring represents nucleotides connected by methylphosphonate internucleotide linkage.
2 Underscoring represents nucleotides connected by methylphosphonothioate linkage.
3 Underscoring represents 2'-OMe nucleotides.
4 Cl2 represents cap structure.
Self-stabilized.

W094/~028 PCT~S94/03454 TABLE II
Additional Anti-Influenza Oligonucleotide Potential Se~-Pn~
Sequence Target rSEO. ID. No.l CTT TCC ATA TTG AAT ATA AT AUG segment 1 [SEQ. ID. No. 17 polymerase 3 CA TCC ATT CAA ATG GTT TG AUG segment 2 [SEQ. ID. No. 18]
polymerase 1 CT TCC ATT TTG GAT CAG TA AUG segment 3 [SEQ. ID. No. 19]
polymerase 2 CC TTC ATT TTG GTT GTT TT AUG segment 4 [SEQ. ID. No. 20]
hemagglutinin AC GCC ATG ATT TTG ATG TC AUG segment 5 ~SEQ. ID. No. 21]
nucleoprotein GA TTC ATT TTA AAC CCC TG AUG segment 6 ~SEQ. ID. No. 22]
neuraminidase GA CTC ATC TTT CAA TAT CT AUG segment 7 [SEQ. ID. No. 23]
matrix protein AT AGA GAG AAC GTA CGT TT left splice [SEQ. ID. No. 24]
junction segment 7 CT GAT AGG CCT GCA AAT TT right splice ~SEQ. ID. No. 25]
junction segment 7 GA TCC ATT ATG TCT TTG TC AUG segment 8 ~SEQ. ID. No. 26]
nonstructural protein AT GTC GGT TAG GTA ACG CG splice branch [SEQ. ID. No. 27]
segment 8 CA ATC TAC CTG AAA GCT TG right splice ~SEQ. ID. No. 28]
junction segment 8 GC AGT ATG TCC TGG AAG AG left splice [SEQ. ID. No. 29]
junction segment 8 AA ACG ACC TTG TTT CTA CT packaging r SEQ. ID. No. 30]
sequence segment 1 AA AAT GCC TTG TTC CTA CT packaging [SEQ. ID. No. 31]
sequence segment 2 ~ W094/~028 PCT~S94/03454 2~3~0 AAA AGT ACC TTG TTT CTA C~ packaging [SEQ. ID. No. 32 sequence segment 3 AAA ACA CCC TTG TTT CTA CT packaging tSEQ. ID. No. 33]
sequence segment 4 AAA ATA CCC TTG TTT CTA CT packaging ~SEQ. ID. No. 34]
sequenc segment 5 AAA AAC TCC TTG TTT CTA CT packaging tSEQ. ID. No. 35]
sequence segment 6 AAA ACT ACC TTG TTT CTA CT packaging [SEQ. ID. No. 36]
sequence segment 7 AAA ACA CCC TTG TTT CTA CT packaging tSEQ. ID. No. 37]
sequence segment 8 In a first preferred embodiment, anti-influenza modified oligonucleotides according to the invention are in the form of a mixed backbone chimeric oligonucleotide having one or more regions of nucleotides connected by phosphorothioate or phosphorodithioateinternucleotidelinkages("phosphorothioate or phosphorodithioate region") as well as one or more regions of nucleotides connected by alkylphosphonate internucleotide linkages ("alkylphosphonate region"). In this embodiment, at least one alkylphosphonate region preferably includes nucleotides at or near the 5' end and/or the 3' end of the oligonucleotide. For purposes of the invention, "at or near the 5' or the 3' end of the oligonucleotide" means involving at least one nucleotide within about 5 nucleotides from the 5' or 3' end of the oligonucleotide. Preferably, the alkylphosphonate region comprises from about 2 to about 10 W094/~028 PCT~S94/03454 ~93~ -contiguous nucleotides connected by alkylphosphonate linkages.
Preferably, the phosphorothioate or phosphorodithioate region comprises at least 3, and up to about 100 contiguous nucleotides connected by phosphorothioate or phosphorodithioate linkages. An example of an anti-influenza modified oligonucleotide according to this embodiment of the invention is shown in Table I as CMPD A.
Anti-influenza modified oligonucleotides according to this embo~ nt of the invention are synthesized by solid phase methods, alternating H-phosphonate chemistry and sulfur oxidation for phosphorothioate regions, and alkylphosphonamidate chemistry for alkylphosphonate regions.
A preferred H-phosphonate approach is taught by Agrawal et al., U.S. Patent No. 5,149,798, the teachings of which are hereby incorporated by reference. Alkylphosphonamidite chemistry is well known in the art, as illustrated by Agrawal and Goodchild, Tetrahedron Lett. 28:3539-3542 (1987).
Synthesis of phosphorodithioate-contA;n~ngoligonucleotides is also well known in the art, as illustrated by U.S. Patent No.
5,151,510, the teachings of which are hereby incorporated by reference (See also, e.a., Marshall and Caruthers, Science 259: 1564-1570 (1993) and references cited therein).
In a second preferred embodiment, anti-influenza modified oligonucleotides according to the invention are in the form of a mixed backbone chimeric oligonucleotide having one or more W094/~028 2 15 9 3 ~ O PCT~S94tO3454 region of nucleotides co~nected by phosphorothioate or phosphorodithioateinternucleotidelinkages("phosphorothioate or phosphorodithioate region"), as well as one or more region of nucleotides connected by alkylphosphonothioate or arylphosphonothioate internucleotide linkages ("alkylphosphonothioate region"). In this embodiment, at least one alkylphosphonothioate region preferably includes nucleotides at or near the 5' end and/or the 3' end of the oligonucleotide. Preferably, the alkylphosphonothioate region comprises from about 2 to about 10 contiguous nucleotides co~nected by alkylphosphonothioate linkages. Preferably, the phosphorothioate or phosphorodithioate region comprises at least 3, and up to about 100 contiguous nucleotides connected by phosphorothioate or phosphorodithioate linkages. Examples of anti-influenza modified oligonucleotides according to this embodiment of the invention are shown in Table I as CMPD B, CMPD E and CMPD F.
Anti-influenza modified oligonucleotides according to this embodiment of the invention are synthesized by solid phase methods, alternating chemistries for each region to be synthesized. Phosphorothioate or phosphorodithioate regions are synthesized as described for the first embodiment.
Alkylphosphonothioate regions are synthesized by coupling together two or more nucleosides via alkylphosphite linkages, then oxidatively thiolating the alkylphosphite linkages to W094/~028 PCT~S94/034~4 ~

~is~3~ ~

produce alkylphosphonothioate lin~ages. This synthesis procedure is set forth in detail in Example 1.
In a third preferred embodiment, anti-influenza modified oligonucleotides according to the invention are in the form of a hybrid oligonucleotide having regions of deoxyribonucleotides ("deoxyribonucleotide regions") and regions of rihonllcleotide6 or 2'-substituted ribonucleotides ("ribonucleotide regions"). Preferably, from about one to about all of the internucleotide linkages are phosphorothioate or phosphorodithioate linkages. Preferred 2'-substituted ribonucleotides are halo, amino, alkyl, aryl or lower alkyl (1-6 carbon atoms) substituted ribonucleotides, especially 2'-OMe-ribonucleotides. Preferably, at least some of the ribonucleotide regions include nucleotides present at or near the 5' end and/or the 3' end of the oligonucleotide. Most preferably, the ribonucleotide regions each comprise from about 2 and preferably from about 4 to about 100 contiguous ribonucleotides and/or 2'-substitute oligonucleotides. The deoxyribonucleotide regions are optional, and when present may contain from about 1 to about 100 contiguous deoxyribo-nucleotides. Examples of anti-influenza modified oligonucleotides according to this embodiment of the invention are shown in Table I as CMPD C, CMPD D, CMPD G, CMPD H, CMPD
K, CMPD M and CMPD N.

W094/~028 PCT~S94/03454 ,~ 5~350 Anti-influenza modified oligonucleotides according to this embodiment of the invention are typically synthesized by solid phase methods, preferably by the H-phosphonate approach, using deoxynucleotide H-phosphonates for deoxyribonucleotide S regions, and ribonucleotide or 2'-substituted ribonucleotide H-phosphonates for ribonucleotide regions.
In a fourth preferred embodiment, anti-influenza modified oligonucleotides according to the invention are in the form of an oligonucleotide having at its 5' and/or 3' end a cap o structure that confers exonuclease resistance to the oligonucleotide. Such modified oligonucleotides preferably also have from 1 to about all modified (non-phosphodiester) internucleotide linkage. Preferred cap structures include those shown in Figure 4, as well as lower alkyl (Cl-C12) or alcohol yr OU~. Preferred modified internucleotide linkages include phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate, bridged phosphorothioate, sulfone, phosphorothioate and phosphorodithioate linkages.
Anti-influenza modified oligonucleotides according to this embodiment of the invention are synthesized according to procedures well known in the art (see e.a., Uhlmann and Peyman, Chemical Reviews 90:543-584 (1990); Schneider and -5 Banner, Tetrahedron Lett. 31:335 (1990)). For W094/23028 PCT~S94/03454 ~1~93~

oligonucleotides having cap structures at the 3' end, the cap structure i8 reversibly attached to the solid support and is then coupled to the first nucleotide monomer in the synthesis scheme. For oligonucleotides having cap structures at the 5' S end, the cap structure is coupled to the end of the oligonucleotide after addition of the last nucleotide monomer in the synthesis scheme.
In a fifth embodiment, anti-influenza modified oligonucleotides are self-stabilized by having a self-complementary region that hybridizes intramolecularly with the oligonucleotide to form an exonuclease resistant hairpin-like structure. Anti-influenza modified oligonucleotides according to this embodiment of the invention are generally characterized by having two regions: an influenza hybridizing region and a self-complementary region. The influenza hybridizing region has a nucleotide sequence that is complementary to an essential nucleic acid sequence of influenza virus. Preferably, this region has from about 6 to about lOO nucleotides. One form of this embodiment of the invention is shown in Figure 2. In this form, the influenza hybridizing region is shown as connected rectangular squares, and the self-complementary region is shown as connected circles. The complementary nucleic acid sequence in a target influenza messenger RNA molecule is represented by connected diamonds. Hydrogen bonding between nucleotides is indicated W094/~028 ~ PCT~S94/03454 ~i5~350 by dots. The oligonucleotide is stabilized, i.e., rendered resistant to exonucleolytic degradation by base-pairing between the target hybridizing region and the self-complementary region and/or by base-pairing between complementary sequences within the self-complementary region.
When the oligonucleotide encounters an influenza nucleic acid molecule having a complementary nucleic acid sequence, base-pairing between the influenza hybridizing region and the self-complementary region of the oligonucleotide is disrupted and replaced by base-pairing between the influenza hybridizing region of the oligonucleotide and the complementary nucleic acid sequence of the nucleic acid molecule. This disruption and replacement of base-pairing takes place because the intermolecular base-paired structure formed by the hybrid between the target nucleic acid sequence and the target hybridizing region i8 more thermodynamically stable than the intramolecular base-paired structure formed by the self-complementary oligonucleotide.
A second form of an oligonucleotide according to this embodiment of the invention operates in a similar way as the first form, but forms a different structure upon self-complementary base-pairing. This alternative form forms a hammer-like structure as shown in Figure 3. In this form, the self-complementary region contains oligonucleotide sequences that can base pair with other oligonucleotide sequences within W094l~028 ~ PCT~S94/03454 213~3~0 the self-complementary region. The self-complementary region may also contain oligonucleotide se~lences that are complementary to the influenza hybridizing region.
The ~ co~ significant region of self-stabilized oligonucleotides according to the invention is the self-complementary region. The self-complementary region contains oligonucleotide sequences that are complementary to other oligonucleotide se~le~c~fi within the oligonucleotide. These other oligonucleotide sequences may be within the influenza hybridizing region or within the self-complementary region, or they may span both regions. The complementary sequences form base pairs, resulting in the formation of a hairpin structure, as shown in Figure 2, or a hammer-like structure, as shown in Figure 3. Either the hairpin structure or the hammer-like structure can have loops resulting from non-base-paired nucleotides, as shown in Figure 2 for the hairpin structure, or can be devoid of such loops, as shown in Figure 3 for the hammer-like structure. The number of base-pairs to be formed by intra-molecular hybridization involving the self-complementary region may vary, but should be adequate to maintain a double-stranded structure so that the 3' end is not accessible to endonucleases. Generally, about 4 or more base-pairs will be necessary to maintain such a double-stranded structure. In a preferred embodiment, there are about 10 intramolecular base-pairs formed in the self-stabilized W094/~028 PCT~S94/03454 ~lSg~50 oligonucleotide, with the 10 base paira being consecutive and involving the 3'-most nucleotides. Of course, the intra-- molecular base-pairing can be so extensive as to involve every nucleotide of the oligonucleotide. Preferably, this will involve a self-complementary region of about 50 nucleotides or less.
Oligonucleotides according to this embodiment may have from 1 to about all modified internucleotide linkages, as described for the fourth embodiment. Preferably, at least either the influenza hybridizing region or the self-complementary region, and most preferably both, will contain from about 2 to about all nucleotides being coupled by phosphorothioate and/or phosphorodithioate linkages.
An example of an anti-influenza modified oligonucleotide according to this embodiment of the invention is shown in Table I as CMPD o.
Those skilled in the art will recognize that the features of the various preferred embodiments described above can be combined to produce additional embodiments that may have even greater anti-influenza activity. Thus, the invention contemplates anti-influenza modified oligonucleotides having every possible combination of chimeric features, hybrid features, cap structures and self-stabilizing character, all as described herein.

W094/~028 PCT~S94/03454 ~5~3~
Each of the preferred embodiments of the present invention has greater ability to inhibit influenza replication or propagation than anti-sense oligonucleotides of the prior art that hybridize to the same influenza mRNA. For example, U.S. Patent No. 5,194,428, teaches modified oligonucleotides that inhibit influenza virus replication. Among those modified oligonucleotides are oligonucleotide phosphorothioates that hybridize to the influenza PBl (polymerase 1) gene. In the present study, an oligonucleotide phosphorothioate that hybridizes to the influenza PBl polymerase gene was tested for its ability to inhibit influenza virus replication in comparison with various preferred embodiments of the present invention. Each embodiment of the present invention tested demonstrated surprisingly improved efficacy in anti-influenza activity, relative to the oligonucleotide phosphorothioate that binds to the same site on the same gene. As shown in Table III, below, anti-influenza modified oligonucleotides according to the invention gave a reduction in the 50 per cent inhibitory concentration (IC50) ranging from 2 to nearly fifteen fold.

W094/~028 PCT~S94/03454 ~5~3~0 TABLE III
Anti-Influenza Activitv Of Oli~onucleotide Oli~onucleotideIÇ~ h- q~ml) X - F o 1 d ImProvement CAGAGC~ TCAT~A~t'-Al 3172 CMPD A N.T.
CMPD B 34 9.3 CMPD C 55 5.8 CMPD D 582 5.5 CMPD E N.T.
CMPD F 178 1.8 CMPD G 147 2.2 CMPD H 59 5.4 CMPD I 45 7.0 CMPD J 272 11.7 CMPD K 222 14.4 CMPD L 61 5.2 CMPD M 175 1.8 CMPD N 1O42 3.0 CMPD O 232 13.8 1 oligodeoxynucleotide phosphorothioate control 2 average of two experiments Such oligonucleotides are useful for a variety of purposes. First, they can be used in studies to determine which influenza genes and sites within such genes provide the best basis for anti-sense oligonucleotides having broad effectiveness against multiple strains of influenza virus.
Second, they can be used to determine what structural features W094/~028 PCT~S94/03454 21~9350 or combination of structural features provide the greatest effectiveness against influenza in vitro and in vivo.
Finally, such oligonucleotides are useful as therapeutic agents for treating influenza infections. For such treatment, oligonucleotides may be administered intraperitoneally, intrA~ ly, orally or anally. Preferably, such oligonucleotides will be administered at a concentration of from about 1 to about 50 mg/kg body weight.
The following examples are inte~ to further illustrate certain preferred embodiments of the invention and are not inte~e~ to be limiting in nature.

~lr~MPIE 1 Synthesis Of A Chimeric Oligonucleotide Havinq Methylphosphonate And PhosPhorothioate Re~ions Chimeric oligonucleotides having methylphosphonate and phosphorothioate regions were synthesized using methylphosphonamindites for methylphosphonate regions and nucleoside H-phosphonates for phosphorothioate regions.
Methylphosphonamidite synthesis was as follows:
Methylchloro-N, N-diisopropylaminosphophine was prepared by reaction of methyldichlorophosphine (51 mmol) with diisopropylamine (102 mmol) in ether at 15 under nitrogen.
After removal of salt by filtration and evaporation of solvent, methylchloro-NlN-diisopropylaminophosphine was obtained as an oil (48 mmol, 95% of theory) that was W094/~028 PCT~S94/03454 characterized by 1H and 31p NMR and was stable at -20- for at least eight weeks. The product was reacted with the usual - protected nucleosides in dichloromethane contA;n;ng N, N-diisopropylethylamine at room temperature for 10-20 min.
Aqueous work up and precipitation from ethyl acetate using pentane at -30- to -40- gave product as white solids in 80-90%
yield. Products were pure by tlc on silica in CH2Cl2:EtOAc:Et3N(9:9:2) and were characterized by lH and ~1p NMR.
These products were used in automated DNA synthesizer using the same conditions and program used for st~n~rd phosphoramidite reagents. Nucleotides were dissolved in acetonitile at a concentration of 33 mg/ml and activated with tetrazole. Synthesis on prepacked CPG cupport was performed using a coupling time of 1 minute.
Coupling efficiency was followed by the dmethoxytrityl assay and was found to be the same as for control syntheses run in parallel using phosphoramidites.
After coupling, the product was detriylated then cleaved from the support with NH~OH at room temperature for 2 hrs and deblocked using ethylenediamine: ethanol (1:1) at room temperature for 4 hrs. This basic treatment caused about 1%
degradation of the internucldoside phosphonate group in a model study assayed by HPLC.

W094/~0~ PCT~S94/03454 ~S93~0 H-phosphonate synthesis was as exemplified in U.S. Patent No. 5,149,798, the teachings of which are hereby incorporated by reference. Then, the H-phosphonates were converted to phosphorthioates by oxidation with 0.2 M sulfur in carbon disulfide/pyridine/triethylamine (9:9:1 vol/vol).

Synthesis Of A Chimeric Oligonucleotide Havinq MethylPhosPhonothioate And PhosPhorothioate Reqions For preparing a modified oligonucleotide having regions of four contiguous nucleotide methylphosphonothioates at either end and a region of 12 contiguous oligonucleotide phosphorothioates in the middle, the following procedure on 8 micromole scale was used. A first monomer was pre-bound to a control pore glass (CPG) solid support. A second monomer, which was a deoxynucleotide methylphosphonamidite, was coupled to the first monomer using a st~n~rd amidite coupling cycle (see e.q., Agrawal and Goo~-h~ld, Tetrahedron ~ett. 28:3539-3542 (1987)). ~n separate cycles, three more deoxynucleotide methylphoshonamidites were sequentially coupled to the growing chain. Then oxidative thiolation was carried out, using 1%
Beaucage reagent (3H-1,2-benzodithiole-2-one) in acetonitrile for 5 minutes at ambient temperature to generate a CPG-bound pentanucleotide methylphosphonothioate. The next 12 monomers were added sequentially by the H phosphonate approach of Agrawal and Zamecnik, U.S. Patent No. 5,149,798, the teachings W094/~028 21S9 ' ` ` - PCT~S94/03454 of which are hereby incorporated by reference. Then, the H-phosphonates were converted to phosphorothioates by oxidation with 0.2 M sulfur in carbon disulfide/pyridine/
triethylamine (9:9:1 vol/vol). The final four monomers, which were deoxynucleotide methylphosphonothioates, were added, then oxidatively thiolated as described above. The resulting oligonucleotide was deprotected at room temperature for 30 minutes in 0.5 ml ethylene diamine, then kept at room temperature for 6 hours with occasional stirring. Finally, the mixture was filtered and evaporated in vacuo to obtain a solid mass and the mass was dissolved in water and desalted on Sep Pak Cl8.

~AMPLE 3 Resistance Of Oligonucleotides Having Methylphos~honothioate Linkaqes To Nucleolytic Deqradation Oligonucleotides having 2-4 contiguous deoxynucleotide methylphosphonates at 3' ends and otherwise having all deoxynucleotide phosphodiesters were tested for their relative resistance to 3' exonucleolytic degradation compared with an oligonucleotide phosphodiester. For each oligonucleotide, 0.4 A2ffo units of oligonucleotide was lyophilized, dissolved in 0.5 ml buffer (10 mM Tris, 10 mM MgCl2, pH 8.5) and mixed with 5 ~1 (1.5 milliunitc) of snake venom phosphodiesterase. The mixture was incubated at 37C in a thermally regulated cell W094/~028 PCT~S94/034~4 2~35 and A~o was plotted against time. Increase in hyperchromicity was used as the indicator for oligonucleotide degradation.
The results are shown in Table IV, below.
These results demonstrate that oligonucleotides having methylphosphonothioate linkages near the 3' end were far more stable than the oligonucleotide lacking such linkages. In addition, oligonucleotide stability increased with increasing numbers of methylphosphonothioate linkages (4 linkages~>3 linkages> >2 linkages).

TABLE IV
Resistance Of Oliqonucleotides To NucleolYtic Deqradation ~ increase in Oliqonucleotide t 1/2 (seconds) hyPerchromicity Oligonucleotide phosphodiester 44 22.56 Oligonucleotide with 210 24.58 2 3' terminal deoxynucleotide methylphosphonothioates Oligonucleotide with 264 18 3 3' terminal deoxynucleotide methylphosphonothioates Oligonucleotide with 401 15.54 4 3' terminal deoxynucleotide methylphosphonothioates WOg4/~028 PCT~S94/03454 21a9350 Synthefiis Of A Hybrid Oligonucleotide Phosphorothioate Havinq Deoxyribonucleotide And 2'-OMe-Ribonucleotide Regions Hybrid oligonucleotide phosphorothioateswere synthesized on CPG on a 5-6 ~mole scale on an automated synthesizer (model 8700, Millipore, Milford, MA) using the H-phosphonate approach described in U.S. Patent No. 5,149,798, the teachings of which are hereby incorporated by reference.
Deoxyribonucleoside H-phosphonates were obt~;ne~ from Millipore. 2'-OMe ribonucleotide H-phosphonates were synthesized by st~n~Ard procedures. Segments of oligonucleotides con~;ning 2'-OMe nucleoside were assembled by using 2'-OMe r;hont~c1eoside H-phosphonates for the desired cycles. Similarly, segments of oligonucleotides conta;n;ng deoxyribonucleosides were assembled by using deoxynucleoside H-phosphonates for the desired cycles. After assembly, CPG
bound oligonucleotide H-phosphonate was oxidized with sulfur as described in Example 2 to generate the phosphorothioate linkage. Oligonucleotides were then deprotected in ~o concentrated NH~OH at 40C for 48 hours.
Crude oligonucleotide (about 500 A260 units) was analyzed on reverse low pressure chromatography on a Cl8 reversed phase medium. The DMT group was removed by treatment with 80%
a~ueous acetic acid, then the oligonucleotides were dialyzed ~5 against distilled water and lyophilized.

W094/~028 PCT~S94/03454 ~1~93~

~AMPLE 5 Relative Nuclease Resistance Of HYbrid Oliqonucleotide Phosphorothioates To test the relative nuclease resistance of various hybrid oligonucleotide phosphorothioates, the oligonucleotides were treated with snake venom phosphodiesterase (SVPD). About 0.2 A260 units of oligos having no 2'-OMe-RNA region, or having 3 and 4 contiguous 2'-OMe ribonucleotides at 5' and 3' ends, respectively, or having all 2'-OMe nucleotides, were dissolved in 500 ~1 buffer (40 mM NH~C03, pH 4.0 + 20 mM MgCl2), and mixed with 0.1 units SVPD. The mixture was incubated at 37C
for 420 minutes. After 0, 200 and 420 minutes, 165 ~1 aliquots were removed and analyzed using ion ~Ych~nge HPLC.
The oligonucleotide having all 2'-OMe-ribonucleotides was very resistant to SVPD, whereas the oligonucleotide having no 2'-OMe-ribonucleotides was digested almost to completion and the oligonucleotide having 5' and 3' terminal 2'-OMe-RNA regions was digested to 50%. An oligonucleotide phosphodiester was digested to about 80% in one minute using one tenth of the concentration of SVPD.
These results indicate that the presence of 2'-OMe ribonucleotides in an oligonucleotide phosphorothioate ~nh~ncPs resistance to exonucleolytic digestion and that this enhanced resistance increases when a larger proportion of 2'-OMe ribonucleotides are used. Due to the similar character W094/~028 ~ PCT~S94103454 2~5935~ `

and behavior of ribonucleotides, other 2~-substituted ribonucleotides and 2'-OMe ribonucleotides, these results also suggest that similar enhancement of nuclease resistance would be obt~; nP~ for hybrid oligonucleotide phosphorothioates and/or phosphorodithioates having ribonucleotides, 2'-substituted ribonucleotides, or a mixture of ribonucleotides and 2'-substituted ribonucleotides.

Synthesis Of An Oligonucleotide Phosphorothioate Havinq A 3' CaP Structure Oligonucleoside phosphorothioates were synthesized on a Model 8700 automated synthesizer (Milligen-Biosearch, Burlington, MA) using H-phosphonate chemistry on controlled pore glass (CPG), followed by oxidation with 0.2 M sulfur in carbon disulfide/pyridine/triethylamine (9:9:1 vol/vol).
Synthesis was carried out on a 5-10 micromolar scale.
Oligonucleoside phosphorothioates were purified by low pressure ion exchange chromatography (DEAE-cellulose, DE-50 Whatman), followed by reverse phase chromatography (Cl8) and dialysis. 5'-capped oligonucleoside phosphorothioates were prepared by carrying out the last coupling, after the assembly of the required sequence, with N-Fmoc-O'-DMTr-3-amino-1,2-propanediol-H-phosphonate. The 5'-capped oligonucleoside H-phosphonate was then oxidized with sulfur. 3'-capped oligonucleoside phosphorothioates were assembled on N-Fmoc-O'-WOg4/~028 PCT~S94/03454 ~,~S~3~

DMTr-3-amino-1,2-prop~nP~iol-CPG, followed by sulfur oxidation. Combination of these procedures was used to produce 3',5'-capped oligonucleoside phosphorothioates.
Alternatively, oligonucleoside phosphorothioates having other 3' or 5' cap structures, (see e.g., Figure 4), are prepared by substituting the phosphonate or CPG-derivatized cap structures forthe N-Fmoc-0'-DMTr-3-amino-1,2-prop~ne~;ol-H phosphonate or CPG in the capping procedure. Similarly, capped modified oligonucleotides other than oligonucleotide phosphorothioates are prepared in an analogous manner by app~n~ng the capping procedure to the appropriate synthetic procedure.

~AMP~E 7 In Vivo Stability Of OligQn~r-l~otide phncrh~othioates Havina Terminal Ca~ Stru~ LUL 6 -Male CDC2Fl mice (average weight 20 grams) were treated by intravenous or intraperitone~l injection with a 30 mg/kg dose of radiolabelled oligonucleotides dissolved in 200 microlitres physiological saline. Each capped or uncapped oligonucleotide was administered to three mice. Urine was collected separately from each animal up to 24 hours post-dosing, then extracted with proteinase K. (2 mg/ml, final concentration) in 0.5% SDS, 10 mM 20 mM Tris Cl (pH 7.6), 10 mM EDTA for one hour at 37C, followed by phenol-chloroform extraction and ethanol precipitation. Recovered ~ W094/~028 PCT~S94/03454 2~S9~5~

oligonucleotides were then analyzed by PAGE (20 polyacrylamide/7 M urea) followed by autoradiography.
Radioactivity was also measure from cage rinse to account for urine spill.
Twenty-four hours after dosing, about 30% of oligonucleoside phosphorothioates were excreted, whether capped or uncapped. Excreted uncapped and 5'-capped oligonucleoside phosphorothioates were extensively degraded, as shown in Figure 5. Excreted 3'-capped and 3',5'-capped o oligonucleoside phosphorothioates, in contrast, demonstrated virtually no degradation. This indicates that n vivo degradation of oligonucleoside phosphorothioates excreted in urine is mediated by 3'-exonuclease ackivity which can be inhibited by adding a cap to the 3' hydroxyl group of the oligonucleotide.

Nuclea~e Resistance Of Self-Stabilized Oliqonucleotide Phoshodiesters The control oligonucleotide used for this study was an 0 oligodeoxynucleotide phosphodiester without a self-complementary region. The test compound was identical, except that it had a 3' self complementary region of 10 nucleotides.
To control for any size effects, another control ; oligodeoxynucleotide phosphodiester was used that was W094l~028 PCT~S94/03454 ~,~.S935 identical to the first control oligonucleotide except for having at its 3' end 10 mismatched nucleotides (Tlo).
The oligonucleotides were tested for their relative resi~tance to 3' exonucleolytic degradation. For each oligonucleotide, 0.4 A~o units of oligonucleotide was lyophilized, dissolved in 0.5 ml buffer (10 mM Tris, 10 mM
MgCl2, pH 8.5) and mixed with S ~1 (1.5 milliunits) of snake venom phosphodiesterase (SVPD). The mixture was incubated at 37 C in a thermally regulated cell and A260 was plotted against time. Oligonucleotide degradation was measured as function of increase in hyperchromicity.
The results of these experiments are shown in Table V, below. These results demonstrate that self-stabilized olignoucleotide phosphodiesters according to the invention are far more resistant to 3' exonucleotlytic degradation than either oligonucleotide phosphodiesters or oligonucleotide phosphodiesters having a non-complementary tail.
In addition to the testing described above, the oligonucleotides were also subjected to DNA Polymerase I 3'-exonuclease digestion. As shown in Figure 6 the non-self-stabilized oligonucleotides were digested to completion in 30 minutes, whereas the self-stabilized oligonucleotide with a 10 nucleotide self-complementary region was only partly digested over 30 minutes.

W094/~028 21~ 9 3 ~ PCT~S94/03454 TABLE V
SVPD Half-T~fe Of Oligonucleotides - Supplementary Reaion Half-Life For SVPD
Diqestion Absent 75 seconds 10 nucleotides 950 seconds mismatched75 seconds Nuclease Re~istance of Self-Stabilized Oligonucleotide Phosphorothioates To test the relative nuclease resistance of self-stabilized and non-self-stabilized oligonucleotide phosphorothioates, a DNA Polymerase I 3'-exonuclease activity assay was used, because of the slow degradation of oligonucleotide phosphorothioates by SVPD.
All oligonucleotides were labelled at the 5-end with gamma-S2P-ATp and k; n~D . To a solution of 40 pmole 5'-labelled oligonucleotide in 20 ~1 buffer (40 mM Tris HCl, pH
8.0, 10 mM MgCl2, 5 mM DTT, 50 mM KCl, 50 ~g/ml BSA), 5 units DNA
polymerase I was added and incubated at 37 C. Ali~uots of 4 ~1 were taken at 0, 30, 60, 120 minutes and were mixed with 6 ~1 stop solution (98% formamide, 10 mM EDTA, 0.1% xylene cyanol, 0.1% bromophenol blue). The samples were analyzed by 15% acrylamide gel (urea) and autoradiography.

W094/~028 PCT~S94/03454 . ~ , 2~93~Q

The results are shown in Figure 7. Oligonucleotide phosphorothioates having no self-complementary region or only mismatched nucleotides (Tlo) at the 3' end (as described in Example 8 for oligonucleotide phosphodiesters) were digested to almost 50% within 4 hours. The oligonucleotide phosphorothioate having a 10 nucleotide self-complementary region was undegraded after 4 hours. Oligonucleotide phosphorothioates having 6 or 4 nucleotide self-complementary regions were also found to be stable. These results demonstrate that self-stabilized oligonucleotide phosphorothioates are far more resistant to nucleolytic degradation than are non-self-stabilized oligonucleotide phosphorothioates.

EXAMPLE lO
Anti-Influenza Activity Of Modified Oligonucleotides MDCK canine kidney cells were seeded in Minimum Essential Medium (MEM) with non-escential amino acids (GIBCO BRL, Grand Island, New York) with 5% fetal bovine serum (Hyclone Laboratories, Logen, Utah), 0.1~ NaHCO3, at a concentration of 4 x 105 cells/ml in 96 well tissue culture plates (Corning, Corning, New York) at 0.2 ml/well. The cells were incubated overnight to establish monolayers of cells. Growth medium was then removed and 0.1 ml of oligonucleotide at pre-selected concentrations in serum-free MEM con~; n; ng 0.18% NaHCO3 and W094/~028 21~ 9 3 ~ ~ PCT~S94/03454 L ;
.. ~' ' '! .

50 ~g/ml gentamycin. This was done for each compound for each of 4 wells: 1 well as toxicity control and 3 wells as anti-- viral tests. Three cell control wells and six virus control wells received 0.1 ml of serum-free MEM cont~;n;ng 0.18~
NaHC08 and 50 ~g/ml gentamycin. Within 10 minutes of addition of the oligonucleotide compounds, influenza A/NWS/33(HlNl) virus was added to each test well and virus control well in 0.1 ml MEM cont~;n;ng 0.18% NaHC0s, 20 ~g/ml trypsin, 2 ~g/ml EDTA and 50 ~g/ml gentamycin. Cell control and toxicity control wells received 0.1 ml of this same medium without virus.
Plates were incubated at 37 C in a humidified incubator with 5% C02, 95% air atmosphere. The cells were examined by microscopic observation for evidence of virus-specific cytopathic effect (CPE) and for morphological changes due to compound effect in non-infected toxicity controls. Virus CPE
was graded on a scale of 0-4, with 4 being 95-100~ CPE. The effective dose, 50% endpoint (ED60) was calculated by regression analysis of the mean CPE grade at each concentration of the co~ Gund where activity was seen to bracket the CPE grade that was 50% of that seen in the virus controls. Visible changes in the morphology of cells in toxicity control wells were graded by microscopic observation, ; using a scale from no toxicity (0%) to complete destruction of the cells (100%) in 20% increments. The cytotoxic dose, 50%

W094/~028 PCT~S94/03454 a l59350 -t -endpoint (CD~o) was calculated by regression analysis of those toxicity grades bracketing the 50% endpoint, compared to the ~o~centrations of compound used for those toxicity grades. A
therapeutic index (TI) was calculated for each compound using the formula TI CD5~ED~o. These results are shown in Table VI, below.

TABLE VI
Anti-Influenza ActivitY Of Modified Oligonucleotides CMPD ~ q~ml) CD~ ~ a/ml) TI
A Not Tested B 34.3 147 4.3 C 55 562 lO

E Not Tested F 178 261 1.5 G 147 649 4.4 H 59 562 9.5 J 175 750 4.3 M 23.7 383 16 Control1 440 422 <l.O

Control is oligodeoxynucleotide phosphorothioate having the sequence 5' CAGAG~ TcAT~r-~r-~ 3'.

These results demonstrate that all of the preferred structural features of anti-influenza modified W094l~028 PCT~S94/03454 21593S~

oligonucleotides according to the invention, i.e., chimeric, hybrid, capped and self-stabilized features, are capable of improving the efficacy of antisense oligonucleotides in inhibiting influenza virus replication or propagation. These results further suggest that combinations of such structural features within an ant~^n~e oligonucleotide should have even greater efficacy.

Inhibition Of Various Strains Of Influenza Virus By Anti-influenza Modified Oliqonucleotides To test whether anti-fluenza modified oligonucleotides according to the invention can inhibit other strains of influenza virus, the experiment described in Example 10 was repeated, using compound M against various influenza strains.
The influenza strains chosen for this study were the HlNl strains A/NWS/33 and A/PR/8/34, the H3N2 strains A/Washington/897/80, A/Victoria/3/75 andA/Port Chalmers/1/73, and the H2N2 strain A2/Japan/305/57. The results were calculated as described in Example 10, and are shown in Table VII below.

W094/~028 PCT~S94/03454 ~1~93SO

TABLE VII
~ffect O~ Com~ound M On Various Strains of Influenza TnfluenZa strain ~n~ a~ml) CD~Q ~a~ml) TI
A/NWS/33 7.6 >100 >13 A/PR/8/34 >100 >100 ?
A2/Japan/305/57 61 >100 >1.6 A/Washington/897/80 6 >100 17 A/Victoria/3/75 6.2 >100 >16 A/Port Chalmers/1/73 >100 >100 ?

According to these results, compound M showed great efficacy in inhibiting three of the six strains of influenza tested and had some efficacy against a fourth strain. These results demonstrate that anti-influenza modified oligonucleotides according to the invention can be effective against multiple strains of influenza virus. To maximize the breadth of cross-strain efficacy, nucleotide se~nc~ of various genes from several different influenza viruses can be compared and the most conserved nucleotide se~lenc~C can be used to prepare inhibitory oligonucleotides.

WO 94/23028 21~ ~ 3 S O PCT/US94/03454 SEQUENCE LISTING

( 1 ) ~N~RAT- INFORMATION:
(i) APPLICANT: HYBRIDON, INC.
- (ii) TITLE OF lNv~l~lION: Novel Anti-Influenza Oligonucleotide~
tiii) NUMBER OF ~U~N~S: 37 (iv) CORRESPONDENCE ADDRESS:
'A' AnD~cs~: Allegretti & Witcoff, Ltd.
Bl STREET: Ten South Wacker Drive C, CITY: Chicago ,D STATE: Illinoi~
~E COUhl~Y: U. S.A.
FJ ZIP: 60606 (v) COMPUTER READABLE FORM:
(A'l MEDIUM TYPE: Floppy di~k B~ COMPUTER: IBM PC compatible C, OPERATING SYSTEM: PC-DOS/MS-DOS
DJ SOFTWARE: PatentIn Release #1.0, Ver~ion #1.25 (vi) ~UK~hl APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION:
(viii) All~Y/AGENT INFORMATION:
(A) NAME: Michael S. Greenfield (B) REGISTRATION NUMBER: 37,142 (C) k~K~CE/DOCKET NUMBER: 93,161-A
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 312/715-1000 (B) TELEFAX: 617/715-1234 (2) INFORMATION FOR SEQ ID NO:l:
(i) SEQUENCE CHARACTERISTICS:
~A' LENGTH: 2149 base pair~
B TYPE: nucleic acid C, STRANDEDNESS: ~ingle ,DI TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOL~h ICAL: NO
(iv) ANTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:

CCAGCACAAA ATGCTATAAG CACAACTTTC CCTTATACTG ~ ~CCTCC TTACAGCCAT 120 GGGACAGGAA CAG~-~AC~C CATGGATACT GTCAACAGGA CACATCAGTA CT~-~GG 180 SUBSTITUTE SHEET (RULE 26) WO 94/23028 , PCT/US94/03454 ~5 ~

Gr~AArATGGA rAAr7~AAC~C CGAAACTGGA GCACCGCAAC Tr-AArccr-AT TGATGGGCCA 240 CTGCCA~-AAG ACAATGAACC AAGTGGTTAT GCC~PAA~AG Al~ ATT GGAAGCA~TG 300 GC~l lC~L lG AGGAATCCCA TCCTGGTATC TTTGAGACCT C~l~l~llGA AACGATGGAG 360 ~ AGC AAArArr-Ar-T GGACAAGCTG ArA~AAr,GCC ~-A~Ar-ACCTA TGACTGGACT 420 cTAAATAr7GA ACCAGCCTGC TGCAACAGCA TTGGCCAACA rAATA~AAr-T GTTCAGATCA 480 AATGGCCTCA CGGCCAATGA ATCCGGAAGG CTr-AT~r-ACT TCCTTAAGGA TGTAATGGAG 540 TCAATGAACA AA~,AArAAAT GGAGATCACA ACTCATTTTC AGAr~AAArA~, ACGAGTGAGA 600 rA~AATATGA cTAAr-AAAAT GGTr-A~ArAr- ArAA~AATAr, GTAAPAGGAA G~AGAr-ATTG 660 AArAAAAr~7GA GTTATCTAAT TAGGGCATTG ACCCTGAACA CAATGACCAA AGATGCTGAG 720 AGAGGGAAGC TAAAACGGAG AGCAATTGCA ACCCCAGGGA TGrAAATAAG GGG~7111~71A 780 TA~lll~l-G AGACACTAGC AAGGAGTATA TGTGAGAAAC TTr-AA~AATC AGGATTGCCA 840 GTTGGAGGCA AT~ -AAr-AA AGCAAAGTTG GCAAATGTTG TAAGGAAGAT GATGArrAAT 900 TCTCAGGACA CTGAAATTTC TTTCACATCA CTGr-Ar-ATAA ~AAATGG AACGAAAATC 960 ArAACCCTCG GAl~lllllG GCCATGATCA r.pTATATAAc ~A~-AAATCAG CCCr-AATGGT 1020 T~A~-AAATGT TCTAAGTATT GCTC~AATAA ~ ~l`AAA CAAAATGGCG AGACTGGGAA 1080 AGGGGTACAT GTTTGAGAGC AAGAGTATTA AAATTAGAAC TrAAATACCT G~Ar-AAATGC 1140 TAGCAAGCAT CGATTTGAAA TACTTCAATG ATTCAACTAG AAAr-AA~ATT r-AAAAAATCC 1200 GGCCGCTCTT AATArATGGG ACTGCATCAT TGAGCCCTGG AATGATGATG GGCATGTTCA 1260 ATATGTTAAG TACTGTATTA GGC~,l~lC~A TCCTGAATCT TGr-~rAA~r- A~,ArAr~rrA 1320 AGACTACTTA CTGGTGGC,AT G~l~AAT ~ll~lGATGA TTTTGCTCTG ATTGTCAATG 1380 ~ACC~AATCA TGAAGGGATT CAAGCCGGAG TCAACAGGTT TTATCGAACC TGTAAGCTAC 1440 TTGGAATTAA TATGAGCAAG AAAAAGTCTT ArATAAA~A~, AACAGGTACA TTTGAATTCA 1500 CAA~ l"L CTATCGTTAT GG~~ G CCAATTTCAG CATGGAGCTT CCCAGCTTTG 1560 GG~l~l~G GATrAAcr-A~r7 TCTGCGGACA TGAGTATTGG AGTTACTGTC ATrA~AArA 1620 ATATGATAAA CAATGATCTT GGTCCAGCAA CCGCTCAAAT GGcc~ll~AG ~llCATCA 1680 AAGATTACAG GTACACGTAC CGCTGCCATA GAGGTGACAC AcA~ATArAA P~CC~-AAGAT 1740 CATTTGAAAT AAA~-AAArTG TGGGAGCAAA CCCATTCCAA AGCTGGACTG CTG~ CCG 1800 GGGAATTAAT GGATGAGGAT TACCAGGGGC GTTTATGCAA CCCACTGAAC CCA~ll~l~A 1920 AC~TAAA~,A CATTGAATCA GTr-AArA~TG CAGTGATAAT GCCAGCACAT GGTCCAGCCA 1980 pAAArA~TGGA GTATGATGCT GTTGCAACAA CACACTCCTG GATcccr-AAA AGAAATCGAT 2040 SUBSTITUTE SHEET (RULE 26) ~ wo 94,23028 2 1 ~ 9 3 5 0 PCT/US94/034S4 GCAACTTATT T~.AAPAATTC lCCC~AGCA GTTr-P~r-AG ~ Cr~GT 2149 (2) INFORMATION FOR SEQ ID NO:2:
(i) ~u~:~ CHARACTERISTICS:
'A' LENGTH: 21 base pairs B TYPE: nucleic acid ,C STR~NDEDNESS: single D, TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~O~ lCAL: NO
(iv) ANTI-SENSE: YES
(Xi) ~U~N~ DESCRIPTION: SEQ ID NO:2:
CAGAGCAA~A TCATCAGAAG A 21 (2) INFORMATION FOR SEQ ID NO:3:
(i) ~Q~:N~ CHARACTERISTICS:
,A~I LENGTH: 21 base pair~
B TYPE: nucleic acid C, STRANDEDNESS: single ,DJ TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) ( iii ) ~Y ~OL~ llCAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:

CAGAGCAA~A TCATCAGAAG A 21 (2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A'l LENGTH: 21 ba~e pairs (Bl TYPE: nucleic acid (C STRANDEDNESS: single (D,, TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) ( iii) ~Y~ ~ ~h ~ lCAL: NO
(iv) ANTI-SENSE: YES

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:

SUBSTITUTE SHEET ~RULE 26) W094/~028 PCT~S94/03454 ~

2~5~35~

(2) lN~O~ ~TION FOR SEQ ID NO:3:
(i) SEQUENCE C~RACTERISTICS:
(A' LENGTH: 21 base pairs (B TYPE: nucleic acid (C STRAN~ N~:~S: single (D, TOPOLOGY: ~inear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~O~ CAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:

CAGAGCAAAA TCAT~.A~ A 21 (2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE ~AR~CTERISTICS:
(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRAN~ S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~Ol~:llCAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
CAGAGCAAAA TCATrA~ G A 21 (2) lN~O~ ~TION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) ~ W094/23028 PCT~S94/03454 21~93~0 (iii) ~Y~O~ CAL: NO
(iv) ANTI-SENSE: YES
- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:

CAGAGCAAAA TCAT~G~C7 A 21 (2) INFORMATION FOR SEQ ID NO:6:
Q~CE CHARACTERISTICS:
(A' LENGTH: 21 base pairs (B TYPE: nucleic acid (C STRANn~nN~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: YES
(xi) S~Qu~CE DESCRIPTION: SEQ ID NO:6:
CAGAGCAAAA TCAT~ G A 21 (2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A' LENGTH: 21 base pairs (B TYPE: nucleic acid (C STRAN~ h~:~S: single (D, TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~Ol~llCAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
CAGAGCAAAA TCAT~ G A 21 W094/~028 PCT~S94/03454 215~5~

(2) lNrO~MATION FOR SEQ ID NO:8:
ti) SEQUENCE CHARACTERISTICS:
'A' LENGTH: 21 base pairs B TYPE: nucleic acid C STRAN~ h~:~S: single ~D, TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
CAGAGCAAAA TCAT~Ar-~G A 21 (2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE r~RACTERISTICS:
(A' LENGTH: 21 base pairs (B TYPE: nucleic acid (C STRAh~ l iN~:SS: S ingle (D, TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~Ol~llCAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:
CAGAGCAAAA TCATr~ G A 21 (2) lNrOKNATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) ~ W094l~028 PCT~S94/03454 21593~0 (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: YES
txi) ~Qu~NCE DESCRIPTION: SEQ ID NO:10:
CAGAGCAAAA TCATr~ G A 21 (2) INFORMATION FOR SEQ ID NO:ll:
(i) SEQUENCE C~AR~CTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRA~ S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Ol~EllCAL: NO
(iv) ANTI-SENSE: YES

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:ll:
AGAGr~AT CATr,~ 19 (2) INFORMATION FOR SEQ ID NO:12:
(i) SEQUENCE r~CTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANv~vN~:SS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:
AGAGr~A~ CAT~A~ G 19 W094/~028 PCT~S94/03454 2~5935~
.; . ~

(2) lN~O~ATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS:
(A' LENGTH: 17 base pairs (B TYPE: nucleic acid (C STRANDEDNESS: single (D~ TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~Oln~llCAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:
GAGr~ ~C ATCAGAA 17 (2) INFORMATION FOR SEQ ID NO:14:
(i) SEQUENCE ~AR~CTERISTICS:
(A' LENGTH: 17 base pairs (B TYPE: nucleic acid (C STRANn~nN~S: single (D, TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) nYW~l~n~ lCAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:
GAG~AAAA~C ATCAGAA 17 (2) INFORMATION FOR SEQ ID NO:15:
(i) SEQUENCE CHARACTERISTICS:
(A' LENGTH: 21 base pairs (B TYPE: nucleic acid (C sTRANn~n~ s: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) ~ W094l23028 ~~ PCT~S94/03454 2~59350`

(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: YES
(xi) S~Qu~NCE DESCRIPTION: SEQ ID NO:15:
CAGAGCAA~ TCAT~A~G A 21 (2) INFORMATION FOR SEQ ID NO:16:
(i) SEQUENCE C~ARACTERISTICS:
(A' LENGTH: 30 base pairs (B TYPE: nucleic acid (C STRA~ N~:~S: single (D, TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~O~ CAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:
CAGAGCAAAA TCATr~r-~G ATTCTGATGA 30 (2) lN~OKMATION FOR SEQ ID NO:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRA~v~vN~:SS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~Ol~:llCAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:
CTTTCCATAT T~-A~A~A~ 20 W094/~028 PCT~S94/03454 z~93~

(2) INFORMATION FOR SEQ ID NO:18:
(i) SEQUENCE CHARACTERISTICS:
(A' LENGTH: 20 base pairs (B TYPE: nucleic acid (C STRAN~ S: single (D, TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~Oln~llCAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:

(2) lNrO~MATION FOR SEQ ID NO:l9:
(i) SEQUENCE CHARACTERISTICS:
(A' LENGTH: 20 base pairs (B TYPE: nucleic acid (C STRANI~ Nl~ S: single (D, TOPOLOGY: linear tii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~Ol~llCAL: NO
(iv) ANTI-SENSE: YES

(xi) S~Q~CE DESCRIPTION: SEQ ID NO:l9:

(2) INFORMATION FOR SEQ ID NO:20:
(i) SEQUENCE C~ARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear W094/23028 PCT~S94/03454 21~350 (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~Oln~ CAL: YES
(iv) ANTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:
G~ll~ATTT TG~l~ 20 (2) lN ~O~IATION FOR SEQ ID NO:21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRAN~ N~:~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOln~llCAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:

(2) INFORMATION FOR SEQ ID NO:22:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRAN~ S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:

W094/~028 PCT~S94/03454 ~

21~935~

t2) lN~ ~TION FOR SEQ ID NO:23:
(i) S~Qu~N-CE CHARACTERISTICS:
(A' LENGTH: 20 base pairs (B TYPE: nucleic acid (C STRAN~ r: I )h ~:S IS: single (D, TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) nY~Oln~llCAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:
AGACTCATCT TTr~AT~CT 20 (2) lN~ ATION FOR SEQ ID NO:24:
(i) SEQUENCE CHARACTERISTICS:
(A' LENGTH: 20 base pairs (B TYPE: nucleic acid (C STRANv~ N~:~S: single (DJ TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) nY~Ol~llCAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:
rA~r.~ ACGTACGTTT 20 (2) lN~o~ATIoN FOR SEQ ID NO:25:
(i) SEQUENCE ~ARAcTERIsTIcs:
(A' LENGTH: 20 base pairs (B TYPE: nucleic acid (C STRANI~ N~ S: single (D, TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) W094/23028 PCT~S94/03454 21~93~
, (iii) ~Y~O~ CAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:

(2) lNrO~lATION FOR SEQ ID NO:26:
(i) SEQUENCE C~A~CTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRA~v~vh~:SS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~Ol~llCAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:
GGATCCATTA TGT~~ C 20 (2) INFORMATION FOR SEQ ID NO:27:
(i) SEQUENCE r~R~CTERISTICS:
(A) L N~l~n: 20 base pairs tB) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~Ol~llCAL: NO
(iv) ANTI-SENSE: YES

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:

W094/~028 PCT~S94103454 215~35~

(2) lN~O~IATION FOR SEQ ID NO:28:
(i) SEQUENCE CU~R~CTERISTICS:
(A' LENGTH: 20 base pairs (B TYPE: nucleic acid (C STRAh~ N~ S: single (D~ TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~Oln~llCAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:

(2) 1N~O~5ATION FOR SEQ ID NO:29:
(i) SEQUENCE CHARACTERISTICS:
'A' LENGTH: 20 base pairs B TYPE: nucleic acid C STRANDEDNESS: single ,D, TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~Ol~llCAL: NO
~ ) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:
AGCAGTATGT CcT~rr~r-Arr 20 (2) INFORMATION FOR SEQ ID NO:30:
(i) SEQUENCE ~AR~CTERISTICS:
(A' LENGTH: 20 base pairs (B TYPE: nucleic acid (C STRANDEDNESS: single (D, TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) ~ W094/23028 PCT~S94/03454 3~`

(iii) ~Y~O~ CAL: NO
(iv) ANTI-SENSE: YES
(xi) ~Qu~:NCE DESCRIPTION: SEQ ID NO:30:
~ C~-~CCT TGTTTCTACT 20 (2) lN~OKMATION FOR SEQ ID NO:31:
(i) SEQUENCE CHARACTERISTICS:
(A' LENGTH: 20 base pairs (B TYPE: nucleic acid (C STRANn~nN~.~S: single (D~ TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~Ol~llCAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:
~ TGCCT TGTTCCTACT 20 (2) INFORMATION FOR SEQ ID NO:32:
(i) SEQUENCE CHARACTERISTICS:
(A' LENGTH: 20 base pairs (B TYPE: nucleic acid (C STRAN~ S: single (D, TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~O~ lCAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:

W094/~028 PCT~S94/03454 "

~5935~

(2) INFORM~TION FOR SEQ ID NO:33:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pair (B) TYPE: nucleic acid (C) STRAN~ N~ S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~O~ CAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:
AA~ cccT l~~ ACT 20 (2) lN~OKMATION FOR SEQ ID NO:34:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~Ol~llCAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:
AAAA~ArccT TGTTTCTACT 20 (2) INFORMATION FOR SEQ ID NO:35:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANv~N~SS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) W094/23028 PCT~S94/03454 2159~
.

ss (iii) nY~O~ CAL: NO
(iv) ANTI-SENSE: YES

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:35:
~A~CTCCT TGTTTCTACT 20 (2) INFORMATION FOR SEQ ID NO:36:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B' TYPE: nucleic acid (C STRA~ h~:~S: single (D, TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) ~Y~Ol~llCAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:
~ACTACCT TGTTTCTACT 20 (2) INFORMATION FOR SEQ ID NO:37:
(i) SEQUENCE ~CTERISTICS:
(A' LENGTH: 20 base pairs (B TYPE: nucleic acid (C STRA~ :l )N~:~S: single (D, TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:

Claims (46)

1. An anti-influenza modified oligonucleotide comprising a nucleotide sequence that is complementary to an essential nucleic acid sequence of influenza virus, wherein the oligonucleotide is a mixed backbone chimeric oligonucleotide comprising a phosphorothioate or phosphorodithioate region and an alkylphosphonate region.
2. The oligonucleotide according to claim 1, wherein an alkylphosphonate region is at or near the 5' or 3' end of the oligonucleotide.
3. The oligonucleotide according to claim 1, wherein an alkylphosphonate region comprises from about 2 to about 10 contiguous nucleotides connected by alkylphosphonate linkages.
4. The oligonucleotide according to claim 2, wherein an alkylphosphonate region comprises from about 2 to about 10 contiguous nucleotides connected by alkylphosphonate linkages.
5. The oligonucleotide according to claim 1, wherein a phosphorothioate or phosphorodithioate region comprises from about 3 to about 100 contiguous nucleotides connected by phosphorothioate or phosphorodithioate linkages.
6. The oligonucleotide according to claim 2, wherein a phosphorothioate or phosphorodithioate region comprises from about 3 to about 100 contiguous nucleotides connected by phosphorothioate or phosphorodithioate linkages.
7. The oligonucleotide according to claim 3, wherein a phosphorothioate or phosphorodithioate region comprises from about 3 to about 100 contiguous nucleotides connected by phosphorothioate or phosphorodithioate linkages.
8. The oligonucleotide according to claim 4, wherein a phosphorothioate or phosphorodithioate region comprises from about 3 to about 100 contiguous nucleotides connected by phosphorothioate or phosphorodithioate linkages.
9. An anti-influenza modified oligonucleotide comprising a nucleotide equence that is complementary to an essential nucleic acid sequence of influenza virus, wherein the oligonucleotide is a mixed backbone chimeric oligonucleotide comprising a phosphorothioate or phosphorodithioate region and an alkylphosphonothioate region.
10. The oligonucleotide according to claim 10, wherein an alkylphosphonothioate region is at or near the 5' or 3' end of the oligonucleotide.
11. The oligonucleotide according to claim 9, wherein an alkylphosphonothioate region comprises from about 2 to about 10 contiguous nucleotides connected by alkylphosphonothioate linkages.
12. The oligonucleotide according to claim 10, wherein an alkylphosphonothioate region comprises from about 2 to about 10 contiguous nucleotides connected by alkylphosphonothioate linkages.
13. The oligonucleotide according to claim 9, wherein a phosphorothioate or phosphorodithioate region comprises from about 3 to about 100 contiguous nucleotides connected by phosphorothioate or phosphorodithioate linkages.
14. The oligonucleotide according to claim 10, wherein a phosphorothioate or phosphorodithioate region comprises from about 3 to about 100 contiguous nucleotides connected by phosphorothioate or phosphorodithioate linkages.
15. The oligonucleotide according to claim 11, wherein a phosphorothioate or phosphorodithioate region comprises from about 3 to about 100 contiguous nucleotides connected by phosphorothioate or phosphorodithioate linkages.
16. The oligonucleotide according to claim 12, wherein a phosphorothioate or phosphorodithioate region comprises from about 3 to about 100 contiguous nucleotides connected by phosphorothioate or phosphorodithioate linkages.
17. An anti-influenza modified oligonucleotide comprising a nucleotide sequence that is complementary to an essential nucleic acid sequence of influenza virus, wherein the oligonucleotide is a hybrid oligonucleotide comprising a deoxyribonucleotide region and a ribonucleotide region.
18. The oligonucleotide according to claim 17, further comprising from about 1 to about all phosphorothioate or phosphorodithioate internucleotide linkages.
19. The oligonucleotide according to claim 17, wherein a ribonucleotide region is at or near the 5' or 3' end of the oligonucleotide.
20. The oligonucleotide according to claim 17, wherein a ribonucleotide region comprises from about 2 to about 100 contiguous ribonucleotides.
21. The oligonucleotide according to claim 18, wherein a ribonucleotide region comprises from about 2 to about 100 contiguous ribonucleotides.
22. The oligonucleotide according to claim 19, wherein a ribonucleotide region comprises from about 2 to about 100 contiguous ribonucleotide
23. The oligonucleotide according to claim 17, wherein a deoxyribonucleotide region comprises from about 0 to about 100 deoxyribonucleotides.
24. The oligonucleotide according to claim 18, wherein a deoxyribonucleotide region comprises from about 0 to about 100 deoxyribonucleotides.
25. The oligonucleotide according to claim 19, wherein a deoxyribonucleotide region comprises from about 0 to about 100 deoxyribonucleotides.
26. The oligonucleotide according to claim 20, wherein a deoxyribonucleotide region comprises from about 0 to about 100 deoxyribonucleotides.
27. The oligonucleotide according to claim 21, wherein a deoxyribonucleotide region comprises from about 0 to about 100 deoxyribonucleotides.
28. The oligonucleotide according to claim 22, wherein a deoxyribonucleotide region comprises from about 0 to about 100 deoxyribonucleotides.
29. An anti-influenza modified oligonucleotide comprising a nucleotide sequence that is complementary to an essential nucleic acid sequence of influenza virus, wherein the oligonucleotide has at its 5' and/or 3' end a nuclease resistance conferring cap structure selected from the group consisting of the cap structures shown in Figure 4 and lower alkyl (C1-C12) or alcohol groups, and wherein the oligonucleotide has from 1 to about all modified internucleotide linkages selected from the group consisting of phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate, bridged phosphorothioate, sulfone, phosphorothioate and phosphorodithioate linkages.
30. An anti-influenza modified oligonucleotide comprising an anti-influenza hybridizing region and a self-complementary region.
31. The oligonucleotide according to claim 30, wherein the influenza hybridizing region comprises from about 6 to about 100 nucleotides that are complementary to an essential nucleic acid sequence of influenza virus.
32. The oligonucleotide according to claim 30, wherein the self-complementary region comprises from about 4 to about 50 nucleotides that form intramolecular base pairs.
33. The oligonucleotide according to claim 30, wherein a self-complementary region is at or near the 5' or 3' end of the oligonucleotide.
34. The oligonucleotide according to claim 31, wherein a self-complementary region is at or near the 5' or 3' end of the oligonucleotide.
35. The oligonucleotide according to claim 32, wherein a self-complementary region is at or near the 5' or 3' end of the oligonucleotide.
36. The oligonucleotide according to claim 30, wherein from about 2 to about all nucleotides are coupled by phosphorothioate and/or phosphorodithioate internucleotide linkages.
37. The oligonucleotide according to claim 31, wherein from about 2 to about all nucleotides are coupled by phosphorothioate and/or phosphorodithioate internucleotide linkages.
38. The oligonucleotide according to claim 32, wherein from about 2 to about all nucleotides are coupled by phosphorothioate and/or phosphorodithioate internucleotide linkages.
39. The oligonucleotide according to claim 33, wherein from about 2 to about all nucleotides are coupled by phosphorothioate and/or phosphorodithioate internucleotide linkages.
40. The oligonucleotide according to claim 34, wherein from about 2 to about all nucleotides are coupled by phosphorothioate and/or phosphorodithioate internucleotide linkages.
41. The oligonucleotide according to claim 35, wherein from about 2 to about all nucleotides are coupled by phosphorothioate and/or phosphorodithioate internucleotide linkages.
42. The oligonucleotide according to claim 1, wherein the essential nucleic acid sequence is selected from the group consisting of influenza polymerase 3 gene, influenza polymerase 1 gene, influenza polymerase 2 gene, influenza hemaglutin gene, influenza nucleoprotein gene, influenza neuraminidase gene, influenza matrix protein gene, influenza left or right splice junctions of segments 7 or 8, influenza splice branch of segment 8 and influenza packaging sequences of segment 1, 2, 3, 4, 5, 6, 7 or 8.
43. The oligonucleotide according to claim 9, wherein the essential nucleic acid sequence is selected from the group consisting of influenza polymerase 3 gene, influenza polymerase 1 gene, influenza polymerase 2 gene, influenza hemaglutin gene, influenza nucleoprotein gene, influenza neuraminidase gene, influenza matrix protein gene, influenza left or right splice junctions of segments 7 or 8, influenza splice branch of segment 8 and influenza packaging sequences of segment 1, 2, 3, 4, 5, 6, 7 or 8.
44. The oligonucleotide according to claim 17, wherein the essential nucleic acid sequence is selected from the group consisting of influenza polymerase 3 gene, influenza polymerase 1 gene, influenza polymerase 2 gene, influenza hemaglutin gene, influenza nucleoprotein gene, influenza neuraminidase gene, influenza matrix protein gene, influenza left or right splice junctions of segments 7 or 8, influenza splice branch of segment 8 and influenza packaging sequences of segment 1, 2, 3, 4, 5, 6, 7 or 8.
45. The oligonucleotide according to claim 29, wherein the essential nucleic acid sequence is selected from the group consisting of influenza polymerase 3 gene, influenza polymerase 1 gene, influenza polymerase 2 gene, influenza hemaglutin gene, influenza nucleoprotein gene, influenza neuraminidase gene, influenza matrix protein gene, influenza left or right splice junctions of segments 7 or 8, influenza splice branch of segment 8 and influenza packaging sequences of segment 1, 2, 3, 4, 5, 6, 7 or 8.
46. The oligonucleotide according to claim 31, wherein the essential nucleic acid sequence is selected from the group consisting of influenza polymerase 3 gene, influenza polymerase 1 gene, influenza polymerase 2 gene, influenza hemaglutin gene, influenza nucleoprotein gene, influenza neuraminidase gene, influenza matrix protein gene, influenza left or right splice junctions of segments 7 or 8, influenza splice branch of segment 8 and influenza packaging sequences of segment 1, 2, 3, 4, 5, 6, 7 or 8.
CA 2159350 1993-03-31 1994-03-30 Modified oligonucleotides having improved anti-influenza activity Abandoned CA2159350A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US4075293A true 1993-03-31 1993-03-31
US08/040,752 1993-03-31

Publications (1)

Publication Number Publication Date
CA2159350A1 true CA2159350A1 (en) 1994-10-13

Family

ID=21912738

Family Applications (1)

Application Number Title Priority Date Filing Date
CA 2159350 Abandoned CA2159350A1 (en) 1993-03-31 1994-03-30 Modified oligonucleotides having improved anti-influenza activity

Country Status (7)

Country Link
EP (1) EP0693123A1 (en)
JP (1) JPH08510900A (en)
CN (1) CN1124980A (en)
AU (1) AU6527094A (en)
CA (1) CA2159350A1 (en)
NZ (1) NZ263985A (en)
WO (1) WO1994023028A2 (en)

Families Citing this family (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100386337B1 (en) * 1993-12-09 2004-03-24 토마스 제퍼슨 대학교 Compounds and a method for the specific mutation-sites in eukaryotic cells
US6645943B1 (en) 1994-10-25 2003-11-11 Hybridon, Inc. Method of down-regulating gene expression
US6608035B1 (en) 1994-10-25 2003-08-19 Hybridon, Inc. Method of down-regulating gene expression
WO1996031600A1 (en) * 1995-04-03 1996-10-10 Hybridon, Inc. Method of modulating gene expression without depleting complement
WO1997038097A1 (en) * 1995-04-12 1997-10-16 Hybridon, Inc. Cooperative oligonucleotides
US6372427B1 (en) * 1995-04-12 2002-04-16 Hybridon, Inc. Cooperative oligonucleotides
GB9511720D0 (en) * 1995-06-09 1995-08-02 Isis Innovation Oligonucleotide phosphorylation method and products
US5652356A (en) * 1995-08-17 1997-07-29 Hybridon, Inc. Inverted chimeric and hybrid oligonucleotides
US5969117A (en) * 1995-08-17 1999-10-19 Hybridon, Inc. Modified protein kinase a-specific oligonucleotide
US6624293B1 (en) 1995-08-17 2003-09-23 Hybridon, Inc. Modified protein kinase A-specific oligonucleotides and methods of their use
US7074768B2 (en) 1995-08-17 2006-07-11 Idera Pharmaceuticals, Inc. Modified protein kinase A-specific oligonucleotides and methods of their use
US5886165A (en) * 1996-09-24 1999-03-23 Hybridon, Inc. Mixed backbone antisense oligonucleotides containing 2'-5'-ribonucleotide- and 3'-5'-deoxyribonucleotides segments
US6958239B2 (en) 1996-11-21 2005-10-25 Oligos Etc Inc. Three component chimeric antisense oligonucleotides
CA2283626A1 (en) * 1997-03-12 1998-09-17 Hybridon, Inc. Modified protein kinase a-specific oligonucleotides and methods of their use
GB9710044D0 (en) * 1997-05-16 1997-07-09 Innes John Centre Innov Ltd A plant disease resistance signalling gene: materials and methods relating thereto
CA2475003A1 (en) 2002-02-01 2003-08-07 Sequitur, Inc. Double-stranded oligonucleotides
US20060009409A1 (en) 2002-02-01 2006-01-12 Woolf Tod M Double-stranded oligonucleotides
WO2007053696A2 (en) 2005-11-01 2007-05-10 Alnylam Pharmaceuticals, Inc. Rnai inhibition of influenza virus replication
AU2009213147A1 (en) 2008-02-11 2009-08-20 Rxi Pharmaceuticals Corp. Modified RNAi polynucleotides and uses thereof
US8664189B2 (en) 2008-09-22 2014-03-04 Rxi Pharmaceuticals Corporation RNA interference in skin indications
WO2010059226A2 (en) 2008-11-19 2010-05-27 Rxi Pharmaceuticals Corporation Inhibition of map4k4 through rnai
WO2010078536A1 (en) 2009-01-05 2010-07-08 Rxi Pharmaceuticals Corporation Inhibition of pcsk9 through rnai
US9745574B2 (en) 2009-02-04 2017-08-29 Rxi Pharmaceuticals Corporation RNA duplexes with single stranded phosphorothioate nucleotide regions for additional functionality
CN103200945B (en) 2010-03-24 2016-07-06 雷克西制药公司 rna interference in ocular symptoms
CN103108642B (en) 2010-03-24 2015-09-23 雷克西制药公司 rna interference with skin fibrosis symptoms in
RU2615143C2 (en) 2010-03-24 2017-04-04 Адвирна Self-delivered rnai compounds of reduced size

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5194428A (en) * 1986-05-23 1993-03-16 Worcester Foundation For Experimental Biology Inhibition of influenza virus replication by oligonucleotide phosphorothioates
DE3907562A1 (en) * 1989-03-09 1990-09-13 Bayer Ag Antisense oligonucleotides for the inhibition of transaktivatorzielsequenz (tar) and the synthesis of the transactivator (tat) of the HIV-1 and the use thereof
US5149797A (en) * 1990-02-15 1992-09-22 The Worcester Foundation For Experimental Biology Method of site-specific alteration of rna and production of encoded polypeptides
BR9106747A (en) * 1990-08-14 1993-07-20 Isis Pharmaceuticals Inc Oligonucleotide or oligonucleotide analog and method for treating an animal suspected of being infected with influenza virus

Also Published As

Publication number Publication date
AU6527094A (en) 1994-10-24
EP0693123A1 (en) 1996-01-24
NZ263985A (en) 1997-07-27
WO1994023028A2 (en) 1994-10-13
JPH08510900A (en) 1996-11-19
CN1124980A (en) 1996-06-19
WO1994023028A3 (en) 1995-02-16

Similar Documents

Publication Publication Date Title
Giles et al. Increased specificity for antisense oligodeoxynucleotide targeting of RNA cleavage by RNase H using chimeric methylphosphonodiester/phosphodiester structures
US6214805B1 (en) RNase L activators and antisense oligonucleotides effective to treat RSV infections
US5998602A (en) RNase L activators and antisense oligonucleotides effective to treat RSV infections
US6028188A (en) Synthetic oligomers having chirally pure phosphonate internucleosidyl linkages mixed with non-phosphonate internucleosidyl linkages
AU2003290596B2 (en) Sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
Paolella et al. Nuclease resistant ribozymes with high catalytic activity.
CA2039718C (en) Chimeric dna-rna catalytic sequences
ES2376507T3 (en) An? Logos? Nucleic acid bic? Clicos 6-Disubstituted.
US6197944B1 (en) DNA molecules stabilized by modifications of the 3′-terminal phosphodiester linkage
US5585479A (en) Antisense oligonucleotides directed against human ELAM-I RNA
US6093555A (en) Amido and peptido modified enzymatic nucleic acid molecules
EP0653439B1 (en) Stabilized oligonucleotids and the use thereof
JP4383720B2 (en) Oligonucleotides n3 &#39;→ p5&#39; phosphoramidate Synthesis and compounds; hybridization and nuclease resistance properties
MacKellar et al. Synthesis and physical properties of anti-HIV antisense oligonucleotides bearing terminal lipophilic groups
AU731088B2 (en) Antisense inhibition of ras gene with chimeric and alternating oligonucleotides
US5545729A (en) Stabilized ribozyme analogs
US8530640B2 (en) Bicyclic cyclohexitol nucleic acid analogs
JP3131222B2 (en) 2 &#39;modified oligonucleotides having a gap
Shea et al. Synthesis, hybridization properties and antiviral activity of lipid-oligodeoxynucleotide conjugates
US5861501A (en) Capped synthetic RNA, analogs, and aptamers
US8993738B2 (en) Modified nucleosides, analogs thereof and oligomeric compounds prepared therefrom
EP0527906B1 (en) Inhibition of influenza virus replication by oligonucleotides
US6358931B1 (en) Compositions and methods for modulating RNA
EP0625192B1 (en) Nucleozymes
US20100190837A1 (en) 5&#39;-Substituted-2-F&#39; Modified Nucleosides and Oligomeric Compounds Prepared Therefrom

Legal Events

Date Code Title Description
FZDE Dead