WO1994011508A2 - Polypeptides presentant une specificite par rapport aux neoplasies, kit et procedes diagnostiques, therapeutiques et de vaccination - Google Patents

Polypeptides presentant une specificite par rapport aux neoplasies, kit et procedes diagnostiques, therapeutiques et de vaccination Download PDF

Info

Publication number
WO1994011508A2
WO1994011508A2 PCT/US1993/011316 US9311316W WO9411508A2 WO 1994011508 A2 WO1994011508 A2 WO 1994011508A2 US 9311316 W US9311316 W US 9311316W WO 9411508 A2 WO9411508 A2 WO 9411508A2
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
tumor
antibody
hybrid
human
Prior art date
Application number
PCT/US1993/011316
Other languages
English (en)
Other versions
WO1994011508A3 (fr
Original Assignee
Cancer Research Fund Of Contra Costa
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cancer Research Fund Of Contra Costa filed Critical Cancer Research Fund Of Contra Costa
Priority to AU56155/94A priority Critical patent/AU5615594A/en
Publication of WO1994011508A2 publication Critical patent/WO1994011508A2/fr
Publication of WO1994011508A3 publication Critical patent/WO1994011508A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/46—Hybrid immunoglobulins
    • C07K16/461—Igs containing Ig-regions, -domains or -residues form different species
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/6425—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent the peptide or protein in the drug conjugate being a receptor, e.g. CD4, a cell surface antigen, i.e. not a peptide ligand targeting the antigen, or a cell surface determinant, i.e. a part of the surface of a cell
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/646—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent the entire peptide or protein drug conjugate elicits an immune response, e.g. conjugate vaccines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6851—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a determinant of a tumour cell
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K51/00—Preparations containing radioactive substances for use in therapy or testing in vivo
    • A61K51/02—Preparations containing radioactive substances for use in therapy or testing in vivo characterised by the carrier, i.e. characterised by the agent or material covalently linked or complexing the radioactive nucleus
    • A61K51/04—Organic compounds
    • A61K51/08—Peptides, e.g. proteins, carriers being peptides, polyamino acids, proteins
    • A61K51/10—Antibodies or immunoglobulins; Fragments thereof, the carrier being an antibody, an immunoglobulin or a fragment thereof, e.g. a camelised human single domain antibody or the Fc fragment of an antibody
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/3015—Breast
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/46—Hybrid immunoglobulins
    • C07K16/461—Igs containing Ig-regions, -domains or -residues form different species
    • C07K16/462—Igs containing a variable region (Fv) from one specie and a constant region (Fc) from another
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/46—Hybrid immunoglobulins
    • C07K16/468—Immunoglobulins having two or more different antigen binding sites, e.g. multifunctional antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2123/00—Preparations for testing in vivo
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/34—Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues

Definitions

  • This invention relates to the diagnosis, immunization, and therapy 5 of neoplastic tumors of a subject of a first species, particularly carcinomas, by means of specifically targeted polypeptides comprising amino acid sequences encompassing, for instance, the variable (F v ) region of anti-tumor antibodies of a second species, among others.
  • This invention provides the polypeptides as a single amino acid chain or as paired chains having the specificity of an antibody's 1 0 F v regions of the light or heavy chains of the second species, either by themselves or bound to other polymers such as synthetic polymers, e.g., oligopeptides, resulting in chimeric antibodies, e.g., human/non-human chimeric antibodies, and other polymeric constructs.
  • the present polypeptides elicit a lesser immunological response in the subject treated, e.g. humans, than the 1 5 complete sequence of the heterologous non-human antibody.
  • the polypeptides of the invention are useful in the in vivo and in vitro diagnosis of neoplasias localized 20 in different organs as well as in their in vivo therapy.
  • the present polypeptides and anti-idiotype antibodies are also suitable for immunizing humans against neoplasias.
  • the polynucleotide sequences, hybrid vectors and transfected hosts are useful for preparing the polypeptides described herein.
  • Carcinomas result from the carcinogenic transformation of ceils of different epithelia. Two of the most damaging characteristics of carcinomas are their uncontrolled growth and their ability to create metastases in distant sites of the host, particularly a human host. It is usually these distant metastases that
  • the systemic therapies currently include, but not fully comprise, chemotherapy, different immunity-boosting 35 medicines and procedures, hyperthermia and systemic monoclonal antibody treatment.
  • the latter can be labeled with radioactive elements, immunotoxins
  • Radioactively labeled monoclonal antibodies were initially used with success in lymphomas and leukemia, and recently in some carcinomas.
  • the concept underlying the use of labeled antibodies is that the labeled antibody will specifically seek and bind to the carcinoma and, the radioactive element, through its decay, will irradiate the tumor in situ. Since radioactive rays travel some distance in tumors it is not necessary that every carcinoma cell bind the labeled antibody.
  • the specificity of the monoclonal antibodies will permit a selective treatment of the tumor while avoiding the irradiation of innocent by-stander normal tissues, that could be dose limiting. Chemotherapy produces serious toxic effects on normal tissues, making the chemotherapy of carcinomas less than desirable, and the use of radiolabeled monoclonal antibodies a valid alternative.
  • Non-human antibodies raised against human epitopes have been used for the diagnosis and therapy of carcinomas as is known in the art. Also known are the methods for preparing both polyclonal and monoclonal antibodies. Examples of the latter are BrE-2, BrE-3 and KC-4 (e.g., US patent Nos. 5,077,220;
  • the KC-4 murine monoclonal antibody is specific to a unique antigenic determinant, the "antigen", and selectively binds strongly to neoplastic carcinoma cells and not to normal human tissue (U.S. Patent No. 4,708,930 to Coulter).
  • the antigen appears in two forms in carcinoma cells, only the smaller of these forms being expressed in the cell membrane. The larger form appears only in the cytoplasm and has an approximate 490 Kdalton molecular weight (range of 480,000-510,000). The second form occurs at a higher density of expression, is found both in the cytoplasm and the membrane of carcinoma cells and has an approximate 438 Kdalton molecular weight (range of 390,000- 450,000) as determined by gel electrophoresis with marker proteins of known molecular weights. Labeled KC-4 was applied to the diagnosis and medical treatment of various carcinomas, particularly adenocarcinoma and squamous cell carcinoma regardless of the human organ site of origin.
  • the BrE-3 antibody (Peterson et al., Hybridoma 9:221 ( 1 990); US patent No. 5,075,21 9) was shown to bind to the tandem repeat of the polypeptide core of human breast epithelial mucin. When the mucin is deglycosylated, the presence of more tandem repeat epitopes is exposed and the binding of the antibody increases. Thus, antibodies such as BrE-3 bind preferentially to neoplastic carcinoma tumors because these express an unglycosylated form of the breast epithelial mucin that is not expressed in normal epithelial tissue.
  • HAMA response which is observed for numerous murine monoclonal antibodies, precludes any long-term administration of murine antibodies to human patients.
  • other heterologous antibodies when administered to humans, elicited similar antibody responses.
  • the anti-heteroiogous human response is, thus, a substantial limiting factor hindering the successful use of heterologous monoclonal antibodies as therapeutic agents, which could, otherwise, specifically anhilate breast carcinomas, causing little or no damage to normal tissue and having no other toxic effects.
  • Chimeric antibodies are direct fusions between variable domains of one species and constant domains of another.
  • Mouse/human chimeric antibodies prepared from other types of B cells binding to other types of antigenic determinants have been shown to be less immu ⁇ ogenic in humans than whole mouse antibodies.
  • This invention relates to a polypeptide which selectively binds to an antigen found on the surface or in the cytoplasm of cells of tumors such as carcinomas or that are released by the cells, the polypeptide consisting essentially of at least one variable region of the light or heavy chains of an antibody selectively binding the human mammary fat globule (HMFG) antigen and to antigen found on the surface or the cytoplasm of tumor cells such as carcinomas or that are released by the cells, combinations thereof wherein each polypeptide is operatively linked to at least one other polypeptide, or mixtures thereof.
  • the polypeptide may be glycosylated.
  • This invention also encompasses a hybrid polypeptide comprising at least one polypeptide described above and at least one effector agent operatively linked thereto, combinations thereof, and mixtures thereof.
  • the polypeptide and hybrid polypeptide are also provided as a composition comprising the anti-tumor polypeptide or hybrid polypeptide of this invention and a non-proteolytic carrier, such as a pharmaceutically-acceptable carrier.
  • the present polypeptide or hybrid polypeptide may be prepared by a method comprising cloning the polydeoxyribonucleotide of this invention into a vector to form a hybrid vector; transfecting a host cell with the hybrid vector and allowing the expression of the anti-tumor polypeptide or hybrid polypeptide; and isolating the anti-tumor polypeptide or hybrid polypeptide or mixtures thereof.
  • hybridoma cells expressing the polypeptide of hybrid polypeptide of the invention such as those having the ATCC Accession Nos. HB 1 1200 and HB 1 1201. Stil part of this invention are diagnostic kits for neoplasias.
  • kits comprises, in separate containers, the anti-tumor polypeptide or hybrid polypeptide of this invention, anti-tumor antibody, and immunoglobulin, protein G or protein A, a solid support, and instructions for its use.
  • the other kit comprises the hybrid polypeptide of the invention, wherein the effector agent is the constant region of a heterologous antibody or fragment thereof that binds immunoglobulins, protein G or protein A, a solid support having operatively linked thereto an antigen selectively binding the anti-tumor hybrid polypeptide and the antibody, and instructions for its use.
  • the polypeptide and hybrid protein of this invention may be applied to the in vivo imaging and/or diagnosing of a tumor such as a carcinoma by administering, to a subject suspected of being afflicted with a primary or metastasized tumor, the anti-tumor polypeptide or hybrid polypeptide of this invention, e.g. in radiolabeled form, in an amount effective to reach the tumor cells and bind thereto, and detecting any localized labeled polypeptide or hybrid polypeptide.
  • a tumor may also be diagnosed in vitro by contacting a biological sample obtained from a subject with the anti-tumor polypeptide or hybrid polypeptide of this invention to form a polypeptide-antigen complex or a hybrid polypeptide-antigen complex with any tumor cell antigen present in the sample, and detecting any complex formed.
  • the diagnosis may also be accomplished in vitro by contacting a biological sample with a known amount of the hybrid polypeptide of the invention having a constant region or fragment thereof and an antibody, in the presence of an antigen molecule that specifically binds the polypeptide being operatively linked to a solid support, to form a polypeptide- antigen molecule complex on the solid support and a polypeptide-sample antigen complex with any neoplastic cell antigen present in the sample, detecting any complex formed between the polypeptide and the solid supported neoplastic cell antigen, and comparing the result with a control conducted in the absence of the sample.
  • polypeptide and hybrid polypeptide of this invention are also useful for inhibiting the growth or reducing the size of a primary or metastasized tumor, for purging neoplastic cells from a biological fluid and for histochemical testing of tissues for the presence of neoplastic cells.
  • composition containing an oligonucleotide encoding the anti-tumor polypeptide and/or hybrid polypeptide described above, a hybrid vector carrying the polydeoxyribonucleotide of the invention operatively linked thereto, and a transfected host cell, carrying the hybrid vector.
  • an anti-idiotype polypeptide comprising polyclonal antibodies raised against the polypeptide of this invention, monoclonal antibodies thereof, fragments thereof selected from the group consisting of Fab, Fab', (Fab') 2 , and variable regions, an oligopeptide comprising the amino acid sequence APDTRPA or tandem repeats thereof, combinations thereof wherein each oligopeptide, antibody or fragment thereof is operatively linked to at least one other oligopeptide, antibody or fragment thereof, and mixtures thereof, and optionally an effector agent operatively linked to the anti-idiotype polypeptide.
  • the anti-idiotype polypeptide of the invention may be used as an anti-tumor vaccine for the prevention and/or therapeutic treatment of or vaccination against tumors such as carcinomas, e.g. as a composition also comprising a pharmaceutically-acceptable diluent or carrier.
  • An anti-tumor vaccination kit may suitable comprise the vaccine of this invention and a diluent, in separate sterile containers, and instructions for its use.
  • the serum concentration of a circulating polypeptide that cross-reacts with the polypeptide of the invention may be lowered by administering to a subject the anti-idiotype polypeptide of this invention in an amount effective to bind the circulating polypeptide and thereby accelerate its clearance.
  • the monoclonal antibodies obtained up the present time have been prepared by fusing immortalized cell lines with B-cells of non-human origin such as murine, rat, rabbit, goat, and the like. Many of these hybridomas can produce monoclonal antibodies that have desirable binding properties such as high affinity and/or specificity for human carcinoma antigens, and are also produced in iarge amounts. However, in general, non-human antibodies may only be administered once to humans due to the detrimental effects they produce.
  • HAMA human anti-mouse antibody
  • human monoclonal hybridoma cell lines have not been very stable and have, therefore, not been suitable for the large scale, repeated production of monoclonal antibodies.
  • the present inventors have undertaken the preparation of anti-tumor heterologous, e.g. human and non-human, variable regions and hybrid polypeptides comprising the heterologous variable regions to lower or even circumvent the endogenous antibody response to heterologous antibodies.
  • the present invention utilizes the Fv regions of light and/or heavy chains of heterologous antibodies, such as those of mouse, human, rat, rabbit, goat, horse, primate' such as human and simian, bovine, and guinea pig, among others.
  • the inventors have surprisingly found that these antibody fragments preserve the binding and specificity characteristics of the whole antibody while eliciting a lesser antibody reaction when administered to a subject of a different species.
  • Antibodies are glycopolypeptides that are folded in certain specific conformations. When the glycosidic portion of the molecule is perturbed or excised, or portions of its amino acid sequence are eliminated, the folding pattern of the molecule is generally perturbed. Thus, any deletion of sequences of an antibody must be made taking into consideration that its folding-dependent properties may be diminished or even obliterated if the folding is affected, even though the amino acid sequences involved in the binding of the antigen are preserved.
  • the present inventors have selected the following strategy for the preparation and manufacture of the polypeptides and hybrid polypeptides of this invention.
  • the cDNAs that encode the variable chains of an antibody may be obtained by isolation of mRNA from a hybridoma cell and reverse transcription of the mRNA, amplification of the cDNA by PCR and insertion of the DNA into a vector for sequencing and restriction enzyme cutting.
  • the variable region cDNAs may then be PCR amplified, cloned, optionally into a vector carrying DNA sequences encoding a constant region(s), and sequenced, and then transfected into a host cell for expression of the gene products.
  • the binding specificity characteristics of the polypeptides may be then determined and compared to those of the whole antibodies.
  • polypeptide structures such as Fab, Fab', (Fab') 2 , variable fragments and combinations thereof having a desired specificity, may be constructed and may be bridged via a linker, or one or more of the polypeptides may be attached to one or more effector agent(s) or bridged via a linker.
  • the cDNAs encoding the variable regions of the antibody of a desired specificity may also be cloned, e.g. into a vector that also contains sequences encoding an effector polypeptide such as whole antibodies, Fab, Fab', (Fab') 2 and human constant regions, enzymes, neuropeptides, other peptide transmitters, toxins, hormones, operative conjugation regions, cytokines, lymphokines and the like, under the same promoter.
  • an effector polypeptide such as whole antibodies, Fab, Fab', (Fab') 2 and human constant regions, enzymes, neuropeptides, other peptide transmitters, toxins, hormones, operative conjugation regions, cytokines, lymphokines and the like, under the same promoter.
  • a human murine BrE-3 hybrid polypeptide binding to human mammary mucin and a human murine anti-KC-4 hybrid polypeptide binding to the KC-4 carcinoma antigen were constructed by joining the DNAs of the respective murine variable domains to the human constant polypeptide domains (an effector agent), then cloned into a hybrid vector, and the product expressed by transfecting the vector into myeloma cells.
  • Two polypeptides of the invention have been prepared comprising the variable regions of mouse antibodies BrE-3 (U.S. Patent No. 5,075,219) and KC- 4 (U.S. Patent No.
  • the hybrid polypeptides of this invention possess less foreign antigenic epitopes that the foreign whole antibodies from which they are derived. Accordingly, the inventors expect them to elicit a less complex immunogenic response in the species of the constant region, e.g. humans for the exemplary human-murine polypeptides, than the corresponding non-human whole antibodies. However, to what extent a portion of the heterologous, e.g. non- human, antibody could be deleted without altering the binding characteristics of the variable regions could not be predicted prior to this invention because of the substantial conformational alterations that normally occur upon truncation of amino acid sequences.
  • the present invention provides a pure, isolated polypeptide which selectively binds to an antigen on the surface or in the cytoplasm of neoplastic cells such as carcinoma cells or that is released by the cells, the polypeptide being selected from the group consisting essentially of at least one variable region of the light or heavy chains of an antibody having affinity and specificity for the HMFG antigen and an antigen found on the surface or the cytoplasm of the neoplastic cell or that is released by the cell; combinations thereof, wherein each polypeptide is operatively linked to at least one other polypeptide; and mixtures thereof.
  • the polypeptide of the invention may be as short as the shortest variable region of an antibody and as long as the variable region of an antibody plus other peptide sequences such as one or more antibodies, and the like, including non- peptide polymers of up to about 10 6 molecular weight, and in some instances even larger.
  • the amino acid sequences of the variable regions of antibodies BrE- 3 and anti-KC-4 are being described and were found to, by themselves or as a pair of light and heavy chains, bind to the respective antigens.
  • the polypeptide of the invention comprises combinations of variable regions that are operatively linked to at least one other region, the consecutive number of amino acids may exceed the number provided above.
  • the smaller molecular weight polypeptides are particularly suitable for greater penetration of live cells, the brain-blood barrier, and tumors, among others, whereas the higher molecular weight polypeptides are better suited for in vitro or in vivo imaging and diagnosis.
  • the polypeptide of the invention may contain amino acid sequences derived from light and/or heavy chains of antibodies raised against a variety of antigens and/or epitopes.
  • antigens and/or epitopes For example, the mouse antibodies disclosed in the examples were raised against human mammary fat globule (HMFG) mucin and the "KC-4" antigen of human carcinoma cells.
  • HMFG human mammary fat globule
  • KC-4" antigen of human carcinoma cells KC-4" antigen of human carcinoma cells.
  • Other antigens comprising a variety of epitopes may also be utilized as long as the antibody contributing the variable region displays affinity and specificity for the tumor cells such as carcinoma cells that will permit their selective binding to the cells in a variety of tissues.
  • the heterologous antibody from which the polypeptide of the invention is derived may be a mouse, rat, goat, rabbit, human, guinea pig, horse, bovine, and primate including human and simian antibody, among others.
  • the preparation of the antibody fragments encompassed by the polypeptides of the invention is similar whether the origin of the antibody is human or non-human.
  • the original mRNA is obtained from cells of the desired species but the remainder of the work-up is similar.
  • the anti-tumor polypeptide comprises the amino acid sequence ID No. 12 starting at amino acid D1 , the amino acid sequence ID No. 13 starting at amino acid E1 , the amino acid sequence ID Nos. 29 to 35, and the amino acid sequence ID Nos. 37 to 43, or combinations thereof wherein each polypeptide is operatively linked to at least one other polypeptide, or mixtures thereof.
  • These sequences are shown in Tables 5, 13, and 14 below.
  • the present polypeptides are provided either as a naked polypeptide or in glycosylated form. When provided in glycosylated form, the polypeptide may be operatively linked to a glycosyl residue provided by the .
  • glycosyl residues that may be added to the polypeptide of the invention are N-glycosylated and O-glycosylated residues, among others.
  • the glycosyl residues added to the naked polypeptide may have a molecular weight of about 20 to 50,000 daltons, and more preferably about 20 to 20,000 dalto ⁇ s, depending on the size and molecular weight of the polypeptide to which they are attached. However, other types of polysaccharides and molecular weights may also be attached.
  • the glycosyl residues may also be attached to the naked polypeptide of the invention by chemical means as is known in the art.
  • the heavy and light chain variable regions may be obtained individually or as V H /V L pairs, or attached to an effector peptide such as a constant region(s) or portions thereof, a drug, an enzyme, a toxin, a whole antibody, or any other molecule or radioisotope.
  • an effector peptide such as a constant region(s) or portions thereof, a drug, an enzyme, a toxin, a whole antibody, or any other molecule or radioisotope.
  • polypeptides of the invention engineered with molecules derived from antibodies or antibody fragments. These polypeptides, among others, are suitable for the practice of this invention.
  • a more extensive list of polypeptide constructs may be found in 0' Kennedy, R., and Roben, P. (O'Kennedy, R., and Roben, P., "Antibody Engineering: an Overview", Essays Biochem. (England) 26:59-75 (1991 )).
  • polypeptides of this invention encompass variable regions with monoclonal antibodies, antibody fragments such as Fab, Fab', (Fab') 2 , constant regions, single or multiple-domain and catalytic fragments, bi-functional or multifunctional combinations thereof, hybrid polypeptides thereof, enzymes, peptide hormones, molecules such as drugs and linkers, transmitters, and toxins, among others. These are suitable for imaging, therapy, diagnostics, and biosensors.
  • polypeptides such as V H -linker-V L and V L -linker-V H , have significant advantages over monoclonal antibodies in a number of applications.
  • the polypeptide linker binding the two chains may be of variable lengths. For example, about 2 to 50 amino acid residues, and more preferably about 12 to 25 residues, and may be expressed in E. coli.
  • Single chain antibodies consist of V L and V H with a polypeptide linker connecting the two chains (V L -linker-V H ).
  • the engineering may be done at the DNA level. So, knowledge of the sequence is required.
  • These polypeptides have the conformational stability, folding, and ligand-binding affinity of single-chain variable region immunoglobulin fragments and may be expressed in Escherichia coli. (Pantoliano, M.V., et al., Biochem. (US) 30 (42): 101 17-25 (1991 )).
  • the polypeptide linker binding the two chains may be of variable length, for example, about 2 to 50 amino acid residues, and more preferably about 12 to 25 residues, and may be expressed in E. coli. (Pantoliano, M.V., et al. (1991 ), supra).
  • a polypeptide such as an scF v may be expressed and prepared from E. coli and used for tumor targeting.
  • the clearance profiles for scF v in some situations fragments are advantageous relative to those of normal antibodies, Fab or (Fab') 2 fragments.
  • polypeptide comprises a V H -linker-V L and may have about 230 to 260 amino acids.
  • a synthetic gene using E. coli codons may be used for expression in E. coli.
  • a leader peptide of about 20 amino acids, such that of Trp LE may be used to direct protein secretion into the periplasm or medium. If this leader peptide is not naturally cleaved, the sF v polypeptide may be obtained by acid cleavage of the unique asp-pro peptide bond placed between the leader peptide and the sF v -encoding region.
  • This type of polypeptide provides extremely rapid tumor penetration and even distribution throughout tumor mass compared to IgG or Ig fragments Fab and F(ab') 2 .
  • V L -linker-V H effector peptide such as a hormone, enzyme, transmitter, and the like.
  • V L -linker-V H effector peptide such as a hormone, enzyme, transmitter, and the like.
  • These hybrid polypeptides may be prepared as described by McCarney, et. al. (McCarney, J.E. et al., "Biosynthetic Antibody Binding Sites: Development of a Single-Chain F v Model Based on Antidinitrophenol IgA Myeloma MOPC 31 5", J. Protein Chem. (US) 10 (6):669-83 (1 991 )).
  • a bi-functional hybrid polypeptide containing an F c -binding fragment B of staph protein A amino terminal to a single-chain F v region of the present specificity is also encompassed and may be prepared as previously described. (Tai, M.S., et al., Biochem. 29 (35):8024-30 (1 990)).
  • hybrid polypeptide of this invention is a Staph.
  • This FB-sF v may be encoded in a single synthetic gene and expressed as a polypeptide in E. coli.
  • This polypeptide is a good example of a useful multifunctional targetable single-chain polypeptide.
  • a hybrid polypeptide also comprising antibodies to a human carcinoma receptor and antiogenin is also part of this invention.
  • Antiogenin is a human homologue of pancreatic RNAse. This is an (Fab') 2 -like antibody-enzyme peptide effector.
  • Another hybrid polypeptide comprising a V H -CH1 heavy chain-RNAse may be expressed in a cell that secretes a chimeric light chain of the same antibody.
  • a secreted antibody of the similar structure was shown to cause the inhibition of growth and of protein synthesis of K562 cells that express the human transferrin receptor.
  • a monoclonal anti-F c antibody may be incorporated into a bi-specific
  • F(ab') 2 derivative as described by Greenman, J., et al. (Greenman, J., et al., Mol. Immunol. (England) 28 (1 1 ): 1243-54 (1 991 ).
  • a bi-specific F(ab') 2 comprising two (Fab'-(thioether-link)-Fab') chains provides the advantage that it is not blocked by human F c gamma Rll antibody. Thus, these are also utilized as effector agents herein.
  • Bi-specific antibodies may be obtained when two whole antibodies are attached. Another way to obtain bi-specific antibodies is by mixing chains from different antibodies or fragments thereof. In this manner the "left" branch of the bi-specific antibody has one function while the "right” branch has another.
  • the new polypeptides in accordance with this invention may be screened with a filamentous phage system.
  • This system may also be used for expressing any genes of antibodies or fragments thereof as well as for screening for mutagenized antibody variants as described by Marks, J.D., et al. (Marks, J.D., et al., "Molecular Evolution of Proteins on Filamentous Phage. Mimicking the Strategy of the Immune System", J.Mol. Biol. (England) 267 (231: 160007-10 (1 992)).
  • V H and V, genes may be cloned and displayed on the surface of a phage.
  • Antibody fragments binding specifically to several antigens may be isolated as reported by Marks. J.D., (Marks, J.D., "By-Passing Immunization. Human Antibodies from V-gene Libraries Displayed on Phage", J. Mol. Biol.
  • the present polypeptides alone or as hybrid polypeptides comprising arjtibodies and fragments thereof may be, e.g., covalently modified utilizing oxidized oligosaccharide moieties.
  • the hybrid polypeptides may be modified at the oligosaccharide residue with either a peptide labeled with a radioisotope such as 1 5 l or with a chelate such as a diethylenetriaminepentaacetic acid chelate with ⁇ ln.
  • a radioisotope such as 1 5 l
  • a chelate such as a diethylenetriaminepentaacetic acid chelate with ⁇ ln.
  • the use of oligosaccharides provides a more efficient localization to a target than that obtained with antibodies radiolabeled either at the amino acid chain lysines or tyrosines.(Rodwell, J.D.
  • effector agents other than polypeptides may also be attached to the polypeptides of the invention. These include non-peptide polymers, monomers, atoms, etc. These are discussed below.
  • Particularly preferred polypeptides of this invention are those having the sequences ID Nos. 29 through 35, or 37 through 43, or combination thereof.
  • Another preferred embodiment is that comprising amino acid sequence ID No. 12 starting at amino acid D1 or amino acid sequence ID No. 1 3 starting at amino acid E1 , or combinations thereof.
  • These amino acid sequences may be bound by a linker such as is known in the art. Examples of linkers are polylysine, EGKSSGSGSEJKVD, and (GGGGS)x3, and non-peptide polymers, among others.
  • Another preferred embodiment comprises a bi-functional polypeptide having a pair of light and heavy chains of the same specificity attached to one another by a linker, such as those provided above.
  • a bi-functional polypeptide comprises one set of light and heavy chains comprising at least one variable region, (e.g., amino acid sequences ID Nos. 12 or 1 3) and one set of light and heavy chain comprising at least one variable region, e.g., amino acid sequences ID Nos. 29 to 35 or 27 to 43, or combinations thereof.
  • Multi-functional hybrid polypeptides may comprise several identical units or combinations of the above bi-functional polypeptides.
  • this invention provides an anti-tumor hybrid polypeptide that comprises at least one anti-tumor polypeptide and at least one effector agent operatively linked to the polypeptide, combinations thereof and mixtures thereof.
  • the effector agent utilized in this invention may be a peptide polymer other than the constant region of an antibody of the same species as the variable region, monomers, and atoms such as metals.
  • the effector agent may comprise an atom such a radioisotope, an enzyme or a fluorescent label.
  • These effector peptides are suited for in vitro assays because they permit the identification of complexes formed by the polypeptide of the invention. Radioisotopes are particularly preferred for in vivo imaging. Labeling of a polypeptide is known in the art (Greenwood, F.C., et al., Biochem. J. 89: 1 14-123 (1963)).
  • the radiolabel may be attached to the glycosyl residue as is known in the art (Hay, G.W. et al, in Methods in Carbohydrate Chemistry, Vol 5:357, Whistler, R.L. Ed., Academic Press, NY and London (1965)).
  • the effector agent comprises a monomer
  • it may be a therapeutic, immunogenic or diagnostic agent, radioisotopes, DNA, or RNA monomers, chemical linkers, transmitter molecules, combinations thereof, or combinations thereof with peptide and non- peptide polymers or copolymers and atoms.
  • therapeutic agents are antineoplastic drugs such as vincristine, intercalation drugs, adriamycin, enzymes, toxins and hormones, among others.
  • immunogenic agents are other vaccines for carcinomas or for others purposes.
  • diagnostic agents are radioisotopes and enzymes, among others.
  • therapeutic, immunogenic and diagnostic agents are toxins, vaccines, and radioisotopes, among others.
  • radioisotopes are ⁇ ln, 36 S, 90 Y, 1 B ⁇ Re, 225 Ac, 25 l and 99 Tc, among others.
  • DNA and RNA monomers are A, T, U, G, C, among others.
  • Examples of chemical linkers are dithiobis-(succinimidyl)propionate and bis-(sulfosuccinimidyl)suberate, among others.
  • Examples of transmitter molecules are cAMP and cGMP, among others.
  • Examples of toxins are ricin A-chain and abrin A-chain, among others.
  • the effector agent when the effector agent is a non-peptide polymer linked to the polypeptide of the invention it may comprises an ester, ether, vinyl, amido, imido, alkylene, arylalkylene, cyanate, urethane, or isoprene polymers, DNA polymers, RNA polymers, copolymers thereof and copolymers thereof with peptide polymers or monomers, or have labeled atoms attached thereto.
  • polyesters examples include polyesters, poiyethers, polyethyleneglycols, polyvinyls, polyamido and polyamido resins, polybethylenes, polytetrafluoroethylene, poly(ethylene)terephathalate, polypropylene, silicone rubber, isoprenes and copolymers thereof, copolymers of silicone and carbonated polylactic or polyglycolic acid or collagen, and the like.
  • Particularly preferred are biodegradable and bioresorbable or bioabsorbable materials, which if detached from the polypeptide and left in the systemic circulation will not damage endogenous tissues.
  • the effector agent being a peptide may comprise antibodies such as
  • IgG, IgM, IgE or IgD the constant region of antibodies of a species different from the variable region or fragments thereof, and the variable regions, Fab, Fab', (Fab') 2 fragments of antibodies of the classes described above, hormones, enzymes, peptide transmitters and whole antibodies, combinations thereof, and combinations thereof with non-peptide polymers, copolymers, monomers and atoms such as radioisotopes.
  • Fab, Fab', (Fab') 2 , and variable regions thereof are those that specifically bind tumor epitopes, such as do BrE-3 and anti-KC-4, and others having specificities for different carcinoma epitopes, such as BrE-1 . Br-E2, and Mc5, among others, and fragments thereof.
  • peptide transmitters and hormones suitable for use herein are insulin, growth hormone, FSH, LH, endorphins, and TNF, among others.
  • enzymes are peroxidase, LDH, alkaline phosphatase and galactosidase, among others.
  • the polypeptide of the invention comprises non-human amino acid sequences, and the effector peptide comprises the constant region of the light or heavy chains of a human antibody or fragments thereof capable of binding anti-immunoglobulin, protein G or protein A, or fragments lacking this binding capability.
  • This hybrid polypeptide is provided as a chimeric antibody if the polypeptide of the invention comprises the variable region of one species and the effector peptide comprises the constant region of another species.
  • the polypeptide comprises the murine-human chimeric antibodies expressed by the hybridoma cell lines having the ATCC Accession Nos. 1 1200 (Chimeric BrE-3 A1 C10) and 1 1201 (Chimeric KC-4 1 E8). These cells were deposited under the Budapest Treaty on November 13, 1992.
  • the hybrid polypeptide comprises two heavy and two light chains, each light and heavy chain comprising at least one variable region polypeptide of one species and the constant region of an antibody of a different species such as human, at least one other variable region, chimeric Fab , Fab' or (Fab') 2 , fragments thereof, combinations thereof, and mixtures thereof. Still more preferred is a hybrid polypeptide comprising at least two murine-human chimeric antibodies or Fab , Fab' or (Fab') 2 fragments thereof operatively linked to one another.
  • the peptide fragments may be covalently attached to one another as is known in the art (Marchis-Mouren G., et al., "HT 29, a Model Cell Line: Stimulation by the Vasoactive Intestinal Peptide (VIP); VIP Receptor Structure and Metabolism", Bioch. 70 (51:663-71 (1988)), or they may be synthesized by methods known in the art (Allen, G., et al., "Production of Epidermal Growth Factor in Escherichia Coli from a Synthetic Gene", J. Cell Sci. Suppl. 3:29-38 (1 985)).
  • the hybrid polypeptide of the invention described above having two heavy and two light chains operatively linked to one another is one where each pair of heavy and light chains has specificity for a different epitope.
  • this polypeptide is a pair of variabieregion heavy and light chains of the BrE-3 polypeptide and a pair of variable region light and heavy chains of the KC-4 polypeptide of this invention that are covalently attached to one another by a peptide linker or by a non-peptide polymer.
  • Non-peptide polymers may be covalently attached to pep ⁇ ides by methods known in the art (Duronio, V., et al., "Two Polypeptides Identified by Interleukin 3 Cross-Linking Represent Distinct Components of the Interleukin 3 Receptor", Exp. Hematol. 20 (4):505-1 1 (1992)).
  • the invention provides a hybrid polypeptide comprising at least one variable region of the heavy chain of a first antibody operatively linked to a first effector agent, and at least one variable region of the light chain of a second antibody operatively linked to a second effector agent, wherein each pair of light and heavy chains has a predetermined specificity, combinations thereof, and mixtures thereof.
  • the at least one variable region of the heavy chain of the non-human antibody and the at least one variable region of the light chain of the non-human antibody are linked to one another by a non-peptide polymer or monomer.
  • the hybrid polypeptide of the invention is one wherein at least one pair of light and heavy chains comprising at least one variable region is linked to at least one other pair of light and heavy chains comprising at least one variable region.
  • the polypeptides and hybrid polypeptides of the invention have affinity and specificity for an epitope located in the most hydrophilic region of a 20 amino acid tandem repeat that makes up a large part of the polypeptide core of mammary mucin.
  • a hexamer sequence APDTRP was shown to afford the strongest binding with five different monoclonal antibodies raised against human mammary fat globule (Mc1 , Mc 5, BrE-1 , BrE-2 and BrE-3).
  • monoclonal antibodies bind to overlapping polypeptide epitopes but have different tissue and tumor specificities, quantitatively differ in their binding to breast carcinoma cell lines when observed by flow cytometry and have different competition patterns for binding to the native antigen on breast carcinoma cells.
  • preferred amongst the antibodies utilized for the preparation of the present polypeptide and hybrid polypeptide are those that exhibit strong binding to the hexamer peptide described above or to tandem repeats thereof.
  • This invention also provides an anti-tumor composition that comprises the anti-tumor polypeptide and/or hybrid polypeptide of the invention and a non- proteolytic carrier,e.g. a pharmaceutically-acceptable carrier.
  • a non- proteolytic carrier e.g. a pharmaceutically-acceptable carrier.
  • the anti-tumor polypeptide and hybrid polypeptide provided herein may be present in the composition in an amount of about 0.001 to 99.99 wt%, more preferably about 0.01 to 20 wt%, and still more preferably about 1 to 5 wt%. However, other amounts are also suitable.
  • Pharmaceuticaliy-acceptable carriers are known in the art and need not be further described herein and may be provided in a separate sterile container or in admixture with the polypeptide.
  • compositions typically, saline, aqueous alcoholic solutions, albumin-saline solutions, and propyiene glycol solutions are suitable. However, others may also be utilized.
  • the composition may also contain other ingredients as is known in the art. Examples of these are other anti-neoplastic drugs such as adriamycin, and mitomyci ⁇ , among others, cytoxan, PALA and/or metrotrexate. However, other therapeutic drugs, diluents, immunological adjuvants and the like may be also be added.
  • the composition described above when utilized for in vivo imaging, it may comprise about 0.001 to 99.9 wt% polypeptide, and more preferably about 0.01 to 20 wt% polypeptide.
  • compositions when utilized for therapeutic purposes it may contain about 0.001 to 99.9 wt % polypeptide, and more preferably about 0.01 to 20 wt % polypeptide.
  • composition of the invention When utilized for the in vitro diagnosis of carcinomas the composition of the invention may comprise about 0.001 to 30 wt% polypeptide, and more preferably about 0.001 to 10 wt% polypeptide. Other amounts, however, are also suitable.
  • Such products find one utility in the treatment of tumors such as of the breast, lung, ovary, endometrial, pancreas, prostate and colon tumors, among others.
  • the present polypeptides are particularly suitable for repeated administrations to a patient and for long term therapies such as is the case of metastases and/or reoccurrence of tumors.
  • a tumor diagnostic kit that comprises the composition of the invention comprising the anti-tumor polypeptide, a solid support, anti-tumor antibody, anti-constant region immunoglobulin, protein G or protein A, and instructions for its use.
  • This diagnostic kit may be utilized by covalently attaching the polypeptide of the invention to the solid support by means of a linker as is known in the art.
  • the support is coated with methylated albumin as described in US Patent No. 4,572,901 , the relevant text of which being incorporated herein by reference.
  • the anti-tumor antibody may be obtained by challenging a human or non- human animal with tumor cells such as human carcinoma cells, the human milk fat globule mucin and the like, as is know in the art (Peterson, J.A., et al., Hybridoma 9:221 (1 990)).
  • Other antibodies may be prepared similarly by varying the antigen and/or the species utilizied. If the antibody utilized is monoclonal, it may be prepared as described by Kohler, G. and Milstein, C. (Kohler, G. and Milstein, C, "Continuous Culture of Fused Cell Secreting Antibody of Predefined Specificity", Nature 256:495-497 (1975)).
  • Suitable for use in this invention are antibodies such as IgG, IgM, IgE and IgD. Protein A , protein G and anti-constant region immunoglobulin may be obtained commercially.
  • the effector agent of the hybrid polypeptide comprises an enzyme, a radioisotope, a fluorescent label and/or a peptide comprising the constant region of an antibody of a different species or fragments thereof capable of binding immunoglobulin, protein G or A, anti-tumor antibody, immunoglobulin, protein G or protein A, a solid support having operatively linked thereto an antigen which specifically binds to the anti-
  • the solid support may have operatively linked thereto an antigen which specifically binds to the effector peptide. This permits the binding of the anti-tumor polypeptide to the antigen molecule attached to the solid support. Any complex formed between the hybrid polypeptide of the invention and the supported antigen will, thus, remain attached to the solid substrate.
  • a competitive assay may then be conducted by addition to the solid supported antigen of a known amount of the antigen hybrid polypeptide and the sample.
  • the amount of neoplastic antigen present in the sample may be obtained from a dilution curve by addition of immunoglobulin, protein G or protein A, e.g., labeled, to bind the hybrid polypeptide that is now attached to the support.
  • This kit may be used in a competitive assay where the supported antigen molecule competes with neoplastic antigen in the sample for a known amount of the polypeptide of the invention.
  • the assay was described by Ceriani, R.L., et al. (Ceriani, R.L., et al., Anal. Biochem. 201 : 178-184 (1992)), the relevant text thereof being incorporated herein by reference.
  • Still part of this invention is an in vivo method of imaging and/or diagnosing a tumor that comprises administering to a subject suspected of carrying a neoplastic tumor the anti-tumor polypeptide of the invention in radiolabeled form, in an amount effective to reach the tumor and bind thereto, and detecting any localized binding of the labeled polypeptide to the tumor.
  • the polypeptide of the invention may be administered in an amount of about 0.01 to 100 ⁇ g/kg weight per treatment, and more preferably about 0.1 _, ⁇
  • Radiolabels that may be utilized are ⁇ ln, 35 l, 99 Tc, and 13l l, among others. These radioisotopes may be detected with a PET scanner, NMR imaging, and radioactivity counting apparatus that are in wide use by the medical community.
  • an in vitro method of diagnosing a neoplasia comprises contacting a biological sample with the anti-tumor polypeptide or hybrid polypeptide of the invention to form an anti-tumor polypeptide-antigen complex with any neoplastic cell antigen present in the sample, and detecting any complex formed.
  • the biological sample is typically obtained from a subject suspected of being afflicted with the tumor. Suitable biological samples are serum, blood, sputum, feces, lymph fluid, spinal fluid, lung secretions, and urine, among others.
  • any source of fluid, tissue and the like may be prepared for use in this method as is known in the art.
  • the hybrid BrE-3 polypeptide of the invention and the murine BrE-3 antibody show substantially no strong binding to normal tissue.
  • the hybrid ' BrE- 3 polypeptide shows a binding pattern similar to that of the murine BrE-3 antibody.
  • the murine BrE-3 antibody was shown to bind strongly with specificity to carcinoma tumors of the breast, lung, ovary, bladder, and the endometrium, mesothelioma, colon, kidney, liver, merkel cells, pancreas, salivary glands, sarcomas and thyroid, among others. Only weak binding was shown to normal breast tissue, lung tissue, distal convoluted tubes of the kidney, acini of the pancreas and stomach mucosa (Peterson, J.A., et al.
  • the anti-KC-4 hybrid polypeptide has tissue specificity similar to that of the murine anti-KC-4 antibody.
  • the anti-KC-4 monoclonal antibody was shown to bind specifically and strongly to solid tumor tissue in the lung, colon, kidney, breast, stomach, prostate, pancreatic, lymph node doctal and lymphoma, and ⁇ on- specifically and weakly to normal breast, kidney, and stomach tissue.
  • KC-4 also showed some weak binding to normal tissue including spinal cord, uterus, thyroid, tongue, prostate, spin, adrenal, lung, gall bladder, heart, lymph nodes, colon, liver, brain, testes, thymus, and placenta (U.S. Patent No. 4,708,930).
  • the anti-tumor polypeptide added to the biological sample comprises a labeled hybrid polypeptide.
  • Suitable labeling materials were described above. This method may be practiced with the solid support containing kit described above, as a competitive assay as disclosed by Ceriani, R.L., et al. (Ceriani, R.L., et al. (1992), supra).
  • Also provided herein is a method of inhibiting the growth or reducing the size of a primary or metastasized human carcinoma comprising administering to a human in a need of the treatment an effective amount of the anti-tumor hybrid polypeptide of the invention.
  • the hybrid polypeptide may be administered in an amount of about 0.001 to 200 g/kg body weight per treatment, and more preferably about 0.01 to 100 mg/kg body weight per treatment.
  • other amounts are also suitable.
  • the administration of the hybrid polypeptide is conducted by infusion so that the amount of radiolabel, toxin or other effector agent present that may produce a detrimental effect may be kept under control by varying the rate of administration.
  • the infusion of one dose may last a few hours.
  • the infusion of the hybrid polypeptide of the invention may be conducted as follows. Intravenous (I.V.) tubing may be pretreated, e.g., with 0.9 % NaCl and 5% human serum albumin and placed for intravenous administration.
  • the prescribed dose of the polypeptide may be infused as follows. Unlabeled antibody may be infused initially. 30 minutes after completion of the unlabeled antibody infusion, 11 l ln-labeled and Y-90 labeled antibody may be co-infused.
  • I.V. Intravenous tubing
  • Unlabeled antibody may be infused initially. 30 minutes after completion of the unlabeled antibody infusion, 11 l ln-labeled and Y-90 labeled antibody may be co-infused.
  • infusion may comprise a total volume of 250 ml of 0.9 % NaCl and 5 % human serum albumin and be infused over a period of about 2 hours depending on any rate-dependent side effects observed.
  • Vital signs should be taken every, e.g., 15 minutes during the infusion and every one hour post infusion until stable. A thorough cardiopulmonary physical examination may be done prior to, and at the conclusion, of the infusion.
  • Medications including acetaminophen, diphenhydramine, epinephrine, and corticosteroids may be kept at hand for treatment of allergic reactions should they occur.
  • the administration of the hybrid polypeptide of the invention may be repeated as seen desirable by a practitioner.
  • repeated treatments may be administered every about 1 to 100, and more preferably about 2 to 60 days. These repeated treatments may be continued for a period of up to about 2 years, and in some circumstances even for longer periods of time or until complete disappearance of the tumor(s).
  • the administration of the hybrid polypeptides of this invention is typically more useful for therapeutic purposes when a primary tumor has, for example, been excised. Thus, it is primarily, for mopping up after surgical intervention or in cases of cancerous metastases that the present method is of most use.
  • polydeoxyribonucieotide that comprises a oligodeoxyribonucleotide encoding the polypeptide or hybrid polypeptide of this invention, including all redundant sequences.
  • the polydeoxyribonucleotide of the invention comprises a DNA sequence selected from the group consisting of DNA Sequence ID No: 10 starting at codon 20 (GAT), DNA Sequence ID No: 1 2 starting at codon 20 (GAA), DNA Sequence ID No: 26, codon 20. Also preferred is Sequence ID NO: 27, starting at codon 20.
  • the above DNA sequences may be cloned for expression under the same operon.
  • hybrid vector that comprises a vector having the polydeoxyribonucleotide of this invention operatively linked thereto.
  • vectors capable of replication both in eukaryotic and prokaryotic cells are suitable.
  • the vector should be suitable for transfection of eukaryotic host cells.
  • the hybrid vector further comprises a polydeoxyribonucleotide comprising an oiigodeoxyribonucleotide encoding an effector peptide, the effector peptide-encoding polydeoxyribonucleotide being operatively linked to the vector.
  • the various DNA sequences may be cloned for expression under the same operon.
  • the polydeoxyribonucleotide encoding the effector polypeptide may also be cloned for expression under the same operon.
  • the invention provides a hybrid vector, wherein the oiigodeoxyribonucleotide encodes a polypeptide selected from the group consisting of the variable regions of the heavy and the light chains of the antibody and combinations thereof, and the effector peptide-encoding oiigodeoxyribonucleotide is operatively linked to the oiigodeoxyribonucleotide so as to express a hybrid polypeptide comprising at least one variable region of the light or heavy chains of the polypeptide or combinations thereof, and the effector peptide.
  • Other polypeptides and hybrid polypeptides comprising effector peptides described above may also be prepared as described above.
  • This invention also encompasses a host cell that has been transfected with the hybrid vector described above.
  • Suitable hosts are prokaryotic and eukaryotic hosts such as bacteria, yeast, and mammalian cells such as insect cells and non producing hybridoma cells, among others.
  • Suitable vectors and/or plasmids for the transfection of each one of these types of hosts are known in the art and need not be further described herein.
  • methods for cloning DNA sequences into each one of these types of vectors and for transfecting the different types of host cells Particularly preferred are the cell lines having the ATCC Accesion Nos. 1 1200 (Chimeric Br-E 3 A1 C10) and 1 1201 (Chimeric KC-4 1 E8).
  • Polyribonucleotides may be obtained by transcription of the polydeoxyribonucloetides described above as is known in the art.
  • polyribonucleotides comprising oligoribonucleotides encoding at least one antibody variable region, combinations thereof, and combinations thereof with an effector peptide may be prepared by cloning the desired DNA segments and then transcribing the thus obtained polydeoxyribonucleotide into the corresponding RNA sequences.
  • This invention also provides a method of producing a polypeptide which selectively binds to the HMFG antigen and to an antigen present on the surface or in the cytoplasm of tumor cells such as carcinomas or that is released by the cells, that comprises cloning the polydeoxyribonucleotide of the invention into a vector to form a hybrid vector, transfecting a host cell with the hybrid vector and allowing the expression of the anti-tumor polypeptide, and isolating the anti- tumor polypeptide or mixtures thereof.
  • the cloning and transfecting steps are conducted by cloning polydeoxyribonucleotides encoding polypeptides selected from the group consisting of at least one of variable region of the heavy or light chains of the human antibody.
  • the method may further comprise allowing the expressed polypeptides to interact with one another to form double chain polypeptides, each chain polypeptide comprising at least one variable region of the light or heavy chain of the antibody.
  • Still part of this invention is a method of producing an anti-tumor hybrid polypeptide comprising an effector peptide and a polypeptide which specifically binds to an antigen on the surface or in the cytoplasm of human carcinoma cells or that is released by the cells, the method comprising transfecting a host cell with the hybrid vector of this invention carrying a DNA sequence encoding the hybrid polypeptide, allowing the expression of the anti-tumor hybrid polypeptide, and isolating the anti-tumor hybrid polypeptide or mixtures thereof.
  • This invention also encompasses an anti-idiotype polypeptide that comprises polyclonal antibodies raised against the polypeptide of the invention, monoclonal antibodies thereof, fragments thereof such as Fab, Fab', (Fab') 2 , and variable region fragments, an oligopeptide comprising the amino acid sequence APDTRPA or tandem repeats thereof, combinations thereof wherein each oligopeptide, antibody or fragment thereof, is operatively linked to at least one other oligopeptide, antibody or fragment thereof, and mixtures thereof.
  • the anti-idiotype polypeptide of the invention specifically binds to at least one variable region of the light or heavy chains of the anti-tumor polypeptide of this invention.
  • the anti-idiotype polypeptide of the invention comprises an effector agent operatively linked to the polypeptide. Effector agents suitable for use herein described above for the anti-tumor polypeptide of the invention are also suitable for use with the anti-idiotype polypeptide.
  • polyclonal antibodies raised against the polypeptide of the invention and a monoclonal antibody obtained by fusion of a B-cell producing an antibody having specificity for the polypeptide of the invention and an immortalized cell line.
  • fragments of the monoclonal antibody such as Fab, Fab', (Fab') 2 and variable region fragments.
  • combinations of the above fragments and combination of the fragments with whole antibodies are also preferred.
  • the anti-idiotype polypeptide comprises the hexapeptide or tandem repeats thereof.
  • an anti-tumor vaccine that comprises the anti- idiotype polypeptide of the invention, and a pharmaceutically-acceptable carrier.
  • the anti-idiotype polypeptide is present in the composition in an amount of about 0.001 to 99.99 wt%, and more preferably about 0.01 to 50 wt% of the composition. However, other amounts are also suitable.
  • Pharmaceutically-acceptable carriers are known in the art and need not be further described herein.
  • the vaccine provided herein may further comprise other ingredients such as adjuvants, and the like. Examples of adjuvants are SAF-1 and Freund's, among others. Suitably, other ingredients typically used for the preparation of vaccines may also be utilized herein.
  • the vaccine of the invention may be provided in unit form as a powder or in a diluent. In another embodiment, it may be provided in powder form in a sterile container comprising a plurality of doses for preparation prior to utilization. Diluents that are suitable for the preparation of a formulation that may be administered to a patient by injection are known in the art. Examples were provided above.
  • a vaccination kit against tumors is also provided by this invention that comprises, the vaccine described above and a diluent, in separate sterile containers, and instructions for its use. Also provided herein is a method of vaccinating against tumors that comprises administering to a subject an effective amount of the anti-idiotype polypeptide described above.
  • Typical amounts administered to a human are about 0.001 to 500 ⁇ g/kg body weight/dose, and more preferably about 0.01 to 100 / g/kg body weight/dose.
  • the anti-idiotype vaccine of the invention may be administered repeatedly in order to boost the active immunization produced by the first dose.
  • An anti- idiotype antibody very likely resembles the epitope on the carcinoma cell to which the anti-tumor antibody binds. Thus, it may be utilized for the production of an immunological response by the patient against its own tumor cells.
  • anti-idiotype polypeptide of non-human origin When an anti-idiotype polypeptide of non-human origin is administered to a human, it may produce some detrimental response. Accordingly, in theory, the smaller the non-human amino acid sequence the anti-idiotype polypeptide contains, the lesser the immunogenic response it will elicit in a human. Accordingly, preferred anti-idiotype polypeptides for use in humans are those containing at least one variable region of a non-human antibody binding selectively to the anti-tumor polypeptide described herein.
  • human anti-idiotype antibodies, variable fragments thereof, and fragments thereof that are operatively linked to an effector agent comprising a human polypeptide that may include the constant region of a human antibody and fragments thereof, non-peptide polymers, monomers and atoms that may be radiolabeled as described above.
  • an effector agent comprising a human polypeptide that may include the constant region of a human antibody and fragments thereof, non-peptide polymers, monomers and atoms that may be radiolabeled as described above.
  • Other types of constructs are also possible, several of which were described above.
  • the APDTRP hexamer may also be utilized for clearing from the circulation of a patient antibody molecules such as the polypeptide of the invention which have been used for therapeutic purposes.
  • the hexapeptide may be utilized as a tandem repeat comprising up to about 10,000 repeats of the basic unit, and in some instances up to about 500,000 repeats.
  • one or more hexapeptides may be operatively linked to other polypeptide sequences of related or unrelated function, which sequences provide bulk that aids the clearance through the liver and/or kidneys of the immunological complex formed between the circulating unbound or residual antibody or polypeptides utilized for the therapy of carcinomas and the hexapeptide.
  • the therapeutic antibody which may carry a radioisotope, a toxin or other therapeutic molecules, may remain in the circulation for several days and in some instances weeks.
  • this invention also provides a method of lowering the serum concentration of the circulating polypeptide that binds to an antigen found on the surface or in the cytoplasm of a neoplastic cell or that is released by the cell comprising administering to the subject a binding polypeptide selected from the group consisting of an oligopeptide comprising the amino sequences APDTRPA, tandem repeats thereof, and the anti-idiotype polypeptide described above, in an amount effective to bind the circulating polypeptide, to thereby accelerate its clearance.
  • a tandem repeat of up to about 20,000 and even up to about 50,000 APDTRPA hexapeptides is preferred.
  • Another preferred embodiment comprises an oligopeptide comprising one or more of the hexapeptide sequences and having a molecular weight of about 5,000 to 1 ,000,000.
  • Still another preferred embodiment is that where the polypeptide comprises the anti-idiotype polypeptide of this invention.
  • the binding polypeptide is administered in an amount of about 0.01 to 100.00 ⁇ g/kg body weight/dose, and more preferably about 1 to 25 ⁇ g/kg body weight/dose. However, other amounts may also be utilized.
  • the administration of the anti- idiotype polypeptide may be infusion intra-muscularly or subcutaneously.
  • Also provided herein is a method of inhibiting the growth or reducing the size of a primary or metas ⁇ asized tumor comprising administering to a subject, e.g. a human, in need of the treatment an effective amount of an anti-tumor hybrid polypeptide comprising an effector agent selected from the group consisting of radioisotopes, therapeutic drugs and vaccines, and an anti-tumor polypeptide which selectively binds to the HMFG antigen and to an antigen on the surface or in the cytoplasm of neoplastic cells or that is released by the cells, allowing the hybrid polypeptide to reach the tumor and the polypeptide to bind thereto, and administering to the subject an amount of the anti-idiotype polypeptide of the invention effective to bind residual or unbound circulating hybrid polypeptide to thereby accelerate the clearance of the hybrid polypeptide.
  • a subject e.g. a human
  • an anti-tumor hybrid polypeptide comprising an effector agent selected from the group consisting of radioiso
  • the present polypeptide and hybrid polypeptide are thus useful for determining in vitro the presence of neoplastic cells in a fluid or in tissue samples by histochemistry, for imaging tumors in vivo, for ex vivo purging neoplastic cells from biological samples such as spinal fluid and the like, as well as for diagnostic applications.
  • RNA is an adequate substrate for RT-PCR.
  • Polyadenylated RNA was utilized herein, however, because it contains only minor levels of contaminating ribosomal RNA and practically no DNA.
  • the polyadenylated RNA was isolated with a Fast Track mRNA isolation kit (Invitrogen Corporation, San Diego, Calif.
  • RNA PCR kit Perkin Elmer-Cetus, Norwalk,
  • PCR DNA fragments were cloned directly into pCR1000, using a TA cloning kit (Invitrogen Corporation, San Diego, CA). Plasmid DNA was isolated with a kit purchased from Qiagen (Tchapsworth, CA), and DNA sequencing was conducted with a Sequenase 2.0 DNA sequencing kit (United States
  • SP2/0-Ag14 cells (Shulman, M., et al. (1978), below) were cultured either in Dulbecco's modified Eagle's medium (DME): fetal bovine serum (FBS), 90:10 (v/v) or in a mixture of DME:RPMI:FBS, 45:45: 10 (v/v/v) or RPMLFBS, 90: 10 (v/v). Penicillin and streptomycin were added to prevent bacterial growth. When serum-free medium was utilized, it contained an HL-1 supplement as directed by the manufacturer (Ventrex Labs., Portland, ME). The freezing medium was 10% DMSO in bovine serum.
  • DME Dulbecco's modified Eagle's medium
  • FBS fetal bovine serum
  • RPMLFBS RPMLFBS
  • Primers and primer mixtures Mulg/.V L 5'-C, Mulg ⁇ V L 3'-1 , MulgV H 5'-C, MulgV H 5'-F, and Mulg) / H 3'-2 were part of a primer set purchased from Novagen. Their sequences may be obtained from Novagen. Other primers were synthesized by the inventors. These sequences are shown in Table 1 below.
  • V H variable heavy
  • V L variable light
  • J018 an i-sense JH3 GGG GCTAGC TGC AGA GAC AGT GAC CAG AGT CC(Seq. ID No: 8)
  • the V H and V L regions in the final mouse-human chimeric antibody were sequenced once again to verify that their sequences were correct.
  • the stable transfectant colonies were clearly established at a frequency of approximately 10 "5 .
  • the colonies were transferred to a normal medium (without histidinol) and the supernatants from stable transfectants were assayed for the presence of the mouse-human chimeric BrE-3 antibody. This was done by capturing the secreted mouse-human chimeric BrE-3 antibody with a plate-bound goat anti-human-.--- antibody and developing with goat anti-human- ⁇ antibody as described by Coloma, M.J. et al. with the following modification. The secondary antibody utilized herein was radiolabeled with 1 5 l.
  • Example 7 Confirmation of Mouse-Human Chimeric BrE-3 Antibody Expression The supernatants were assayed for binding to human milk fat globule (HMFG) as described by Ceriani R. L. (Ceriani R.L., et al., Diagnostic Ability of Different
  • HMFG Human Milk Fat Globule Antigens in Breast Cancer
  • Breast Cancer Res. Treat. 1 5: 161 -174 (1990) HMFG was bound to the microtiter plates as described previously (Ceriani R.L., "Solid Phase Identification and Molecular Weight Determination of Cell Membrane Antigens with Monoclonal Antibodies", in: Monoclonal antibodies and functional cell lines. Progress and application, Bechtol, K.B., McKern, T.J., and Kennett, R., Eds., Plenum Press, New York, pp 398-402 (1984)).
  • the antibody-antigen affinity constants for the mouse-human chimeric antibody which binds to human milk mucin and the whole murine antibody were determined by obtaining the reciprocal value of the concentration of competing unlabeled monoclonal antibody giving 50% binding as described by Sheldon, K. et al. (Sheldon, K.,et al., "Characterization of Binding of Four Monoclonal Antibodies to the Human Ovarian Adenocarcinoma Cell Line HEY", Biochem. Cell Biol., 65: 423-428, (1987)).
  • the protocol for the assay was as follows.
  • Microtiter plates (Dynatech, Chantilly, VA) were prepared using successive layers of methylated BSA, glutaraldehyde, anti- -galactosidase and the bacterial fusion protein 1 1 -2 ( a hybrid of /?-galactosidase and human mammary mucin) as described in Ceriani, R.L., et al. (Ceriani, R.L., et al., "A Novel Serum Assay for Breast Cancer Epithelial Antigen Using a Fusion Protein", Anal. Biochem. 201 : 178-184 (1992). Each well contained 388ng of the 1 1 -2 fusion protein.
  • variable region's affinity characteristics have been preserved.
  • V H and V L The cDNAs that encode the BrE-3 mouse immunoglobulin variable domains (V H and V L ) were prepared by reverse transcription and PCR amplification (RT-PCR) from polyadenylated RNA isolated from 10 8 BrE-3 hybridoma cells by the following procedure.
  • V H 1 BACK The J02, J03, J04, J014 and V H 1 BACK primers were synthesized, and there sequences shown in Example 3 above. Other primers were purchased from Novagen. With the exception of V H 1 BACK, which is a framework-specific primer, all sense primers are specific for the leader peptide region. All anti- sense primers are specific for the constant regions. The degenerate A chain of the specific primer Mulg IV L 3'-1 (from Novagen), was used to isolate the K chain cDNA clones because of the similarity of the ⁇ and .. An identical K chain clone was isolated with primer J02 which is specific for the K chain constant domain. The V H region cDNA could not be isolated with the available leader peptide primers.
  • V H 1 BACK primer was used, which yielded the V H cDNA ⁇ 72.
  • the leader-peptide primer J014 was then designed by extrapolating from the framework sequence of 72, using cataloged nucleotide sequences (Kabat, E.A., et al., "Sequences of Proteins of Immunological Interest", U.S. Dept. Health and Human Services, NIH publication No. 91 -3242, 5th. Edition ( 1 991 ). After sequential PCR reactions, this new primer yielded the complete V H framework cDNA. This information is summarized in Table 3 below.
  • Example 10 Isolation of Amplified BrE-3 V L and V H cDNA and Sequences The PCR products were cloned without prior purification into pCRIOOO
  • V L clones 152 and 164 were found to be identical, as were the sequences of the V H clones 1012, 1043.
  • the V H and V L DNA sequences and their derived protein sequences are shown in Tables 4 and 5 below.
  • the sequences were interpreted as described by Kabat et al. (1991). The residues that are shown in lower case correspond to PCR primers. The mature chains begin at D1 (V L ) and E1 (V H ), respectively. The amino-acids that are underlined are those corresponding to the CDRs. The underlined 5 nucleotides indicate joining segments.
  • V L is a group Ik chain.
  • Part of the CDR 3 and all of framework 4 (FR4) are encoded by J kl .
  • V H belongs to group lllc.
  • CDR 3 and FR4 are encoded by J H3 Little or nothing remains from an 10 unidentified D minigene. Thus, the CDR 3 is only 4 amino-acids long.
  • Example 11 Comparison of cDNA deduced Amino Acid Sequence with Directly Determined N-Terminal Fragment Sequence
  • VH Protein sequence EVKLEESGGVLVQPGGSMKLSSAAS BrE-3 was reduced with 5% mercaptoethanol, separated on a 10% SDS polyacrylamide gel, and electroblotted onto a ProBlott membrane (Applied Biosystems, Foster City, CA). Amino acid sequencing was performed directly on the immobilized bands by the Biotechnology Instrumentation Facility, University of California, Riverside. The protein sequence given here is the sequencer's best guess.
  • variable region cDNAs were cloned, it was confirmed that, in fact, they encoded the variable regions of BrE-3 and not those of another antibody by comparing the cDNA-derived amino acid sequences of the cloned BrE-3 variable region with the N-terminal sequence of purified BrE-3 antibody directly determined by a single run of protein sequencing.
  • the cDNA sequences were shown to be accurate by comparison with 2 independently reverse transcribed clones.
  • the vectors used were developed by Coloma, M.J., et al. (Coloma, M.J., et al. (1992), supra) and kindly provided by S.L. Morrison (Dept. of Microbiology and Molecular Genetics, UCLA). Both vectors were derived from pSV2 (Mulligan, R.C., and Berg, P., "Expression of a Bacterial Gene in Mammalian Cells", Science 209:1422-1427 (1980)), and contain genomic fragments encoding either the heavy or the light chain constant domains.
  • the vectors accept cDNAs that encode the F v regions. To ligate the F v cDNAs to the vectors, restriction ends were added to the cDNAs in a set of PCR reactions, using the J01 6, J017, J018 and J019 primers.
  • the pAG4622 light chain vector contains the gene for the human K chain constant region, including the J-C intron. It encodes xanthine-guanine phosphoribosyltransf erase or gpt (Mulligan, R.C., and Berg, P., "Selection for Animal Cells that Express the Escherichia Coli Gene Coding for Xanthine-Guanine Phosphoribosyltransferase", P.N.A.S. (USA) 78:2072-2076 (1981 )) as a dominant selectable marker.
  • gpt xanthine-guanine phosphoribosyltransf erase or gpt
  • the J-C intron contains the k chain enhancer (Potter, H., et al., "Enhancer-Dependent Expression of Human K Immunoglobulin Genes Introduced into Mouse Prep-B Lymphocytes by Electroporation", P.N.A.S. (USA) 81 :7161 -7165 (1984); Emorine, L., et al., "A conserveed Sequence in the Immunoglobulin J Kappa-C Kappa Intron: Possible Enhancer Element", Nature 304: 447-449 (1983)).
  • the pAH4604 heavy chain vector contains the gene for the heavy chain yl constant region, but no J-C intron.
  • the vector also contains an insert that encodes the heavy chain enhancer (Rabbitts, T.H., et al, "Transcription Enhancer Identified Near the Human C mu Immunoglobulin Heavy Chain Gene is Unavailable to the Translocated c-myc Gene in a Burkitt Lymphoma", Nature 306:806-809 (1 983)).
  • the new V H and V L DNA fragments with appropriate restriction ends were integrated into pAH4604 and pAG4622 as described in Example 4 above.
  • the vectors were then electroporated (together) into SP2/0-Ag14 myeloma cells as described by Coloma et al. (1992), supra.
  • mice-human chimeric antibody produced by the myeloma cell line was then purified from the culture supernatant using a Sepharose 4B-protein A column (Bio-Rad, Richmond, CA) as described in Ey, P.L., et al. (Ey, P.L., et al., "Isolation of Pure IgGI , lgG2a and lgG2b Immunoglobulins from Mouse Serum Using Protein A-Sepharose", Immunochemistry 1 5:429-436 (1978)).
  • Antibody disulfide bonds were reduced to separate the light and heavy chains by heating for 10 min at 65° in Laemmli loading buffer containing 5% beta-mercaptoethanol. The separated chains were then chromatographed on a SDS polyacrylamide gel (10%). The reduced mouse- human chimeric antibody and BrE-3 antibody were eletrophoresed in separate lanes next to 97.4, 66.2, 45.0, 31 .0 and 2.5 Kdalton protein markers. Table 7 below shows the apparent molecular weights of the two bands obtained for both.
  • the heavy and light chains of the chimeric BrE-3 antibody separate as expected when electrophoresed on a polyacrylamide gel.
  • Example 15 Tissue Binding Studies immunohistochemical staining using the immunoperoxidase technique of consecutive human breast carcinoma tissue sections was conducted with the mouse-human chimeric BrE-3 antibody. A control was stained with the anti-human secondary antibody only. Positive staining resulted from the use of the mouse-human chimeric BrE-3 antibody, followed by the anti-human antibody specific binding. (Pictures not shown).
  • the breast carcinoma tissue sections were stained with the supernatant of the transfected cells using the Vectastain ABC method (Vector Labs,
  • the tissue stained with the goat anti-human Ig secondary antibody only shows background or non-specific staining of necrotic areas of the tissue section.
  • Example 16 BrE-3 Imaging Studies
  • the murine monoclonal antibody BrE-3 has been shown to be highly effective for imaging and for the radioimmunotherapy of breast cancers.
  • the serum levels were low in most patients, the blood clearance correlated with the circulating antigen and the imaging results showed that about 86% of all sites could be imaged (Liebes, L., et al., "Pharmacokinetics of 1 l ln-BrE-3 Monoclonal Antibody in Patients with Breast Carcinoma", Proc. Am. Assoc. Cancer Res. 33:21 6(Abs No. 1292) (1992)).
  • a 90 Y-BrE-3 radioimmunoconjugate having similar pharmacokinetic characteristics and extrapolating the 11 l l ⁇ -BrE-3 dosimetry results provide a superior therapeutic agent, as well.
  • the BrE-3 variable region polypeptides have been cloned without the constant regions to produce less immunogenic polypeptides than the parent murine antibody. It has, moreover, been shown herein that the mouse-human chimeric BrE-3 antibody lacking its original murine constant region preserves its antigen binding characteristics.
  • a BrE-3 variable region chimeric alone or as a mouse-human chimeric antibody also containing a constant region human region or a fragment thereof is significantly less immunogenic to humans than the parent murine antibody.
  • the hybrid polypeptide comprising the variable region of the BrE-3 antibody and the constant region of a human antibody was shown to preserve the original binding affinity of the murine antibody. in this hybrid polypeptide, approximately 2/3 of its contiguous non- human immunogenic targets (C L and C H regions) were entirely replaced by human constant domains.
  • Example 18 Cloning of KC-4 V H and V L and cDNAs
  • Example 19 PCR Primers used in First Isolation of KC-4 cDNAs
  • the PCR primers were purchased from Novagen (Madison, Wl). Their sequences, reproduced from the booklet provided by Novagen, are shown in Table 8 below.
  • ACTAGTCGACATGAAGTTGCCTGTTAGGCTGTTGGTGCTG (Seq. ID No: 14)
  • ACTAGTCGACATGGAGWCAGACACACTCCTGYTATGGGT (Seq. ID No: 15)
  • ACTAGTCGACATGGATTTWCAGGTGCAGATTWTCAGCTTC (Seq. ID No: 16)
  • Muig rV L 3'-1 antisense kappa constant region CCCAAGCTTACTGGATGGTGGGAAGATGGA (Seq. ID No: 17)
  • KC-4 Antibody Ribonucleotide The two expression vectors pAG4622 and pAH4604 described in
  • Oligonucleotides synthesized and used in a PCR to produce V H and V L fragments with the correct ends for insertion into the pAG4622 and pAH4604 expression vectors are shown in Table 9 below.
  • V H and V L regions in the KC-4 mouse-human chimeric antibody were sequenced once again to verify that their sequences were correct.
  • Example 22 Production of Transfected Hosts After ten days, stable transfectant colonies were clearly established at a frequency of approximately 1 /10,000. The colonies were transferred to normal medium and the assays conducted as described in Example 6 above.
  • HMFG and BEM breast epithelial mucin
  • HMFG and BEM were bound to the microtiter plates as described previously by Ceriani, R.L. (1990).
  • the bound chimeric KC-4 (HMFG and BEM) was detected by anti-human gamma chain conjugated to 125" l.
  • Most colony supernatants were positive by both assays. The colonies that secreted the highest level of chimeric antibody in the supernatants, as determined by these assays, were subcloned.
  • 75 ⁇ l of the culture supernatant was added to 20 ⁇ l of 4x Laemmli buffer and 5 ⁇ l /S-mercaptoethanol and the mixture was heated at 65 °C for 1 5 min., in order to reduce antibody disulfide bonds and, thus, separate heavy from light chains.
  • 20 ⁇ l of the treated sample was chromatographed in duplicate lanes on a 10% SDS poiyacrylamide gel together with other antibodies that were treated similarly and that were loaded for comparison. Pre-stained size markers (BioRad, Richmond, CA) were also loaded.
  • the chromatographed proteins were electroblotted onto a ProBlott membrane (Applied Biosystems, Foster City, CA) in 90% 30 mM CAPS pH1 1 , 10% methanol, for 1 hour at 25 V and at
  • the membrane was cut into 2 parts containing identical antibody samples.
  • the 2 membranes were immersed in 20% Bovine Calf Serum in PBS and shaken slowly at room temperature for 1 hour 35 min.
  • 125 l labeled goat anti-human K chain antibody was added to one membrane and 125 l labeled goat anti-human y chain antibody to the other membrane.
  • Antibodies were labeled at a specific activity of approximately 10 mCi/mg using the chloramine T method as described by Ceriani, R.L. and Blank, E.W. (1988), the labeled antibodies were diluted to 4,000 cpm/ ⁇ l in RIA buffer.
  • the blots were washed twice in TBS for 10 min each time, once in TBST (50 mM TRIS pH7.5, 3 mM EDTA 25 mM NaCl) 10 min and once more in TBS (TBS with 0.05% Tween 20) for 10 min.
  • TBS TBS with 0.05% Tween 20
  • Example 25 Amplification of cD As Encoding KC-4 F v Regions
  • the cDNAs that encode the KC-4 mouse immunoglobulin V H and V L were prepared as described in Example 9 above from polyadenylated RNA isolated frqm 100 million KC-4 hybridoma cells. All clones were obtained from independent PCRs. The sequences of the primers are given in Example 1 9 and 20 above. All primers are specific for either the leader peptide region or for the constant regions. The primer combinations utilized herein are shown in Table 10 below.
  • V H and V L DNA sequences and their derived protein sequences are shown in Tables 1 1 and 12 below.
  • V L is a group II K chain. Part of the CDR 3 and all of the framework 4 (FR4) are encoded by Jk2. V H belongs to group Hid. CDR 3 and FR4 resulted from a genomic recombination involving minige ⁇ es D9 and JH3. There is an asparagine glycosylation site in the light chain in FR3. The site reads NIS (Asn He Ser).
  • Example 28 Comparison of cDNA deduced Amino
  • the supernatants from stable transfectants were assayed for the presence of the mouse-human chimeric KC-4 antibody as described in Example 1 3.
  • the chimeric antibody secreted in the supernatant bound both HMFG and BEM very strongly.
  • the supernatants containing mouse-human chimeric KC-4 antibody were used to stain human breast carcinoma tissue sections by using the immunoperoxidase immunohistochemical staining technique. The intensity of the staining was comparable to that obtained with the original murine monoclonal antibody.
  • the KC-4 monoclonal antibody is known to bind the human milk fat globule and the breast epithelial mucin. This binding specificity of the KC-4 monoclonal antibody was maintained after the recombinant procedure.
  • the KC-4 chimeric antibody bound very strongly to the human milk fat globule and the breast epithelial mucin as determined by radioassay (Ceriani, et al., Breast Cancer Res. Trent. 1 5: 161 (1990)).
  • the KC-4 chimeric antibody bound several human breast tumors in histopathological sections in a manner comparable to the KC-4 murine monoclonal antibody, as detected by immunostaining described in Example 1 5 above. This specificity of binding demonstrated the retained binding reactivity of the variable regions of KC-4 by the polypeptide of the invention when attached to the human F c fragment.
  • hybridoma cell lines expressing the BrE-3 and anti-KC-4 mouse- human chimeric antibodies were deposited on November 1 3, 1992 under the Budapest Treaty with the ATCC and have been assigned Accession Nos. HB 1 1 1 99 (Chimeric BrE-3 A1 C10) and HB 1 1201 (Chimeric KC-4 1 E8).
  • the polyethylene pins were arranged in a 8x12 configuration that fits into a 96 well microtiter dish.
  • the pins are supplied with an alanine attached to the ends to which the amino acids are added consecutively using pentafluorophenyl active esters of fluorenylmethyloxycarbonyl (Fmoc)-L-amino acids.
  • Fmoc fluorenylmethyloxycarbonyl
  • Each monoclonal antibody was tested for binding to the synthetic peptides using an ELISA method with horse radish peroxidase-conjugated goat anti-mouse IgG (Promega, Madison, Wl) and color development with 2,2'azinobis (3-ethylbenzothiazoline- 6-sulfonic acid (Sigma, St. Louis, MO).
  • the hexapeptides starting with A,P, D, and T bind well to the antibodies (Hexamers 1 to 3 and 20), whereas the hexamers starting between these positions did not.
  • the hexamers prepared are shown in Table 16 below.
  • each monoclonal antibody binds the linear amino acid sequence essential for its binding to the antigen.
  • BrE-3 required the sequence TRP within the hexamer.
  • Other monoclonal antibodies required other amino acid sequences (e.g., Mc5, TRPAP; Mel , DTR; BrE-1 , DTRP).
  • BrE-2 also required TRP but its different specificity for normal and tumor tissue indicates that its epitope on the native antigen is different from BrE- 3.
  • HMFG human milk fat globule

Abstract

Un polypeptide se compose d'une région variable des chaînes légères ou lourdes d'un anticorps appartenant à une espèce liant sélectivement l'antigène du globule de graisse mammaire humaine (HMFG) et un antigène situé sur la surface ou le cytoplasme de cellules tumorales telles que des cellules de carcinome, ou qui est libéré par des cellules, la combinaison de ces éléments liés de manière fonctionnelle les uns aux autres, et de mélanges de ces éléments. Le polypeptide peut être glycosylé. Un polypeptide hybride comprend le polypeptide de l'invention et un agent effecteur, les deux polypeptides pouvant être présents sous forme d'une composition comprenant un véhicule non protéolytique ainsi qu'un véhicule pharmaceutiquement acceptable. Des kits diagnostiques comprennent le polypeptide ou le polypepitde hybride de l'invention, ainsi que d'autres constituants tels qu'un anticoprs anti-tumoral et une immunoglobuline dirigée contre une région constante, une protéine G ou A, un support solide et des directives d'utilisatioon. Des tumeurs peuvent être mises en image et/ou diagnostiquées in vivo par administration du plypeptide radiomarqué de l'invention, et par détection de tout polypeptide marqué localisé et, in vitro, par la mise en contact d'un échantillon biologique et du polypeptide hybride de l'invention afin de former un complexe avec un antigène néoplasique présent dans l'échantillon, après quoi tout complexe formé est détecté. Il est possible de réduire ou d'inhiber de manière thérapeutique la croissance ou la grosseur d'une tumeur primaire ou métastasée par l'administration du polypeptide ou du polypeptide hybride de l'invention. Un polynucléotide comprend un oligonucléotide codant le polypeptide ou polypeptide hybride décrit ci-dessus, des vecteurs hybrides portent le ou les polydésoxyribonucléotides de l'invention, et des cellules hôtes sont transfectées avec les vecteurs hybrides. Le polypeptide ou le polypeptide hybride peuvent être obtenus par clonage d'un ou plusieurs des polydésoxyribonucléotides de l'invention. Un polypeptide anti-idiotypique comprend des anticorps polyclonaux dirigés contre le polypeptide de l'invention; leurs anticorps monoclonaux; Fab, Fab';, (Fab')2, et des fragments de région variable de ces derniers; un oligopeptide comprenant la séquence d'acides aminés APDTRPA ou des répétitions en tandem de cette séquence, des combinaisons ou des mélanges de ces éléments. Le polypeptide hybride peut également contenir un agent effecteur et peut être présenté sous forme d'un vaccin antinéoplasique dans un kit de vaccination. La concentration sérique d'un polypeptide à circulation qui se lie à un antigène présent sur la surface ou dans le cytoplasme de cellules tumorales, ou qui est libéré par ces cellules peut être réduite par administration du polypeptide anti-idiotypique de l'invention afin d'accélerer la clairance du polypeptide.
PCT/US1993/011316 1992-11-13 1993-11-15 Polypeptides presentant une specificite par rapport aux neoplasies, kit et procedes diagnostiques, therapeutiques et de vaccination WO1994011508A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU56155/94A AU5615594A (en) 1992-11-13 1993-11-15 Polypeptides with specificity for neoplasias, kit, and diagnostic, vaccination, and therapeutic methods

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US97770792A 1992-11-13 1992-11-13
US97770692A 1992-11-13 1992-11-13
US07/977,707 1992-11-13
US07/977,706 1992-11-13
US12801593A 1993-09-28 1993-09-28
US08/128,015 1993-09-28

Publications (2)

Publication Number Publication Date
WO1994011508A2 true WO1994011508A2 (fr) 1994-05-26
WO1994011508A3 WO1994011508A3 (fr) 1994-07-07

Family

ID=27383656

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1993/011316 WO1994011508A2 (fr) 1992-11-13 1993-11-15 Polypeptides presentant une specificite par rapport aux neoplasies, kit et procedes diagnostiques, therapeutiques et de vaccination

Country Status (2)

Country Link
AU (1) AU5615594A (fr)
WO (1) WO1994011508A2 (fr)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997022699A2 (fr) * 1995-12-20 1997-06-26 University Of Kentucky Research Foundation Anticorps monoclonal murin anti-idiotype 11d10 et ses procedes d' utilisation
WO2001012217A1 (fr) * 1999-08-18 2001-02-22 Altarex Corp. Anticorps therapeutiques utilises contre l'antigene muc-1, et leurs procedes d'utilisation
GB2360771A (en) * 2000-03-28 2001-10-03 Antisoma Res Ltd Compounds for targeting
US6716966B1 (en) 1999-08-18 2004-04-06 Altarex Corp. Therapeutic binding agents against MUC-1 antigen and methods for their use
US7041801B1 (en) 1995-06-07 2006-05-09 Vanderbilt University Antibodies binding to polypeptides encoded by developmentally-regulated endothelial cell locus-1
US7582603B2 (en) * 1998-08-03 2009-09-01 University Of Maryland, Baltimore Method for treating or inhibiting intestinal inflammation
US8168594B2 (en) 2006-02-09 2012-05-01 Alba Therapeutics Corporation Method for treating celiac disease
US8299017B2 (en) 2006-10-06 2012-10-30 Alba Therapeutics Corp. Use of tight junction antagonists to treat inflammatory bowl disease
CN112694521A (zh) * 2020-12-02 2021-04-23 杭州百凌生物科技有限公司 一种人工多肽lh、其抗体及在病理检测中的应用

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1986002945A1 (fr) * 1984-11-09 1986-05-22 Coulter Corporation Anticorps monoclonal d'un antigene associe a une tumeur cancereuse chez l'homme
WO1990005142A1 (fr) * 1988-11-10 1990-05-17 Imperial Cancer Research Technology Ltd. Polypeptides
WO1990012319A1 (fr) * 1989-04-05 1990-10-18 John Muir Cancer & Aging Institute Anticorps monoclonal reconnaissant une glycoproteine d'antigene mucine de membrane de globule de matiere grasse du lait humain
WO1992004380A1 (fr) * 1990-09-07 1992-03-19 Unilever Plc Agents de liaison specifiques
WO1992007939A2 (fr) * 1990-11-01 1992-05-14 John Muir Cancer & Research Institute Polypeptide possedant la specificite de liaison de l'antigene de differenciation 46kd hmfg
EP0534742A1 (fr) * 1991-09-26 1993-03-31 Celltech Therapeutics Limited Anticorps humanisés anti-globule de matière grasse du lait

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1986002945A1 (fr) * 1984-11-09 1986-05-22 Coulter Corporation Anticorps monoclonal d'un antigene associe a une tumeur cancereuse chez l'homme
WO1990005142A1 (fr) * 1988-11-10 1990-05-17 Imperial Cancer Research Technology Ltd. Polypeptides
WO1990012319A1 (fr) * 1989-04-05 1990-10-18 John Muir Cancer & Aging Institute Anticorps monoclonal reconnaissant une glycoproteine d'antigene mucine de membrane de globule de matiere grasse du lait humain
WO1992004380A1 (fr) * 1990-09-07 1992-03-19 Unilever Plc Agents de liaison specifiques
WO1992007939A2 (fr) * 1990-11-01 1992-05-14 John Muir Cancer & Research Institute Polypeptide possedant la specificite de liaison de l'antigene de differenciation 46kd hmfg
EP0534742A1 (fr) * 1991-09-26 1993-03-31 Celltech Therapeutics Limited Anticorps humanisés anti-globule de matière grasse du lait

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CANCER JOURNAL vol. 5, no. 1 , 1992 , VILLEJUIF, FRANCE pages 38 - 44 E. BLANK ET AL. 'A novel anti-breast epithelial mucin Mab (BrE-3). Characterization and experimental biodistribution and immunotherapy.' *
CANCER RESEARCH vol. 50, no. 21 , 1 November 1990 , PHILADELPHIA PA, USA pages 7068 - 7076 D. DIENHART ET AL. 'Imaging of non-small cell lung cancers with a monoclonal antibody, KC-4G3, which recognizes a human milk fat globule antigen.' *
HYBRIDOMA vol. 12, no. 1 , February 1993 , NEW YORK, USA pages 15 - 23 J. COUTO ET AL. 'Cloning of cDNAs encoding the variable domains of antibody BrE-3 and construction of a chimeric antibody.' *
THE JOURNAL OF EXPERIMENTAL MEDICINE vol. 174 , 1991 , NEW YORK, USA pages 613 - 624 S. STARK ET AL. 'Antibodies that are specific for a single amino acid interchange in a protein epitope use structurally distinct variable regions.' *

Cited By (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7399849B2 (en) 1995-01-29 2008-07-15 University Of Kentucky Research Foundation Murine monoclonal anti-idiotype antibody 11D10 and methods of use thereof
US7083943B1 (en) 1995-01-29 2006-08-01 Malaya Chatterjee Polynucleotides related to murine anti-idiotype antibody 11D10 and methods of use thereof
US7041801B1 (en) 1995-06-07 2006-05-09 Vanderbilt University Antibodies binding to polypeptides encoded by developmentally-regulated endothelial cell locus-1
US6949244B1 (en) 1995-12-20 2005-09-27 The Board Of Trustees Of The University Of Kentucky Murine monoclonal anti-idiotype antibody 11D10 and methods of use thereof
WO1997022699A3 (fr) * 1995-12-20 1997-09-04 Univ Kentucky Anticorps monoclonal murin anti-idiotype 11d10 et ses procedes d' utilisation
WO1997022699A2 (fr) * 1995-12-20 1997-06-26 University Of Kentucky Research Foundation Anticorps monoclonal murin anti-idiotype 11d10 et ses procedes d' utilisation
US7582603B2 (en) * 1998-08-03 2009-09-01 University Of Maryland, Baltimore Method for treating or inhibiting intestinal inflammation
US6716966B1 (en) 1999-08-18 2004-04-06 Altarex Corp. Therapeutic binding agents against MUC-1 antigen and methods for their use
JP2003519096A (ja) * 1999-08-18 2003-06-17 アルタレックス コーポレーション Ｍｕｃ−１抗原に対する治療用抗体およびその使用方法
WO2001012217A1 (fr) * 1999-08-18 2001-02-22 Altarex Corp. Anticorps therapeutiques utilises contre l'antigene muc-1, et leurs procedes d'utilisation
GB2360772B (en) * 2000-03-28 2002-05-22 Antisoma Res Ltd Compounds for targeting
GB2360772A (en) * 2000-03-28 2001-10-03 Antisoma Res Ltd Compounds for targeting
GB2360771A (en) * 2000-03-28 2001-10-03 Antisoma Res Ltd Compounds for targeting
US8168594B2 (en) 2006-02-09 2012-05-01 Alba Therapeutics Corporation Method for treating celiac disease
US9241969B2 (en) 2006-02-09 2016-01-26 Alba Therapeutics Corp. Method for treating celiac disease
US9265811B2 (en) 2006-02-09 2016-02-23 Alba Therapeutics Corporation Formulations for a tight junction effector
US8299017B2 (en) 2006-10-06 2012-10-30 Alba Therapeutics Corp. Use of tight junction antagonists to treat inflammatory bowl disease
CN112694521A (zh) * 2020-12-02 2021-04-23 杭州百凌生物科技有限公司 一种人工多肽lh、其抗体及在病理检测中的应用
CN112694521B (zh) * 2020-12-02 2023-01-17 杭州百凌生物科技有限公司 一种人工多肽lh、其抗体及在病理检测中的应用

Also Published As

Publication number Publication date
AU5615594A (en) 1994-06-08
WO1994011508A3 (fr) 1994-07-07

Similar Documents

Publication Publication Date Title
US6309636B1 (en) Recombinant peptides derived from the Mc3 anti-BA46 antibody, methods of use thereof, and methods of humanizing antibody peptides
US6936706B2 (en) Modified antibodies with human milk fat globule specificity and uses
US20090010848A1 (en) Recombinant Peptides Derived from the Mc3 Anti-BA46 Antibody, Methods of Use Thereof, and Methods of Humanizing Antibody Peptides
US5833943A (en) Minimum recognition unit of a pem mucin tandem repeat specific monoclonal antibody
US8088357B2 (en) Tumor-specific recognition molecules
KR20080106345A (ko) 항-5ｔ4 항체 및 이의 용도
JPH11506435A (ja) 腫瘍特異的抗体を利用する大腸ガンの治療方法
EP0674710B1 (fr) Peptides à large spécificité néoplastique
WO1996008565A9 (fr) PEPTIDES RECOMBINANTS DERIVES DE L'ANTICORPS Mc3 DIRIGE CONTRE L'ANTIGENE BA46, LEURS PROCEDES D'UTILISATION ET PROCEDES D'HUMANISATION D'ANTICORPS PEPTIDIQUES
WO1991013166A1 (fr) Constructions d'anticorps ayant une affinite de liaison amelioree
US5792852A (en) Polynucleotides encoding modified antibodies with human milk fat globule specificity
WO1994011508A2 (fr) Polypeptides presentant une specificite par rapport aux neoplasies, kit et procedes diagnostiques, therapeutiques et de vaccination
JP2001508052A (ja) ホジキンリンパ腫（Ｈｏｄｇｋｉｎ’ｓ ｌｙｍｐｈｏｍａ）の診断および治療方法
EP0723663B1 (fr) Hybridome et anticorps monoclonal humanise anti kc-4, adn et arn encodant ce dernier, trousse, et procedes diagnostiques
CA2101868A1 (fr) Constructions a anticorps se liant aux granulocytes, leur preparation et leur utilisation
COUTO et al. Cloning of cDNAs encoding the variable domains of antibody BrE-3 and construction of a chimeric antibody
AU644413B2 (en) Antibody constructs with enhanced binding affinity
NZ505305A (en) Antigen binding fragments that inhibit an antibody comprising amino acid sequences of H and L chain V regions of a scFv from binding to the surface of a cancer cell

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AT AU BB BG BR CA CH DE DK ES FI GB HU JP KP KR LK LU MG MN MW NL NO PL RO RU SD SE

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

AK Designated states

Kind code of ref document: A3

Designated state(s): AT AU BB BG BR CA CH DE DK ES FI GB HU JP KP KR LK LU MG MN MW NL NO PL RO RU SD SE

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: CA