NZ505305A - Antigen binding fragments that inhibit an antibody comprising amino acid sequences of H and L chain V regions of a scFv from binding to the surface of a cancer cell - Google Patents

Antigen binding fragments that inhibit an antibody comprising amino acid sequences of H and L chain V regions of a scFv from binding to the surface of a cancer cell

Info

Publication number
NZ505305A
NZ505305A NZ505305A NZ50530597A NZ505305A NZ 505305 A NZ505305 A NZ 505305A NZ 505305 A NZ505305 A NZ 505305A NZ 50530597 A NZ50530597 A NZ 50530597A NZ 505305 A NZ505305 A NZ 505305A
Authority
NZ
New Zealand
Prior art keywords
fragment
antibody
antigen
composition
antigen binding
Prior art date
Application number
NZ505305A
Inventor
Michael D Dann
Pradip K Maiti
Howard A Kaplan
Original Assignee
Viventia Biotech Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Viventia Biotech Inc filed Critical Viventia Biotech Inc
Priority claimed from NZ332566A external-priority patent/NZ332566A/en
Publication of NZ505305A publication Critical patent/NZ505305A/en

Links

Landscapes

  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

Described is the monoclonal antibody H11 and antigen binding fragments that specifically bind to the antigen recognized by H11, the C-antigen. The C-antigen is found specifically on neoplastic cells and not on normal cells. Also disclosed are polynucleotide and polypeptide derivatives based on H11, including single chain V region molecules and fusion proteins, and various pharmaceutical compositions. When administered to an individual, the H11 antibody is effective in diagnosing, localizing, and/or treating neoplasias. Further provided are methods for treating a neoplastic disease, particularly melanoma, neuroblastoma, glioma, soft tissue sarcoma, and small cell lung carcinoma. Patients who are in remission as a result of traditional modes of cancer therapy may be treated with a composition of this invention in hopes of reducing the risk of recurrence. Patients may also be treated concurrently with the antibodies and traditional anti-neoplastic agents.

Description

Patents Form # 5 CHANGE OF NAME OF APPLICANT DIVISIONAL OUT OF APPLICATION # PCT/US97/08962 ANTE-DATING REQUESTED TO 22 MAY 1997 NEW ZEALAND Patents Act 1953 COMPLETE SPECIFICATION Title ANTIGEN BINDING FRAGMENTS THAT SPECIFICALLY DETECT CANCER CELLS, NUCLEOTIDES ENCODING THE FRAGMENTS, AND USE THEREOF FOR THE PROPHYLAXIS AND DETECTION OF CANCERS We, Novopharm Biotech Inc.
Address: 30 Novopharm Court, Toronto, Ontario, Canada Nationality: A Canadian company do hereby declare the invention for which we pray that a patent may be granted to us and the method by which it is to be performed, to be particularly described in and by the following statement : " 1 - - ■i 0c,MZ~" PF05 JWP FEE CODE 1050 2 j in la ANTIGEN BINDING FRAGMENTS THAT SPECIFICALLY DETECT CANCER CELLS, NUCLEOTIDES ENCODING THE FRAGMENTS, AND USE THEREOF FOR THE PROPHYLAXIS AND DETECTION OF CANCERS TECHNICAL FIELD This invention relates to antibodies specific to an antigen detected on neoplastic cells but not on normal cells. This antigen is termed herein the "C-antigen." The C-antigcn is recognized by the human monoclonal antibody (Mab) termed "HI 1The invention encompasses a wide variety of antibodies, and functional derivatives thereof that retain the immunologic specificity of HI 1 and are termed herein "aC." The exemplary antibody. Hi 1. compositions comprising the HI 1, and hybridomas producing HI 1 are included herein. The HI 1 V region polynucleotides and polypeptides encoded thereby and recombinant molecules containing these polynucleotides are also encompassed by the invention. Methods of use including therapeutic and diagnostic of the aC antibodies are also included in the invention.
BACKGROUND ART In spite of numerous advances in medical research, cancer remains the second leading cause of death in the United States. In the industrialized nations, roughly one in five persons will die of cancer. Traditional modes of clinical care, such as surgical resection, radiotherapy and chemotherapy, have a significant failure rate, especially for solid tumors. Failure occurs either because the initial tumor is unresponsive, or because of recurrence due to regrowth at the original site and/or metastases. Even in cancers such as breast cancer where the mortality rate has decreased, successful intervention relies on early detection of the cancerous cells. The etiology, diagnosis and ablation of cancer remain a central focus for medical research and development.
Neoplasia resulting in benign tumors can usually be completely cured by removing the mass surgically. If a tumor becomes malignant, as manifested by invasion of surrounding tissue, it becomes much more difficult to eradicate. Once a malignant tumor metastasizes, it is much less likely to be eradicated.
WO 97/44461 PCT/US97/08962 The three major canccrs, in terms of morbidity and mortality, are colon, breast and lung. New surgical procedures offer an increased survival rate for colon cancer. Improved screening methods increase the detection of breast cancer, allowing earlier, less aggressive therapy. Numerous studies have shown that early detection increases survival and treatment options. Lung cancer remains largely refractory to treatment.
Excluding basal cell carcinoma, there are over one million new cases of cancer per year in the United States alone, and cancer accounts for over one half million deaths per year in this country. In the world as a whole, the five most common cancers are those of lung, stomach, breast, colon/rectum, and uterine cervix, and the total number of new cases per year is over 6 million. Only about half the number of people who develop cancer die of it.
Melanoma is one of the human diseases for which there is an acute need of new therapeutic modalities. It is a particularly aggressive form of skin canccr, and occurs in increased frequency in individuals with regular unguarded sun exposure. Ln the early disease phases, melanoma is characterized by proliferation at the dermal-epidermal junction, which soon invades adjacent tissue and metastasizes widely. Oncc it has metastasized, it is often impossible to extirpate and is consequently fatal. Worldwide, 70,000 patients are diagnosed with melanoma and it is responsible for 25,000 reported deaths each year. The American Cancer Society projects that by the year 2000, 1 out of every 75 Americans will be diagnosed with melanoma.
Neuroblastoma is a highly malignant tumor occurring during infancy and early childhood. Except for Wilra's tumor, it is the most common retroperitoneal tumor in children. This tumor metastasizes early, with widespread involvement of lymph nodes, liver, bone, lung, and marrow. While the primary tumor is resolvable by resection, the recurrence rate is high.
An estimated 178,100 new cases of lung cancer will be diagnosed in 1997, accounting for 13% of cancer diagnoses. An estimated 160,400 deaths due to lung cancer will occur in 1997 accounting for 29% of all cancer deaths. The one year survival rates for lung cancer have increased from 32% in 1973 to 41% in 1993, largely due to improvements in surgical techniques. The 5 year survival rate for all stages combined is WO 97/44461 PCT/US97/08962 only 14%. The survival rate is 48% for cases detected when the disease is still localized, but onlv 15% of lung cancers are discovered that early Small cell lung cancer is the most malignant and fastest growing form of lung cancer and accounts for 20-25% of new cases of lung cancer. 60,000 cases will be diagnosed in the U.S. in 1996. The primary tumor is generally responsive to chemotherapy, but is followed by wide-spread metastasis. The median survival time at diagnosis is approximately 1 year, with a 5 year survival rate of 5-10%.
Breast cancer is one of the most common cancers and is the third leading cause of death from cancers m the United States with an annual incidence of about 180.200 new cases among women in the United States during 1997 About 1.400 new cases of breast cancer will be diagnosed in men m 1997. In industrialized nations, approximately one in eight women can expect to develop breast cancer. The overall mortality rate for breast cancer has remained unchanged since 1930. It has increased an average of 0.2% per year, but decreased in women under 65 years of age by an average of 0 3% per year.
Preliminary data suggest that breast cancer mortality may be beginning to decrease, probably as a result of increased diagnoses of localized cancer and carcinoma in situ. See e.g., Marchant (1994) Contemporary Management of Breast Disease II: Breast Cancer, in: Obstetrics and Gynecology Climes of North America 21:555-560; and Colditz (1993) Cancer Suppl. 71:1480-1489. An estimated 44,190 deaths (43.900 women. 290 men) in 1997 will occur due to breast cancer. In women, it is the second major cause of cancer death after lung cancer. The five-year survival rate for localized breast cancer has increased from 72% in the 1940s to 97% today. If the cancer has spread regionally, however, the rate is 76%, and for women with distant metastases the rate is 20%. Survival after a diagnosis of breast cancer continues to decline beyond five years. Sixty-five percent of women diagnosed with breast cancer survive 10 years and 56% survive 15 years.
Non-Hodgkin's B cell lymphomas are cancers of the immune system that are expected to afflict approximately 225,000 patients in the United States in 1996. These cancers are diverse with respect to prognosis and treatment, and are generally classified into one of three grades. The median survival of the lowest grade is 6.6 years and the 4 higher grade cancers have much lower life expectancy. Virtually all non-Hodgkin's B cell lymphomas are incurable. New diagnoses of non-Hodgkins lymphomas have increased approximately 7% annually over the past decade, with 52.700 new diagnoses estimated for 1996. The increase is due in part to the increasing prevalence of lymphomas in the AIDS patient population.
Colon and rectal cancer will account for an estimated 131,200 cases in 1997, including 94.100 of colon canccr and 37,100 of rectal cancer. Colorectal cancers account for about 9% of new cancer diagnoses. An estimated 54,900 deaths due to colorectal cancer will occur in 1997, accounting for about 10% of cancer deaths. Mortality rates for colorectal canccr have fallen 32% for women and 14% for men during the past 20 years, reflecting decreasing incidence rates and increasing survival rates. However, the mortality rate in African American men continues to rise. The 1 and 5 year relative survival rates for patients with colon and rectal cancer are 82% and 61%, respectively. When colorectal cancers are detected in an early, localized stage, the 5 year survival rate is 91%, however, only 37% of colorectal cancers are discovered at that stage. After the cancer has spread regionally to involve adjacent organs or lymph nodes, the rate drops to 63% Survival rates for persons with distant metastases is 7%. Survival continues to decline beyond 5 years, and 50% survive 10 years.
In spite of the difficulties, effective cures using anticancer drugs (alone or in combination with other treatments) have been devised for some formerly highly lethal cancers. Most notable among these are Hodgkin's lymphoma, testicular cancer, choriocarcinoma, and some leukemias and other cancers of childhood. For several of the more common cancers, early diagnosis, appropriate surgery or local radiotherapy enables a large proportion of patients to recover.
Current methods of cancer treatment are relatively non-selective. Surgery removes the diseased tissue, radiotherapy shrinks solid tumors and chemotherapy kills rapidly dividing cells. Chemotherapy, in particular, results in numerous side effects, in some cases so severe to preclude the use of potentially effective drugs. Moreover, cancers often develop resistance to chemotherapeutic drugs.
Numerous efforts are being made to enhance the specificity of cancer therapy. For review, see Kohn and Liotta (1995) Cancer Res. 55:1856-1862. In particular, identification of cell surface antigens expressed exclusively or preferentially on certain tumors allows the formulation of more selective treatment strategies. Antibodies directed to these antigens have been used in immunotherapy of several types of cancer.
The basic immunoglobulin (Ig) structural unit in vertebrate systems is composed of two identical light ("L") polypeptide chains (approximately 23 kDa), and two identical heavy ("H") chains (approximately 53 to 70 kDa). The four chains are joined by disulfide bonds in a *'Y" configuration. At the base of the Y. the two H chains are bound by covalent disulfide linkages.
Figure 1 shows a schematic of an antibody structure. The L and H chains are each composed of a variable (V) region at the N-terminus, and a constant (C) region at the C-terminus. In the L chain, the V region (termed "VlJl") is composed of a V (Vl) region connected through the joining (JL) region to the C region (CJ. In the H chain, the V region (VHDHJH) is composed of a variable (VH) region linked through a combination of the diversity (DH) region and the joining (JH) region to the C region (CH). The VLJL and VhDhJh regions of the L and H chains, respectively, are associated at the tips of the Y to form the antigen binding portion and determine antigen binding specificity.
The (CH) region defines the isotype. i.e.. the class or subclass of antibody. Antibodies of different isotypes differ significantly in their effector functions, such as the ability to activate complement, bind to specific receptors (e.g., Fc receptors) present on a wide variety of cell types, cross mucosal and placental barriers, and form polymers of the basic four-chain IgG molecule.
Antibodies are categorized into "classes" according to the CH type utilized in the immunoglobulin molecule (IgM, IgG, IgD, IgE, or IgA). There are at least five types of CH genes (Cfx, Cy, C5, Ce, and Ca), and some species have multiple CH subtypes (e.g., Cy,, Cy2, Cy3, and Cy4, in humans). There are a total of nine CH genes in the haploid genome of humans, eight in mouse and rat, and several fewer in many other species. In contrast there are normally only two types of L chain C regions (CL), kappa (tc) and lambda (A.), and only one of these C regions is present in a single L chain protein (i.e., 97/44461 6 there is only one possible L chain C region for eveiv VLJL produced). Each H chain class can be associated with either of the L chain classes (e.g.. a CMy region can be present in the same antibody as either a k or X L chain), although the C regions of the H and L chains within a particular class do not vary with antigen specificity (e.g., an IgG antibody always has a Cy H chain C region regardless of the antigen specificity).
Each of the V, D, J, and C regions of the H and L chains are encoded by distinct genomic sequences. Antibody diversity is generated by recombination between the different V,,. Dn. and JH gene segments in the H chain, and VL and JL gene segments in the L chain. The recombination of the different VH, DH, and J„ genes is accomplished by DNA recombination during B ccll differentiation. Briefly, the H chain sequence rccombines first to generate a DHJH complex, and then a second recombinatorial event produces a VhDhJu complex. A functional H chain is produced upon transcription followed by splicing of the RNA transcript. Production of a functional H chain triggers recombination in the L chain sequences to produce a rearranged VLJL region which in turn forms a functional VLJLCt region, i.e.. the functional L chain.
The value and potential of antibodies as diagnostic and therapeutic reagents has been long-recognized in the art. Unfortunately, the field has been hampered by the slow, tedious processes required to produce large quantities of an antibody of a desired specificity. The classical cell fusion techniques allowed for efficient production of Mabs by fusing the B cell producing the antibody with an immortalized cell line. The resulting cell line is a hybridoma cell line.
Antibodies and functional derivatives thereof have been used in a variety of clinical settings. For instance, digoxin-specific Fab antibody fragments were used to treat life-threatening digitalis intoxication. Antibodies are becoming more routinely useful in diagnostic techniques such as Tadioimmune diagnosis of colon cancers. Koda et al. (1995) Am. J Gastroenterol 90:1644. A number of uses of Mabs, previously thought to be untenable, have recently been put into practice. For instance, see Hall (1995) Science 279:915-916.
A number of autoantibodies (antibodies that recognize and bind to self antigens) are found in humans. Many of these are associated with particular diseases such as 7 rheumatoid arthritis, systemic lupus erythematosus, myasthenia gravis, primary biliary cirrhosis, polymyositis, systemic vasculitis, idiopathic necrotizing and crescentic glomerulonephritis and amyotrophic lateral sclerosis. For review, see Shattner (1986/1987) Immunol Lett. 14:143-153. Other autoantibodies are naturally-occurring. Lutz and Wipp (1982) J. Immunol. 128.1965: and Guilben et al. (1982) J. Immunol. 128:2779-2787. Recently, human autoantibodies to specific cancer antigens have been detected and. in some cases, are being produced by hvbridoma technology. These antibodies have also been produced by active immunization. United States Patent No. 5.474.755. Originally, the human B cells were immortalized using Epstein-Barr Virus or mouse myelomas. For review, see Buck et al. (1984) "Monoclonal Antibodies" NY. Plenum Press. More recent techniques have allowed immortalization without the use of this potentialK harmful virus. See. e.g., U.S. Patent No. 4.618,477; and Glassy (1987) Cancer Rei 47:5181-5188. In most instances, the antibodies are specific for one, or in some instances, a few, cancer types. For instance, a Mab has been described that specifically recognizes glioma cells but no other tumor or normal cells. These antibodies were used to image the glioma in the patient's brain. Fischer et al. (1991) Immunobiol. Prot. Pep. VI (M- Atassi, ed.) Plenum Press. NY. pp. 263-270. No antibody has been described that is capable of recognizing a wide range of tumors while failing to recognize, or only poorly recognize, normal, non-cancerous cells.
Recombinant genetic techniques have allowed cloning and expression of antibodies, functional fragments thereof and the antigens recognized. These engineered antibodies provide novel methods of production and treatment modalities. For instance, functional immunoglobulin fragments have been expressed in bacteria and transgenic tobacco seeds and plants. Skerra (1993) Curr. Opin. Immunol. 5:256-262; Fiedler and Conrad (1995) Bio/Technology 13:1090-1093; Zhang et al. (1993) Cancer Res. 55:3384-3591; Ma et al. (1995) Science 268:916; and, for a review of synthetic antibodies, see Barbas (1995) Nature Med. 1:836-839.
Several human Mabs against tumor associated antigens have been produced and characterized. The tumor associated antigens recognized by human Mabs include cell surface, cytoplasmic and nuclear antigens. Yoshikawa et al. (1989) Jpn. J Cancer Res WO 97/44461 PCT/US97/08962 (Gann) 80:546-553: Yamaguchi et al. (1987) Proc. Natl. Acad Sci. USA 84:2416-2420: Haspel et al. (1985) Cancer Res. 45:3951-3961; Cote et al. (1986) Proc. Natl. Acad. Sci USA 83.2959-2963: Glassy (1987) Cancer Res 47:5181-5188; Borup-Christensen et al. (1987) Cancer Detect. Prevent Suppl. 1:207—215: Haspel et al. (1985) Canccr Re.j. 45:3951-3961: Kan-Mitchell et al. (1989) Cancer Res. 49:4536—4541; Yoshikawaet al. (1986) Jpn J Cancer Res. 77 1122-1133; and McKnight ei al. (1990) Human Antibod. Hybridomas 1:125-129.
Human Mabs have been used in cancer imaging, diagnosis and therapy. Olsson (1985) J Nat. Cancer Inst 75:397-404: Larrick and Bourla (1986) J. Biol. Resp. Mod 5.379-393: McCabe ct al. (1988) Cancer Res 48:4348-4353: Research News (1993) Science 262:841; Diizel et al. (1994) Cancer 73:858-863: and Alonso (1991) ^4/n. J. Clin. Oncol. 4:463-471. A recombinant single chain bispecific antibody has been reported that has high tumor cell toxicity. This molecule recognizes both the CD3 antigen of human T cells and EpCAM. which is associated with disseminated tumor cells in patients with minimal residual colorectal cancer. Mack et al. (1995) Proc. Natl. Acad. Sci. USA 92:7021-7025.
Several murine monoclonal anti-GD2 aniibodies were reported to suppress the growth of tumors of neuroectodermal origin in athymic (nu/nu) mice or cause remission in patients with metastatic melanoma. A human-mouse chimeric anti-GD2 antibody caused remission in patients with metastatic neuroblastoma. The mechanism of action of the antibodies is thought to involve antibody dependent cellular cytotoxicity (ADCC) or complement-mediated cytotoxicity (CMC). Clinical responses have been obtained by treating melanoma with Mabs against GM2, GD2 and GD3. Cheresh et al. (1985) Proc. Natl. Acad. Sci. USA 82:5155-5159. Active immunization with a ganglioside vaccine comprising GM2 produced anti-GM2 antibodies in 50/58 patients, who survived longer on averagfe than patients without detectable anti-GM2 antibody.
Mabs to GD2 have also been found to react specifically with small cell lung carcinoma. Cheresh et al. (1986) Cancer Res. 46:5112-5118. Human Mabs specific for other cancers including lung, melanoma, stomach, squamous cell carcinoma, cervical carcinoma, and mammary carcinoma have also been produced. Murakami (1985) in Vitro 9 Cell. Dev. Biol. 21:593: Schadendorf (1989) J. Immunol. 142:1621-1625; Yoshikawa « al. (1986) Jpn. J. Cancer Res. 77:1122-1133; Pickering and Misra (1984) Clin. Immunol. Immunopaihol 32:253-260; Hagiwara and Sato (1983) Mol Biol Med. 1:245-252; and Schlom et al. (1980) Proc. Natl. Acad. Set. USA 77:6841-6845. Human anti-cancer Mabs and ihc antigens they recognize have also been suggested for use in vaccines. See, e.g.
Finn et al. (1995) Immunol. Rev. 145:61-89. A human Mab to malignant brain tumors was used in a phase I clinical trial without adverse side effects. Matsumoto et al. (1994) The Clinical Report 28:118-126. Phase II trial results have been reported on combined treatment with murine Mab and colony stimulating factor in metastatic gastrointestinal canccr. Saleh ci al. (1995) Cancer Res 55:4339-4346 A single chatn immunotoxin has also been found to cure carcinomatous meningitis in a rat model Pastan et al. (1995) Proc. Nail Acad Sci. USA 92:2765-2769. Human Mabs that specifically recognize ovarian canccr cclls have been shown to effectively image this cancer. Chaudhuri et al. (1994) Canccr 73: 1098-1104.
If there were a simple and reliable strategy for providing immune reactivity against an antigen common to these cancers rather than cancer-specific immunity, the clinical prospects of cancers in general would improve. All references cited herein are hereby incorporated by reference in their entirety.
DISCLOSURE OF THE INVENTION This invention encompasses compositions containing antigen binding fragments of an antibody where the antibody specifically recognizes the antigen recognized by an antibody comprising a H chain V region having the amino acid sequence of SEQ ID NO:2 and a L chain V region having the amino acid sequence of SEQ ID NO:4. Preferably, the antibody is Hi 1. The invention further encompasses antibodies comprising the H and L chain V regions of HI 1 (SEQ ID NOS:2 and 4, respectively). HI 1 specifically recognizes cancer cells from a wide variety of cancers but does not recognize normal, non-cancerous cells. By "does not recognize" is meant that noncancer cells are either not specifically bound to by HI 1 or arc only poorly recognized by the antibody. The antibodies are designated aC and include HI 1 and any antibody with the "immunologic specificity" of Hi 1, that is, recognizing the antigen recognized by HI 1. and that is specific for at least one type of cancer ccll but does not recognize normal cells. These antigen binding fragments include, but are not limited to, whole native antibodies, exemplified by HI 1; bispecific antibodies: chimeric antibodies: Fab, Fab', single chain V region fragments (scFv) and fusion polypeptides.
The invention further encompasses HI 1 antibody fusion molecules comprising a polypeptide region with an antigenic, therapeutic, toxic or labeling molecule attached to the H chain C region, a single-chain VH—VL or VL—VH V region, and polynucleotides encoding such polypeptides.
Also embodied in the invention are polypeptides having the immunologic specificm of Hi 1, wherein the polypeptide comprises at least 5 consecutive amino acids from a V region of an aC antibody. The V region may be from a L chain or H chain. The 5 consecutive amino acids preferably play a role in immunologic specificity, and may be from a CDR (Complementarity Determining Region of an antibody). Intact HI 1, functionally active fragments of HI 1, fusion proteins, chimeric antibodies, multiple antigen proteins, and other polypeptide derivatives of aC antibodies are included. Of special interest are single-chain V regions and fusion proteins.
The compounds and compositions of this invention may be used inter alia for detecting or treating a cancer, including therapy of such cancer, and prophylactic care, particularly for decreasing the risk of recurrence.
The invention further embodies cells and cell lines producing the uC antigen binding fragments.
Another embodiment of this invention is a polynucleotide comprising a sequence encoding a polypeptide with the immunologic specificity of HI 1, wherein the encoded polypeptide comprises at least 5 consecutive amino acids from a V region of HI 1. The V region may be from either the HI 1 L chain or H chain. The 5 consecutive amino acids preferably play a role in HI 1 immunologic reactivity, and may be from a CDR, The V region of Hi 1 has been found to have a small region of homology to an antibody designated A6. Peptides comprised solely of this region of homology and lacking other 11 Hi 1-specific amino acid residues are specifically excluded from the claimed invention. A6 is described in W0953574.
The invention also encompasses isolated polynucleotides of at least 20 consecutive nucleotides capable of forming a stable duplex with the HI 1 L or H chain encoding sequences, but not with sequences forother previously described immunoglobulin molecules. Any of these polynucleotides may be in the form of cloning vectors, expression vectors, or transfected into host cells.
A further embodiment of this invention comprises prophylactic treatment of a cancer patient with at least one aC antigen binding fragment. Preferably, aC is fused to a therapeutic molecule to effcct delivery of the therapeutic molecule to the cancer cell. The individual may have a clinically detectable tumor, or the tumor may have been previously treated and rendered undetectable. The method may be for palliating the disease, or for reducing the risk of recurrence.
A further embodiment of the invention is a kit for detection or quantitation of the antigen recognized by aC (hereinafter, the "C-antigen") in a sample, comprising Hi 1 or a polypeptide of this invention in suitable packaging. Also embodied by the invention are methods for detecting the C-antigen or cells expressing the C-antigen by employing a reagent or kit embodied in this invention BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 depicts a schematic of the general antibody structure.
Figure 2 depicts flow cytometric analysis of cells recognized by HI 1.
Figure 3 depicts flow cytometric analysis of cells recognized by Hi 1.
Figure 4 depicts flow cytometric analysis of cells recognized by HI 1. A is A-375 (melanoma), B is SKMG-1 (glioma), C is SK-BR-3 (breast adenocarcinoma), D is HT-29 (colon adenocarcinoma), E is MB-468 (breast carcinoma), and F is T47D (breast carcinoma).
Figure 5 depicts binding of HI 1 to tumor cell extracts. The light bars represent HI 1 and the dark bars represent control antibody.
Figure 6 depicts binding of HI 1 to tumor cell extracts. 12 Figure 7 depicts binding of HI 1 lo human tumor cell lines by cell-fixed ELISA. The light bars arc HI 1 IgM and the dark bars are control IgM.
Figure 8 depicts a schematic of the expression vector pSJFl.
Figure 9 depicts the determination of the antigenic similarities between Mab Hi 1 and HI 1-scFv by cell fixed ELISA. Reactivity was determined by rabbit antibody to Hi 1 scFv.
Figure 10 depicts the relative fluorescence intensity of biotinylated HI 1-scFv (thick line) and BGA scFv (thin line) to lymphoma cells.
Figure 11 depicts the titration of the reactivity of biotinylated HI 1-scFv for the binding to lymphoma cells. RAMOS, Daudi. CA-46 and CCRF-CEM cells as determined by cell fixed ELISA. The antibody concentrations decrease from an initial 10 jig/mL (open bar) to 5 ng/mL. then 2.5 p.g/mL and finally, 1.25 jig/mL (doubly cross-hatched line).
Figure 12 depicts the relative fluorescence intensity of HI 1-scFv and control scFv binding to tumor cell lines. A is A-375 (melanoma), B is SK-BR-3 (breast adenocarcinoma), C is HT-29 (colon adenocarcinoma). D is CA-46 (Burkitt's lymphoma), E is RAMOS (Burkitt's lymphoma), F is H9 (T cell lymphoma), and G is CCRF-CEM (acute lymphoblastoid lymphoma).
Figure 13 depicts the binding of lZ5I-Hl 1-scFv to LS174T cells.
Figure 14 depicts the binding of UII-H11-scFv to A3 75.
Figure 15 depicts the mammalian expression vector pNB2 used to transfect and express recombinant HI 1-IgG.
Figure 16 depicts the mammalian expression vector pNB3 used to transfect and express recombinant HI 1-IgG.
Figure 17 depicts the purification of mI«Hl 1 -scFv on P-2 minicolumn (A) and analysis of ,23I-H11-scFv by paper chromatography in 85% methanol (B).
Figure 18 depicts the purification of l25I-Hl 1 IgM on a Sephadex G-25 minicolumn (A) and analysis of mI-Hl 1 IgM by paper chromatography in 85% methanol (B).
Figure 19 depicts the purification of mIn-DTPA-Hl 1-scFv on Sephadex G-50 minicolumn (A) and analysis of ,uIn-DTPA*Hl 1-scFv by ITLC-SG/0.1M citrate (B). 13 Figure 20 depicts in vivo binding of 1,lIn-Hl 1-scFv to A375 .xenograft tumors in nude mice.
BEST MODE FOR CARRYING OUT THE TNVF.NTTON This invention encompasses antigen binding fragments exemplified by a newly identified human Mab that recognizes specifically cancerous cells. This specificity extends only to cancer cells, and the antibody does not recognize non-cancerous cells. The exemplary antibody is designated HI 1 and the variable regions are encoded by SEQ ID NOS. 1 and 4 (SEQ ID NOS:3 and 6 being the complementary strands of 1 and 4. lespcctively) and rccogni2es the antigen designated "C-antigen." The specificity of HI 1 includes, but is not limited to, glioblastoma, neuroblastoma, malignant melanoma, breast adenocarcinoma, lung adenocarcinoma, small cell lung carcinoma, colon adenocarcinoma and prostate adenocarcinoma.
As shown in the examples herein. Hi 1 and Hi 1-scFv do not recognize noncancerous cells from all normal tissues tested. HI 1 and aC antigen binding fragments are therefore useful in palliating the clinical conditions related to a wide variety of cancers. The invention comprises antigen binding fragments recognizing the antigen HI 1 is specific for (designated C antigen). The invention further comprises polypeptide derivatives of Hi 1 and methods for using these compositions in diagnosis, treatment, and manufacture of novel reagents. The invention further encompasses polynucleotides encoding aC, HI 1 and derivatives thereof. Methods of use thereof are also encompassed by the invention.
The invention further encompasses aC derivatives with immunologic specificity for the C-antigen. These derivatives comprise regions of the polypeptide sequence comprising part of the HI 1 VDJ junction. Also encompassed are regions spanning at least one, preferably 2, and more preferably 3 or more of the HI 1 CDR amino acid sequences.
The full sequences of the HI 1 L and H chain C regions have not been determined, but are expected to be identical or nearly identical to those of other human immunoglobulin molecules. Further, knowledge of the V region amino acid sequences allows subcloning with any C region. Such subcloning techniques are well known in the 14 an. The chimeric molecules produced by these cloning techniques are also encompassed by the invention.
Screening a commercial heptapeptide phage library with HI 1 IgM and scFv antibody clones has shown a very strong consensus sequence at the N-termmus having the following amino acid sequence: Phc-His-Arg-Tyr-Ser/Thr. The results are shown in Table 1.
TABLE I IgM Hi 1 pannings Ml Phe-His-Arg-Tyr-Ser-Leu-Pro M2 Phe-His-Arg-Tvr-Ser-Asp-Tyr M3 Phe-His-Arg-Tyr-Ser-Leu-Pro M4 Phe-His-Arg-Tyr-Ser-Pro-Thr M7 Phe-His-Arg-Tyr-Thr-Pro-Gly M8 Phe-His-Arg-Tyr-Ser-Leu-Pro M10 Phe-His-Arg-Tyr-Ser-Pro-Thr sfFvHll pannings S2 Phe-His-Arg-Tyr-Ser-Leu-Pro S5 Met-His-Arg-Tyr-Thr-Pro-Leu The DNA sequences use multiple codons. indicating quite different phage origins. For example, the Are is coded by triplets CGx and AGx families. In addition, comparison of the HI 1 pentapeptide consensus with sequence databases showed homology to the SI 00 family of Ca2+ binding proteins. The results are shown in Table 2.
TABLE 2 HI 1 pcntapeptjde 5. griseus protein Peanut stuni virus Human caicvclin Cystic Fibrosis Ag Phe-His-Arg-T yr-Ser/Thr Phe-His-Arg-Tyr-Ser (amino acids 2M -255) Phe-His-Arg-Tyr-Ser (amino acids 5'>0-544) Phe-His-Lys-Tvr-Ser (amino acids 16-20) Tyr-His-Lys-Tyr-Ser (amino acids l(j-21) The consensus pentapeptide sequences described herein are encompassed by the present invention.
Certain compounds, compositions and methods described in this application relate generally to aC and derivatives thereof which are rouunely generated by classical techniques of immunochemistry. This includes aC which has been coupled to another compound by chemical conjugation, or by mixing with an excipient or an adjuvant. The term aniigen binding fragment includes any peptide that binds to the C antigen m a cancer cell-specific manner. Typically, these derivatives include such immunoglobulin fragments as Fab. F(ab')2, Fab', scFv (both monomers and polymeric forms) and isolated H and L chains. An antigen binding fragment retains the specificity of HI 1. although avidity and/or affinity may be altered. Especially preferred is the Hi 1-scFv described hen sin.
The antigen binding fragments (also termed "derivatives" herein) ar: typically generated by genetic engineering, although they may alternatively be obtair ed by other methods and combinations of methods. This classification includes, but is not limited to, engineered peptide fragments and fusion peptides. Preferred compounds include polypeptide fragments of the HI 1 CDRs, antibody fusion proteins comprising cytokine effector components, antibody fusion proteins comprising adjuvants or drugs, and single-chain V region proteins.
The invention further comprises polynucleotides encoding the Hi 1 mtibody V regions and derivatives thereof. These include isolated polynucleotide fragments, recombinant polynucleotides, and therapeutic plasmids and vectors, such a; vaccinia vectors, comprising the polynucleotides. These polynucleotides are exemp lified by SEQ ID NOS:I,3,4, 6, 13,15, 16, and 18. 16 Pharmaceutical compositions and treatment modalities of this invention are suitable for eliciting an immune response against neoplasia. Human cancer patients, including, but not limited to, glioblastoma, melanoma, neuroblastoma, adenocarcinoma, glioma, soft tissue sarcoma, and various carcinomas (including small cell lung cancer) are especially appropriate subjects.
As Hi 1 has been shown to recognize specifically a variety of carcinomas, it is particularly useful in diagnosis, imaging and treatment of carcinomas. Suitable carcinomas include any known in the field of oncology, including, but not limited to. astrocytoma, oligodendroglioma, ependymoma, mcdulloblastoma, primitive neural ectodermal tumor (PNET), pancreatic ductal adenocarcinoma, small and large cell lunc adenocarcinomas, squamous cell carcinoma, bronchoaiveolarcarcinoma, epithelial adenocarcinoma, and liver metastases thereof, hepatoma, cholangiocarcinoma. breast tumors such as ductal and lobular adenocarcinoma, squamous and adenocarcinomas of the uterine cervix, uterine and ovarian epithelial carcinomas, prostatic adenocarcinomas, transitional squamous cell carcinoma of the bladder, B and T cell lymphomas (nodular and diffuse) plasmacytoma, acute and chronic leukemias. malignant melanoma, soft tissue sarcomas and leiomyosarcomas.
The subjects may have an advanced form of disease, in which case the treatment objective may include mitigation or reversal of disease progression, and amelioration of side effects. The subjects may have had a history of the condition, for which they have already been treated, in which case the objective will typically include a decrease or delay in the risk of recurrence.
Additionally, the antigen binding fragments of this invention can be used as diagnostic and imaging reagents. These applications are described in more detail in the sections that follow.
MH11" is an antibody obtained from the fusion of peripheral blood lymphocytes of a 64 year old male with a low grade glioma and fused to a human myeloma cell line to produce a hybridoma designated NBGM 1/Hl 1 The generation and characterization of HI 1 is described in Example 1. "aC" represents any antibody, or antigen binding fragment thereof, either monoclonal, polyclonal or derivative thereof that recognizes 17 specifically the C antigen and distinguishes between canccr and noncancer cells. aC includes Hi 1.
"Immunologic activity" of aC refers to the ability to specifically bind C antigen. Such binding may or may not elicit an immune response. A specific immune response may comprise antibody. B cells. T cells, and any combination thereof, and effector functions resulting therefrom. Included are the antibody-mediated functions ADCC and complement-mediated cytolvsis (CDC). The T cell response includes T helper cell function, cytotoxic T cell function, inflammaiion/inducer T cell function, and T cell mediated suppression. A compound able to elicit a specific immune response according to any of these criteria is referred to as ""immunogenic." aC "activity" or "function" refers to any of the immunologic activities of aC, or to any other biological activity ascribed to HI I in this disclosure, including the role of HI 1 in the detection, amelioration or palliation of cancer.
The "V region" of Hi 1 refers to the V region of the HI 1 L chain or the V region of the HI 1 H chain, either alone or in combination. These V regions are depicted in SEQ ID NOS: 2 and 5; the DNA encoding these regions is depicted in SEQ ID NOS: 1 and 4, respectively.
GM-CSF. IL-2. and other biologically active molecules referred to herein are meant to include fragments and derivatives based on the respective parent molecule that have the same biologic or physiologic function.
The terms "polypeptide", "peptide" and "protein" axe used interchangeably herein to refer to polymers of amino acid residues of any length. The polymer may be linear or branched, it may comprise modified amino acids or amino acid analogs, and it may be interrupted by chemical moieties other than amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling or bioactive component Unless stated or implied otherwise, the term aC or HI 1 includes any polypeptide monomer or polymer with HI I immunologic specificity, including the intact aC antibody, and smaller and larger functionally equivalent polypeptides. 97/44461 18 ' A "fusion polypeptide" is a polypeptide comprising regions in a different position in the sequence than occurs in nature. The regions may normally exist in separate proteins and are brought together in the fusion polypeptide: they may normally exist in the same protein but are placed in a new arrangement in the fusion polypeptide; or they may be synthetically arranged. For instance, as described below, the invention encompasses recombinant proteins (and the polynucleotides encoding the proteins) that are comprised of a functional portion of aC and a toxin. Methods of making these fusion proteins are known in the art and are described for instance in W093/07286.
A "functionally equivalent fragment'" of a aC polypeptide varies from the native sequence by any combination of additions, deletions, or substitutions while preserving at least one functional property of the fragment relevant to the context in which it is being used. A functionally equivalent fragment of a aC polynucleotide either encodes a polypeptide that is functionally equivalent lo HI 1 when produced by an expression system, or has similar hybridization specificity as a HI 1 polynucleotide when used in a hybridization assay. A functionally equivalent fragment of a aC polypeptide typically has one or more of the following properties: ability to bind C antigen: ability to bind at least one type of cancer cell in a specific manner; and an ability to elicit an immune response with a similar antigen specificity as that elicited by HI 1.
A "polynucleotide" is a polymeric form of nucleotides of any length, which contain deoxyribonucleotides, ribonucleotides, and analogs in any combination analogs. Polynucleotides may have any three-dimensional structure, and may perform any function, known or unknown. The term "polynucleotide" includes double-, single-stranded, and triple-helical molecules. Unless otherwise specified or required, any embodiment of the invention described herein that is a polynucleotide encompasses both the double-stranded form and each of two complementary single-stranded forms known or predicted to make up the double stranded form of either the DNA, RNA or hybrid molecules.
The following are non-limiting examples of polynucleotides: a gene or gene fragment, exons, introns, mRNA, tRNA, rRNA, ribozymes, cDNA. recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A 19 polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. uracyl. other sugars and linking groups such as fluororibose and thioate. and nucleotide branches. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component. Other types of modifications included in this definition are caps, substitution of one or more of the naturally occurring nucleotides with an analog, and introduction of means for attaching the polynucleotide to proteins, metal ions, labeling components, other polynucleotides, or a solid support.
The term '"recombinant" polynucleotide means a polynucleotide of genomic. cDNA. semisynthetic, or synthetic origin which cither does not occur in nature or is linked to another polynucleotide in a nonnatural arrangement.
A "vector" refers to a recombinant DNA or RNA plasmid or virus that comprises a heterologous polynucleotide to be delivered into a target cell, either in vitro or in vivo. The heterologous polynucleotide may comprise a sequence of interest for purposes of therapy, and may optionally be in the form of an expression cassette. As used herein, a vector need no: be capablc of replication in the ultimate target cell or subject The term includes cloning vectors for the replication of a polynucleotide, and expression vectors for translation of a polynucleotide encoding sequence. Also included are viral vectors, which comprise a polynucleotide encapsidated or enveloped in a viral particle.
A "cell line" or "cell culture" denotes bacterial, plant insect or higher eukaryotic cells grown or maintained in vitro. The descendants of a cell may not be completely identical (either morphologically, genotypically, or phenotypically) to the parent cell. A Mab may be produced by a hybridoma or other cell. Methods of making hybridomas, both murine and human, are known in the art Particular methods of producing human hybridomas are described and referenced throughout the specification.
A "host cell" denotes a prokaiyotic or eukaryotic cell that has been genetically altered, or is capable of being genetically altered by administration of an exogenous polynucleotide, such as a recombinant plasmid or vector. When referring to genetically altered cells, the term refers both to the originally altered cell, and to the progeny thereof.
"Heterologous" means derived from a genotvpically distinct entity from the rest of the entity to which it is being compared. For example, a polynucleotide may be placed by genetic engineering techniques into a plasmid or vector derived from a different source, and is a heterologous polynucleotide. A promoter removed from its native coding sequence and operatively linked to a coding sequence other than the native sequence is a heterologous promoter.
A "signal peptide" or "leader sequence'" is a short amino acid sequence that directs a newly synthesized protein through a cellular membrane, usually the endoplasmic reticulum in eukaryotic cells, and either the inner membrane or both inner and outer membranes of bacteria Signal peptides are typically at the //-terminal portion of a polypeptide and arc typically removed enzymatically between biosynthesis and secretion of the polypeptide from the cell. The signal peptide is not present in the secreted protein, only during protein production.
An "isolated" polynucleotide or polypeptide is one that is substantially free of the materials with which it is associated in its native environment. By substantially free is meant at least 50%, preferably at least 70%, more preferably at least 80%. and even more preferably at least 90% free of these materials.
A "stable duplex" of polynucleotides, or a "stable complex" formed between any two or more components in a biochemical reaction, refers to'a duplex or complex that is sufficiently long-lasting to persist between the formation of the duplex or complex and subsequent detection, including any optional washing steps or other manipulation that may take place in the interim.
A "biological sample" encompasses a variety of sample types, including blood and other liquid samples of biological origin, solid tissue samples such as a biopsy specimens or tissue cultures, or cells derived therefrom and the progeny thereof. The definition also includes samples that have been manipulated in any way after their procurement, such as by treatment with reagents, solubilization, or enrichment for certain components, such as proteins or polynucleotides. The term encompasses various kinds of clinical samples obtained from any species, and also includes cells in culture, cell supematants, and cell lysates. Particularly, for the purposes described herein, biological samples comprise tumor 21 tissue or tissue thought to be tumorous and are obtained for instance by surgical resection, biopsy, aspiration or an) method known in the art.
An "immunogen" refers to composition for human or animal use. which is administered with the intention of conferring to the recipient a degree of specific immunologic reactivity against a particular antigen. The immunologic reactivity may be carried out by antibodies or cells (particularly B cells, plasma cells. T helper cells, and cytotoxic T lymphocytes, and their precursors) that are immunologically reactive against the target, or any combination thereof. For purposes of this invention, the target is primarily tumor-associated C antigen or a tumor-specific portion thereof. The immunologic reactivity may be desired for experimental purposes, for treatment of a particular condition, for the elimination of a particular substance, or for prophylaxis. An active immunogen is intended to elicit an immune response that persists in the absence of the vaccine components.
"Adjuvant" as used herein has several meanings, all of which will be clear depending on the context in which the term is used. In the context of a pharmaceutical preparation, an adjuvant is a chemical or biological agent given in combination with or recombmantly fused to an antigen to enhance immunogenicity of the antigen. In the context of cancer diagnosis or management, adjuvant refers to a class of cancer patients with no clinically detectable tumor mass, but who are suspected of being at risk of recurrence.
When referring to a type of cancer that normally manifests as a solid tumor, a "clinically detectable" tumor is one that is detectable on the basis of tumor mass; i.e., by such procedures as CAT scan. X-Ray, or palpation. Biochemical, histological or immunologic findings alone may be insufficient to meet this definition.
As used herein, "treatment" refers to clinical intervention in an attempt to alter the nanxral course of the individual or cell being treated, and may be performed either for prophylaxis or during the course of clinical pathology. Desirable effects of the treatment include preventing occurrence or recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, 22 preventing metastasis, decreasing the iate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis.
The "pathology" associated with a disease condition is any condition that compromises the well-being, normal physiology, or quality of life of the affected individual. This may involve, but is not limited to, destructive invasion of affected tissues into previously unaffccted areas, growth at the expense of normal tissue function, irregular or suppressed biological activity, aggravation or suppression of an inflammatory or immunologic response, increased susceptibility to other pathogenic organisms or agents, and undesirable clinical symptoms such as pain, fever, nausea, fatigue, mood alterations, and such other features as may be determined by an attending physician.
An "effective amount" is an amount sufficient to effect a beneficial or desired clinical result. An effective amount can be administered in one or more doses. In terms of treatment, an effective amount is amount that is sufficient to palliate, ameliorate, stabilize, reverse or slow the progression of the disease, or otherwise reduce the pathological consequences of the disease. In terms of an adjuvant, an effective amount is one sufficient to enhance the immune response to the immunogen. The effective amount is generally determined by the physician on a case-by-case basis and is within the skill of one in the art-Several factors are typically taken into account when determining an appropriate dosage. These factors include age, sex and weight of the patient, the condition being treated, the severity of the condition and the form of the antibody being administered. For instance, the concentration of scFv need not be as high as that of native antibodies in order to be therapeutically effective.
An "individual", "patient" or "subject" is a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, humans, farm animals, sport animals, and pets.
The practice of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are within the skill of the an. Such techniques are explained fully in the literature, such as, "Molecular Cloning: A Laboratory Manual", second edition (Sambrook et al., 1989); "Oligonucleotide WO 97/44461 PCT/US97/08962 23 Synthesis" (M.J. Gail, ed., 1984); "Animal Cell Culture" (R.I. Freshney, ed.. 1987); "Methods in Enzymology" (Academic Press, Inc.); "Handbook of Experimental Immunology" (D.M. Wei & C.C. Blackwell, cds.); "Gene Transfer Vcctors for Mammalian Cells" (J.M. Miller &. M.P. Calos. eds.. 1987); "Current Protocols in Molecular Biology" (F.M. Ausubel et al., eds.. 1987); "PCR: The Polymerase Chain Reaction", (Mullis et al., eds.. 1994); "Current Protocols in Immunology" (J.E. Coligan et al., eds.. 1991). These techniques are applicable to the production of the polynucleotides and polypeptides of the invention, and, as such, may be considered in making and practicing the invention. Particularly useful techniques for particular embodiments will be discussed in the sections that follow.
The invention also encompasses aC conjugated to a chemically functional moiety. Typically, the moiety is a label capable of producing a detectable signal. These conjugated aC are useful, for example, in detection systems such as quantitation of tumor burden, and imaging of metastatic foci and tumor imaging. Such labels are known in the art and include, but are not limited to, radioisotopes, enzymes, fluorescent compounds, chemiluminescent compounds, bioluminescent compounds substrate cofactors and inhibitors. See, for examples of patents teaching the use of such labels, U.S. Patent Nos. 3.817.837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149; and 4,366.241. The moieties may be covalently linked to aC. recombinant^ linked, or conjugated to the aC through a secondary reagent, such as a second antibody, protein A. or a biotin-avidin complex.
Other functional moieties include signal peptides, agents that enhance immunologic reactivity, agents that facilitate coupling to a solid support, vaccine carriers, bioresponse modifiers, paramagnetic labels and drugs. Signal peptides are described above and include prokaryotic and eukaryotic fonns. Agents that enhance immunologic reactivity include, but are not limited to. bacterial superantigens. Agents that facilitate coupling to a solid support include, but are not limited to, biotin or avidin, Immunogen carriers include, but are not limited to, any physiologically acceptable buffers. Bioresponse modifiers include cytokines, particularly tumor necrosis factor (TNF), interleukin-2, interleukin-4, granulocyte macrophage colony stimulating factor and y interferons. 24 Suitable drug moieties include antineoplastic agents. These include, but are not limited to. radioisotopes, vinca alkaloids such as the vinblastine, vincristine and vindesine sulfates, adriamycin. bleomycin sulfate, carboplatin. cisplatin, cyclophosphamide, cvtarabine. dacarbazine, dactinomycin, duanorubicin hydrochloride, doxorubicin hydrochloride, etoposide, fluorouracil, lomustine, mechlororethamine hydrochloride, melphalan, mercaptopurine, methotrexate, mitomycin, mitotane, pentostatin, pipobroman. procarbaze hydrochloride, streptozotocin, taxol, ihioguanine, and uracil mustard.
Immunotoxins. including single chain molecules, can be produced by recombinant means. Production of various immunotoxins is well-known in the art, and methods can be found, for example, in "Monoclonal Antibody-toxin Conjugates: Aiming the Magic Bullet." Thorpe et al. (1982) Monoclonal Antibodies in Clinical Medicine. Academic Press, pp. 168-190; Vitatta (1987) Science 238:1098-1104; and Winter and Milstein (1991) Narure 349:293-299. Suitable toxins include, but are not limited to, ricin, radionuclides, pokeweed antiviral protein. Pseudomonas exotoxin A, diphtheria toxin, ricin A chain, fungal toxins such as restrictocin and phospholipase enzymes. See, generally, "Chimeric Toxins,"1 Olsnes and Pihl, Pharmac. Ther. 15:355-381 (1981); and "Monoclonal Antibodies for Cancer Detection and Therapy," eds. Baldwin and Byers, pp. 159-179,224—266, Academic Press (1985).
The chemically functional moieties can be made recombinantly for instance by creating a fusion gene encoding the antigen binding fragment and functional regions from other genes (e.g. enzymes). In the case of gene fusions, the two components are present within the same polypeptide gene. Alternatively, the aC antigen binding fragments can be chemically bonded to the moiety by any of a variety of well known chemical procedures. For example, when the moiety is a protein, the linkage may be by way of heterobifunctional cross linkers, e.g., SPDP, carbodiimide glutaraldehyde, or the like. The moieties may be covalently linked, or conjugated, through a secondary reagent, such as a second antibody, protein A, or a biotin-avidin complex. Paramagnetic moieties and the conjugation thereof to antibodies are well-known in the art. See, e.g., Miltenyi et al. (1990) Cytometry 11:231-238.
The aC antibody of this invention can be prepared in several ways. It is most conveniently obtained from cells engineered to express an antigen binding fragment containing SEQ ID NOS:l and 5 or other polynucleotides encoding aC binding fragments. For example, the cells can be cultured in a suitable medium, and spent medium can be used as an antibody source. Optionally, matrix-coated channels or beads and cell co-cultures may be included to enhance growth of antibody-producing cells. For the production of large amounts of antibody, it is generally more convenient to obtain an ascites fluid. The method of raising ascites generally comprises injecting hybridoma cells into an immunologically naive histocompatible or immunotolerant mammal, especially a mouse. The mammal may be primed for ascites production by prior administration of a suitable composition; e.g., Pristanc.
Alternatively, aC can be chemically synthesized using sequence data and other information provided in this disclosure, in conjunction with standard methods of protein synthesis. A suitable method is the solid-phase Merrifield technique. Automated peptide synthesizers are commercially available, such as those manufactured by Applied Biosystems, Inc. (Foster City. CA). aC may also be obtained by employing routine recombinant methods such as described in Sambrook ct al. (1989). For instance, using the amino acid and polynucleotide (SEQ ID NOS. 1-6, and 13-18) sequences and information provided herein, a polynucleotide encoding either the aCHorL chain can be cloned into a suitable expression vector (which contains control sequences for transcription, such as a promoter). The expression vector is in turn introduced into a host cell. The host cell is grown under suitable conditions such that the polynucleotide is transcribed and translated into a protein. H and L chains of aC may be produced separately, and then combined by disulfide bond rearrangement Alternatively, vectors with separate polynucleotides encoding each chain of aC, or a vector with a single polynucleotide encoding both chains as separate transcripts, may be transfected into a single host cell which may then produce and assemble the entire molecule. Preferably, the host cell is derived from a higher eukaryote that can provide the normal carbohydrate complement of the molecule. The aC thus produced can be purified using standard techniques in the art. Polynucleotides encoding 26 aC for use in the production of aC can in turn be obtained from a hybridoma producing a aC antibody, or produced synthetically or recombinantiy from the DNA sequences provided herein.
Another method of obtaining aC is to immunize suitable host animals with C antigen and to follow standard procedures for polyclonal or Mab production. Mabs thus produced can be "humanized" by methods known in the art. Examples of humanized antibodies are provided, for instance, in United Slates Patent Nos. 5,530,101 and 5.585,089.
"Humanized" antibodies are antibodies in which at least part of the sequence has been altered from its initial form to render it more like human immunoglobulins. In one version, the H chain and L chain C regions are replaced with human sequence. This is a fusion polypeptide comprising a HI 1 V region and a heterologous immunoglobulin C region. In another version, the CDR regions comprise HI 1 amino acid sequences, while the V framework regions have also been convened human sequences. See, for example, EP 0329400. In a third version, V regions are humanized by designing consensus sequences of human and mouse V regions, and converting residues outside the CDRs that are different between the consensus sequences. The invention encompasses humanized Mabs.
In making humanized antibodies, the choice of framework residues can be critical in retaining high binding affinity. In principle, a framework sequence from any HuAb can serve as the template for CDR grafting; however, it has been demonstrated that straight CDR replacement into such a framework can lead to significant loss of binding affinity to the antigen. Glaser et al. (1992) J. Immunol 149:2606; Tempest et al. (1992) Biotechnology 9:266; and Shalaby et al. (1992) J. Exp. Med 17:217. The more homologous a HuAb is to the original muAb, the less likely that the human framework will introduce distortions into the murine CDRs that could reduce affinity. Based on a sequence homology search against an antibody sequence database, the HuAb IC4 provides good framework homology to muM4TS.22, although other highly homologous HuAbs would be suitable as well, especially kappa L chains from human subgroup I or H chains from human subgroup III. Kabat et al. (1987). Various computer programs such as WO 97/44461 PCT/US97/08962 27 ENCAD (Levitt et al. (1983) J Moi Biol 168:595) are available to predict the ideal sequence for the V region. The invention thus encompasses HuAbs with different V regions. It is within the skill of one in the art to determine suitable V region sequences and to optimize these sequences. Methods for obtaining antibodies with rcduced inununogenicity are also described in U.S. Patent No. 5.270,202 and EP 699,755.
Methods of antibody production and isolation are well known in the art. See, for example, Harlow and Lane (1988) Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York. The HI 1 antibody is a human immunoglobulin of the IgM subclass, and may be isolated by any technique suitable for immunoglobulins of this isotypc. Purification methods may include salt precipitation (for example, with ammonium sulfate), ion exchange chromatography (for example, on a cationic or anionic exchange column run at neutral pH and eluted with step gradients of increasing ionic strength), gel filtration chromatography (including gel filtration HPLC), and chromatography on affinity resins such as protein A, protein G, hydroxyapatite. and antiimmunoglobulin. HI 1 may also be purified on affinity columns comprising the C antigen; for example, in the form of a purified Abl or Ab3. Preferably, HI 1 is purified using Protein-A-CL-Sepharose™ 4B chromatography followed by chromatography on a DEAE-Sepharose™ 4B ion exchange column.
The invention also encompasses hybrid antibodies, in which one pair of H and L chains is obtained from a first antibody, while the other pair of H and L chains is obtained from a different second antibody. For purposes of this invention, one pair of L and H chains is from aC. In one example, each L-H chain pair binds different epitopes of the C antigen. Such hybrids may also be formed using humanized H or L chains.
Another aC contemplated by this invention is an antibody in which the H or L chain has been modified to provide additional properties. For instance, a change in amino acid sequence can result in reduced inununogenicity of the resultant polypeptide. The changes range from changing of one or more amino acids to the complete redesign of a region such as a C region domain. Typical changes include, but are not limited to, those related to complement fixation, interaction with membrane receptors, and other effector > functions. A recombinant antibody may also be designed to aid the specific delivery of a WO 97/44461 PCMJS97/08962 28 substance (such as a cytokine) to a tumor cell. Also encompassed by the invention are peptides in which various immunoglobulin domains have been placed in an order other than that which occurs in nature.
If aC is to be administered to an individual, it is preferably at least 80% pure, more preferably it is at least 90% pure, even more preferably it is at least 95% pure and free of pyrogens and other contaminants. In this context, the percent purity is calculated as a weight percent of the total protein content of the preparation, and does not include constituents which are deliberately added to the composition after the aC is purified.
The aC antibodies may be used for a number of purposes. These include eliciting an antibody response to produce aaC which can then be used to elicit a T cell response to cxC or the C antigen and treating various types of cancer. These uses are elaborated more fully in a later section.
The invention encompasses polypeptide fragments of aC containing at least a portion of a V region of aC. Preferred fragments are those with the immunologic activity of HI 1. Also preferred are fragments which comprise amino acid sequences substantially different from other immunoglobulins, and fragments comprising a CDR. In one embodiment, the invention includes a polypeptide fragment of the aC H chain V region, comprising at least 25 consecutive amino acids, more preferably 30 consecutive amino acids of SEQ ID NO-2, or 5 consecutive amino acids of the CDRl thereof, or at least 7 consecutive amino acids, preferably at least 9 consecutive amino acids of the CDR2 or CDR3 thereof. The invention also includes a polypeptide fragment of the aC L chain V region, comprising at least 25 consecutive amino acids, more preferably 30 consecutive amino acids of SEQ ID NO:5, or 7 consecutive amino acids of the CDR2 thereof, or at least 8 consecutive amino acids, preferably 10 consecutive amino acids of the CDRl or CDR3 thereof.
The size of the aC polypeptides can be only the minimum size required to provide a desired function. The polypeptides can optionally comprise additional sequence, either native to aC, or from a heterologous source, as desired. aC peptides can contain only 5 consecutive amino acids from a HI 1 V-region sequence that axe not the same as the homologous region of A6- Polypeptides comprising 7 amino acids, more preferably about 29 amino acids, more preferably about 15 amino acids, more preferably about 25 amino acids, more preferably about 50 amino acids, more preferably about 75 amino acids from the aC L or H chain V region are also included. Even more preferred are polypeptides comprising the entire aC L or H chain V region. Preferably the polypeptides are derived from HI 1. Preferably, the polypeptides are the scFvs depicted in SEC ID NOS:14 and 17.
The invention includes modified aC polypeptides which arc functionally equivalent to HI 1. or have altered but measurable Hi I immunologic activity. Modified polypeptides with improved Hi 1 immunologic activity are preferred. Examples of modified polypeptides include those with conservative substitutions of amino acid residues, and one or more deletions or additions of amino acids which do not sicnificanlly deleteriously alter the immunologic activity.
One example of this is Hi 1 polypeptides comprising one or more amino acid substitution in comparison with the prototype Hi 1 sequence. Substitutions can range from changing or modifying one or more amino acid residues to complete redesign of a region, such as the V region. Amino acid substitutions, if present, are preferably conservative substitutions that do not deleteriously affect folding or functional properties of the peptide. Groups of functionally related amino acids within which conservative substitutions can be made are glycine/alanine; valine/isoleucine/leucine; asparagine/glutamine; aspartic acid/glutamic acid; serine/threonine/methioninc; lysine/arginine: and phenylalanine/tryosine/tryptophan. Polypeptides of this invention can be in glycosylated or unglycosylated form, can be modified post-translaiionally (e.g., acetylation. and phosphorylation) or can be modified synthetically (e.g., the attachment of a labeling group).
HI 1 polypeptide derivatives comprising both a Hll L chain and a HI 1 H chain can be formed as separate L and H chains and then assembled, or assembled in situ by an expression system for both chains. Such expression systems can be created by transfecting a suitable cell with a plasmid comprising separate transcribable regions for the L and H chain, or by co*transfecting the same cell with plasmids for each chain. In a third method, a suitable plasmid with a H chain encoding region is transfected into a H chain loss mutant.
H chain loss mutants can be obtained by treating approximately 2 x 10? Hi 1 producing cells with fluorescein-labeled rabbit anti-mouse IgG (H chain specific, DAKO Corporation, Carpi nteria. CA) according to the supplier's instruction. The stained and unstained cell populations are analyzed in a fluorescence-activated cell sorter. The unstained cells are collected in a sterilized tube and placed in 96-weIl plates with 1 cell/well by limiting dilution. The culture supematants are then assayed by ELISA using goat anti-mouse IgG (H chain specific) and goat anti-mouse kappa. The clones with kappa-positive and IgG-negativc phenotype are subcloned at least 3 times to obtain stable Hi ]*"H) mutants. mRNA from putative H chain loss mutant Hi lf"H) clones can be isolated and the sequence of the L chain V region cDNA determined. Reverse PCR of the mRNA for the Hi 1 VH is performed with 2 sets of 5'- and 3'- primers, used for cloning of HI 1*"H) cDNA (Example 7). A H chain loss mutant yields no detectable DNA band Transfection of the cells proceeds with a suitable H chain plasmid.
Another aC derivative encompassed by this invention is an antibody in which the aC H or L chain has been modified to provide additional properties. For instance, a change in amino acid sequence can result in greater immunogenicity of the resultant polypeptide. The changes range from changing of one or more amino acids to the complete redesign of a region such as a C region domain. Changes contemplated affect complement fixation, interaction with membrane receptors, and other effector functions. A recombinant HI 1 antibody can also be designed to aid the specific delivery of a substance (such as a lymphokine) to an effector cell. Also encompassed by the invention are proteins in which various immunoglobulin domains have been placed in an order other than that which occurs in nature.
The invention also encompasses single chain V region fragments ("scFv") of Hll. Single chain V region fragments are made by linking L and/or H chain V regions by using a short linking peptide. Bird et al. (1988) Science 242:423-426. Any peptide having sufficient flexibility and length can be used as a linker in a scFv. Usually the linker is selected to have little to no immunogenicity. An example of a linking peptide is (GGGGS)3, which bridges approximately 3.5 ran between the carboxy terminus of one V region and the amino terminus of another V region. Other linker sequences can aiso be 31 used, and can provide additional functions, such as a means for attaching a drug or a solid support.
All or any portion of the H or L chain can be used in any combination. Typically, the entire V regions are included in the scFv. For instance, the L chain V region can be linked to the H chain V region. Alternatively, a portion of the L chain V region can be linked to the H chain V region, or a portion thereof. Also contemplated are scFvs in which the H chain V region is from HI 1. and the L chain V region is from another immunoglobulin. It is also possible to construct a biphasic. scFv in which one component is a HI 1 polypeptide and another component is a different polypeptide, such as a T cell epitope.
The scFvs can be assembled in any order, for example, VH—(linker)—VL or VL—(linker)—VH. For example, SEQ ID NOS. 13 and 16 show HI l-scFv2 constructs having the form VL—(linker)—VH. However, the construct shown in SEQ ID NO: 13 forms monomers, while the construct shown in SEQ ID NO: 16 forms dimers. There may be a difference in the level of expression of these two configurations in particular expression systems, in which case one of these forms may be preferred. Tandem scFvs can also be made, such as (X)—(linker)—(X>—(linker)—(X), in which X are aC polypeptides, or combinations of aC polypeptides with other polypeptides. In another embodiment, single chain antibody polypeptides have no linker polypeptide, or just a short, inflexible linker. Exemplary configurations include VL—VH and VH—VL. The linkage is loo short to permit interaction between VL and VH within the chain, and the chains form homodimers with a VL/VH antigen binding site at each end. Such molecules are referred to in the art as "cliabodies".
ScFvs can be produced either recombinantly or synthetically. For synthetic production of scFv, an automated synthesizer can be used. For recombinant production of ScFv, a suitable plasmid containing a polynucleotide that encodes the scFv can be introduced into a suitable host cell, either eukaryotic, such as yeast, plant, insect or mammalian cells, or prokaryotic, such as Escherichia coli, and the protein expressed by the polynucleotide can be isolated using standard protein purification techniques.
WO 97/44461 PCT/US97/08962 32 A particularly useful system for the production of scFvs is plasmid pET-22b(+) (Novagen, Madison. WD in E. coli. pET-22b(+) contains a nickel ion binding domain consisting of 6 sequential histidine residues, which allows the expressed protein to be purified on a suitable affinity resin. Another example of a suitable vector is pcDNA3 (Invitrogen, San Diego, CA), described above.
Expression conditions should ensure that the scFv assumes functional and, preferably, optimal tertiary structure. Depending on the plasmid used (especially the activity of the promoter) and the host cell, it may be necessary to modulate the rate of production. For instance, use of a weaker promoter, or expression at lower temperatures, may be necessary to optimize production of properly folded scFv in prokaiyotic systems: or. it may be preferably to express scFv in eukaiyotic cells.
Preferred scFv comprise at least 10 consecutive amino acids of SEQ. ID NO:2 and at least 10 consecutive amino acids of SEQ. ID NO:5, especially wherein the amino acids of SEQ. ID NO:2 and the amino acids of SEQ. ID NO:5 are joined by a linker polypeptide of 5 to 20 amino acids, or comprising the L chain V region and the H chain V region of HI 1.
The invention also encompasses polymeric forms of aC polypeptides, containing a plurality of aC polypeptides. One embodiment is a linear polymer of aC polypeptides, optionally conjugated to carrier. These linear polymers can comprise multiple copies of a single aC polypeptide, or combinations of different aC polypeptides, and can have tandem aC polypeptides, or aC polypeptides separated by other amino acid sequences. Another embodiment is aC multiple antigen peptides (MAPs). MAPs have a small immunologically inert core having radially branching lysine dendrites, onto which a number of aC polypeptides are covalently attached. See for instance, Posnett et al. (1988) J, Biol. Chem. 263:1719-1725; and Tam (1989) Meth. Enz. 168:7-15. The result is a large macromolecule having a high molar ratio of aC polypeptides to core. MAPs are efficient immunogens and useful antigens for immunoassays. The core for creating an aC MAP can be made by standard peptide synthesis techniques, or obtained commercially, e.g., from Quality Controlled Biochemicals, Inc., Hopkinton. MA. A typical core matrix is made up of three levels of lysine and eight amino acids. 33 When using aC polypeptides as immunogens, preferably the polypeptides are delivered in conjunction with a carrier. Any carrier can be used which is not harmful to the host. Suitable carriers are typically large, slowly metabolized macromolecules such as proteins, polysaccharides (such as latex functionalized Sepharose, agarose, cellulose, cellulose beads and the like); polymeric amino acids (such as polyelutamic acid, polylysine, and the like); amino acid copolymers; and inactive virus panicles or attenuated bacteria, such as Salmonella. Especially useful carrier proteins are serum albumins, keyhole limpet hemacyanin (KLH), certain Ig molecules, thyroglobulin. ovalbumin, and tetanus toxoid. KLH is especially preferred. aC polypeptides of the invention can be identified in a number of ways. For example, the V regions of the L and H chains can be screened by preparing a series of short polypeptides that together span the entire V region ammo acid sequence. Using a series of polypeptides of 20 or 50 amino acids in length, each aC V region can be surveyed for useful functional properties. It is also possible to carry out a computer analysis of a protein sequence to identify potentially interesting polypeptides, such as those that bear the shape of D2, or those involved in idiotvpe-anti-idiotype contact.
The invention further encompasses various adaptations of aC described in this section combined in various fashions to yield other aC polypeptides with desirable properties. For instance. aC polypeptides with modified amino acid residues can be comprised in a MAP. In another example, a aC scFv is fused to a cytokine, such as IL-2. All such combinations are contemplated in this invention.
The polypeptides of this invention can be made by any suitable procedure, including proteolysis of the aC antibody, by recombinant methods or by chemical synthesis. These methods are known in the art and need not be described in detail herein. Examples of proteolytic enzymes include, but are not limited to, trypsin, chymotrypsin, pepsin, papain, V8 protease, subtilisin, plasmin. and thrombin. Intact aC can be incubated with one or more proteinases simultaneously or sequentially. Alternatively, or in addition, intact antibody can be treated with disulfide reducing agents. Peptides can then be separated from each other by techniques known in the art including, but not limited to, gel filtration chromatography, gel electrophoresis, and reverse-phase HPLC. % 34 aC polypeptides can also be made by expression from a polynucleotide encoding the peptide according to the information provided elsewhere in this application, in a suitable expression system. Typically, polynucleotides encoding a aC polypeptide are ligated into an expression vector under control of a suitable promoter and used to genetically alter the intended host cell. Both eukaryouc and prokaryotic host systems can be used. The polypeptide is then isolated from lysed cells or from the culture medium and purified to the extent needed for its intended use. Examples of prokaryotic host cells appropriate for use with this invention include E. coli. Examples of eukaryotic host cells include avian, insect, plant, and animal cells including, but not limited to, COS7, HeLa. and CHO cells.
In certain applications, such as when a HI 1 polypeptide is expressed in a suitable storage medium such as a plant seed, the HI I polypeptide can be used without purification. Fiedler et al. (1995) Biotechnology 13:1090-1093. For most applications, it is generally preferable that the polypeptide is at least partially purified from other cellular constituents. Preferably, the polypeptide is at least about 50% pure as a weight percent of total protein. More preferably, the protein is at least about 50-75% pure. For clinical use, the polypeptide is preferably at least about 80% pure.
The invention also encompasses methods of detecting C antigen in a biological sample. The methods include obtaining a biological sample, contacting the sample with aC under conditions that allow antibody antigen binding and detecting binding, if any, of the antibody to the antigen.
The invention also encompasses methods of detecting anti-Hl 1 or anti-ocC in a biological sample. Anti-aC is detectable whenever it cross-reacts with HI 1. Anti-aC with this activity can spontaneously arise during the course of a tumor-associated disease. Anti-aC with this activity is especially likely in individuals who have received a course of therapy with aC. These methods are applicable in a clinical setting, for example, for monitoring antibody levels in an individual, as well as an industrial setting, as in commercial production of anti-H 11 or anti-aC.
The assay methods entail contacting any anti-Hl 1 or anti-aC target antibody in the sample with aHll antibody or polypeptide under conditions suitable to allow the formation of a stable complex between the target and HI 1, and detecting any stable complex formed. The sample is suitably prepared before conducting the assay, optionally by enriching for antibody concentration. When using intact murine aC. it is generally preferable to deplete the sample of any anti-mouse immunoglobulin activity that may be present. Anti-mouse immunoglobulin antibody can be removed from a sample, for example, by precipitation with normal mouse IgG or adsorption with a mouse Ig adsorbent Binding of anti-mouse immunoglobulin antibody, particularly that specific for the Fc region, can be minimized by judicious choice of the reagents of the assay. F(ab')2 or Fab fragments of murine aC and other reagents such as humanized aC or HI 1. with fewer mouse determinants are appropriate.
After the sample is suitably prepared, it is mixed with a excess aC under conditions that permit formation of a complex between aC and any target antibody that may be present. The amount of complex is then determined, and compared with complexes formed with standard samples containing known amounts of target antibody in the range expected. Complex formation can be observed by any method known in the art such as imrnunoprecipitation or nephelometry, but it is generally more sensitive to employ a reagent labeled with such labels as radioisotopes such as I2SI. enzymes such as peroxidase and p-galactosidase, or fluorochromes such as fluorescein.
The invention provides various polynucleotides encoding the antibody HI 1 or fragments of Hi L based on the polynucleotide sequences provided herein (SEQ ID NOS:l and 4). Various embodiments are described in this section, comprising a number of different combinations of the HI 1 H or L chain V region sequences. In general, a HI 1 polynucleotide of this invention encodes at least one feature that is unique to the Hi 1 molecule (in comparison with other immunoglobulins and, in particular, the A6 antibody). Preferably, this feature is related in some way to an immunologic reactivity of HI 1.
The invention encompasses polynucleotides encoding a portion of the HI 1 L chain V region, comprising at least about 70 consecutive nucleotides, preferably at least about 80 consecutive nucleotides, more preferably at least about 100 consecutive nucleotides, even more preferably at least about 150 nucleotides of SEQ ID NO:4. The invention also encompasses a polynucleotide encoding a portion of the HI 1 L chain V region, comprising 36 at least about 25 consecutive nucleotides, preferably at least about 30 consecutive nucleotides, and even more preferably at least about 35 consecutive nucleotides of the CDRl encoding sequence thereof. The invention also encompasses a polynucleotide encoding a portion of the H11 L chain V region, comprising at least about 20 consecutive nucleotides, preferably at least about 25 consecutive nucleotides, and even more preferably at least about 35 consecutive nucleotides of the CDR2 or CDR3 encoding sequence thereof.
The invention also encompasses polynucleotides encoding a portion of the HI 1 H chain V region, comprising at least about 70 consecutive nucleotides, preferably at least about 80 consecutive nucleotides, more preferably at least about 100 consecutive nucleotides, even more preferably at least about 150 nucleotides of SEQ ID NO:l. The invention also encompasses a polynucleotide encoding a portion of the HI 1 L chain V region, comprising 15 consecutive nucleotides of the CDRl encoding sequence thereof. The invention also encompasses a polynucleotide encoding a portion of the HI 1 L chain V region, comprising at least about 20 consecutive nucleotides, preferably at least about 25 consecutive nucleotides, and even more preferably at least about 35 consecutive nucleotides of the CDR2 or CDR3 coding sequence thereof.
The invention includes isolated Hi 1 polynucleotides encoding a polypeptide having immunologic activity of Hi 1, wherein the polypeptide encodes at least 5 amino acids of a V L chain of HI 1 as depicted in SEQ. ID NO:5. The invention also includes isolated HI 1 polynucleotides encoding a polypeptide having immunologic activity of HI 1, wherein the polynucleotide encodes at least 5 amino acids of a V H chain of HI 1 as depicted in SEQ. ID NO:2. The polynucleotide sequence can be similar to those depicted in SEQ. ID NO:l or SEQ ID NO:4 with changes designed to optimize codon usage, stability, facilitate cloning, or any other purpose. It is within the skill of one in the art, given the amino acid sequence in SEQ ID NO:2 or SEQ ID NO:5, to design such polynucleotides. Preferred polynucleotides encode at least five amino acids of a HI 1 CDR.
The invention also encompasses polynucleotides encoding for functionally equivalent variants and derivatives of Hi 1 and functionally equivalent fragments thereof 37 which may enhance, decrease or not significantly affect properties of the polypeptides encoded thereby. These functionally equivalent variants, derivatives, and fragments display the ability to specifically recognize C antigen. For instance, changes in a DNA sequence thai do not change the encoded amino acid sequence, as well as those that result in conservative substitutions of amino acid residues, one or a few ammo acid deletions or additions, and substitution of amino acid residues by amino acid analogs are those which will not significantly affect properties of the encoded polypeptide. Conservative amino acid substitutions are glycine/alanine; vaiine/isoleucine/leucine; asparagineyglutamine; aspanic acid/glutamic acid; serinc/threonine/methionine: lysine/arginine; and phemlalanineAyrosine/tryptophan.
The polynucleotides of the invention may comprise additional sequences, such as additional encoding sequences within the same transcription unit, controlling elements such as promoters, ribosome binding sites, and polyadenylation sites, additional transcription units under control of the same or a different promoter, sequences that permit cloning, expression, and transformation of a host cell, and any such construct as may be desirable to provide embodiments of this invention.
The invention encompasses a polynucleotide of at least about 15 consecutive nucleotides, preferably al least about 20 nucleotides, more preferably at least about 25 consecutive nucleotides, more preferably at least about 35 consecutive nucleotides, more preferably at least about 50 consecutive nucleotides, even more preferably at least about 75 nucleotides, still more preferably at least about 100 nucleotides, still more preferably at least about 200 nucleotides, and even more preferably at least about 300 nucleotides that forms a stable hybrid with a polynucleotide encoding the L chain or H chain V region of HU, but not with other immunoglobulin encoding regions known at the time of filing of this application. Any set of conditions may be used for this test, as long as at least one set of conditions exist wherein the test polynucleotide demonstrates the required specificity. Preferably, the HI 1 encoding sequences to which the test polynucleotide binds are those shown in SEQ. ID NOS: 1 and 4. Since the known immunoglobulin sequences fall into a hierarchy of similarity with that of HI I, the test may be performed by comparing the hybridization of the test polynucleotide with the HI 1 sequence with the hybridization with 38 the most closely related sequences. Preferred is a panel of about 10 of the most closely related sequences to SEQ. ID NO:l. 3,4 or 5.
Hybridization reactions can be performed under conditions of different "stringency". Conditions that increase stringency of a hybridization reaction are well known. See, for example, Sambrookand Maniatis. Examples of relevant conditions include (in order of increasing stringency): incubation temperatures of 25"C, 37°C, 50°C and 68°C; buffer concentrations of 10 x SSC, 6 x SSC, 1 x SSC, 0.1 x SSC (where SSC is 0.15 M NaCl and 15 m.M citrate buffer) and their equivalent using other buffer systems; formamide concentrations of 0%, 25%. 50%, and 75%: incubaiion times from 5 minutes to 24 hours; 1,2, or more washing steps; wash incubation times of 1, 2. or 15 minutes; and wash solutions of 6 x SSC, 1 x SSC, 0.1 x SSC, or deionized water.
Useful HI 1 polynucleotides encoding fragments of HI 1 may be identified by generating polynucleotide fragments (based on SEQ ID NO:l or SEQ ID NO:4, for example) and testing the polypeptides encoded thereby for a function of interest. Alternatively, the polypeptide fragment encoded by a particular polynucleotide can be prepared and tested for a function of interest. Alternatively, given a aC polypeptide wilh desirable properties, polynucleotides can be designed that encode the polypeptide.
Included in all these embodiments are polynucleotides with encoding regions for Hi 1 polymers, fusion proteins, humanized immunoglobulins, single-chain V regions, and other particular polypeptides of interest. These polypeptides are described above.
The invention also provides polynucleotides covalently linked with a detectable label. Such polynucleotides are useful, for example, as probes for detection of related nucleotide sequences.
The polynucleotides of this invention can be obtained using chemical synthesis, recombinant cloning methods. PCR, or any combination thereof. Methods of chemical polynucleotide synthesis are well known in the art and need not be described in detail herein. One of skill in the art can use the sequence data provided herein to obtain a desired polynucleotide by employing a DNA synthesizer or ordering from a commercial service.
Alternatively, aC polynucleotide sequences can be obtained from a aC antibody producing cell line. aC cloning vector, or aC expression vector. RNA or DNA encoding 39 the desired sequence can be isolated, amplified, and processed by standard recombinant techniques. Such techniques include digestion wuh restriction nucleases, and amplification by polymerase chain reaction (PCR), or a suitable combination thereof. PCR technology is described in U.S. Patent Nos. 4,683.195,4.800,159,4,754,065 and 4,683,202, as well as PCR. The Polymerase Cham Reaction, Mullis et al. eds., Birkauswer Press. Boston (1994).
Polynucleotides comprising a desired sequence can be inserted into a suitable vcctor, and the vector in turn can be introduced into a suitable host cell for replication and amplification. Polynucleotides can be introduced into host cells by any means known in the art. Cells are transformed by introducing an exogenous polynucleotide by direct uptake, endocytosis. transfection. f-mating or electroporation. Once introduced, the exogenous polynucleotide can be maintained within the cell as a non-integrated vector (such as a plasmid) or integrated into the host cell genome. Amplified DNA can be isolated from the host cell by standard methods. See, e.g., Sambrook et al. (1989). RNA can also be obtained from transformed host cell, or it can be obtained directly from the DNA by using a DNA-dependent RNA polymerase.
The present invention further encompasses a variety of vectors comprising a Hll polynucleotide. These vectors can be used for expression of recombinant polypeptides are also a source of H11 polynucleotides. Cloning vectors can be used to obtain replicate copies of the HI 1 polynucleotides they contain, or as a means of storing the polynucleotides in a depository for future recovery. Expression vectors (and host cells containing these expression vectors) can be used to obtain polypeptides produced from the polynucleotides they contain. They can also be used where it is desirable to express HI 1 in an individual and thus have intact cells capable of synthesizing the polypeptide, such as in gene therapy. Suitable cloning and expression vectors include any known in the art, e.g., those for use in bacterial, mammalian, yeast and insect expression systems. Specific vectors and suitable host cells are known in the art and are not described in detail herein. See e.g. Gacesa and Ramji, Vectors, John Wiley & Sons (1994).
Cloning and expression vectors typically contain a selectable marker (for example, a gene encoding a protein necessary for the survival or growth of a host cell transformed 40 with the vector), although such a marker gene can be carried on another polynucleotide sequence co-introduced into the host cell. Only those host cells into which a selectable gene has been introduced will grow under selective conditions. Typical selection genes cither: (a) confer resistance to antibiotics or other toxins, e.g.. ampicillin, neomycin, methotrexate; (b) complement auxotrophic deficiencies: or (c) supply critical nutrients not available from complex media. The choice of the proper marker gene will depend on the host cell, and appropriate genes for different hosts are known in the art. Vectors also typically contain a replication system recognized by the host.
Suitable cloning vectors can be constructed according to standard techniques, or selected from a large number of cloning vectors available in the art. While the cloning vector selected may vary according to the host cell intended to be used, useful cloning vectors will generally have the ability to self-replicate, may possess a single target for a particular restriction endonuclease, or may cany marker genes. Suitable examples include plasmids and bacterial viruses, e.g., pUC18, mp!8, mpl9. pBR322, pMB9, ColEl, pCRl, RP4, phage DNAs, and shuttle vectors such as pSA3 and pAT28. These and other cloning vectors are available from commercial vendors such as BioRad. Stratagene. and Invitrogen.
Expression vectors generally are replicable polynucleotide constructs that contain a polynucleotide encoding a aC polypeptide of interest. The polynucleotide encoding aC polypeptide is operatively linked to suitable transcriptional controlling elements, such as promoters, enhancers and terminators. For expression (i.e., translation), one or more translational controlling elements are also usually required, such as ribosome binding sites, translation initiation sites, and stop codons. These controlling elements (transcriptional and translational) can be derived from the HI 1 gene, or heterologous (i.e., derived from other genes or other organisms). A polynucleotide sequence encoding a signal peptide can also be included to allow a aC polypeptide to cross or lodge in cell membranes or be secreted from the cell. A number of expression vectors suitable for expression in eukaryotic cells including yeast, avian, and mammalian cells are known in the art. One example of an expression vector is pcDNA3 (Invitrogen, San Diego, CA), in which transcription is driven by the cytomegalovirus (CMV) early promoter/enhancer. This vector also contains recognition sites for multiple restriction enzymes for insertion of an 41 aC polynucleotide of interest. Another example of an expression vector (system) is the baculovirus/insect system.
Also encompassed by the invention are expression systems suitable for use in antibody-targeted gene therapy comprising a aC polynucleotide. Suitable systems are described for instance by Brown et al. (1994) Viroi 198:477-488; and Miyamura et al. (1994) Proc. Natl. Acad. Sci. USA 91:8507-8511.
The vectors containing the polynucleotides of interest can be introduced into the host cell by any of a number of appropriate means, including elcctroporation, transfection employing calcium chloride, rubidium chloride, calcium phosphate, DEAE-dextran, or other substances; microprojectile bombardment: lipofection: and infection (where the vector is an infectious agent, such as vaccinia virus, which is discussed below). The choice of introducing vectors or aC polynucleotides will often depend on features of the host cell.
Once introduced into a suitable host cell, expression of a aC polypeptide can be determined using any assay known in the art. For example, presence of aC polypeptide can be detected by RJA or ELISA of the culture supernatant (if the Hi 1 polypeptide is secreted) or cell lysates.
A particularly useful expression vector for Hi 1 polynucleotides is a vaccinia virus comprised of a Hi 1 polynucleotide sequence, which can also be used in vaccine preparations. Moss (1991) Science 252:1662-1667. To introduce polynucleotide sequences encoding Hi 1 polypeptide, including Hi 1 polypeptide fragments, into vaccinia, the polynucleotide sequence of interest is first inserted into a plasmid containing a vaccinia virus promoter with flanking sequences homologous to vaccinia DNA not required for replication. Plasmid-containing cells are then infected with vaccinia, which leads to a low level of homologous recombination between plasmid and virus, with resultant transfer of the vaccinia promoter and HI 1 polypeptide-encoding polynucleotide sequence into the vaccinia virus genome. Typically, the Hi 1 polynucleotide is inserted into the viral TK (thymidine kinase) gene. Insertion into the TK site attenuates the virus more than 10,000 fold compared to wild type. Flexner et al. (1980) Vaccine 88 (Cold Spring Harbor Laboratory), pp. 179-184. Recombinant virus is identified by the TK" phenotype. Preferably, expression of the HI 1 polynucleotide is under the control of the vaccinia wo 97/44461 pct/us97/08962 42 early/lale promoter (7.5 K). whereby ihe resultant HI 1 polypeptides can be expressed in infected cells tliroughoui the life cycle of the virus. However, other promoters known in the art can be used, such as pH6, or synthetic promoters. Expression of the Hi 1 polypeptide occurs in cells infected with the recombinant vaccinia or individuals immunized with the live recombinant vaccinia virus. Any one of several strains of vaccinia can be used, including, but not limited to, WR. ALVAC, and NYVAC.
A vector of this invention can contain one or more polynucleotides encoding a aC polypeptide. It can also contain polynucleotide sequences encoding other polypeptides that cnhancc. facilitate, or modulate the desired result, such as lymphokincs, including, but not limited to. IL-2, IL-4. GM-CSF. TNF-a. and IFN-y A preferred lymphokine is GM-CSF. Preferred GM-CSF constructs are those which have been deleted for the AU-rich elements from the 3' untranslated regions and sequences in the 5"" untranslated region that are capable of forming a hairpin loop. Also embodied in this invention are vaccinia vectors encoding for recombinant aC variants, such as scFvs. chimeras, and polymers.
Other embodiments of this invention are host ceils transformed with aC polynucleotides and vectors comprising aC polynucleotide sequences, as described above. Both prokaryotic and eukaryotic host cells may be used. Prokaryotic hosts include bacterial cells, for example E. coli and Mycobacteria. Among eukaryotic hosts are yeast, insect, avian, plant and mammalian cells. Host systems are known in the art and need not be described in detail herein. Examples of mammalian host cells include CHO and NSO, obtainable from the European Collection of Cell Cultures (England). Transfection of NSO cells with a plasmid, for example, which is driven by a CMV promoter, followed by amplification of this plasmid in using glutamine synthetase provides a useful system for protein production. Cockett et al. (1990) Bio/Technology 8:662-667.
The host cells of this invention can be used, inter alia, as repositories of aC polynucleotides, or as vehicles for production of aC polynucleotides and polypeptides. They may also be used as vehicles for in vivo expression of aC polypeptides. The HI 1 polynucleotides of this invention can be used in expression systems to produce HI I polypeptides, intact HI 1. or recombinant forms of Hi 1, such as are described below.
WO 97/44461 PCT/US97/08962 43 The polynucleotides of this invention have several uses. They are useful, for example, in expression systems for the production of aC. They are also useful as hybridization probes to assay for the presence of aC polynucleotide or related sequences in a sample using methods well known to those in the art. Further, the polynucleotides are also useful as primers to effect amplification of desired polynucleotides. The polynucleotides of this invention are also useful in pharmaceutical compositions including vaccines and for gene therapy.
The polynucleotides can also be used as hybridization probes for detection of aC encoding sequences. Suitable samples include cells transformed ex vivo for use in gene therapy. In one illustration. DNA or RNA is extracted from a sample, and optionally run on a gel and/or digested with restriction endonucleases. The processed sample polynucleotide is typically transferred to a medium suitable for washing. The sample polynucleotide is then contacted with the HI 1 polynucleotide probe under conditions that permit a stable duplex to form if the sample contains a matching aC sequence. Any stable duplexes formed are detected by any suitable means. For example, the aC polynucleotide probe can be supplied in labeled form, and label remaining with the sample after washing will directly reflect the amount of stable duplex formed. In a second illustration, hybridization is performed in situ. A suitably prepared tissue sample is overlaid with a labeled probe to indicate the location aC encoding sequences.
A short aC polynucleotide can also be used as a primer for a PCR reaction, particularly to amplify a longer sequence comprising a region hybridizing with the primer. This can be conducted preparatively, in order to produce polynucleotide for further genetic manipulation. It can also be conducted analytically, to determine whether a aC encoding polynucleotide is present, for example, in a sample of diagnostic interest.
Another use of the polynucleotides is in vaccines and gene therapy. The general principle is to administer the polynucleotide so that it either promotes or attenuates the expression of the polypeptide encoded therein. Thus, the present invention includes methods of inducing an immune response and methods of treatment comprising administration of an effective amount aC polynucleotides to an individual. In these methods, a aC polynucleotide encoding a aC polypeptide is administered to an individual, WO 97/44461 PCT/US97/08962 44 either directly or via cells transfected with the aC polynucleotide. Preferably, the aC polynucleotide is in the form of a circular plasmid. preferably in a supercoiled configuration. Preferably, the aC polynucleotide is replicated inside a cell. Thus, the aC polynucleotide is operativelv linked to a suitable promoter, such as a heterologous promoter that is intrinsically active in cells of the target tissue type. Preferably, once in cell nuclei, plasmids persist as circular non-replicating episomal molecules. In vitro mutation can be earned out with plasmid constructs to encode, for example, molecules with greater affinity and/or avidity.
To determine whether plasmids containing aC polynucleotides are capable of aC expression in eukaryotic cells, cells such as COS-7, CHO, or HeLa can be transfected with the plasmids. Expression of uC is then determined by immunoassay; for example, by Western blot Smaller aC polypeptides can be detected, for example, by constructing the plasmid so that the resultant aC polypeptide is fused with a tag, such as a target epitope or enzyme label. Further characterization of the expressed aC polypeptide can be achieved by purifying the peptide and then conducting one of the functional assays described herein.
In one mode of gene therapy, the polynucleotides of this invention are used for genetically altering cells ex vivo. In this strategy, cells removed from a donor or obtained from a cell line are transfected or transduced with vectors encoding a aC polypeptide, and then administered to a recipient. Suitable cells for transfection include peripheral blood mononuclear cells.
In another mode of gene therapy, the polynucleotides of this invention are used for genetically altering cells in vivo. The purpose includes, but is not limited to, treating various types of cancer. aC polypeptides can be characterized in several ways. For instance, a aC polypeptide may be tested for its ability to bind specifically to cancer cells, for its ability to specifically inhibit the binding between cancer cells and intact HI 1. A aC polypeptide can also react with anti-CDR3 polypeptides. aC polypeptides can also be tested for their ability to palliate or ameliorate neoplastic disease, such as carcinomas. It is understood that only one of these properties need be present in order for a polypeptide to come within 45 the scope of this invention, although preferably more than one of these properties is present.
The ability of a uC polypeptide to bind cancer cells or antigenic fractions thereof can be tested by immunoassay. Any form of direct binding assay is suitable. In one such assay, the cancer ccll or the putative aC polypeptide is labeled. Suitable labels include radioisotopes such as ,-5I. enzymes such as peroxidase, fluorcsccm labels such as fluorescein, and chemiluminesccnt labels. Typically, the other binding partner is insolubilized (for example, by coating onto a microtiter plate) to facilitate washing. After combining the labeled component with the insolubilized component, the solid phase is washed and the amount of bound label is determined. Another such assay is a sandwich assay, in which the putative uC polypeptide is captured by a first anti-immunoglobulin on a solid phase and developed with aC antibody. In either of these examples, the extent of binding of aC is directly related to the amount of label bound to the solid phase.
To conduct the inhibition assays, the putative uC polypeptide is titered for its ability to decrease the binding of HI 1 to cancer cells. Either of the binding pairs in the reaction to be inhibited is labeled, while the other is typically insolubilized in order to facilitate washing. The putative aC polypeptide is typically mixed with the labeled component, and then the mixture is combined with the solid phase. Polypeptides with the characteristics of HI 3 will proportionately decrease the amount of label attached to the solid phase, compared with control polypeptides. This test may be more sensitive than measuring direct binding, because lower affinity interaction between aC and C antigen may be too weak to form a stable bond, but adequate to interfere with the binding of another ligand-receptor pair when present at sufficient concentration.
The present invention encompasses pharmaceutical compositions and immunogenic compositions containing aC either alone or in combination. Such pharmaceutical compositions and vaccines are useful for eliciting an immune response and treating neoplastic diseases, either alone or in conjunction with other forms of therapy, such as chemotherapy or radiotherapy.
The preparation of pharmaceutical compositions that contain aC antibody, or a polynucleotide or a polypeptide derivative thereof as an active ingredient is conducted in WO 97/44461 PCT/US97/08962 46 accordance with generally accepted procedures for the preparation of pharmaceutical preparations. See, for example. Remington's Pharmaceutical Sciences 18th Edition (1990), E.W Martin ed., Mack Publishing Co.. PA. Depending on the intended use and mode of administration, it may be desirable to process the active ingredient further m the preparation of pharmaceutical compositions. Appropriate processing may include sterilizing, mixing with appropriate non-toxic and non-interfering components, dividing into dose units, and enclosing in a delivery device.
Liquid pharmaceutically acceptable compositions can, for example, be prepared by dissolving or dispersing a polypeptide embodied herein in a liquid excipient. such as water, saline, aqueous dextrose, glycerol, or ethanol. The composition can also contain other medicinal agents, pharmaceutical agents, adjuvants, carriers, and auxiliary substances such as wetting or emulsifying agents, and pH buffering agents.
Pharmaceutical compositions of the present invention are administered by a mode appropriate for the form of composition. Typical routes include subcutaneous, intramuscular, intraperitoneal, intradermal, oral, intranasal, and imrapulmonary (i.e.. by aerosol). Pharmaceutical compositions of this invention for human use are typically administered by a parenteral route, most typically intracutaneous, subcutaneous, or intramuscular.
Pharmaceutical compositions for oral, intranasal, or topical administration can be supplied in solid, semi-solid or liquid forms, including tablets, capsules, powders, liquids, and suspensions. Compositions for injection can be supplied as liquid solutions or suspensions, as emulsions, or as solid forms suitable for dissolution or suspension in liquid prior to injection. For administration via the respiratory tract, a preferred composition is one thai provides a solid, powder, or liquid aerosol when used with an appropriate aerosolizer device. Although not required, pharmaceutical compositions are preferably supplied in unit dosage form suitable for administration of a precise amount. Also contemplated by this invention are slow release or sustained release forms, whereby a relatively consistent level of the active compound are provided over an extended period.
Compositions embodied in this invention can be assessed for their ability to recognize specifically a neoplasia. Accordingly, test compounds are prepared as a suitable 47 pharmaceutical composition and administered to test subjects. Initial studies are preferably done in small animals such as micc or rabbits, optionally next in non-human primates and then ultimately in humans. Immunogenicity is preferably tested in individuals without a previous antibody response. A test composition in an appropriate dose is administered on an appropriate treatment schedule. It may be appropriate to compare different doses and schedules within the predicted range. Such testing is within the skill of one in the ait.
Compositions of this invention are particularly suitable for administration to humans with a neoplastic disease. Especially relevant are melanoma, neuroblastoma, glioma, sarcoma, lymphoma, and small cell lung cancer.
Also included in this invention are methods for treating cancer. The methods comprise administering an amount of a pharmaceutical composition containing aC effective to achieve the desired effect, be it palliation of an existing tumor mass or prevention of recurrence. For treatment of cancer, the amount of a pharmaceutical composition administered is an amount effective in producing the desired effect. An effective amount can be provided in one or a series of administrations.
The effective amount of aC antigen binding fragments to be administered will depend upon several factors, such as the route of administration, the condition of the individual, and the desired objective. The term "therapeutically effective" means that the amount of antigen binding fragment used is of sufficient quantity to ameliorate the cancer. "Ameliorate" denotes a lessening of the detrimental effect of the cancer on the individual. Typically, if administered directly, the amount per administration is about 10 fig to 20 mg, preferably 250 fig to 10 mg, more preferably 300 fig to 5 mg, even more preferably 500 fig to 2.5 mg. Administrations are typically conducted on a weekly or biweekly basis until a desired, measurable parameter is detected, such as diminution of disease symptoms. Administration can then be continued on a less frequent basis, such as biweekly or monthly, as appropriate.
The various compositions of this invention can be used alone, or in conjunction with other active agents that promote the desired objective, or provide a desirable adjunct therapy. Suitable active agents include the anti-neoplastic drugs and bioresponse modifiers wo 97/44461 48 pct /us97/08962 described above and effector cells such as those described by Douillard et al, fl986) Hybridomas (Supp. 1:5139).
When used for immunotherapy, cxC can be unlabeled or labeled with a therapeutic agent as described above. These agents can be coupled either directly or indirectly to the polypeptides of the invention. One example of indirect coupling is by use of a spacer moiety These spacer moieties, in turn, can be either insoluble or soluble (Diener et al. (1986) Science 231:148) and can be selected to enable drug release from aC at the target site. Alternatively, an uC and a therapeutic agent can be translated, synthesized, ligated or otherwise produced as a single molecule which has both aC and therapeutic agent functions. Examples of dierapeutic agents which can be coupled to aC for immunotherapy include, but are not limited to. bioresponse modifiers, drugs, radioisotopes, lectins, and toxins. Bioresponse modifiers include Iymphokines which include, but are not limited to, tumor necrosis factor, interleukins 1,2, and 3, lymphoioxin, macrophage activating factor, migration inhibition factor, colony stimulating factor, and interferon. Interferons with which aC can be labeled include cx-inierferon, p-interferon, and y-interferon (IFN-y) and their subtypes.
In using radioisotopically conjugated aC for immunotherapy, certain isotypes may be more preferable than others depending on such factors as leukocyte distribution as well as isotype stability and emission. If desired, the malignant cell distribution can be evaluated by the in vivo diagnostic techniques described below. Depending on the malignancy, some emitters may be preferable to others. In general, alpha and beta particle-emitting radioisotopes are preferred in immunotherapy. For example, if an animal has solid tumor foci, as in a carcinoma, a high energy beta emitter capable of penetrating several millimeters of tissue, such as ^Y, may be preferable. On the other hand, if the malignancy consists of simple target cells, as in the case of leukemia, a short range, high energy alpha emitter, such as zuBi, may be preferable. Radioisotopes which can be bound to the antigen binding fragments of the invention for therapeutic purposes include, but are not limited to, l25I, ,31I, "Y, 67Cu, 212Bi,21'At, 212Pb, 47Sc, 109Pd, and ,MRe.
Lectins are proteins, usually isolated from plant material, which bind to specific sugar moieties. Many lectins are also able to agglutinate cells and stimulate lymphocytes.
WO 97/44461 PCT/US97/08962 49 However, ricin is a toxic lectin which has been used immunotherapeuticaily This is preferably accomplished by binding the alpha-peptidc chain of ricin, which is responsible for toxicity, to the antibody molecule to enable site specific delivery of the toxic effect Toxins are poisonous substances produced by plants, animals, or microorganisms that, in sufficient dose, are often lethal. Diphtheria toxin is a substance produced by Cotyne bacterium diphtheria which can be used therapeutically. This toxin consists of an alpha and beta subunit which under proper conditions can be separated. The toxic A chain component can be bound to an antibody and used for site specific delivery to a neoplastic cell.
Thus, for example. uC can be used in combination with alpha-interferon This treatment modality enJiances Mab targeting of melanomas by increasing the expression of Mab reactive antigen by the melanoma cells. Greiner et al. (1987) Science 235:895 Alternatively, aC could be used, for example, in combination with IFN-y to thereby activate and increase the expression of Fc receptors by effector cells which, in turn, results m an enhanced binding of the antigen binding fragments to the effector cell and killing of target malignant cells. Those of skill in the art will be able to selcct from the various biological response modifiers to create a desired effector function which enhances the efficacy of aC.
When aC is used in combination with various therapeutic agents, such as those described herein, the administration of both usually occurs substantially contemporaneously. The term "substantially contemporaneously" means that they are administered reasonably close together with respect to time. Usually, it is preferred to administer the therapeutic agent before aC. For example, the therapeutic agent can be administered 1 to 6 days before aC. The administration of the therapeutic agent can be daily, or at any other suitable interval, depending upon such factors, for example, as the nature of the malignancy, the condition of the patient and half-life of the agent.
Using aC, it is possible to design combination therapies. It may be desirable to administer a therapeutic agent, or agents, prior to the administration of aC in combination with effector cells and the same, or different, therapeutic agent or agents. For example, 50 patients can be treated by first administering IFN-y, and interleukin-2 (11-2) daily for 3 to 5 days, and on day 5 administering aC in combination with effector cells, IFN-y, and 11-2.
The present invention also encompasses the use of liposomes with membrane bound aC to specifically deliver the liposomes to the area of the tumor or neoplastic cells expressing C antigen. These liposomes can be produced such that they contain, in addition to aC, such immunotherapeutic agents as those described above which would then be released at the site of malignancy. Wolff et a. (1984) Biochem Biophys Acta 802:259. Another such delivery system described by Brown et al. (1994) Virology 198:477-488; and Miyamura et al. (1994) Proc Natl Acad Sci. USA 91:8507-8511 utilizes chimeric parvovirus B19 capsids for presentation of the antigen binding fragments. Such chimeric systems are encompassed for use in the claimed methods.
The dosage ranges for the administration of aC are those large enough to produce the desired effect in which the symptoms of the malignant disease are ameliorated without causing undue side effects such as unwanted cross-reactions, anaphylactic reactions, and the like. Generally, the dosage will vary with the patient's age, condition, sex and extent of the disease and can be determined by one of skill in the art. The dosage can be adjusted by the individual physician in the event of any complication. Dosage can vary from about 0.01 mg/kg to about 2000 mg/kg, preferably about 0.1 mg/kg to about 500 mg/kg, in one or more dose administrations daily, for one or several days. Generally, when aC are administered conjugated with therapeutic agents, lower dosages, comparable to those used for in vivo immunodiagnostic imaging, can be used.
Therapeutic compositions of aC can be administered by injection or by gradual perfusion. The aC antigen binding fragments can be administered intravenously, intraperitoneally, intramuscularly, subcutaneously, intracavity, intrathecally or transdermally, alone or in combination with effector cells.
Another method of administration is intralesionally, for instance by direct injection directly into the tumor. Intralesional administration of various forms of immunotherapy to cancer patients does not cause the toxicity seen with systemic administration of immunologic agents. Fletcher et al. (1987) Lymphokine Res. 6:45; Rabinowich et al. 51 (1987) Cancer Res. 47:173; Rosenberg ei al. (1989) Science 23 3:1318; and Pizz ei al. (1984) Int J. Cancer 34:359. aC is particularly suitable for use in treating and imaging brain cancer. When the site of delivery is ihe brain, the therapeutic agent must be capable of being delivered to the brain. The blood-brain barrier limits the uptake of many therapeutic agents into the brain and spinal cord from the general circulation. Molecules which cross the blood-brain barrier use two main mechanisms: free diffusion: and facilitated transport. Because of the presence of the blood-brain barrier, attaining beneficial concentrations of a given therapeutic agent in the CNS may require the use of specific drug delivery strategies. Delivery of therapeutic agents to the CNS can be achieved by several methods.
One method relies on neurosurgical techniques. In the case of gravely ill patients, surgical intervention is warranted despite its attendant risks. For instance, therapeutic agents can be delivered by direct physical introduction into the CNS, such as intraventricular, intralesional, or intrathecal injection. Intraventricular injection can be facilitated by an intraventricular catheter, for example, attached to a reservoir, such as an Oxnmaya reservoir. Methods of introduction are also provided by rechargeable or biodegradable devices. Another approach is the disruption of the blood-brain barrier by substances which increase the permeability of the blood-brain barrier. Examples include intra-anerial infusion of poorly diffusible agents such as mannitol, pharmaceuticals which increase cerebrovascular permeability such as ctoposide, or vasoactive agents such as leukotriene5- Neuwelt and Rappoport (1984) Fed. Proc. 43:214-219; Baba et al. (1991) J Cereb. Blood Flow Metab 11:638-643; and Gennuso et al. (1993) Cancer Invest. 11:638-643.
Further, it may be desirable to administer the compositions locally to the area in need of treatment; this can be achieved by, for example, local infusion during surgery, by injection, by means of a catheter, or by means of an implant, said implant being of a porous, non-porous, or gelatinous material, including membranes, such as silastic membranes, or fibers. A suitable such membrane is Gliadel® provided by Guilford Pharmaceuticals Inc. 52 Another method involves pharmacological techniques such as modification or selection of die uC to provide an analog which will cross the blood-brain barrier.
Examples include increasing the hydrophobicity of the molecule, decreasing net charge or molecular weight of the molecule, or modifying the molecule, such as to resemble one normally transported across the blood-brain barrier. Levin (1980) J. Med Chem. 23:682-684; Pardridge (1991) in: Peptide Drug Delivery to the Brain: and Kostis et al. (1994) J Clin Pharmacol. 34:989-996.
Encapsulation of aC in a hydrophobic environment such as liposomes is also effective in delivering drugs to the CNS. For example. WO 91/04014 describes a liposomal delivery system in which the drug is encapsulated within liposomes to which molecules have been added that are normally transported across the blood-brain barrier.
Another method of formulating aC to pass through the blood-brain barrier is encapsulation in cyclodextnn. Any suitable cyclodexirin which passes through the blood-brain barrier can be employed, including, but not limited to. P-cyclodextrin, y-cyclodextrin and derivatives thereof. See generally, U.S. Patent Nos. 5,017.566, 5,002,935 and 4,983,586. Such compositions can also include a glycerol derivative as described by U.S. Patent No. 5,153,179.
Yet another method takes advantage of physiological techniques such as conjugation of aC to a transportable agent to yield a new chimeric transportable aC. For example, vasoactive intestinal peptide analog (VlPa) exerts its vasoactive effects only after conjugation to a Mab to the specific carrier molecule transferrin receptor, which facilitates the uptake of the VIPa-Mab conjugate through the blood-brain barrier. Pardridge (1991); and Bickel etal. (1993) Proc. Natl. Acad Sci. USA 90:2618-2622. Several other specific transport systems have been identified, these include, but are not limited to, those for transferring insulin, or insulin-like growth factors I and II. Other suitable, non-specific earners include, but are not limited to, pyridinium, fatty acids, inositol, cholesterol, and glucose derivatives. Certain prodrugs have been described whereby, upon entering the central nervous system, the drug is cleaved from the carrier to release the active drug. U.S Patent No. 5,017,566. 53 Suitable subjects include those who are suspccted of being at risk of a pathological effect of any neoplasia, particularly carcinoma, are suitable for treatment with the pharmaceutical compositions of this invention. Those with a history of cancer are especially suitable. Suitable human subjects for therapy comprise two groups, which can be distinguished by clinical criteria. Patients with "advanced disease" or "high tumor burden"' are those who bear a clinically measurable tumor. A clinically measurable tumor is one that can be detected on the basis of tumor mass (e.g., by palpation, CAT scan, or X-Ray; positive biochemical or histopathological markers on their own may be insufficient to identify this population). A pharmaceutical composition embodied in this invention is administered to these patients to elicit an anu-tumor response, with the objective of palliating their condition. Ideally, reduction in tumor mass occurs as a result, but any clinical improvement constitutes a benefit. Clinical improvement includes decreased risk or rate of progression or reduction in pathological consequences of the tumor.
A second group of suitable subjects is known in the art as the "adjuvant group". These are individuals who have had a history of cancer, but have been responsive to another mode of therapy. The prior therapy may have included, but is not restricted to, surgical resection, radiotherapy, and traditional chemotherapy. As a result, these individuals have no clinically measurable tumor. However, they are suspected of being at risk for progression of the disease, either near the original tumor site, or by metastases.
This group can be further subdivided into high-risk and low-risk individuals. The subdivision is made on the basis of features observed before or after the initial treatment. These features are known in the clinical arts, and are suitably defined for each different cancer. Features typical of high risk subgroups are those in which the tumor has invaded neighboring tissues, or who show involvement of lymph nodes.
Another suitable group of subjects is those with a genetic predisposition to cancer but who have not yet evidenced clinical signs of cancer. For instance, women testing positive for a genetic mutation associated with breast cancer, but still of childbearing age, may wish to receive aC treatment prophylactically to prevent the occurrence of cancer until it is suitable to perform preventive surgery. 54 A pharmaceutical composition embodied in this invention is administered to patients in the adjuvant group, or in either of these subgroups, in order to elicit an anticancer response. Ideally, the composition delays recurrence of the cancer, or even better, reduccs the risk of recurrence (i.e., improves the cure rate). Such parameters may be determined in comparison with other patient populations and other modes of therapy.
Of course, crossovers between these two patient groups occur, and the pharmaceutical compositions of this invention can be administered at any time that is appropriate. For example. uC therapy can be conducted before or during traditional therapy of a patient with high tumor burden, and continued after the tumor becomes clinically undetectable. uC therapy can be continued in a patient who initially fell in the adjuvant group, but is showing signs of recurrence. The attending physician has the discretion to determine how or when the compositions of this invention are to be used.
Various compounds and compositions of this invention have other clinical indications, of which the following section provides only a survey.
One indication is the treatment of cells ex vivo. This may be desirable for experimental purposes, or for treatment of an individual with a neoplastic disease. In one example, aC is administered to a culture of cells, such as peripheral blood cells obtained from a donor, or a suitable cell line. About 0.5 to 2 [ig/mL of HI 1 is an effective dose for this purpose. In a second example, donor cells are genetically altered with an expression vector of this invention, to provide for ongoing secretion of aC after administration of the cells to the recipient.
The present invention further encompasses methods for in vivo detection of cancer cells. A diagnostically effective amount of detectably labeled aC is given to the subject in need of tumor imaging- The term "diagnostically effective" means that the amount of detectably labeled aC is administered in sufficient quantity to enable detection of the neoplasia.
The concentration of detectably labeled aC which is administered should be sufficient such that the binding to those cells having C antigen is detectable compared to the background. Further, it is desirable that the detectably labeled aC be rapidly cleared from the circulatory system in order to give the best target-to-background signal ratio. 55 As a rule, the dosage of detectably labeled aC for in vivo diagnosis is somewhat patient-specific and depends on such factors as age, sex, and extent of disease. The dosage of aC can vary from about 0.01 mg/m2 lo about 500 mg/m2, preferably 0.1 mg/m* to about 2 2 200 mg/m", most preferably about 0.1 mg/m to about 10 mg/m. Such dosages may vary, for example, depending on number of injections given, tumor burden, and other factors known to ihose of skill m the art. For instance, tumors have been labeled in vivo using cyanine-conju gated Mabs. Ballou et ai. (1995) Cancer Immunol. Immunother. 41:257-263.
For in vivo diagnostic imaging, the type of detection instrument available is a major factor in selecting a given radioisotope. The radioisotope chosen must have a type of decay which is detectable for a given type of instrument. Still another important factor in selecting a radioisotope for in vrvo diagnosis is that the half-life of the radioisotope be long enough so that it is still detectable at the time of maximum uptake by the target, but short enough so that deleterious radiation with respect to the individual is minimized. Ideally, a radioisotope used for in vivo imaging lacks a particle emission, but produces a large number of photons in the 140-250 keV range, to be readily detected by conventional gamma cameras. For imaging, doses of1 "in-H 11-scFv (for instance. 2 mg of scFv labeled with 5 mCi of1 "indium) the range administered is about 0.01 rag to 20 mg, more preferably about 0.1 -10 mg and even more preferably about I -5 mg per patient.
For in vivo diagnosis, radioisotopes can be bound to aC either directly or indirectly by using an intermediate functional group. Intermediate functional groups which are often used to bind metallic ion radioisotopes to immunoglobulins arc the bifunctional chelating agents such as diethylene triaminepentacetic acid (DTPA) and ethylenediaminetetraacetic acid (EDTA) and similar molecules. Typical examples of metallic ions which can be bound to aC are "'in, 97Ru. 67Ga, 6sGa, ^As, 89Zr, ®°Y, and 201T1. aC can also be labeled with a paramagnetic isotope for purposes of in vivo diagnosis, as in magnetic resonance imaging (MRI) or electron spin resonance (ESR). In general, any conventional method for visualizing diagnostic imaging can be utilized. Usually, gamma and positron emitting radioisotopes are used for camera imaging and paramagnetic isotopes for MRJ. Elements which are particularly useful in such techniques 56 include l37Gd, ijMn. 16iDY, S2Cr. and i6Fe. oC can also be labeled with a fluorescent dye for the purpose of in vivo diagnosis. aC can also be used to detect neoplasias using in viiro assays. Samples are taken from the patient and subject to any suitable immunoassay with aC to detect the presence of C antigen. This is particularly useful in detecting lymphomas and leukemias where the tumor cells bearing C antigen are circulating in the patient's bloodstream. aC can also be used to monitor the course of amelioration of malignancy in an individual. Thus, by measuring the increase or decrease in the number of cells expressing C antigen or changes in the concentration of C antigen present in various body fluids, it is possible to determine whether a particular therapeutic regimen aimed at ameliorating the malignancy is effective.
The present invention encompasses kits containing aC. Diagnostic procedures using aC can be performed by diagnostic laboratories, experimental laboratories, practitioners, or private individuals. The clinical sample is optionally pre-treated for enrichment of the target being tested for. The user then applies a reagent contained in the kit in order to delect the changed level or alteration in the diagnostic component.
Each kit comprises aC used for detecting C antigen in the sample. Optionally, the reagent may be conjugated with a label to permit detection of any complex formed with the target in the sample. In another option, a second reagent is provided that is capable of combining with the first reagent after it has found its target and thereby supplying the detectable label. For example, labeled anti-mouse IgG may be provided as a secondary reagent for use with intact aC. Labeled avidin may be provided as a secondary reagent when the primary reagent has been conjugated with biotin.
The kits can be employed to test a variety of biological samples, including both liquid samples, cell suspensions and tissue samples. Suitable assays using aC that can be supplied in kit form include those described herein. Each reagent is supplied in a solid form or dissolved/suspended in a liquid buffer suitable for inventory storage, and later for exchange or addition into the reaction medium when the test is performed. Suitable packaging is provided. The kit can optionally provide additional components that are useful in the procedure. These optional components include, but are not limited to. 57 buffers, capture reagents, developing reagents, labels, reacting surfaces, means for detection, control samples, instructions, and interpretive information.
The foregoing description provides, inter alia, detailed methods for preparing Hi 1, along with H11 encoding polynucleotides. HI 1 polypeptide fragments, and other derivatives. A practitioner of ordinary skill in the art can practice embodiments of this invention by referring to the sequence data for Hi 1, which is provided herein. The following examples are provided to illustrate but not limit the claimed invention.
FXAMPIF. 1 Method of obtaining Mab Hi 1 Mab NBGM1/H11 ("Hi 1"). is a human monoclonal IgM antibody reactive against the following human tumor tissues and corresponding tumor cell lines: glioma, malignant melanoma, colon adenocarcinoma and breast adenocarcinoma. In vitro characterization of Mab NBGM1/H11 is shown in Example 2- Fusion of Hi 1 was accomplished by fusing 8 x 106 peripheral blood lymphocytes obtained from a 64 year old male with a low grade glioma with the TM-H2-SP2 human myeloma cell line. The TM-H2-SP2 cell line is the immunoglobulin nonsecreting subline of the IgG(K) parental cell line TM-H2. a hypoxanthine guanine phosphoribosyltransferase (EC 2.4.2.8)-deficient derivative of an unknown human myeloma-like line selected in 0.8% methylcellulose for its resistance to 6-thioguanine (6 ng/mL) and failure to grow in hypoxanthine-ammopterin-thyrnidine medium. The karyotype of TM-H2-SP2 is 46±2, XX.
The resultant viable hybridoma cells were split among 40 microwells at a density of 2 x 105 cells/mL and 0.2 mL/well. The frequency of outgrowth from fusion HI 1 was 12 of 40 03 0%) potential hybridoma-containing wells. Outgrowth resulting from sustained growth is defined as prolonged growth with culture expansion for periods longer than 3 months: instances of hybridoma growth failure occuning later than 3 months post-fusion were not observed. 58 Screening of hybridoma clones was performed by antigen-capture enzyme-linked immunosorbent assay (ELISA) in microtiter plates using polyclonal anti-human IgM or IgG as coating antigen. A hybridoma culture supernatant was positive if the measured optical density (O.D.) value exceeded the mean background level of a control culture supernatant by greater than tAvo standard deviations.
Selection of hybridoma clone NBGMI/H11 was performed by cell-fixed ELISA. Culture supernatants from 6 microtiter wells, which tested high for IgM or IgG secretion, were screened against previously attached and fixed human tumor cell lines: Glioblastoma (SKMG-1 and D-54MG); melanoma (A-375); and colon adenocarcinoma (SK-CO-1). A hybridoma supernatant was considered to be positive if the measured O.D. value exceeded the mean background level of control culture supernatants by greater than two standard deviations. Mab produced by hybridoma NBGM1/H11 continues to be reactive against these tumor ccll lines. The "HI 1" antibodies are IgM(k).
Characterization of the hybridoma NBGM1/H11 seed bank was performed by Microbiological Associates (Rockville, MD). The cells tested negative for (I) bacterial and fungal contamination, (2) mycoplasma contamination. (3) HIV-1 and HIV-2 antigens and (4) HTLV-1 and HTLV-2 antigens.
The methods used for the characterization of Mab NBGM1/H11 include: antigen-capiure ELISA. antigen ELISA. cell-fixed ELISA. flow cytometry, immunoperoxidase staining of human tumor cell lines and immunohistochemistry of human tumor and normal tissues (see following examples).
Binding characteristics of this human Mab to human tumor cell lines as determined by flow cytometry, immunoperoxidase staining, cell-fixed ELISA and antigen ELISA (i.e., tumor cell freeze-thaw extracts) are presented below. example 2 Binding of Mab Hll to Human Glioblastoma (SKMG-l) and Melanoma (A375) Cell Lines bv Flow Cytometric Analysis In order to determine the binding of Mab Hi 1 to tumor cells, tumor cells growing in T-flasks were detached by incubation with PBS-EDTA. Cells were collected by low 59 speed ccntrifugation, washed with ice-cold PBS-1% FBS. centrifuged and the supernatant aspirated. The cell pellet was resuspended in culture medium spiked with one of the following: a control human melanoma IgM: hybridoma NBGM1/H11 culture supernatant: or PBS containing purified Mab HI 1: and incubated on ice for 30 minutes. After incubation, the cells were collected by cemrifugation. washed by resuspension in PBS-FBS and centrifuged. The cell pellet was then incubated for 30 min. with FITC-conjugated goat anti-human IgM. After incubation, the cells were washed with PBS-FBS. Finally, the cells were resuspended in PBS-FBS propidium iodide (PI) was added and the cclls washed. Pi-positive and FITC-positive cells were analyzed by flow cytometry.
The results of the flow cytometric analyses are shown in Figs. 2. 3 and 4. These results indicate that crude and purified forms of Mab HI 1 bind to a ccll surface-associated antigcn(s) expressed on live human tumor cell lines, including glioblastoma, melanoma, breast adenocarcinoma and colon adenocarcinoma.
EXAMPLE 3 Binding of Mab HIT to Freezc-Thaw Extracts of Human Tumor Cell Lines bv ELISA Analysis In order to determine the ability of HI 1 lo bind specifically to human tumor antigen(s), ELISA plates were coated with human tumor cell extracts prepared by repeated freezing and thawing of glioblastoma (SKMG-1), breast adenocarcinoma (BT-20. MB-468 and MB-453), colon adenocarcinoma (SK-CO-1 and HT-29) cells.
The coated ELISA plates were incubated for 16-18 hours at 2-8'C. The plates were blocked with PBS-3% BSA for 1 hr at room temperature. Then the plates were incubated with either Mab HI 1 in PBS or control IgM in PBS or culture medium for 2 hrs at room temperature. The plates were washed and incubated with biotinylated anti-human IgM followed by incubation with biotinylated anti-human IgM followed by incubation with streptavidin-conjugated alkaline phosphatase for 1 hr. After washing, p-nitrophenyl phosphate substrate was added to each plate and, after incubation, the plates were read at 405 nm in an ELISA plate reader. 60 The binding of Mab HI 1 to the tumor cell extracts is shown in Figs. 5 and 6 These results indicate that Mab HI 1 binds to tumor cell extracts prepared from glioblastoma, breast adenocarcinoma and colon adenocarcinoma cells in a dose-dependent manner ' EXAMPLE 4 Binding of Mab HI 1 to Human Tumor Cells Determined hv Immunoperoxidase Staining In order to determine immunoreactivity of HI 1, the following experiment was performed Tumor cells were grown in 24-well plates on coverslips for 48-96 hrs. The cells were washed with PBS, fixed with formaldehyde and incubated with 5% normal goat serum on PBS for 30 min After washing, the cells were incubated for 2 hrs with either hybridoma NBGM1/H11 culture supernatants or purified Mab HI 1 (10 jig/mL) in PBS or culture medium spiked with control human myeloma IgM (10 yig/mL) for 2 hrs The cells were then washed and incubated with anti-human IgM conjugated to HRP. Finally, the cells were washed, incubated with DAB substrate to visualize Mab HI 1 binding, counter-stained with hematoxylin and mounted in GVA The results of the immunoreactivity of Mab HI 1 are shown in Table 3 where reactivity is indicated as negative (—), weak positive (+), positive (++), strong positive (+++) These results indicate that, as determined by immunoperoxidase staining, the epitope recognized by Mab HI 1 is expressed by a number of different types of human tumor cells and cell lines 61 TABLE 3 CELL LINES/TYPE OF TUMOR REACTIVITY Control IgM Mab H11 HUMAN GLIOBLASTOMA SKMG 1 __ +++ U-118MG ++ U-S7 MG -- ++ HUMAN MALIGNANT MELANOMA A-375 — +-+-+ SK-MEL-5 — -w- HUMAN COLON ADENOCARCINOMA SK-CO-1 — ++ HUMAN BREAST ADENOCARCINOMA MG-468 4-t- MB-453 4- BT-20 — 4-4- BT-474 — 4-4- HUMAN KIDNEY ADENOCARCINOMA SW-839 — ++ HUMAN OSTEOGFNTC SARCOMA SAOS-2 — -H- HUMAN OVARY ADENOCARCINOMA SK-OV-3 — 4-4- EXAMPLE 5 Binding of Mab Hi! to Human Tumor Cell Lines Determined bv Cell-Fixed F-T.ISA The binding of HI I to human tumor cells and cell lines was also determined by cell-fixed ELISA. Growing tumor cells were detached from the T-flask surface by incubating with EDTA-PBS. Cells were collected by centrifugation, washed with PBS, resuspended in culture medium, counted, and 50 jil of cell suspension containing 5,000-10,000 cells placed in each well of 96-well ELISA plates. After allowing the cells to attach to the plates, the culture supernatants were removed and the plates were blocked with PBS-BSA. The cells were then incubated with different concentrations (1-20 |ig/mL) of either Mab Hi 1 or control human 62 myeloma IgM for 2 hrs After incubation, the plates were washed, incubated with biotin-conjugated goat anti-human IgM, washed again and incubated with strepiavidin-conjugated alkaline phosphatase. Finally, the plates were washed, incubated with p-nitrophenyl phosphate substrate and read at 405 nm in an ELISA plate reader.
Results of the reactivity of Mab HI 1 to human tumor cell lines by cell-fixed ELISA are shown in Table 4 and Figure 7. In Table 4. Control IgM 10 ng/mL and HI 1 10 ng/mL were used for testing the reactivity, and values are given as absorbance at 405 nm ± standard deviation. These results indicate thai: 1) Mab HI 1 reacts strongly with glioblastoma cells (SKMG-1). even at a low concentration of 1 ng/mL. whereas control IgM at 20 ng/mL does not react with SKMG-1 cells: and 2) Mab HI 1 recognizes the tumor antigen(s) present on numerous tumor cell lines (breast adenocarcinoma, colon adenocarcinoma, malignant melanoma, neuroblastoma, glioblastoma, lung adenocarcinoma, small cell lung carcinoma and prostate adenocarcinoma). The degree for Mab reactivity varies both with the type of cancer and the tumor ccll lines. The reactivity of Mab HI 1 for cancer and tumor cells was between three and ten times greater than that of the control IgM- 63 TABLE 4 Cell lines/Tumor Type Reactivity (O.D at 405 nm) Control IgM Mab H11 Human Glioblastoma SKMG-I D-54-MG U-87MG 0.21 ±0.01 0.13 ±0.02 0 13 ± 0.02 0.95 ± 0.06 0.43 ± 0.07 0.60 ±0.01 Neuroblastoma SK-N-SH SK-N-MC 0.14 ±0.02 0.17 ±0 03 0.96 ± 0.06 1.00 ±0.05 Malignant Melanoma SK-MEL-5 SK-MEL-28 0 18 ±0.03 0.19 ±0 03 1.42 ±0.04 1.79 ± 0.05 Breast adenocarcinoma MB-453 MB-468 SK-BR-3 T47D BT-20 BT-474 0 68 ± 0.18 0.60 ± 0.03 0 60 ± 0 03 0.58 ±0.01 0.57 ± 0.02 061 i 0 03 2.85 ±0.14 2.39 ± 0.10 2.14 ± 0.13 2.13 ±0.04 2.07 ± 0.13 2.20 ±0.17 Lung adenocarcinoma SW-900 SK-LU-l A-427 0.20 ± 0 02 0.19 ±0 02 0.22 ±0.01 0.68 ±0.10 0.57 ± 0.07 0 88 ± 0.07 Small cell lung carcinoma NCI-H69 NCI-H82 0.25 ± 0 04 0.20 ± 0.09 1 42 ± 0.20 1.16 ± 0.13 Colon adenocarcinoma SK-Co-1 HT-29 0.27 ± 0.03 0J37 ± 0.02 0.98 ±0,11 1.78 ± 0.20 Prostate adenocarcinoma PC-3 DU-145 0.17 ±0.01 0.15 ±0.01 0.60 ±0.01 0.52 ±0.01 Kidnev adenocarcinoma SW-839 0.2 ±0.01 1.43 ±0.01 Osteogenic sarcoma SAOS-2 0.24 ± 0.02 132 ± 0.07 U-2 OS 0.13 ±0.04 1.93 ±0.05 Bladder cell carcinoma T-24 0.13 ±0.01 1.25 ± 0.03 Ovarian adenocarcinoma SKOOV-3 0.12 ±0.0! 1.14 ±0.02 Larvnx Carcinoma HEP-2 0.25 ± 0-01 1.25 ±0.01 Normal hunian fibroblast GM-8333 0,13 ±0.01 0.39 ±0.01 64 EXAMPLE 6 [mmnnoanntomk- Distribution and Irnmunopathologic Analysis of H11 Immunohistochemistry was used to determine HI I specificity for micro-anatomical detail and heterogeneity in tissues and tumors. Limitations of this technique include possible false negative results due to low levels of expression of the molecule under study, as well as false positive results (cross-reactivity) due to antibody-binding to similar epitopes or epitopes shared by other antigens. To address these limitations, this study was carried out at the highest concentration of antibody that did not show non-specific binding. This allowed for detection of all levels of cross-reactivitv in different tissues. Also, fixation analysis established the best combination of antigenic staining intensity and morphological preservation. The present example presents results obtained from IMPATH Inc., New York, retained to study the cellular specificity and antigen expression of Hi 1, on a selected panel of cryostat-cut frozen sections of normal and tumor tissues. The study used an indirect immunoperoxidase technique.
Histologically normal human tissues were obtained from surgical and autopsy specimens. These fresh tissues were embedded in OCT (Miles Laboratories, Inc., Naperville, IL) in cryomolds. snap-frozen in isopentane, cooled by liquid nitrogen. The tissues from IMPATH's frozen tissue bank were cut at 5 microns, placed on poly-L-lysine coated slides, air-dried, and stored at —70®C.
HI 1, received on wet ice and stored at 2-8°C, was supplied non-biotinylated at a concentration of200 ng/mL, total volume of 3.0 mL. A human myeloma IgM (Pierce Cat. #31146), also supplied by Novopharm, was used as the negative control. Both antibodies were diluted in phosphate buffered saline to the same working concentrations dictated by titration analysis of antibody HU. The peroxidase-labeled secondary antibody was a goat anti-human IgM (American Qualex, San Clemente, CA, lot#AH2PN) diluted in PBS to 1:500.
Immunoperoxidase Techniques: Immunohistochemical studies were performed using an indirect immunoperoxidase method. The ciyostat cut sections were removed from the -70°C freezer, air-dried and fixed according to the fixation protocol (fixation 65 deiails, provided below). Tissue sections were blocked for 10 minutes with 5% normal goat serum diluted in PBS, then incubated with the primary antibody overnight at 4°C. Slides were washed in PBS, followed by a wash with 0.5% Tween/PBS solution, then PBS again. Endogenous peroxidase activity was blocked with a 30 minute 3% hydrogen peroxidc/methanol incubaiion. followed by 3 washes of PBS. The sections were then incubated with goal anti-human IgM (peroxidase-Iabeled) secondary antibody for 15 minutes, ai room temperature, and washed in PBS as described above.
The peroxidase reaction was visualized by incubating tissue sections for 2-5 minutes with 3.3-diaminobenzidine-tetrahydrochloride (DAB) (Sigma Chemical Co., St. Louis. MOV Tissue sections were thoroughly washed, counterstaincd with a modified Harris hematoxylin (Fisher Scicntific. Fair lawn, NJ) dehydrated through graded alcohols, cleared in xylene, and coverslipped. Tissues that demonstrated high levels of background staining with the negative control antibody were repeated with more extensive washing. Human breast carcinoma (F95-036). supplied by IMPATH, was the positive control for HI 1. Negative controls substituted the primary test antibody with purified human myeloma IgM.
The purpose of the fixation analysis was to establish the conditions which provide ihe optimal combination of antigenic staining intensity and morphological preservation. The positive control tissue was tested with five fixation protocols, including no fixation. The fixation protocols tested were 10% neutral buffered formalin (23-25°C), acetone (2-8"C), methyl/acetone (1:1 V/V, 2-8°C) and 95% ethanol (23-25°C) For this study. 10% neutral buffered formalin (NBF) gave optimal results for HI I.
Using 10% NBF as the fixative, serial antibody dilutions (20.0 p.g/mL to 0.1 jig/mL) were tested on the positive control, human breast carcinoma. A concentration of 10.0 pg/mL of antibody HI 1 gave optimal results—maximum staining intensity without significant background staining of the negative control.
The results obtained are depicted in Tables 5 and 6. Table 5 depicts Hi 1 reactivity on normal tissues and Table 6 depicts HI 1 reactivity on human tumors. 66 TABLE 5 Tested Range of Tissye Positive/Total Reactivity (0-3-^-1 Adrenal 0/3 0 Bladder 0/3 0 Bone Marrow 1/3 1 + Brain 0/3 0 Breast 0/3 0 Cervix 0/3 0 Esophagus 0/3 0 Eye ~ 0/3 0 Heart 0/3 0 Kidney 0/3 0 Large Intestine 0/3 0 Liver 0/3 0 Lung 0/3 0 Lymph Node 0/3 0 Muscle 0/3 0 Ovary 0/2 0 Pancreas 0/3 0 Parotid 0/3 0 Pituitary 0/1 0 Prostate 0/3 0 Skin 0/3 0 Small intestine 0/3 0 Spinal cord 0/3 0 Spleen 0/3 0 Stomach 0/3 0 Testis 0/3 0 Thymus 0/3 0 Thyroid 0/3 0 Tonsil 1/3 1+ Uterus 0/3 0 WBC 0/3 0 67 TABLE 6 Tested % of Tumor Range of Tvmflj Positive/Total Cells Stamina Reactivitv r0-3+^ Breast carcinoma 2/3 -90 1-3+ Colon carcinoma 3/3 40-70 1-2+ Glioma 4/6 -90 1-2+ Gastric carcinoma 3/3 -50 1-2+ Lung adenocarcinoma 3/4 -70 1-2+ Lung squamous carcinoma 3/3 -95 1-3+ Lung small cell carcinoma 1/2 1+ Lymphoma 8/8 -95 1-3+ Melanoma 3/3 -95 1-2+ Ovarian carcinoma 3/3 -30 1-3+ Prostate carcinoma 3/3 -95 1-2+ Sarcoma 0/3 0 0 The results obtained indicate that weak (1+) to strong (3+) reactivity was observed in over 70% of the positive control sample. The antigen recognized by Hi 1 has a restricted pattern of distribution. HI 1 was largely unreactive with normal human tissues tested in the IMPATH system. All simple epithelial cells, as well as the stratified epithelia and squamous epithelia of different organs were found to be unreactive. Reactivity was also not seen in neuroectodermal cells, including those in the brain, spinal cord and peripheral nerves. Mesenchymal elements such as skeletal and smooth muscle cells, fibroblasts, and endothelial cells were negative. Tissues of lymphoid origin including bone marrow, lymph node, spleen, and thymus were largely unreactive with antibody HI 1.
Weak (1+) reactivity was observed in rare cells in one specimen of bone marrow and in the germinal centers of one of three specimens of tonsil tested.
Positive inununoreactivitv was observed in almost all specimens of tumor tested including breast, colon, glioma, gastric, lung (adeno, squamous, and small cell), lymphoma, melanoma, ovarian, and prostate. Reactivity was seen in 10% to greater than 95% of the tumor cells present in these specimens; staining intensity ranged from weak (1+) to strong (3+). Antibody HI 1 was, however, unreactive with all three specimens of sarcoma tested. Some but not all normal counterparts of the tumor cells, when present in the specimens, were reactive with HI 1. A few normal cells present in breast, gastric and 68 prostate carcinoma were reactive with antibody HI 1. The large granular cells that were reactive with antibody HI 1 are believed to be inflammatory cells of the eosinophile-mast cell lineage.
In summary, antibody Hi I is largely unreactivc with normal human tissues with the exception of some normal tissues present in tumors. The HI 1 antibody detects an antigen that is expressed in almost all of the tumors tested. example 7 HI 1 Clonintr. Expression and immunologic reactivity In order xo determine the ability of HI 1-scFv antibody fragments to bind specifically to cancer cells, the following experiments were performed.
The single chain antibody constructs were made by the following procedure. Primers specific to the 5' and 3' ends of the HI 1 kappa and mu V regions were synthesized on an Applied Biosystems DNA synthesizer. All the primers contained a restriction endonuclease site for cloning. Primers 5 and 6 also contained additional nucleotides that encode a (SGGGO3 linker. The primers used are listed in Table 7 where the restriction endonuclease site introduced is underlined. 69 Primer j. 4.
TABLE 7 Sequence. (5^3') TATGAAGACACCAGGCCGATATTGTGTTGACGCAG (SEQ ID NO:7) TATCCGGATGCAOCCACAGTTCGTTT (SEQ ID NO:8) TATTCGGACAGGTGCAGCTGGTGGAG (SEQ ID NO:9) Site Introduced Bbsl BspEl BspEl TATGGATCCTGAGGAGACGGTGACCGT (SEQ ID NO: 10) BaraHl TATATATCCGGAGGTGGTGGATCAGGTGGAGGTGGCTC BspEl CCAGGTGCAGCTGGTGGAGTCT(SEQ ID NO: 11) GCCACATTC (SEQ ID NO: 12) BspEl PCR reactions were carried out using primers 1 and 2 for the kappa dimer, primers 3 and 4 for the rau dimer, primers 1 and 6 for the kappa monomer and primers 4 and 5 for the mu monomer. The PCR fragments were then purified and digested with their respective restriction endonucleases. The coding nucleotides arc depicted in SEQ ID NOS: 13 and 16 and the complementary nucleotides axe depicted in SEQ ID NOS: 15 and 18, respectively.
The expression vector pSJFl containing a ribosome binding site. OmpA signal peptide sequence, c-myc (9E10) detection tag and histidine tail (See Figure 8) was prepared by cutting with Bbsl and BamHl. The monomer and dimer constructs were assembled by ligating the respective kappa and mu fragments into pSJFl and transforming them into competent TGI £. coli. Resulting colonies were screened by colony PCR and restriction endonuclease digests to confiim the correct size inserts and the sequences were verified by dideoxy fluorescent sequencing.
Transformed TGI containing either the HI 1 monomer or dimer expression plasmid were shaken at 26°C for 24 hours followed by the addition IPTG to a final concentration of 0.1 nM. The cells were incubated for a further 16 hours and then harvested by centrifugation. The periplasmic proteins containing the HI 1 antibody were released by 70 treatment with sucrose buffer (25% sucrose, 1 mM EDTA. lOmM Tris pH 8.0) followed by ice cold shock buffer (10 mM Tris 8.0, 0.5 mM MgCh). Expression was verified by polyacrylamide gel electrophoresis and Western Blotting. The antibody was purified using a nickel-charged column (Pharmacia HiTrap chelating column) and the bound antibody was eluted with an increasing gradient of imidazole. The purified antibody was dialyzed against PBS/0.02% sodium azide and concentrated to 0.5 mg/mL.
The antigenic similarities between Mab HI 1 and HI 1-scFv were also determined by cell fixed ELISA. ELISA plates coated with A375 cells were incubated with Mab HI 1, control IgM.
HI 1-scFv or control BGA-scFv followed by incubation with rabbit anti-human IgM antibody or rabbit anti-scFv antibody as appropriate. The detection was by goat anti-rabbit IgG-horse radish peroxidase followed by substrate. The results, shown in Figure 9 demonstrate a high affinity of both HI 1 IgM and HI 1-scFv, and a low affinity of both the control IgM and BGA-SL-6.
In order to determine the specificity of biotinylated HI 1-scFv relative to a biotinylated control scFv, the following experiment was performed. Human tumor cells were fixed to ELISA plates and incubated with either biotinylated HI 1-scFv or biotinylated BGA scFv (control) as described above.
Biotinylated HI 1-scFv also demonstrated a much greater affinity (between 8- and 50-fold) for tumor cell lines than the control in cell fixed ELISA. Data corresponding to a concentration of 2.5 |0.g/mL of HI 1-scFv or BGA scFv is shown in Table 8 .
Figure 11 illustrates the portion of Table 8 related to the titration of reactivity of biotinylated HI 1-scFv for the binding of lymphoma cells Daudi, Ramos, CA-46 and CCRF-CEM cells. At every concentration tested (1.25 to 10 jig/mL), HI 1-scFv demonstrated a high affinity for lymphoma cells, but BGA scFv did not. 71 TABLE 8 Tumor Cell Lines Reactivity (O.D. at 450 nm ±SD) Biotinylated BGA scFv Biotin-HlI-scFv Human Glioblastoma SKMG-1 0.01 ±0.01 0.56 ± 0.04 U-118MG 0.01 ±0.02 0.47 ± 0.03 D-54MG 0.01 ±0.00 0.50 ± 0.02 Neuroblastoma SK-N-MC 0 0J ±0.00 0.50 ± 0.02 Malignant Melanoma SK-MEL-5 0.02 ±0.01 0.61 ±0.04 A-375 0.12 ±0.03 0.97 ± 0.03 SK-MEL-28 0.02 ± 0.00 0.71 ±0.04 Breast adenocarcinoma T47D 0.02 ± 0.00 0.64 ± 0.03 MB-468 0.01 ± 0.00 0.65 ± 0.01 SK-BR-3 0.01 ±0-00 0.58 ± 0.02 BT-20 0.01 ±0.00 0.54 ± 0.06 BT-474 0.01 ±0.00 0.60 ±0.01 Lung adenocarcinoma SW-9000 0.01 ± 0.00 0.41 ±0.02 SK-LU-I 0.01 ±0.00 0.45 ± 0.03 A-427 0.01 ± 0.00 0.40 ±0.05 Colon adenocarcinoma SK-Co-1 0.01 ± 0.00 0.56 ±0.01 HT-29 0.01 ± 0.00 0.53 ± 0.06 LS17T 0.01 ± 0.00 0.57 ± 0.02 Osteogenic sarcoma SAOS-2 0.02 ± 0.00 0.88 ± 0.06 U-2 0S 0.02 ± 0.00 0.93 ±0.01 Bladder ccll carcinoma T-24 0.02 ±0.01 0.97 ±0.05 Ovarian adenocarcinoma - SK-OV-3 0.01 ±0.00 0.77 ± 0.02 Larynx carcinoma HEP-2 0.02 ± 0.00 0.08 ± 0.04 Prostate carcinoma DU-145 0.01 ±0.00 0.42 ±0.02 PC-3 0.01 ±0.00 0.36 ±0.01 72 Tumor Cell Lines Reactivity (O.D. at 450 nm ± 0.00 Biotinylated BGA scFv Biotin-Hl 1-scFv Small cell lung carcinoma NCI-H82 NCI-69 0.01 ± 0.00 0.01 ± 0.00 0.44 ± 0.02 0.44 ± 0.01 Lymphoma cell lines Chronic myelogenous leukemia K-562 0.02 ± 0.00 0.65±0.00 Acute lymphoblastic leukemia CEM 0.04 ± 0.00 1.4 ±0.03 Burkitt Lymphoma CA-46 RAMOS DAUDI 0.02 ± 0.00 0.04 ± 0.00 0.02 ± 0.00 1.2 ±0.02 1.3 ±0.02 1.38 ±0.01 In order to verify the specificity of biotinylated HI 1-scFv for cancerous cells, the following experiment was performed. Malignant and normal tissue specimens were prepared and incubated with biotinylated HI 1-scFv as described above.
The HI 1-scFv was used to stain sections of tumor and normal tissues. The results are depicted in Table 9 for normal tissues and Table 10 for tumor tissues.
Figure 10 and Figure 12 depict the relative fluorescence intensity of HI 1-scFv and control icFv to tumor cell lines.
The data in Table 9 demonstrates that biotinylated HI 1-scFv generally does not react to normal tissues. Almost all of the normal tissues tested demonstrated no measurable reactivity, with only a weakly positive signal generated by normal pancreas and peripheral nerve tissues. In Table 9, -ve indicates no measurable activity and +/- indicates weakly positive activity. 73 TABLE 9 Normal Tissues Reactivity of Biotinylated Hi 1-scFv (50 pg/mL) Cortex -ve Breast -ve Colon -ve Heart -ve Liver -ve Lymph node -ve Prostate -ve Thyroid -ve Adrenal -ve Cerebellum -ve Lung -VC Pancreas Peripheral Nerve +/- Skin -ve Spleen -ve Smooth muscle -ve Stomach -ve Thymus -ve 74 TABLE 10 Tissue Type Number of Percentage of Range of positives/ Total Tumor Cells Reactivity (0 - +3) samples tested staining Breast carcinoma 27/31 40/60 1-3+ Colon carcinoma 23/26 80/100 1-3+ Melanoma 13/14 ' 50/70 1-3+ Prostate carcinoma 17/20 /70 1-2+ Cervix squamous 22/24 nd 1 -2+ cell carcinoma Cervix 9/9 nd 1-2+ adenocarcinoma Kaposi Sarcoma 7/8 nd 1-2+ Benign Colon 0/2 0 0 nd: noi determined The results presented in Table 10 indicate that positive staining was found in most breast (27/31) and colon (23/26) and prostate (17/20) carcinoma samples tested. Positive staining was found at 25 ^ig/mL concentration of HI 1-scFv Although the staining was predominantly detected in tumor cells, various degrees of reactivity were also found on stroma and adjacent tissue. The HI i-scFv was also tested for its specificity for normal tissue. The results obtained are presented in Table 11 which summarizes the immunohistochemistry staining of HI 1-scFv with normal human tissue sections. 75 Tissue Adrenal Cerebellum Cortex Colon Breast Kidney Aorta Heart Liver Lung Lymph node Pancreas Pituitary Prostate Peripheral nerve Skin Spleen Small intestine Stomach St. muscle Thymus Thyroid S94-7474-2 (Colon Car. control1) TABLE 11 HI 1-scFv (25 ng/mL) ± -(focal ±) -{sweat gland ±) ++ 3B1 scFv (25 jig/mL) —(focal ±) -(sweat gland ±) FXAMPT.F8 Reactivity of Hll -scFv to Live Tumor Cells as Determined bv Flow Cytometry In order to test the reactivity of HI 1-scFv to live tumor cells, cells from tumor cell lines were prepared for flow cytometry as described above in Example 2. Tumor cells were incubated with either biotinylated HI 1-scFv or control biotinylated scFv as described above at a protein concentration of 100 ng/mL or 200 fig/mL. The reactivity was determined as the mean fluorescence and % positive cells. A biotinylated HI 1-scFv was prepared as described above and at a protein concentration of either 100 (Ag/mL or 200 (j-g/mL. The mean fluorescence and % positive cells are shown in Table 12 where # is 76 biotinylated 3B1 as control scFv; * is biotinylated BGA SL-6 as control scFv; ** is PBS 5% FCS as control: and *** is Biotin-5Bl as control scFv.
Table 12 Mean Fluorescence % Positive Cells Cell Line Protein conc'n (fig/mL) Biotinylated 3BI scFv fc Biotinylated HI 1-scFv Biotinylated 3B1 ScFv H Biotinylated HI 1-scFv SK-BR-3 (Breasi adenocarcinoma) 200 149 233 11 36 MB-468 (Breast adenocarcinoma) 200 144 156 9 11 A-375 (Melanoma) 200 III 207 80 A-375 (Melanoma) 200 161 * 235 28 76 LS-174T (Colon adeno carcinoma) 200 182 233 24 37 HT-29 (Colon adenocarcinoma) 200 141 179 12 18 SKMG-1 (Glioma) 100 100 148"* 189** 206 224 9 14 31 27 H9 (T cell Lymphoma) 100 185"** 145 13 WI-38 (Human diploid lung cells) 100 293*** 255 26 l25I labeled HI 1-scFv demonstrated an affinity of binding (Ka) of 3 x IO8 L/mol for LS174T cells (specific binding shown in Figure 13). u,In-Hl 1-scFv demonstrated an affinity of binding (Ka) of 3.6 x 10s L/mol for A-375 cells and 1.4 x 109 L/mol for SKMG 1 cells. The results are depicted in Figure 14. There were approximately 24,000 binding sites/cell for A-375 cells and approximately 5000 binding sites/cell for SKMG1.
WO 97/44461 PCT/US97/08962 77 These results indicate that purified forms of Mab HI 1 bind to cell surface-associated antigen(s) expressed on breast adenocarcinoma (SK-BR-3), glioblastoma (SKMG-I), and melanoma (A-375) lymphoma cell lines.
In order to further test the reactivity of biotinylated HI 1-scFv to live lymphoma cells, cells from tumor cell lines were prepared and incubated with biotinylated HI 1-scFv at a protein concentration of either 100 [ig/mL and analyzed by flow cytometry as described above in Example 2. The mean fluorescence and % positive cells were measured by flow cytometry. The control for scFv binding was biotinylated BGA scFv. Results are shown in Table 13 and Figure 10.
Table 13 CELL SAMPLES CONC.
MEAN % % LINE ([xg/mL) FLUORESCENCE FLUORESCENCE POSITIVE CELLS Burkitt's PBS 123 Lymphoma BIOTIN- 200 126 9 BGA scFv 100 133 14 CA-46 BIOTIN- 200 262 108 76 H11-scFv 100 211 66 58 T CELL PBS 150 6 lymphoma BIOTIN- 200 155 8 BGA scFv 100 149 7 H9 BIOTIN- 200 186 13 H11-scFv 100 171 9 Acute PBS 151 8 lymphoblast BIOTIN- 200 171 14 oid leukemia BGA scFv 100 159 BIOTIN- 200 231 34 CCRF-CEM H11-scFv 100 242 52 38 Burkitt's PBS 151 Lymphoma BIOTIN- 200 174 BGA scFv 100 169 13 RAMOS BIOTIN- 200 423 143 95 H11-scFv 100 316 87 67 78 HXAMPT.F. 9 Bindini' of Biotmvlated HlRscFv to Human Tumor Cells Determined hv Immunoperoxidase Staining In order lo determine immunoreactivity of HI 1-scFv. the following experiment was performed. Tumor cells were grown in T-flasks and cytospins were prepared and incubated with biotinylated HI 1-scFv or PBS to determine binding.
The results of the immunoreactivity of HI 1-scFv are shown in Table 14 where reactivity is indicated as negative weak positive (+), positive (+ or ++). These results indicate that, as determined by immunoperoxidase staining, the epitope recognized by Mab HI 1 is expressed by a number of different types of human tumor cells and cell lines. 79 Tabic 14 CELL LINES/TYPE OF TUMOR REACTIVITY PBS HI 1-scFv (50 ng/mL) HUMAN GLIOBLASTOMA SKMG 1 -- + U-87 MG - + HUMAN MALIGNANT MELANOMA A-375 - + SK-MEL-5 - ++ HUMAN COLON ADF.NOCARCINOMA SK-CO-I -- + HT-29 - + 174T + HUMAN BREAST ADENOCARCINOMA SK-BR-3 - + BT-20 - + HUMAN LYMPHOMA CELL LINES U-937 Histocytic Lymphoma — ± H9 T Cell Lymphoma — + CEM Acute Lymphoblastoid leukemia MOLT-3 Acute Lymphoblastoid leukemia — ± HL-60 Promyelocytic leukemia — + KG-1 Acute myelogenous leukemia — + K-562 Chronic myelogenous leukemia — -1- GASTRIC CARCINOMA KATO III - ++ HUMAN OSTEOGENIC SARCOMA SAOS-2 - * HUMAN OVARY ADENOCARCINOMA SK-OV-3 - ± BLADDER CEI.T. CARCTNOMA T-24 - + LARYNX CARCINOMA Hep-2 + f.x ample 10 Reactivity of Rpcnmhinantlv Produ^d HI 1 IgCil HI 1 IgGl was produced in Chinese Hamster Ovary (CHO) cells as follows. Several vectors containing cDNAs encoding light and heavy chain sequences of HI 1 were 80 prepared. The orientation. DNA inserts and antibiotic selection criteria of these constructs are shown in Table 15 where CMV is cytomegalovirus: DHFR is dihydrofolate reductase; HC is heavy chain and LC is light chain.
Table 15 vector DNA insert HC + LC promoter promoter orientation antibiotic selection amplif. ppNBl cDNA heavy and light chains CMV* HC- clockwise LC- anticlockwise neomycin DHFR pNB2 cDNA heavy and light chains CMV HC - clockwise LC- clockwise zeocin DHFR pNB3 cDNA ' heavy and light chains CMV HC - clockwise LC - anticlockwise zeocin DHFR These expression vectors have separate insertional sites for the sequences encoding the light and heavy antibody chains. A high level of constitutive expression of both the heavy and light chains is directed by the cytomegalovirus immediate - early (CMV) enhanccr/promoter. A chimeric intron comprising the 5' donor site of the first intron of the human p-globin and the 3' acceptor site from the intron of an immunoglobulin gene (heavy chain variable region) is located downstream from the promoter which has frequently been shown to enhance gene expression levels. Polyadenylation of mRNAs are provided by the poladenylation signal from the simian virus 40 (SV40).
The plasmids also contain the gene encoding dihydrofolate reductase (DHFR) and can thus be grown in Chinese hamster ovaiy (CHO) DHFR deficient cells. Amplification using methotrexate, a folate analogue and potent DHFR inhibitor, results in amplification of the DHFR gene and its flanking sequences (namely, the light and heavy chains of the antibody in the consrruct). A stepwise increase in methotrexate (from about 0.01 nM to about 800 nM) concentration can produce veiy high levels of protein from the target gene(s). The constructs also contain a gene which confers antibiotic resistance was a selectable marker, either neomycin or zeomycin is used. The vectors are shown in Figs. 15 and 16. 81 Results of flow-cytometry analysis of recombinants produced Hi 1 IgGl are shown in Table 16 and illustrate that Hi 1 IgGl which binds to an antigen on SK-BR-3 breast carcinoma cells can be produced in CHO cells.
Table 16 Cell Lines/I.D.
Cone, of IgGl in samples (mg/L) Mean Fluorescence (MF) % Increase of MF above IgGl control PBS 156 Control IgGl 169 1129/pNBl 172 1233 /pNBl 1 184 9 KL-13 / pNB2 3.3 192 14 KL-14 / pNB2 3.3 186 Sb2 / pNB3 4.0 224 33 3sB3 / pNB3 3.9 200 18 EXAMPLE 11 Hi 1 Bindinp to Canccr Cell Lines The binding affinities of Hi 1 IgM and HI 1-scFv for various human cancer cell lines were determined by labeling HI I antibodies with either radioactive iodine or radioactive indium. l25l-Hl 1-scFv was prepared with specific activities of 7,20 or 150 p.Ci/fo.g and U5I-H11 IgM with 0.6 (iCi/jxg were obtained. In addition, l,lIn-Hl 1-scFv having a specific activity of 13 and 38 fiCi/^g was prepared as described in Example 12. The scFv 3B1, which does not recognize the C-antigen, was used as a control lo indicate non-specific binding and was labeled with 150 fiCi/jig.
I25I-H11-scFv was purified using a P-2 minicolumn and analyzed by paper chromatography in 85% methanol as shown in Figure 17. l2sI-Hl I IgM was purified using a Sephadex G-50 mini-column (Pharmacia) and analyzed by paper chromotography in 85% methanol as shown in Figure 18. A Sephadex G-50 column was used to purify 11 lIn-Hl 11 scFv which was then analyzed by ITLC-SG in 0.1 M Citrate as shown in Figure 19. 82 Results of HI 1 binding are shown in Figures 13 and 14. Figure 13 shows the specific binding of 125I-H11-scFv to LS174T human colon cancer cells. Figure 14 shows the total binding of lI1In-Hl 1-scFv to A375 cells.
The results obtained indicate that HI 1 binds specifically to both LT174T and human melanoma cells. HI 1 also binds, but with lower affinity, to the breast cancer ccll line.
EXAMPLE 12 Tumor Imaging with '"indium-DTPA-Hl 1 -scFv Hi 1-scFv was conjugated with the bycyclic anhydride of diethylenetriaminepentaacetic acid (DTPA) at a molar ratio of 10:1 (DTPA:H11 -scFv) resulting in a substitution level of 2 moles of DTPA per mole of H11 -scFv. DTPA-H11 -scFv was purified from excess DTPA on a Sephadex G-25 (Pharmacia) mini-column and reconcentrated to 10 mg/mL using a Centricon-30 microconcentrator (Amicon). The DTPA-H11 -scFv was radiolabeled to a specific activity of 25 mCi/mg with 11 'indium acetate. Unincorporated n,In was removed using a Sephadex G-25 minicolumn. The "'indium acetate was prepared from "'indium chloride (Nordion) and 1 M acetate buffer at pH 6.0. The radiochemical purity of the final " 'in-DTAP-Hl 1-scFv was greater than 99% as measured by thin layer silica gel chromatography in 100 mM sodium citrate pH 5.0. Figure 19 shows the purification and TLC A female nude mouse with an existing subcutaneous A375 melanoma xenograft on the right lateral side and a subcutaneous HT-29 human colon cancer xenograft in the mid-abdominal region was injected intravenously in the tail vein with 100 nCi of U1ln-DTAP-H11-scFv. The mouse was immediately placed under the gamma camera (Siexnans ZL3700) interfaced with a GE Star 4000i computer and a dynamic acquisition was obtained for 120 minutes, for a total of480 frames of 15 seconds each. The frames were then combined into 12x10 minute images. The A375 tumor was visible on the right lateral side of the mouse as early as 30 minutes post-injection.
Region-of-interest analysis of the two tumors showed that the A375 tumor accumulated radioactivity throughout the 120 minute study, whereas the HT-29 tumor 83 accumulated radioactivity for ihe first hour and then the radioactivity concentration remained relatively constant. Figure 20 shows 12 frames and the two arrows on the bottom right hand frame, taken at 120 minutes, show the accumulation of radioactivity in the two tumors. The narrow arrow points to the A375 tumor, and the broad arrow points to the HT-29 tumor. Normal tissues visible on the images include the heart, liver, kidneys and bladder. The heart is visible due to circulating amounts of radioactivity, and the kidneys and bladder are visible due to renal elimination of ,uIn-DTAP-Hl 1-scFv. The small amount of liver uptake may be due to blood flow to the liver or to partial binding of mln-DTAP-Hl 1-scFv to the liver.
Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity and understanding, it will be apparent to those skilled in the art that certain changes and modifications may be practiced. Therefore, the description and examples should not be construed as limiting the scope of the invention, which is delineated by the appended claims. 84 SEQUENCE LISTING (1) GENERAL INFORMATION: (i) APPLICANT: Dan, Michael D.
Maiti, Pradip K.
Kaplan, Howard A. (ii) TITLE OF INVENTION; ANTIGEN BINDING FRAGMENTS Hll. THAT SPECIFICALLY DETECT CANCER CELLS, NUCLEOTIDES ENCODING THE FRAGMENTS, AND USE THEREOF FOR THE PROPHYLAXIS AND DETECTION OF CANCERS Uil) NUMBER OF SEQUENCES: 18 (lv) CORRESPONDENCE ADDRESS: (A) ADDRESSEE: Morrison & Foerscer (B) STREET: 755 Page Mill Road (C) CITY: Palo Alto (D) STATE: CA (E) COUNTRY: USA IF) ZIP: 943 04-1018 (v) COMPUTER READABLE FORM: (A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS (D) SOFTWARE: Patentln Release #1.0, Version *1.30 (vi) CURRENT APPLICATION DATA: (A) APPLICATION NUMBER: (B) FILING DATE: (C) CLASSIFICATION: (viii) ATTORNEY/AGENT INFORMATION: (A) NAME; Lehnhardt, Susan K.
(B) REGISTRATION NUMBER; 33,943 (C) REFERENCE/DOCKET NUMBER: 31608-20001.20 (ix) TELECOMMUNICATION INFORMATION: (A) TELEPHONE: (415) B13-S600 (B) TELEFAX: (415) 494-0792 (C) TELEX: 706141 (2) INFORMATION FOR SEQ ID NO:l. (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 543 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: I..543 WO 97/44461 PCT/US97/08962 85 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:l: CAAGCTATTT AGGTGACACT ATAGAATACT CAAGCTATGC ATCCAACGCG TTGGGAGCTC 6 0 TCCCATATGG TCGACCTGCA GGCGGCCGCA CTAGTGATTT CAAGCTTCAT CACTGAACAC 120 AGAGGACTCA CCATGGAGTT TGGGCTGAGC TGGGTTTTCC TCGTTGCTCT TTTAAGAGGT 180 ATCCAGTGTC AGGTGCAGCT GGTGGAGTCT GGGGGAGGCG TGGTCCAGCC TGGGAGGTCC 240 CTGAGACTCT CCTGTGCAGC CTCTGGATTC CCCTTCAGAA GCTTTGCTAT GCACTGGGTC 3 00 |CGCCAGGCTC TAGGCAAGGG GCTGGAGTGG GTGGCAGTTA TATCATATGA TGGAAGCACT 3S0 AAATACTACG CAGACTCCGT GAAGGGGCGA TTCACCATCT CCAGAGACAC TTCCAAGAAC 420 ACGGTGTATC TAAAAATGAA CAGGCTGAGA ACTGAGGACA CGGCTGTCTT TTACTTGTGC 4 80 GAAAGACAGA GCCTGCTGGG TGACTATGAC CACTACTACG GNTTGGACGC TTGGGGAAAG 54 0 GGA 54 3 (2) INFORMATION FOR SEQ ID NO:2. (1) SEQUENCE CHARACTERISTICS: (A) LENGTH-. 179 amino acids O) TYPE: amino acid (C) STRANDEDNESS. single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: Gin Ala lie Val Thr Leu Asn Thr Gin Ala Met His Pro Thr Arg Trp 10 15 Glu Leu Ser His Met Val Asp Leu Gin Ala Ala Ala Leu Val lie Ser 20 25 30 Ser Phe He Thr Glu His Arg Gly Leu Thr Met Glu Phe Gly Leu Ser 35 40 45 Trp Val Phe Leu Val Ala Leu Leu Arg Gly lie Gin Cys* Gin Val Gin SO 55 60 Leu Val Glu Ser Gly Gly Gly Val Val Gin Pro Gly Arg Ser Leu Arg 65 70 75 80 Leu Ser Cys Ala Ala Ser Gly Phe Pro Phe Arg Ser Phe Ala Met His 85 90 95 Trp Val Arg Gin Ala Leu Gly Lys Gly Leu Glu Trp Val Ala Val lie 100 10S 110 86 Ser Tyr Asp Gly Ser Thr Lys Tyr Tyr Ala Asp 115 120 Ser val Lys Gly Arg 125 Phe Thr lie Ser Arg Asp Thr Ser Lys Asn Thr 130 135 Val Tyr Leu Lys Met 14 0 Asn Arg Leu Arg Thr Glu Asp Thr Ala Val Phe 145 ISO 155 Tyr Leu Cys Glu Arg 160 Gin Ser Leu Leu Gly Asp Tyr Asp Has Tyr Tyr 165 170 Gly Leu Asp Ala Trp 175 Gly Lys Gly (21 INFORMATION FOR SEQ ID NO:3: li) SEQUENCE CHARACTERISTICS: (A) LENGTH: 543 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SSQ ID NO:3- TCCCTTTCCC CAAGCGTCCA ANCCGTAGTA GTGGTCATAG TCACCCAGCA GGCTCTGTCT 60 TTCGCACAAG TAAAAGACAG CCGTGTCCTC AGTTCTCAGC CTGTTCATTT TTAGATACAC 120 CGTGTTCTTG GAAGTGTCTC TGGAGATGGT GAATCGCCCC TTCACGGAGT CTGCGTAGTA 18 0 TTTAGTGCTT C CAT CATATG ATATAACTGC CACCCACTCC AGCCCCTTGC CTAGAGCCTG 240 GCGGACCCAG TGCATAGCAA AGCTTCTGAA GGGGAATCCA GAGGCTGCAC AGGAGAGTCT 300 CAGGGACCTC CCAGGCTGGA CCACGCCTCC CCCAGACTCC ACCAGCTGCA CCTGACACTG 360 GATACCTCTT AAAAGAGCAA CGAGGAAAAC CCAGCTCAGC CCAAACTCCA TGGTGAGTCC 420 TCTGTGTTCA GTGATGAAGC TTGAAATCAC TAGTGCGGCC GCCTGCAGGT CGACCATATG 4B0 GGAGAGCTCC CAACGCGTTG GATGCATAGC TTGAGTATTC TATAGTGTCA CCTAAATAGC 54 0 TTG 543 (2) INFORMATION FOR SEQ ID NO:4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 450 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear 87 (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..450 ixi) sequence description: seq id no:4: ;gagatc-g acatggagtt ccaggcgcag cttctcttcc tcctgctact ctggctccca gatatcaccg gagatattgt gttgacgcag tctccaggca ccctgtcttt gtctccaggg GAAAGAGCCA CCCTCTCCTG CAGGGCCAGT CAGAGTGTTA GTAGCAGCTA CTTAGCCTGG TACCAGCAGA AACCTGGCCA GGCTCCCAGG CTCCTCATCT ATGGTGCATC CACCAGGGCC ACTGGCATGC CAGACAGGTC CAGTGGCAGT GGGTCCGGGA CAGACTTCAC TCTCACCATC AGTAGACTGG AGCCTGAAGA TTTTGCAGTG TATTACTGTC AGCAGTATGG TAGCTCACCT CAGACACCTC AGATCACTTT CGGCGGAGGG ACCAAGGTGG AGATCAAACG AACTGTGGCT GCACCATCTG TCTTCATCTT CCCGCCATCT (2) information for seq id no:s: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 150 amino acids (E) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: Leu Glu Met Asp Met Glu Phe Gin Ala Gin Leu Leu Phe Leu Leu Leu IS 10 IS Leu Trp Leu Pro Asp lie Thr Gly Asp lie Val Leu Thr Gin Ser Pro 20 25 30 Gly Thr Leu Ser Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg 35 40 45 Ala Ser Gin Ser Val Ser Ser Ser Tyr Leu Ala Trp Tyr Gin Gin Lys 50 55 60 Pro Gly Gin Ala Pro Arg Leu Leu lie Tyr Gly Ala Ser Thr Arg Ala 65 70 75 SO Thr Gly Met Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe 85 90 95 Thr Leu Thr lie Ser Arg Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr 100 105 110 Cys Gin Gin Tyr Gly Ser Ser Pro Gin Thr Pro Gin lie Thr Phe Gly 115 120 125 SO 120 100 240 300 360 420 450 88 Gly Gly Thr 130 Lys Val Glu lie Lys Arg Thr Val Ala Ala Pro Ser Val 13S 140 Phe lie Phe Pro Pro Ser 145 150 (2) INFORMATION FOR SEQ 10 NO:6: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 4S0 base pairs (B) TYPE; nucleic acid (C> STRAMDEDNESS: double (D) TOPOLOGY: linear (Xi] SEQUENCE DESCRIPTION: SEQ ID NO:6: AGATGGCGGG AAGATGAAGA CAGATGGTGC AGCCACAGTT CGTTTGATCT CCACCTTGGT 60 CCCTCCGCCG AAAGTGATCT GAGGTGTCTG AGGTGAGCTA CCATACTGCT GACAGTAATA 120 CACTGCAAAA TCTTCAGGCT CCAGTCTACT GATGGTGAGA GTGAAGTCTG TCCCGGACCC ISO ACTGCCACTG AACCTGTCTG GCATGCCAGT GGCCCTGGTG GATGCACCAT AGATGAGGAG 240 CCTGGGAGCC TGGCCAGGTT TCTG CTGGTA CCAGGCTAAG TAG CTG CTAC TAACACTCTG 300 ACTGGCCCTG CAGGAGAGGG TGGCTCTTTC CCCTGGAGAC AAAGACAGGG TGCCTGGAGA 36 0 CTGCGTCAAC ACAATATCTC CGGTGATATC TGGGAGCCAG AGTAGCAGGA GGAAGAGAAG 420 CTGCGCCTGG AACTCCATGT CCATCTCGAG 4 50 (2) INFORMATION FOR SEQ ID NO.7: (i) SEQUENCE CHARACTERISTICS.
(A) LENGTH: 34 base pairs (B) TYPE: nucleic acid (C) STRANDSDNESS: 6ingle (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SSQ ID NO: 7: TATGAAGACA CCAGGCCGAT ATTGTGTTGA CGCA 34 (2) INFORMATION FOR SEQ ID NO:B: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 26 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: 89 •TATCCGGATG CAGCCACAGT TCGTTT 26 12) INFORMATION FOR SEQ ID NO:9: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 26 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (XI) SEQUENCE DESCRIPTION. SEQ ID NO:9* TATTCGGACA GGTGCAGCTG GTGGAG 26 (2) INFORMATION FOR SEQ ID NO:10: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 2 7 base pairs (B) TYPE; nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION. SEQ ID NO-10: TATGGATCCT GAGGAGACGG TGACCGT 27 (2) INFORMATION FOR SEQ ID NO:11: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH- 60 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (XI) SEQUENCE DESCRIPTION: SEQ ID NO:11: 7ATATATCCG GAGGTGGTGG ATCAGGTGGA GGTGGCTCCC AGGTGCAGCT GGTGGAGTCT 60 (2) INFORMATION FOR SEQ ID NO:12: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 46 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (XI) SEQUENCE DESCRIPTION: SEQ ID NO:12: ACCTCCGGAA CCGCCACCGC CAGAGACAGA TGGTGCAGCC ACATTC 46 90 (2) INFORMATION FOR SEQ ID NO-.13: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 916 base pairs (B1 TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ix) FEATURE: (A) NAME/KEY: CDS (E) LOCATION: join(1..906, 913..918) (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: GAA TTC ATG AAA AAA ACC GCT ATC GCG ATC GCA GTT GCA CTG GCT GGT 48 Glu Phe Met Lys Lys Thr Ala lie Ala lie Ala Val Ala Leu Ala Gly 15 10 15 TTC GCT ACC GTT GCG CAG GCC GAT ATT GTG TTG ACG CAG TCT CCA GGC 96 Phe Ala Thr Val Ala Gin Ala Asp lie Val Leu Thr Gin Ser Pro Gly 20 25 30 ACC CTG TCT TTG TCT CCA GGG GAA AGA GCC ACC CTC TCC TGC AGG GCC 144 Thr Leu Ser Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala 35 40 45 AGT CAG AGT GTT AGT AGC AGC TAC TTA GCC TGG TAC CAG CAG AAA CCT 192 Ser Gin Ser Val Ser Ser Ser Tyr Leu Ala Trp Tyr Gin Gin Lys Pro SO 55 60 \ GGC CAG GCT CCC AGG CTC CTC ATC TAT GGT GCA TCC ACC AGG GCC ACT 240 Gly Gin Ala Pro Arg Leu Leu lie Tyr Gly Ala ser Thr Arg Ala Thr 65 70 75 SO GGC ATG CCA GAC AGG TTC AGT GGC AGT GGG TCC GGG ACA GAC TTC ACT 28 0 Gly Met Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr 85 90 95 CTC ACC ATC AGT AGA CTG GAG CCT GAA GAT TTT GCA GTG TAT TAC TGT 336 Leu Thr He Ser Arg Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys 100 105 110 CAG CAG TAT GGT AGC TCA CCT CAG ACA CCT CAG ATC ACT TTC GGC GGA 384 Gin Gin Tyr Gly Ser Ser Pro Gin Thr Pro Gin lie Thr Phe Gly Gly 115 120 125 GGG ACC AAG GTG GAG ATC AAA CGA ACT GTG GCT GCA CCA TCT GTC TCT 432 Gly Thr Lys Val Glu lie Lys Arg Thr Val Ala Ala Pro Ser Val Ser 130 135 140 91 GGC GGT GGC GGT TCC GGA GGT GGT GGA TCA GGT GGA GGT GGC TCC CAG 480 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gin 145 " ISO 155 160 GTG CAG CTG GTG GAG TCT GGG GGA GGC GTG GTC CAG CCT GGG AGG TCC 526 Val Gin Leu Val Glu Ser Gly Gly Gly Val Val Gin Pro Gly Arg Ser 165 170 17 S CTG AGA CTC TCC TGT GCA GCC TCT GGA TTC CCC TTC AGA AGC TIT GCT 576 Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Pro Phe Arg Ser Phe Ala 180 1B5 190 ATG CAC TGG GTC CGC CAG GCT CTA GGC AAG GGG CTG GAG TGG GTG GCA 624 Met His Trp Val Arg Gin Ala Leu Gly Lys Gly Leu Glu Trp Val Ala 195 200 205 GTT ATA TCA TAT GAT GGA AGC ACT AAA TAC TAC GCA GAC TCC GTG AAG 6 72 Val lie Ser Tyr Asp Gly Ser Thr Ly3 Tyr Tyr Ala Asp Ser Val Lys 210 215 220 GGC CGA TTC ACC ATC TCC AGA GAC ACT TCC AAG AAC ACG GTG TAT CTA 72 0 Gly Arg Phe Thr lie Ser Arg Asp Thr Ser Lys Asn Thr Val Tyr Leu 225 230 235 240 AAA ATG AAC AGC CTG AGA ACT GAG GAC ACG GCT GTC TAT TAC TGT GCG 76 8 Lys Met Asn Ser Leu Arg Thr Glu Asp Thr Ala Val Tyr Tyr Cys Ala 245 250 255 AGA GAT CAG AGC CTG TTG GGT GAC TAT GAC CAC TAC TAC GGT TTG GAC 816 Arg Asp Gin Ser Leu Leu Gly Asp Tyr Asp His Tyr Tyr Gly Leu Asp 260 265 270 GTC TGG GGC AAA GGG ACC ACG GTC ACC GTC TCC TCA GGA TCC GAA CAA 854 Val Trp Gly Lys Gly Thr Thr Val Thr Val Ser Ser Gly Ser Glu Gin 275 2 6 0 265 AAA CTG ATC AGC GAA GAA GAT CTG AAC CAT CAC CAT CAC CAT 906 Lys Leu lie Ser Glu Glu Asp Leu Asn Els His His His His 290 295 300 TAGTGA AAG CTT 918 Lys Leu (2) INFORMATION FOR SEQ ID NO:14: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 304 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:14: 92 Glu Phe Met Lys Lys Thx Ala lie Ala lie Ala Val Ala Leu Ala Gly i 5 XO 15 Phe Ala Thr Val Ala Gin Ala Asp lie val Leu Thr Gin Ser Pro Gly 20 25 30 Thr Leu Ser Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala 35 40 45 Ser Gin Ser Val Ser ser Ser Tyr Leu Ala Trp Tyr Gin Gin Lys Pro SO 55 60 Gly Gin Ala Pro Arg Leu Leu lie Tyr Gly Ala Ser Thr Arg Ala Thr 65 70 75 80 Gly Met Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr 05 90 95 Leu Thr lie Ser Arg Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys 100 10S X10 Gin Gin Tyr Gly Ser Ser Pro Gin Thr Pro Gin lie Thr Phe Gly Gly 115 120 125 Gly Thr Lys Val Glu lie Lys Arg Thr Val Ala Ala Pro Ser Val Ser 130 135 140 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gin 145 150 155 160 Val Gin Leu Val Glu Ser Gly Gly Gly Val Val Gin Pro Gly Arg Ser 165 170 175 Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Pro Phe Arg Ser Phe Ala 160 185 190 Met His Trp Val Arg Gin Ala Leu Gly Lys Gly Leu Glu Trp Val Ala 19S 200 20S Val lie Ser Tyr Asp Gly Ser Thr Lys Tyr Tyr Ala Asp Ser Val Lys 210 215 220 Gly Arg Phe Thr He Ser Arg Asp Thr ser Lys Asn Thr Val Tyr Leu 225 230 235 240 Lys Met Asn Ser Leu Arg Thr Glu Asp Thr Ala Val Tyr Tyr Cys Ala 245 250 255 Arg Asp Gin Ser Leu Leu Gly Asp Tyr Asp His Tyr Tyr Gly Leu Asp 260 265 270 Val Trp Gly Lys Gly Thr Thr Val Thr Val Ser Ser Gly Ser Glu Gin 275 200 265 93 Lys Leu lie Ser Glu Glu Asp Leu Asn His His His His His Lys Leu 290 295 300 (2) INFORMATION FOR SEQ ID NO:15: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 918 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15: AAGCTTTCAC TAATGGTGAT GGTGATGGTT CAGATCTTCT TCGCTGATCA GTTTTTGTTC 6 0 (3GATCCTGAG GAGACGGTGA CCGTGGTCCC TTTGCCCCAG ACGTCCAAAC CGTAGTAGTG 120 GTCATAGTCA CCCAACAGGC TCTGATCTCT CGCACAGTAA TAGACAGCCG TGTCCTCAGT 180 TCTCAGGCTG TTCATTTTTA GATACACCGT GTTCTTGGAA GTGTCTCTGG AGATGGTGAA 240 TCGGCCCTTC ACGGAGTCTG CGTAGTATTT AGTGCTTCCA TCATATGATA TAACTGCCAC 3 00 CCACTCCAGC CCCTTGCCTA GAGCCTGGCG GACCCAGTGC ATAGCAAAGC TTCTGAAGGG 3 80 GAATCCAGAG GCTGCACAGG AGAGTCTCAG GGACCTCCCA GGCTGGACCA CGCCTCCCCC 420 AGACTCCACC AGCTGCACCT GGGAGCCACC TCCACCTGAT CCACCACCTC CGGAACCGCC 480 ACCGCCAGAG ACAGATGGTG CAGCCACAGT TCGTTTGATC TCCACCTTGG TCCCTCCGCC S40 GAAAGTGATC TGAGGTGTCT GAGGTGAGCT ACCATACTGC TGACAGTAAT ACACTGCAAA 600 ATCTTCAGGC TCCAGTCTAC TGATGGTGAG AGTGAAGTCT GTCCCGGACC CACTGCCACT 660 GAACCTGTCT GGCATGCCAG TGGCCCTGGT GGATGCACCA TAGATGAGGA GCCTGGGAGC 720 CTGGCCAGGT TTCTGCTGGT ACCAGGCTAA GTAGCTGCTA CTAACACTCT GACTGGCCCT 730 GCAGGAGAGG GTGCCTCTTT CCCCTGGAGA CAAAGACAGG GTGCCTGGAG ACTGCGTCAA 840 CACAATATCG GCCTGCGCAA CGGTAGCGAA ACCAGCCAGT GCAACTGCGA TCGCGATAGC 900 GGTTTTTTTC ATGAATTC 918 (2) INFORMATION FOR SEQ ID NO:16: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 361 base pairs (B) TYPE: nucleic acid.
(C) STRANDEDNESS: single (D) TOPOLOGY: linear wo 97/44461 94 (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 30111(1..855. 862.. B67) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16: GAA TTC ATG AAA AAA ACC GCT ATC GCG ATC GCA GTT GCA CTG GCT GGT 4 8 Glu Phe Met Lys Lys Thr Ala lie Ala lie Ala Val Ala Leu Ala Gly X 5 10 15 TTC GCT ACC GTT GCG CAG GCC GAT ATT GTG TTG ACG CAG TCT CCA GGC 96 Phe Ala Thr Val Ala Gin Ala Asp lie Val Leu Thr Gin Ser Pro Gly 20 25 30 ACC CTG TCT TTG TCT CCA GGG GAA AGA GCC ACC CTC TCC TGC AGG GCC 144 Thr Leu Ser Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala 35 40 45 AGT CAG AGT GTT AGT AGC AGC TAC TTA GCC TGG TAC CAG CAG AAA CCT 192 Ser Gin Ser Val Ser Ser Ser Tyr Leu'Ala Trp Tyr Gin Gin Lys Pro 50 55 60 GGC CAG GCT CCC AGG CTC CTC ATC TAT GGT GCA TCC ACC AGG GCC ACT 24 0 Gly Gin Ala Pro Arg Leu Leu lie Tyr Gly Ala Ser Thr Arg Ala Thr 65 70 75 90 GGC ATG CCA GAC AGG TTC AGT GGC AGT GGG TCC GGG ACA GAC TTC ACT 288 Gly Mtet Pro Asp Arg Phe Ser Gly Ser Gly ser Gly Thr Asp Phe Thr 65 90 95 CTC ACC ATC AGT AGA CTG GAG CCT GAA GAT TTT GCA GTG TAT TAC TGT 336 Leu Thr lie Ser Arg Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys 100 10S 110 CAG CAG TAT GGT AGC TCA CCT CAG ACA CCT CAG ATC ACT TTC GGC GGA 384 Gin Gin Tyr Gly Ser Ser Pro Gin Thr Pro Gin lie Thr Phe Gly Gly 115 120 125 GGG ACC AAG GTG GAG ATC AAA CGA ACT GTG GCT GCA TCC GGA CAG GTG 432 Gly Thr Lys Val Glu lie Lys Arg Thr Val Ala Ala Ser Gly Gin Val 130 135 140 CAG CTG GTG GAG TCT GGG GGA GGC GTG GTC CAG CCT GGG AGG TCC CTG 480 Gin Leu Val Glu Ser Gly Gly Gly Val Val Gin Pro Gly Arg Ser Leu 145 ISO 155 ISO AGA CTC TCC TGT GCA GCC TCT GGA TTC CCC TTC AGA AGC TTT GCT ATG 520 Arg Leu Ser Cys Ala Ala Ser Gly Phe Pro Phe Arg Ser Phe Ala Met 165 170 175 CAC TGG GTC CGC CAG GCT CTA GGC AAG GGG CTG GAG TGG GTG GCA GTT 576 His Trp Val Arg Gin Ala Leu Gly Lys Gly Leu Glu Trp Val Ala Val 180 185 190 wo 97/44461 95 ATA TCA TAT GAT GGA AGC ACT AAA TAC TAC GCA GAC TCC GTG AAG GGC 624 lie Ser Tyr Asp Gly Ser Thr Lys Tyr Tyr Ala Asp Ser Val Lys Gly 19S 200 205 CGA TTC ACC ATC TCC AGA GAC ACT TCC AAG AAC ACG GTG TAT CTA AAA 672 Arg Phe Thr lie Ser Arg Asp Thr Ser Lys Asn Thr val Tyr Leu Lys 210 215 220 ATG AAC AGC CTG AGA ACT GAG GAC ACG GCT GTC TAT TAC TGT GCG AGA 720 Met Asn Ser Leu Arg Thr Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg 225 230 235 240 GAT CAG AGC CTG TTG GGT GAC TAT GAC CAC TAC TAC GGT TTG GAC GTC 768 Asp Gin Ser Leu Leu Gly Asp Tyr Asp His Tyr Tyr Gly Leu Asp Val 245 250 255 TGG GGC AAA GGG ACC ACG GTC ACC GTC TCC TCA GGA TCC GAA CAA AAA 816 Trp Gly Lys Gly Thr Thr val Thr Val Ser Ser Gly Ser Glu Gin Lys 260 26 S 270 CTG ATC AGC GAA GAA GAT CTG AAC CAT CAC CAT CAC CAT TAGTGA AAG 664 Leu lie Ser Glu Glu Asp Leu Asn His His His His His Lys 275 260 205 CTT 867 Leu (2) INFORMATION FOR SEQ ID NO:17 ; (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 2B7 ammo acids (B) TYPE: ammo acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO;17: Glu Phe Met Lys Lys Thr Ala lie Ala lie Ala Val Ala Leu Ala Gly 15 10 15 Phe Ala Thr Val Ala Gin Ala Asp lie Val Leu Thr Gin Ser Pro Gly 20 25 30 Thr Leu Ser Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala 35 40 45 Ser Gin Ser val Ser Ser Ser Tyr Leu Ala Trp Tyr Gin Gin Lys Pro 50 55 60 Gly Gin Ala Pro Arg Leu Leu lie Tyr Gly Ala Ser Thr Arg Ala Thr 65 70 75 80 96 Gly Met Pro Asp Arg Phe ser Gly Ser Gly Ser Gly Thr Asp Phe Thr 85 90 95 Leu Thr lie Ser Arg Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys 100 105 110 Gin Gin Tyr Gly Ser Ser Pro Gin Thr Pro Gin lie Thr Phe Gly Gly 115 120 125 Gly Thr Lys Val Glu lie Lys Arg Thr Val Ala Ala Ser Gly Gin Val 130 135 140 Gin Leu Val Glu Ser Gly Gly Gly Val Val Gin Pro Gly Arg Ser Leu |14 5 150 155 160 Arg Leu Ser Cys Ala Ala Ser Gly Phe Pro Phe Arg Ser Phe Ala Met 165 170 175 Kis Trp Val Arg Gin Ala Leu Gly Lys Gly Leu Glu Trp Val Ala Val 180 ies 190 He Ser Tyr Asp Gly Ser Thr Lys Tyr Tyr Ala Asp Ser Val Lys Gly 195 200 205 Arg Phe Thr lie Ser Arg Asp Thr Ser Lys Asn Thr Val Tyr Leu Lys 210 215 220 Met Asn Ser Leu Arg Thr Glu Asp Thr Ala Val Tyr Tyr Cya Ala Arg 225 230 235 240 Asp Gin Ser Leu Leu Gly Asp Tyr Asp HjlS Tyr Tyr Gly Leu Asp Val 245 250 255 Trp Gly Lys Gly Thr Thr Val Thr Val Ser Ser Gly Ser Glu Gin Lys 260 265 270 Leu lie Ser Glu Glu Asp Leu Asn His Hzs His His His Lys Leu 275 280 265 (2) INFORMATION FOR SEQ ID NO:IS: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 8 67 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID N0:18: AAGCTTTCAC TAATGGTGAT GGTGATGGTT CAGATCTTCT TCGCTGATCA GTTTTTGTTC 60 GGATCCTGAG GAGACGGTGA CCGTGGTCCC TTTGCCCCAG ACGACCAAAC CGTAGTAGTG 120 GTCATAGTCA CCCAACAGGC TCTGATCTCT CGCACAGTAA TAGACAGCCG TGTCCTCAGT 180 97 TCTCAGGCTG TTCATTTTTA GATACACCGT GTTCTTGGAA GTGTCTCTGG AGATGGTGAA 24 0 TCGGCCCTTC ACGGAGTCTG CGTAGTATTT AGTGCTTCCA TCATATGATA TAACTGCCAC 3 00 CCACTCCAGC CCCTTGCCTA GAGCCTGGCG GACCCAGTGC ATAGCAAAGC TTCTGAAGGG 360 GAATCCAGAG GCTGCACAGG AGAGTCTCAG GGACCTCCCA GGCTGGACCA CGCCTCCCCC 42 0 AGACTCCACC AGCTGCACCT GTCCGGATGC AGCCACAGTT CGTTTGATCT CCACCTTGGT 4 80 CCCTCCGCCG AAAGTGATCT GAGGTGTCTG AGGTGAGCTA CCATACTGCT GACAGTAATA 540 CACTGCAAAA TCTTCAGGCT CCAGTCTACT GATGGTGAGA GTGAAGTCTG TCCCGGACCC 6 00 ACTGCCACTG AAC CTGT CTG GCATGCCAGT GGCCCTGGTG GATG CAC CAT AGATGAGGAG 660 CCTGGGAGCC TGGCCAGGTT TCTGCTGGTA CCAGGCTAAG TAGCTGCTAC TAACACTCTG 72 0 ACTGGCCCTG CAGGAGAGGG TGGCTCTTTC CCCTGGAGAC AAAGACAGGG TGCCTGGAGA 7BO CTGCGTCAAC ACAATATCGG CCTGCGCAAC GGTAGCGAAA CCAGCCAGTG CAACTGCGAT 84 0 CGCGATAGCG GTTTTTTTCA TGAATTC 867 98

Claims (82)

WHAT WE CLAIM IS:
1. A composition comprising a substantially isolated polynucleotide encoding an antigen binding fragment that inhibits an antibody or fragment thereof comprising the ammo acid sequences of the H chain and L chain V regions of the scFv identified m SEQ ID NO: 14 from binding to the surface of a cancer cell.
2. A composition comprising a substantially isolated polynucleotide encoding an antigen binding fragment which recognizes an epitope on the surface of a cancer cell that is recognized by an antibody or fragment thereof comprising the ammo acid sequences of the H chain and L chain V regions of the scFv identified in SEQ. ID NO. 14.
3. A composition comprising a substantially isolated polynucleotide encoding an antigen binding fragment which recognizes C-antigen, wherein C-antigen is recognized by an antibody or fragment thereof comprising the ammo acid sequences of the H chain and L chain V regions of the scFv identified m SEQ. ID NO 14, both said antigen binding fragment and said antibody or fragment thereof recognizing, m competition with one another, respective epitopes on C-antigen.
4. A composition comprising a substantially isolated polynucleotide encoding an antigen binding fragment, wherein said antigen binding fragment is a functionally equivalent fragment of an antibody or fragment thereof which comprises the ammo acid sequences of the H chain and L chain V regions of the scFv identified in SEQ. ID NO: 14 intellectual property office of nz. 2 7 nov 2001 received 99
5. A composition comprising a substantially isolated polynucleotide which encodes an antigen binding fragment having the H chain and L chain V regions of the scFv identified m SEQ. ID NO. 14 with the exception of a combination of one or more ammo acid deletions, additions and/or substitutions, while having substantially the same specificity as said scFv
6. A composition according to any one of claims 1 to 3, wherein said antigen binding fragment comprises withm its H chain or L chain V region at least five consecutive ammo acids from a corresponding region of the H chain or L chain V region of said antibody or fragment thereof, including ammo acids from a CDR of said antibody or fragment thereof.
7. A composition according to any one of claims 1 to 3, wherein said antigen binding fragment comprises at least five consecutive ammo acids from a CDR of said antibody or fragment thereof.
8. A composition comprising a substantially isolated first polynucleotide encoding an antigen binding fragment that has the immunologic specificity of an antibody or fragment thereof having the ammo acid sequences of the H chain and L chain V regions of the scFv identified m SEQ. ID NO: 14, said first polynucleotide comprising a region of at least 20 consecutive nucleotides that is capable of selectively forming a stable duplex under stringent conditions with a second polynucleotide which is complementary m its entirety to a third polynucleotide encoding said antibody or fragment thereof, said region of at least 20 consecutive nucleotides corresponding to a polypeptide segment of said antibody or fragment thereof comprising ammo acids of at least one CDR region thereof of said antibody or fragment thereof. intellectual property office of n.z. 2 7 nov 2001 received 100
9 A composition as claimed in claim 8, wherein said polypeptide spans at least one CRD region of said antibody and wherem the length and nucleotide composition of said first polynucleotide enables it to form the stable duplex with said second polynucleotide over the region of said third polynucleotide corresponding to said polypeptide.
10 A composition accordmg to any of claims 1 to 9, wherem said antigen binding fragment specifically recognizes any one or more of at least glioma, melanoma, breast carcinoma, lung carcinoma, ovarian carcinoma, lymphoma, gastric carcinoma, colon carcinoma or prostate carcinoma cells, but does not recognize normal, non-cancerous cells of at least bram, skin, breast, lung, ovary, lymph node, large intestine and prostate tissues
11 A composition accordmg to any one of claims 1 to 3, wherem said antigen binding fragment has a H chain CDR3 which comprises the ammo acid sequence of the H cham CDR3 of said antibody or fragment thereof.
12 A composition according to any one of claims 1 to 3, wherem said antigen binding fragment has a H cham CDR3 which consists of the ammo acid sequence of the H chain CDR3 of said antibody or fragment thereof
13 A composition accordmg to any one of claims 1 to 3, wherem said antigen binding fragment has a H cham CDR3 which consists of the amino acid sequence of the H chain CDR3 of said antibody or fragment thereof with the exception of one or more, deletions, additions and/or substitutions, relative to said ammo acid sequence, while having substantially the same specificity as said antibody or fragment thereof. — ' intellectual pkop^y OFFICE OF N-z- 2 3 jan 2002 received 101
14 A composition according to any one of claims 1 to 13, wherem said antigen binding fragment comprises an L cham CDR3 comprising the ammo acid sequence of the L chain CDR3 of said antibody or fragment thereof.
15 A composition accordmg to any one of claims 1 to 13, wherem said antigen binding fragment comprises an L cham CDR3 consisting of the ammo acid sequence of the L cham CDR3 of said antibody or fragment thereof
16. A composition accordmg to any one of claims 1 to 13, wherein said antigen binding fragment has an L cham CDR3 consisting of the ammo acid sequence of the L cham CDR3 of said antibody or fragment thereof, with the exception of one or more, deletions, additions and/or substitutions relative to said amino acid sequence while having substantially the same specificity as said ammo acid sequence.
17. A composition according to any one of claims 1 to 13, wherem said antigen binding fragment comprises one or more conservative substitutions relative to said antibody or fragment thereof
18 A composition accordmg to any one of claims 1 to 3, wherem said antigen binding fragment recognizes the tumors recognized by said antibody or fragment thereof.
19. A composition according to claim 1, 4, 5 or 8, wherein said antigen binding fragment recognizes substantially the same epitope recognized by said antibody or fragment thereof. intellectual property office of n.z. 2 7 nov 2001 received 102 50 0
20. A composition according to any one of claims 1 to 5, wherein said antigen bmding fragment specifically recognizes a heptapeptide displayed by peptide phage display, said heptapeptide selected from the group consisting of Phe-His-Arg-Tyr-Ser-Leu-Pro Phe-His-Arg-Tyr-Ser-Asp-Tyr Phe-His-Arg-Tyr-Ser-Pro-Thr Phe-His-Arg-Tyr-Thr-Pro-Gly, and Met-His-Arg-Tyr-Thr-Pro-Leu, each identified m TABLE 1.
21. A compostion accordmg to any one of claims 1 to 5, wherem the antigen bmdmg fragment specifically recognizes an N-terminus pentapeptide consensus sequence Phe-His-Arg-Tyr-Ser/Thr displayed as part of a heptapeptide by peptide phage display
22. A composition accordmg to any one of claims 1 to 3, wherem the antigen bmdmg fragment comprises a H cham CDR3 comprising at least five consecutive amino acids of the H cham CDR3 of said antibody or fragment thereof.
23. A composition according to any one of claims 1 to 3, wherein the antigen bmdmg fragment comprises a H cham CDR3 comprising at least six consecutive ammo acid residues of the H cham CDR3 of said antibody or fragment thereof. intellectual property OFFICE OF N.Z. 2 3 jan 2002 received 103
24. A composition according to any one of claims 1 to 7, wherein the antigen binding fragment comprises a H cham CDR3 comprising at least seven consecutive ammo acid residues of the H chain CDR3 of said antibody or fragment thereof.
25. A composition accordmg to claim 1 to 3, wherem the antigen binding fragment comprises a L cham CDR3 comprising at least five consecutive ammo acid residues of the L cham CDR3 of said antibody or fragment thereof.
26. A compsoition according to claim 1 to 3, wherein the antigen bmdmg fragment comprises a L chain CDR3 comprising at least six consecutive ammo acid residues of the L cham CDR3 of said antibody or fragment thereof
27 A composition accordmg to claim 1 to 3, wherem the antigen binding fragment comprises a L chain CDR3 comprising at least seven consecutive ammo acid residues of the L chain CDR3 of said antibody or fragment thereof.
28. A composition accordmg to any one of claims 1 to 3, wherem the antigen binding fragment comprises H cham V region ammo acid residues identical to the H chain V region ammo acids of said antibody or a fragment thereof
29. A composition accordmg to any one of claims 1 to 3, wherem the antigen binding fragment comprises L chain V region ammo acid residues identical to the L cham V region ammo acids of said antibody or fragment thereof intellectual property office of n z. 2 7 nov 2001 received 104 0
30 A composition according to any of claims 1 to 3, wherem the antigen binding fragment compnses consecutive H cham V region ammo acid residues which correspond identically to the H cham V region ammo acids of said antibody or fragment thereof, with the exception of one or more additions, deletions and/or substitutions relative thereto, while having substantially the same specificity as said antibody or fragment thereof
31 A composition according to claim 30, wherem the antigen binding fragment is a scFv comprising ammo acid sequences, which are substantially the same as the ammo acid sequences of H and L cham V regions of the scFv identified m SEQ ID NO 14
32 A composition accordmg to claims 1 to 31, wherem polynucleotide encodes a fusion protein
33 A composition as claimed m any of claims 4, 5, 8 or 9, wherein said antigen bmdmg fragment competitively inhibits specific bmdmg of said antibody or fragment thereof to C-antigen.
34. A composition accordmg to any one of claims 1 to 33, wherem said antigen bmdmg fragment is a scFv and wherem the amino acid composition of the linker of the scFv is adapted to make a scFv dimer.
35. A composition as claimed m claim 8, wherem said polypeptide compnses at least five - consecutive ammo acids of a CDRl region of said antibody and wherem the length and nucleotide composition of said first polynucleotide enables it to form the stable duplex with said second polynucleotide over the region of said third polynucleotide corresponding to said polypeptide INTELLECTUAL PROPttT' OFFICE Of "7 2 3 jan 20g2 RECEIVE!
36 A composition as claimed m claim 8, wherein said polypeptide compnses at least seven consecutive ammo acids of the heavy chain CDR2 or CDR3 region of said antibody and wherem the length and nucleotide composition of said first polynucleotide enables it to form the stable duplex with said second polynucleotide over the region of said third polynucleotide corresponding to said polypeptide
37 A composition as claimed m claim 8, wherein said polypeptide spans at least 25 ammo acids of the vanable region of said antibody and wherem the length and nucleotide composition of said first polynucleotide enables it to form the stable duplex with said second polynucleotide over the region of said third polynucleotide corresponding to said polypeptide
38 A composition as claimed m claim 8, wherem said polypeptide spans at least 30 ammo acids of the vanable region of said antibody and wherem the length and nucleotide composition of said first polynucleotide enables it to form the stable duplex with said second polynucleotide over the region of said third polynucleotide corresponding to said polypeptide.
39. A composition according to any one of claims 1 to 38 wherem the ant gen bmdmg fragment compnses human immunoglobulin sequences
40. A composition accordmg to any of claims 1 to 39, wherein said antigen bmdmg fragment is an antigen binding fragment of a human antibody i 2 3 jan 2002 106
41 A composition according to any of claims 1 to 39, wherein said antigen binding fragment compnses human framework sequences.
42. A composition accordmg to any of claims 35 to 41, wherein said antigen binding fragment specifically recognizes any one or more of at least glioma, melanoma, breast carcinoma, lung carcinoma, ovarian carcinoma, lymphoma, gastric carcinoma, colon carcinoma or prostate carcinoma cells, but does not recognize normal, non-cancerous cells of at least brain, skin, breast, lung, ovary, lymph node, large intestine and prostate tissues.
43. A composition which compnses a polynucleotide encoding the H cham vanable region of an antigen bmdmg fragment encoded by a polynucleotide as defined m any of claims 1 to 42.
44. A composition which comprises a polynucleotide encoding the L cham variable region of an antigen bmdmg fragment encoded by a polynucleotide as defined m any of claims 1 to 42.
45. A composition accordmg to any of claims 1 to 44, wherein the polynucleotide is a cloning vector
46 A composition accordmg to any of claims 1 to 44, wherein the polynucleotide is an expression vector.
47. A host cell comprising a polynucleotide as defined in claim 45 or 46. intellectual property office of n.z. 2 7 nov 2001 received 107
48. A composition according to any of claims 1 to 47, further comprising a pharmaceutical^ acceptable excipient.
49. A process for making an antigen bmdmg fragment by expressing a polynucleotide accordmg to any one of claims 1 to 47 m a host cell
50. A composition comprising an antigen binding fragment as identified m any of claims 1 to 42
51. A composition comprising an antigen binding fragment that comprises a polypeptide encoded by a polynucleotide as identified m claim 43 or 44
52 A composition accordmg to claim 50 or 51, wherein the antigen binding fragment is chosen from a group comprising a whole antibody, a Fab, F(ab')2 and a scFv.
53. A composition as claimed in claim 50, 51 or 52, wherein said antigen binding fragment is at least one of a fusion protein, a chimeric antibody, a bispecific antibody and a diabody.
54. A composition accordmg to claim. 50, 51, 52 or 53, wherem said antigen binding fragment is fused or conjugated to at least one chemically functional moiety, the moiety chosen from a selection comprising signal peptides, agents that enhance immunologic reactivity, agents that facilitate coupling to a solid support, earners, bioresponse modifiers, toxms and drugs.
55 A composition according to claim 54, wherem the signal peptide is prokaryotic. intellectual property office of n.z. 2 7 nov 2001 received 108
56 A composition accordmg to claim 54, wherem the agent that enhances immunologic reactivity is a bacterial superantigen.
57. A composition accordmg to claim 54, wherem the bioresponse modifier is a cytokine.
58. A composition accordmg to claim 54, wherein the toxin is chosen from a selection compnsmg ncm, pokeweed antiviral protein, Pseudornonas exotoxin A, diphthena toxin, ncm A cham, restnctocm and phospholipase enzymes.
59. An antigen bmdmg fragment which is anti-idiotope of the antigen binding fragment identified m any of the claims 1 to 42.
60. A method of detecting an antigen binding fragment identified m any one of claims 1 to 42, by a) reacting said antigen binding fragment with an antibody or fragment thereof which specifically recognizes said antigen binding fragment but does not recognize an antigen bmdmg fragment lacking the specificity of said antigen binding fragment, under conditions suitable to form a stable complex; and b) detecting the formation of said stable complex.
61. A method according to claim 60, wherem said antibody or fragment thereof is reacted m a biological sample with said antigen bmdmg fragment as identified m any one of claims 1 to 42, and wherein said biological sample is depleted of antibodies or fragments thereof which specifically recognize the constant regions of an antigen binding fragment intellectual property office of n.z. 2 7 nov 2001 RECEIVED
62 A method accordmg to claim 60, wherein said antibody or fragment thereof specifically recognizes the portion of said antigen binding fragment to which is involved in ldiotype antiidiotype contact.
63. A polynucleotide encoding an antigen binding fragment as claimed m claim 59.
64. A method of making an antibody or fragment thereof as claimed m claim 59 by using an expression vector comprising a polynucleotide as claimed m claim 63 to express said antibody or fragment thereof m a cell.
65. A diabody comprising an antigen binding fragment as defined in claims 1 to 42.
66. A dimer comprising an antigen bmdmg fragment as defined m claims 1 to 42.
67. A composition comprising an antigen bmdmg polypeptide fragment which under suitable conditions inhibits specific binding of an antibody comprising amino acid sequences of the H cham or L cham variable regions of SEQ ID NO 14 to a cell surface antigen present on glioma, melanoma, breast carcinoma, lung carcinoma, ovarian carcmoma, lymphoma, colon carcinoma, gastric carcinoma or prostate carcinoma tumor cells, but not normal non-cancerous cells of at § 0 T ~ N % ■ \ 1 1 A ' s intellectual property office of n.z. 2 2 mar 2002 RECEIVED least one of bram, skin, breast, lung, ovary, lymph node, large intestine, stomach and prostate tissues
68. The composition of claim 67, wherem said antigen binding polypeptide fragment does not bind to normal non-cancerous cells of brain, skin, breast, lung, ovary, lymph node, large intestine, stomach and prostate tissues.
69. A method of assessing an antigen bmdmg fragment for its ability inhibit specific bmdmg of an antibody comprising the H and L cham vanable regions of the antibody fragment identified m SEQ.ED.NO 14 to an antigen specifically recognized by the antibody, said method compnsmg the steps of. a) obtaining an antigen binding fragment having the ammo acid sequences of the H and L chain variable regions of said antibody with exception of one or more deletions, additions, and/or substitutions relative thereto; and, b) determining whether said antigen binding fragment is capable of decreasing the bmdmg of said antibody to said antigen
70. A method of assessmg an antigen bmdmg fragment for its ability to inhibit specific binding of an antibody comprising the H and L cham vanable regions of the scFv identified in SEQ. ID. NO: 14 to a tumor cell surface antigen specifically recognized by the antibody, said method comprising the steps of: a) obtaining an antigen binding fragment which specifically recognizes any one or more of at least glioma, melanoma, breast carcmoma, lung carcinoma, ovanan carcinoma, lymphoma, gastric carcmoma, colon carcinoma or prostate carcmoma cells but does not recognize normal Ill non-cancerous cells of at least bram, skin, breast, lung, ovary, lymph node, large intestine and prostate tissues, b) determining whether said antigen binding fragment is capable of decreasing the bmdmg of said antibody to said cell surface antigen.
71. An antigen bmdmg fragment capable of inhibiting under suitable conditions specific bmdmg of an antibody to a cell surface antigen of a tumor as determined by the method accordmg to claim 69 or 70, said antigen bmdmg fragment capable of specifically binding to said antigen to decrease bmdmg of said antibody.
72. The composition according to claim 50, wherem the amount of antigen bmdmg fragment corresponds to a dosage of about 0.01 mg/kg/dose to about 2000 mg/kg/dose.
73 A composition comprising an antigen binding fragment which recognizes a C-antigen epitope recognized by an scFv comprising amino acid sequences of the VH cham and VL chain regions of SEQ ID NOS 2 and 5.
74. A method for detecting C-antigen m a sample, comprising the steps of a) contacting the sample with the antigen bmdmg fragment defined m any of claims 1 to 42 under conditions that permit the formation of a stable antibody-antigen complex; and b) detecting any stable complex formed in step a); wherem C antigen is the antigen specifically recognized by an antibody or fragment thereof comprising the H cham and L cham V regions of the scFv identified m SEQ ID NO-14 ,MTr.. intellectual property office of n.z. 1 4 may 2002 RECEIVED 112 (JJ ^ >) p- _. s / r-
75. The use of an effective amount of an antigen binding fragment as defined m any of claims 1 to 42 m the manufacture of a medicament for administration to an individual for treating a neoplasia.
76 The use according to claim 75, wherein the individual has a clinically detectable tumor
77. The use according to claim 75, wherein a tumor that was previously detected m the individual has been treated and is clinically undetectable at the time of the administering of the antigen binding fragment.
78. The use accordmg to claim 75, for reducing the risk of recurrence of a clinically detectable tumor.
79 The use according to claim 75, wherem administration of the antigen bmdmg fragment is by parenteral administration selected from the group consisting of subcutaneous, intramuscular, mtrapentonial, mtracavity, intrathecal, transdermal, or intravenous injection.
80. The use according to claim 75, wherem the administration is at a dosage of about 0.01 mg/kg/dose to about 2000 mg/kg/dose.
81. The use according to claim 76, wherein the antigen bmdmg fragment is labelled with a therapeutic moiety.
82. The use accordmg to claim 81, wherein the therapeutic moiety is selected from the group consisting of radioisotopes, antineoplastic agent, immunomodulators, biological response modifiers, lectins and toxms. INTELLECTUAL PROPERTY OFFICE OF N.Z. 2 2 mar 2002 RECEIVED Viventia Biotech Inc.
NZ505305A 1996-05-22 1997-05-22 Antigen binding fragments that inhibit an antibody comprising amino acid sequences of H and L chain V regions of a scFv from binding to the surface of a cancer cell NZ505305A (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US65744996A 1996-05-22 1996-05-22
NZ332566A NZ332566A (en) 1996-05-22 1997-05-22 Antigen binding fragments that specifically detect cancer cells

Publications (1)

Publication Number Publication Date
NZ505305A true NZ505305A (en) 2002-06-28

Family

ID=26651978

Family Applications (1)

Application Number Title Priority Date Filing Date
NZ505305A NZ505305A (en) 1996-05-22 1997-05-22 Antigen binding fragments that inhibit an antibody comprising amino acid sequences of H and L chain V regions of a scFv from binding to the surface of a cancer cell

Country Status (1)

Country Link
NZ (1) NZ505305A (en)

Similar Documents

Publication Publication Date Title
AU725238B2 (en) Antigen binding fragments that specifically detect cancer cells, nucleotides encoding the fragments, and use thereof for the prophylaxis and detection of cancers
JP2000511421A5 (en)
US7183384B2 (en) Monoclonal antibody 7H11 reactive with human cancer
CA2020247C (en) Antibodies reactive with human carcinomas
JP3492373B2 (en) Monoclonal antibody
EP0521842B1 (en) Tumor antigen specific antibody
JP2001521520A (en) Anti-α-low v ▼ β-low 3 ▼ Integrin antibody antagonist
CA2295375A1 (en) Antigen binding fragments, designated 4b5, that specifically detect cancer cells, nucleotides encoding the fragments, and use thereof for the prophylaxis and detection of cancers
US20030118593A1 (en) Antigen binding fragments, designated 4B5, that specifically detect cancer cells, nucleotides encoding the fragments, and use thereof for the prophylaxis and detection of cancers
US20080031873A1 (en) Humanized monoclonal antibody 31.1 as an anticancer agent
US7560095B2 (en) Cancer specific monoclonal antibodies
CA2255540C (en) Antigen binding fragments that specifically detect cancer cells, nucleotides encoding the fragments, and use thereof for the prophylaxis and detection of cancers
AU775448B2 (en) Antigen binding fragments that specifically detect cancer cells, nucleotides encoding the fragments, and use thereof for the prophylaxis and detection of cancers
US7115722B1 (en) Antigen binding fragments that specifically detect cancer cells, nucleotides encoding the fragments, and use thereof for the prophylaxis and detection of cancers
NZ505305A (en) Antigen binding fragments that inhibit an antibody comprising amino acid sequences of H and L chain V regions of a scFv from binding to the surface of a cancer cell
Sikora Monoclonal antibodies and drug targeting in cancer
WO2001040292A1 (en) Antigen-binding fragments specific for tumor associated antigens
WO1999043815A2 (en) Human monoclonal antibodies capable of oligospecifically recognizing the major tumor-associated gangliosides and methods of use thereof

Legal Events

Date Code Title Description
ASS Change of ownership

Owner name: VIVENTIA BIOTECH INC, CA

Free format text: OLD OWNER(S): NOVOPHARM BIOTECH INC.

PSEA Patent sealed
RENW Renewal (renewal fees accepted)
RENW Renewal (renewal fees accepted)
RENW Renewal (renewal fees accepted)