WO1994010300A1 - Interaction trap system for isolating novel proteins - Google Patents

Interaction trap system for isolating novel proteins Download PDF

Info

Publication number
WO1994010300A1
WO1994010300A1 PCT/US1993/010069 US9310069W WO9410300A1 WO 1994010300 A1 WO1994010300 A1 WO 1994010300A1 US 9310069 W US9310069 W US 9310069W WO 9410300 A1 WO9410300 A1 WO 9410300A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
cdil
leu
cell
gene
Prior art date
Application number
PCT/US1993/010069
Other languages
French (fr)
Inventor
Roger Brent
Jeno Gyuris
Erica Golemis
Original Assignee
The General Hospital Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The General Hospital Corporation filed Critical The General Hospital Corporation
Priority to AT93900596T priority Critical patent/ATE256738T1/en
Priority to EP93900596A priority patent/EP0672131B1/en
Priority to DE69333366T priority patent/DE69333366T2/en
Priority to CA002148252A priority patent/CA2148252C/en
Priority to JP51116194A priority patent/JP3537141B2/en
Publication of WO1994010300A1 publication Critical patent/WO1994010300A1/en
Priority to HK98113234A priority patent/HK1012027A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4738—Cell cycle regulated proteins, e.g. cyclin, CDC, INK-CCR
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1055—Protein x Protein interaction, e.g. two hybrid selection
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/61—Fusion polypeptide containing an enzyme fusion for detection (lacZ, luciferase)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/71—Fusion polypeptide containing domain for protein-protein interaction containing domain for transcriptional activaation, e.g. VP16
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/80—Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor

Definitions

  • This invention relates to methods for isolating novel proteins.
  • This invention also relates to cancer diagnostics and therapeutics.
  • the cell cycle is governed by controls exerted during Gl and G2.
  • G2 cells decide whether to enter M in response to relatively uncharacterized intracellular signals, such as those that indicate completion, of DNA synthesis (Nurse, Nature 344:503-508, 1990; Enoch and Nurse, Cell 65:921- 923, 1991).
  • cells either enter S or withdraw from the cell cycle and enter a nondividing state known as GO (Pardee, Science 246:603-608, 1989). While the control mechanisms for these decisions are not yet well understood, their function is clearly central to processes of normal metazoa development and to carcinogenesis.
  • the Gl/S and G2/M transitions depend on a family of ⁇ 34kd protein kinases, the Cdc2 proteins, encoded by the cdc2 + (in S. pojnJbe) and CDC28 (in S . cerevisiae) genes.
  • Cdc2 family proteins from mammalian cells have been also identified. Some including Cdc2 (Lee and Nurse, Nature 327:31-35, 1987), Cdk2 (Elledge and Spotswood, EMBO J.
  • Cdc2 protein activity is regulated in two ways: positively, by association with regulatory proteins called cyclins, and negatively, by phosphorylation of a tyrosine near their ATP binding site. At least one of these regulatory mechanisms is operative during Gl (see Figure IA) . At this time, Cdc2 protein activity is regulated by facultative association with different Gl specific cyclins. In S . cerevisiae at least five putative Gl cyclins have been identified in genetic screens, including the products of the CLN1, CLN2, CLN3, HSC26 and CLB5 genes (Cross, Mol. Cell. Biol 8:4675-4684, 1988; Nash et al., EMBO J.
  • the SWI4 and SWI6 gene products positively regulate CLN1 and CLN2 transcription and may also positively modulate the activity of Cln3 (Nasmyth and Dirick, Cell 66:995-1013, 1991)
  • the FAR1 product negatively regulates both CLN2 transcription and the activity of its product (Chang and Herskowitz, Cell 63:999-1011, 1990)
  • the FUS3 product negatively regulates Cln3 activity (Elion et al., Cell 60:649-664, 1990).
  • mammalian Gl to S transitions may be regulated by similar mechanisms: regulatory molecules (Cdc2 kinases and cyclins) similar to those found in yeast are observed in mammalian Gl, and like S . cerevisiae, mammalian cells arrest in Gl when deprived of nutrients and in response to certain negative regulatory signals, including contact with other cells or treatment with negative growth factors (e.g., TGF-0) (Figure IB).
  • TGF-0 negative growth factors
  • the invention features a method for determining whether a first protein is capable of physically interacting (i.e., directly or indirectly) with a second protein.
  • the method involves: (a) providing a host cell which contains (i) a reporter gene operably linked to a protein binding site; (ii) a first fusion gene which expresses a first fusion protein, the first fusion protein including the first protein covalently bonded to a binding moiety which is capable of specifically binding to the protein binding site; and (iii) a second fusion gene which expresses a second fusion protein, the second fusion protein including the second protein covalently bonded to a weak gene activating moiety; and (b) measuring expression of the reporter gene as a measure of an interaction between the first and the second proteins.
  • the method further involves isolating the gene encoding the second protein.
  • the weak gene activating moiety is of lesser activation potential than GAL4 activation region II and preferably is the gene activating moiety of B42 or a gene activating moiety of lesser activation potential;
  • the host cell is a yeast cell;
  • the reporter gene includes the LEU2 gene or the lacZ gene;
  • the host cell further contains a second reporter gene operably linked to the protein binding site, for example, the host cell includes both a LEU2 reporter gene and a lacZ reporter gene;
  • the protein binding site is a LexA binding site and the binding moiety includes a LexA DNA binding domain;
  • the second protein is a protein involved in the control of eukaryotic cell division, for example, a Cdc2 cell division control protein.
  • the invention features a substantially pure preparation of Cdil polypeptide.
  • the Cdil polypeptide includes an amino acid sequence substantially identical to the amino acid sequence shown in Figure 6 (SEQ ID NO: 1) ; and is derived from a mammal, for example, a human.
  • the invention features purified DNA (for example, cDNA) which includes a sequence encoding a Cdil polypeptide, and preferably a human Cdil polypeptide, of the invention.
  • cDNA purified DNA
  • the invention features a vector and a cell which includes a purified DNA of the invention; a purified antibody which specifically binds a Cdil polypeptide of the invention; and a method of producing a recombinant Cdil polypeptide invloving, providing a cell transformed with DNA encoding a Cdil polypeptide positioned for expression in the cell; culturing the transformed cell under conditions for expressing the DNA; and isolating the recombinant Cdil polypeptide.
  • the invention further features recombinant Cdil polypeptide produced by such expression of a purified DNA of the invention.
  • the invention features a therapeutic composition which includes as an active ingredient a Cdil polypeptide of the invention, the active ingredient being formulated in a physiologically- acceptable carrier.
  • a therapeutic composition is useful in a method of inhibiting cell proliferation in a mammal, involving administering the therapeutic composition to the mammal in a dosage effective to inhibit mammalian cell division.
  • the invention features a method of detecting a malignant cell in a biological sample, involving measuring Cdil gene expression in the sample, a change in Cdil expression relative to a wild-type sample being indicative of the presence of the malignant cell.
  • reporter gene a gene whose expression may be assayed; such genes include, without limitation, lacZ, amino acid biosynthetic genes, e.g. the yeast LEU2 , HIS3, LYS2, or E7.RA3 genes, nucleic acid biosynthetic genes, the mammalian chloramphenicol transacetylase (CAT) gene, or any surface antigen gene for which specific antibodies ,are available.
  • operably linked is meant that a gene and a regulatory sequence(s) are connected in such a way as to permit gene expression when the appropriate molecules (e.g., transcriptional activator proteins or proteins which include transcriptional activation domains) are bound to the regulatory sequence(s) .
  • binding moiety is meant a stretch of amino acids which is capable of directing specific polypeptide binding to a particular DNA sequence (i.e., a "protein binding site") .
  • weak gene activating moiety is meant a stretch of amino acids which is capable of weakly inducing the expression of a gene to whose control region it is bound.
  • weakly is meant below the level of activation effected by GAL4 activation region II (Ma and Ptashne, Cell 48:847, 1987) and is preferably at or below the level of activation effected by the B42 activation domain of Ma and Ptashne (Cell 51:113, 1987).
  • Levels of activation may be measured using any downstream reporter gene system and comparing, in parallel assays, the level of expression stimulated by the GAL4 region II- polypeptide with the level of expression stimulated by the polypeptide to be tested.
  • substantially pure is meant a preparation which is at least 60% by weight (dry weight) the compound of interest, e.g., a Cdil polypeptide. Preferably the preparation is at least 75%, more preferably at least 90%, and most preferably at least 99%, by weight the compound of interest. Purity can be measured by any appropriate method, e.g., column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis.
  • purified DNA is meant DNA that is not immediately contiguous with both of the coding sequences with which it is immediately contiguous (one on the 5' end and one on the 3' end) in ,the naturally occurring genome of the organism from which it is derived.
  • the term therefore includes, for example, a recombinant DNA which is incorporated into a vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g., a cDNA or a genomic DNA fragment produced by PCR or restriction endonuclease treatment) independent of other sequences. It also includes a recombinant DNA which is part of a hybrid gene encoding additional polypeptide sequence.
  • substantially identical is meant an amino acid sequence which differs only by conservative amino acid substitutions, for example, substitution of one amino acid for another of the same class (e.g., valine for glycine, arginine for lysine, etc.) or by one or more non-conservative substitutions, deletions, or insertions located at positions of the amino acid sequence which do not destroy the function of the protein (assayed, e.g., as described herein) .
  • a "substantially identical" nucleic acid sequence codes for a substantially identical amino acid sequence as defined above.
  • transformed cell is meant a cell into which (or into an ancestor of which) has been introduced, by means of recombinant DNA techniques, a DNA molecule encoding (as used herein) a Cdil polypeptide.
  • positioned for expression is meant that the DNA molecule is positioned adjacent to a DNA sequence which directs transcription and translation of the sequence (i.e., facilitates the production of, e.g., a Cdil polypeptide) .
  • purified antibody is meant antibody which is at least 60%, by weight, free from the proteins and naturally-occurring organic molecules with which it is naturally associated.
  • the preparation is at least 75%, more preferably at, least 90%, and most preferably at least 99%, by weight, antibody, e.g., Cdil- specific antibody.
  • a purified Cdil antibody may be obtained, for example, by affinity chromatography using recombinantly-produced Cdil polypeptide and standard techniques.
  • specifically binds is meant an antibody which recognizes and binds Cdil polypeptide but which does not substantially recognize and bind other molecules in a sample, e.g., a biological sample, which naturally includes Cdil polypeptide.
  • a malignant cell is meant a cell which has been released from normal cell division control. Included in this definition are transformed and immortalized cells.
  • the interaction trap system described herein provides advantages over more conventional methods for isolating interacting proteins or genes encoding interacting proteins. Most notably, applicants' system provides a rapid and inexpensive method having very general utility for identifying and purifying genes encoding a wide range of useful proteins based on the protein's physical interaction with a polypeptide of known diagnostic or therapeutic usefulness. This general utility derives in part from the fact that the components of the system can be readily modified to facilitate detection of protein interactions of widely varying affinity (e.g., by using reporter genes which differ quantitatively in their sensitivity to a protein interaction) .
  • the inducible nature of the promoter used to express the interacting proteins also increases the scope of candidate interactors which may be detected since even proteins whose chronic expression is toxic to the host cell may be isolated simply by inducing a short burst of the protein's expression and testing for its ability to interact and stimulate expression of a ⁇ - galactosidase reporter gene.
  • FIGURE 1 illustrates cell cycle control systems.
  • FIGURE 1(A) illustrates Gl control in yeast.
  • FIGURE IB illustrates cell cycle control in yeast and mammals.
  • FIGURE 2 A-C illustrates an interaction trap system according to the invention.
  • FIGURE 3A is a diagrammatic representation of a "bait" protein useful in the invention; the numbers represent amino acids.
  • FIGURE 3B is a diagrammatic representation of reporter genes useful in the invention.
  • FIGURE 3C is a diagrammatic representation of a library expression plasmid useful in the invention and the N- terminal amino acid sequence of an exemplary "prey" protein according to the invention.
  • FIGURE 4 depicts yeast assays demonstrating the specificity of the Cdil/Cdc2 interaction.
  • FIGURE 5 shows the results of an immunoprecipitation experiment demonstrating that Cdil physically interacts with Cdc2.
  • FIGURE 6 shows the Cdil coding sequence together with the predicted amino-acid sequence of its open reading frame (SEQ ID NO:l).
  • FIGURE 7A the growth rates of yeast cells that express Cdil are depicted; open squares are cells transformed with expression vectors only; ovals are cells expressing Cdc2; triangles are cells expressing Cdil; and filled squares are cells expressing Cdil and Cdc2.
  • FIGURE 7B is shown a budding index of yeast that express Cdil.
  • FIGURE 7C is shown a FACS analysis of yeast that express Cdil; fluorescence (on the x-axis) is shown as a function of cell number (on the Y-axis) .
  • FIGURE 8A shows the morphology of control cells
  • FIGURE 8B shows the morphology of control cells stained with DAPI
  • FIGURE 8C shows the morphology of cells expressing Cdil
  • FIGURE 8D shows the morphology of cells expressing Cdil stained with DAPI.
  • FIGURE 9A indicates the timing of Cdil expression in Hela cells; lanes represent different timepoints: (1) Oh, (2) 3h, (3) 6h, (4) 9h, (5) 12h, (6) 15h, (7) 18h, (8) 21h, (9) 24h, and (10) 27h after release.
  • FIGURE 9B shows the effect of Cdil overexpression.
  • FIGURE 10 shows an alignment of Cdc2 proteins and FUS3. Depicted is an alignment of the sequences of the bait proteins used herein. Amino acids are numbered as in human Cdc2. Abbreviations are as follows: HsCdc2, human Cdc2; HsCdk2, human Cdk2; ScCdc28, S .
  • the system involves a eukaryotic host strain (e.g., a yeast strain) which is engineered to express the protein of therapeutic or diagnostic interest as a fusion protein covalently bonded to a known DNA binding domain; this protein is referred to as a "bait” protein because its purpose in the system is to "catch” useful, but as yet unknown or uncharacterized, interacting polypeptides (termed the "prey”; see below).
  • the eukaryotic host strain also contains one or more "reporter genes", i.e., genes whose transcription is detected in response to a bait-prey interaction. Bait proteins, via their DNA binding domain, bind to their specific DNA site upstream of a reporter gene; reporter transcription is not stimulated, however, because the bait protein lacks its own activation domain.
  • cells of this strain are transformed with individual members of a DNA (e.g., a cDNA) expression library; each member of the library directs the synthesis of a candidate interacting protein fused to a weak and invariant gene activation domain tag.
  • a DNA e.g., a cDNA
  • Those library- encoded proteins that physically interact with the promoter-bound bait protein are referred to as "prey" proteins.
  • Such bound prey proteins (via their activation domain tag) detectably activate the transcription of the downstream reporter gene and provide a ready assay for identifying particular cells which harbor a DNA clone encoding an interacting protein of interest.
  • Figure 2A shows a yeast strain containing two reporter genes, LexAop-LEU2 and LexAop- lacZ, and a constitutively expressed bait protein, LexA- Cdc2. Synthesis of prey proteins is induced by growing the yeast in the presence of galactose.
  • Figure 2B shows that if the prey protein does not interact with the transcriptionally-inert LexA-fusion bait protein, the reporter genes are not transcribed; the cell cannot grow into a colony on leu " medium, and it is white on Xgal medium because it contains no 0-galactosidase activity.
  • Figure 2C shows that, if the prey protein interacts with the bait, then both reporter genes are active; the cell forms a colony on leu " medium, and cells in that colony have 0-galactosidase activity and are blue on Xgal medium.
  • the selection host strain depicted in Figure 2 contains a Cdc2 bait and a DNA binding moiety derived from the bacterial LexA protein (see Figure 3A) .
  • the use of a LexA DNA binding domain provides certain advantages.
  • the LexA moiety contains no activation function and has no known effect on transcription of yeast genes (Brent and Ptashne, Nature 312:612-615, 1984; Brent and Ptashne, Cell 43:729-736, 1985) .
  • use of the LexA rather than the GAL4 DNA-binding domain allows conditional expression of prey proteins in response to galactose induction; this facilitates detection of prey proteins which might be toxic to the host cell if expressed continuously.
  • the use of LexA allows knowledge regarding the interaction between LexA and the LexA binding site (i.e., the LexA operator) to be exploited for the purpose of optimizing operator occupancy.
  • the bait protein illustrated in Figure 3A also includes a LexA dimerization domain; this optional domain facilitates efficient LexA dimer formation. Because LexA binds its DNA binding site as a dimer, inclusion of this domain in the bait protein also optimizes the efficiency of operator occupancy (Golemis and Brent, Mol. Cell Biol. 12:3006-3014, 1992).
  • LexA represents a preferred DNA binding domain in the invention.
  • any other transcriptionally- inert or essentially transcriptionally-inert DNA binding domain may be used in the interaction trap system; such DNA binding domains are well known and include the DNA binding portions of the proteins ACE1 (CUP1) , lambda cl, lac repressor, jun fos, or GCN4.
  • the GAL4 DNA binding domain represents a slightly less preferred DNA binding moiety for the bait proteins.
  • Bait proteins may be chosen from any protein of known or suspected diagnostic,or therapeutic importance.
  • Preferred bait proteins include oncoproteins (such as myc, particularly the C-terminus of myc, ras, src, fos, and particularly the oligomeric interaction domains of fos) or any other proteins involved in cell cycle regulation (such as kinases, phosphatases, the cytoplasmic portions of membrane-associated receptors, and other Cdc2 family members) .
  • the protein of diagnostic or therapeutic importance would be fused to a known DNA binding domain as generally described for LexA-Cdc2. Reporters
  • one preferred host strain according to the invention contains two different reporter genes, the LEU2 gene and the lacZ gene, each carrying an upstream binding site for the bait protein.
  • the reporter genes depicted in Figure 3B each include, as an upstream binding site, one or more LexA operators in place of their native Upstream Activation Sequences (UASs) .
  • UASs Upstream Activation Sequences
  • These reporter genes may be integrated into the chromosome or may be carried on autonomously replicating plasmids (e.g., yeast 2 ⁇ plasmids) . A combination of two such reporters is preferred in the invention for a number of reasons.
  • the LexAop-LEU2 construction allows cells that contain interacting proteins to select themselves by growth on medium that lacks leucine, facilitating the examination of large numbers of potential interactor protein- containing cells.
  • the LexAop-lacZ reporter allows LEU + cells to be quickly screened to confirm an interaction.
  • the LexAop-LEU2 reporter provides an extremely sensitive first selection, while the LexAop-lacZ reporter allows discrimination between proteins of different interaction affinities.
  • reporter genes described herein represent a preferred embodiment of the invention
  • other equivalent genes whose expression may be detected or assayed by standard techniques may also be employed in conjunction with, or instead of, the LEU2 and lacZ genes.
  • useful genes include amino acid and nucleic acid biosynthetic genes (such as yeast HIS3, URA3, and LYS2 ) GAL1, E. coli galK (which complements the yeast GAL1 gene) , and the higher cell reporter genes CAT, GUS, and any gene encoding a cell surface antigen for which antibodies are available (e.g., CD4) .
  • a fourth DNA construction was utilized which encoded a series of candidate interacting proteins, each fused to a weak activation domain (i.e., prey proteins).
  • a weak activation domain i.e., prey proteins.
  • FIG 3C One such prey protein construct is shown in Figure 3C; this plasmid encodes a prey fusion protein which includes an invariant N-terminal moiety. This moiety carries, amino to carboxy terminal, an ATG for protein expression, an optional nuclear localization sequence, a weak activation domain (i.e., the B42 activation domain of Ma and Ptashne; Cell 51:113, 1987), and an optional epitope tag for rapid immunological detection of fusion protein synthesis.
  • a HeLa cDNA libraray was constructed, and random library sequences were inserted downstream of this N-terminal fragment to produce fusion genes encoding prey proteins.
  • cDNAs may be constructed from any mRNA population and inserted into an equivalent expression vector.
  • a library of choice may be constructed de novo using commercially available kits (e.g., from Stratagene, La Jolla, CA) or using well established preparative procedures (see, e.g., Current Protocols in Molecular Biology, New York, John Wiley & Sons, 1987) .
  • kits e.g., from Stratagene, La Jolla, CA
  • a number of cDNA libraries are publically and commercially available; sources of libraries include, e.g., Clontech (Palo Alto, CA) and Stratagene (La Jolla, CA) .
  • prey proteins need not be naturally occurring full length polypeptides.
  • a prey protein may be encoded by a synthetic sequence or may be the product of a randomly generated open reading frame or a portion thereof.
  • the prey protein includes only an interaction domain; such a domain may be useful as a therapeutic to modulate bait protein activity.
  • activation domains may be substituted for the B42 portion of the prey molecule; such activation domains must be weaker than the GAL4 activation region II moiety and preferably should be no stronger than B42 (as measured, e.g., by a comparison with GAL4 activation region II or B42 in parallel ⁇ - galactosidase assays using lacZ reporter genes) ; such a domain may, however, be weaker than B42.
  • the extraordinary sensitivity of the LEU2 selection scheme allows even extremely weak activation domains to be utilized in the invention.
  • the prey proteins may include other optional nuclear localization sequences (e.g., those derived from the GAL4 or MAT 2 genes) or other optional epitope tags (e.g., portions of the c-myc protein or the flag epitope available from Immunex) . These sequences optimize the efficiency of the system, but are not absolutely required for its operation.
  • the nuclear localization sequence optimizes the efficiency with which prey molecules reach the nuclear-localized reporter gene construct(s) , thus increasing their effective concentration and allowing one to detect weaker protein interactions; and the epitope tag merely facilitates a simple immunoassay for fusion protein expression.
  • reporter gene, DNA binding domain, and gene activation domain components may be derived from any appropriate eukaryotic or prokaryotic source, including yeast, mammalian cell, and prokaryotic cell genomes or cDNAs as well as artificial sequences.
  • yeast represents a preferred host organism for the interaction trap system (for reasons of ease of propagation, genetic manipulation, and large scale screening)
  • other host organisms such as mammalian cells may also be utilized.
  • a preferred reporter gene is the sensitive and easily assayed CAT gene; useful DNA binding domains and gene activation domains may be chosen from those described above (e.g., the LexA DNA binding domain and the B42 or B112 activation domains) .
  • the general type of interaction trap system described herein provides a number of advantages. For example, the system can be used to detect bait-prey interactions of varying affinity. This can be accomplished, e.g., by using reporter genes which differ quantitatively in their sensitivity to an interaction with a library protein. In particular, the equilibrium Kd with which a library-encoded protein must interact with the bait to activate the LexAop-LEU2 reporter is probably ⁇ 10 ⁇ 6 M.
  • the lacZ reporters are less sensitive, allowing the selection of different prey proteins by utilizing reporters with the appropriate number, affinity, and position of LexA operators; in particular, sensitivity of the lacZ reporter gene is increased by either increasing the number of upstream LexA operators, utilizing LexA operators which have increased affinity for LexA binding dimers, and/or decreasing the distance between the LexA operator and the downstream reporter gene promoter.
  • This ability to manipulate the sensitivity of the system provides a measure of control over the strength of the interactions detected and thus increases the range of proteins which may be isolated.
  • the system provides at least three other advantages.
  • the activation region on the library- encoded proteins is relatively weak, in order to avoid restrictions on the spectrum of library proteins detected; such restrictions are common when utilizing a strong, semi-toxic activation domain such as that of GAL4 or VP16 (Gill and Ptashne, Nature 334:721-724, 1988; Triezenberg et al., Genes Dev. 2:730-742, 1988; Berger et al., Cell 70:251-265, 1992).
  • LexA to bind the bait to DNA allows the use of GAL4 + yeast hosts and the use of the GAL1 promoter to effect conditional expression of the library protein.
  • the yeast strain EGY48/pl840 was utilized to isolate proteins which interact with the cell division control protein Cdc2.
  • This strain contained both the LexAop-LEU2 and LexAop-lacZ reporters, as well as a plasmid that directed the synthesis of a LexA-Cdc2 bait protein (see below) .
  • the LexAop-LEU2 reporter replaced the chromosomal LEU2 gene.
  • This reporter carried 3 copies of the high affinity colEl double LexA operator (Ebina et al., J. Biol. Chem. 258:13258-13261, 1983) 40 nucleotides upstream of the major LEU2 transcription startpoint.
  • the LexAop-lacZ reporter (pl840) was carried on a URA3 + 2 ⁇ plasmid. This reporter carried a single LexA operator 167 nucleotides upstream of the major GAL1 transcription startpoint.
  • a HeLa cDNA interaction library (described below) was also introduced into this strain using the plasmid depicted in Figure 3C (termed pJG4-5) ; this library vector was designed to direct the conditional expression of proteins under the control of a derivative of the GAL1 promoter.
  • This plasmid carried a 2 ⁇ replicator and a TRP1 + selectable marker.
  • cDNA was inserted into this plasmid on EcoRl-XhoI fragments. Downstream of the Xhol site, pJG4-5 contained the ADH1 transcription terminator.
  • the sequence of an invariant 107 amino acid moiety, encoded by the plasmid and fused to the N-terminus of all library proteins, is shown below the plasmid map in Figure 3C.
  • This moiety carries, amino to carboxy terminal, an ATG, the SV40 T nuclear localization sequence (Kalderon et al., Cell 39:499-509, 1984), the B42 transcription activation domain, (Ma and Ptashne, Cell 51:113-119, 1987; Ruden et al. , Nature 350:426-430, 1991) and the 12CA5 epitope tag from the influenza virus hemagglutinin protein (Green et al., Cell 28:477-487, 1982) .
  • both reporters were active, both phenotypes were galactose-dependent, confirming that they required the library-encoded protein.
  • Library plasmids were rescued from these cells, assigned to one of three classes by restriction mapping, and the plasmids identified from each class that contained the longest cDNA inserts. Synthesis of a fusion protein by the plasmid was verified in each case by Western blot analysis using anti-epitope antiserum.
  • the CDJ1 gene was introduced into a panel of EGY48-derived strains (i.e., EGY48/1840 containing different LexA fusion baits) in order to test the reproducibility and specificity of the interaction between Cdc2 and Cdil.
  • Cells from 8 individual transformed cells that contained Cdil plus a given bait (horizontal streaks) or the same bait plus the library vector as a control (adjacent vertical streaks) were streaked with toothpicks onto each of three plates ( Figure 4) .
  • the plates shown in Figure 4, included a "control” plate, a Ura “ Trp “ His “ glucose plate which selected for the presence of the bait plasmid, the LexAop-lacZ reporter, and the Cdil expression plasmid; a "glucose” plate, a Ura “ Trp “ His “ Leu “ glucose plate, which additionally selected for activation of the LexAop- LEU2 reporter; and a "galactose” plate, a Ura “ Trp” His “ Leu “ galactose plate, which selected for the activation of the LexAop-LEU2 reporter, and which induced the expression of Cdil.
  • Baits used in this test included: (1) LexA-Cdc2, (2) LexA-Bicoid, (3) LexA-Max, (4) LexA- Cln3, (5) LexA-Fus3, and (6) LexA-cMyc-Cterm (Figure 4).
  • Cdil interacted specifically with LexA-Cdc2, and did not interact with LexA-cMyc-Cterm, LexA-Max, LexA-Bicoid, LexA-Cln3, or LexA-Fus3 (Figure 4). Cdil also interacted with other Cdc2 family proteins, including LexA-Cdc28, as discussed below. Applicants also note that, on glucose, the LexA-Cln3 bait weakly activated the LexAop-LEU2 reporter, but that, on galactose, the inferiority of the carbon source and the dimished bait expression from the ADHl promoter eliminated this background.
  • Extracts were made from EGY48 cells that contained a library plasmid that directed the synthesis of tagged Cdil and that also contained either a LexA-Cdc2 or a LexA-Bicoid bait.
  • 100 ml of cells were grown in glucose or galactose medium (in which Cdil expression was induced) to an OD 600 of 0.6-0.8, pelleted by centrifugation, resuspended in 500 ⁇ l RIPA, lysed by beating with glass beads five times for two minutes each, and spun twice for five minutes in a microfuge (10,000 X G) at 4° to remove the beads and cell debris. 5 ⁇ l of this supernatant was taken as a control, and 15 ⁇ l of rabbit anti-LexA antiserum was added to the remainder, which was incubated at 4°C for four hours on a rotating platform.
  • LexA-containing proteins were first precipitated from this remainder with 50 ⁇ l Staph A-coated sepharose beads (Pharmacia, Piscataway, NJ) as described in Wittenberg and Reed (Cell 54:1061-1072, 1988). The entire pellet was then dissolved in Laemmli sample buffer, run on a 12.5% protein gel (SDS/PAGE) , and blotted onto nitrocellulose. Tagged Cdil fusion proteins were identified by Western analysis of the blotted proteins with the 12CA5 monoclonal antihemagglutinin antibody essentially as described in Samson et al. (Cell 57:1045-1052, 1989).
  • anti-LexA antiserum precipitated Cdil from a yeast extract that contained LexA-Cdc2 and Cdil, but not from one that contained LexA-Bicoid and Cdil, thus confirming that Cdil physically interacted only with the Cdc2- containing bait protein.
  • the Cdil cDNA was isolated from 12 different library plasmids that contained cDNAs of 4 different lengths. Sequence analysis revealed that all of the cDNA inserts contained an open reading frame, and inspection of the sequence of the longest cDNAs (Figure 6) revealed an ATG with a perfect match to the Kozak consensus translation initiation sequence (PuCC/GATGG) (Kozak, Cell 44:283-292, 1986) . Careful analysis of the size of the Cdil mRNA in HeLa cells revealed that this ATG occurred between 15 and 45 nucleotides from the 5' end of the Cdil message, suggesting that the longest cDNAs spanned the entire open reading frame.
  • the Cdil gene is predicted to encode a protein of 212 amino acids.
  • the Cdil amino acid sequence does not reveal compelling similarities to any previously identified proteins ( Figure 6) .
  • Two facts about the protein sequence are worth noting.
  • 19 of the amino-terminal 35 amino acids are either proline, gluta ic acid, serine, or threonine. Proteins that contain these stretches, called PEST sequences, are thought to be degraded rapidly (Rogers et al., Science 234:364-368, 1986); in fact, this stretch of Cdil is more enriched in these amino acids than the C-termini of the yeast Gl cyclins, in which the PEST sequences are known to be functional (Cross, Mol. Cell.
  • Cks proteins can rescue the temperature sensitivity of strains that bear certain cdc28 ts alleles was exploited; this effect is thought to be due to the ability of these proteins to form complexes with the labile Cdc28 ts protein, protecting it against thermal denaturation (Hadwiger et al., Proc. Nat. Acad. Sci. USA 86:6255-6259, 1989). It was found that Cdil expression did not rescue the temperature-sensitivity of any cdc28 allele tested, although human Cks2 did.
  • Cdil might have a similar effect on the ability of mammalian cells to traverse Gl or S. Since Cdil was isolated from HeLa cDNA, the point in the cell cycle at which Cdil mRNA was expressed in these cells was first measured. Specifically, adherent HeLa cells were synchronized in late Gl by a double thymidine block (Rao and Johnson, Nature 225:159-164, 1970) as described in Lew et al. (Cell 66:1197-1206, 1991). Aliquots of cells were collected every three hours after release from the block. Released cells reentered the cell cycle 9 hours after release, as measured by FACS analysis of DNA content.
  • HeLa cells were transfected either with pBNCdil, a construction that directed the synthesis of Cdil under the control of the Moloney Murine Leukemia Virus LTR (see below) , or with the vector alone. Individual transformed clones were selected by their resistance to G418, and cells from these clones were stained with propidium-iodide and subjected to FACS analysis to determine DNA content (as described below) .
  • Cdil was tested for its ability to interact with a panel of different bait proteins that included Cdc2 proteins from yeast, humans, and flies, as well as the yeast Fus3 protein kinase (a protein kinase of the ERK class which negatively regulates Cln3 and which, by sequence criteria, is less related to the Cdc2 proteins than those proteins are to one another (Elion et al., Cell 60:649-664, 1990).
  • yeast Fus3 protein kinase a protein kinase of the ERK class which negatively regulates Cln3 and which, by sequence criteria, is less related to the Cdc2 proteins than those proteins are to one another (Elion et al., Cell 60:649-664, 1990).
  • LexA-Cdk2 Hs
  • LexA-Cdc28 Sc
  • tagged Cdil stimulated transcription from these baits to different levels; it activated strongly in strains that contained the human Cdc2 bait, against which it was selected, less strongly in strains that contained S. cerevisiae Cdc28 or human Cdk2 baits, and only weakly in strains that contained the DmCdc2 bait, one of the two Drosophila Cdc2 homologs (Jimenez et al., EMBO J. 9:3565-3571, 1990; Lehner and O'Farrell, EMBO J. 9:3573-3581, 1990). In strains that contained the DMCdc2c bait or Fus3, Cdil did not activate at all.
  • baits in this panel were related in sequence, were made from the same vector, were translated from a message that had the same 5' untranslated sequence and the same LexA coding sequence, and were expressed in yeast in the same amounts, the differences in transcription among the bait strains very likely reflected differences in interaction with the tagged Cdil.
  • Cdil is a protein which complexes with Cdc2 family proteins. It is expressed around the time of the Gl to S transition, and the above results suggest that it may negatively regulate passage of cells through this part of the cycle, thus linking the regulatory networks connecting extracellular signals with core cell cycle controls. If Cdil is in fact a negative regulator, it is interesting to note that its normal function may be to convey signals that retard or block the cell cycle during Gl. Since both normal differentiation and cancer can be considered consequences of changes in Gl regulation, this idea raises the possibilities that Cdil may function to remove cells from active cycle to allow differentiation (Pardee, Science 246:603-608, 1989); and that there are cancers in which lesions in the Gl regulatory machinery prevent Cdil from exerting its full effect.
  • cdc28-lN MATa ura3 adel trpl cdc28-lN
  • cdc28-13 MAT ⁇ leu2 trpl his3 ura3 adel tyrl cdc28-13
  • cdc28-17 MATa leu2 trpl his3 ura3 metl4 arg5 arg ⁇ tyrl cdc28-17
  • pJG4-6Cdil a yeast expression plasmid that directs the synthesis of Cdil that contains a hemagglutinin epitope tag at its amino terminus
  • pJG4-7Cks2 derived from the same selection
  • strain 3C-1AX (MATa barl Acini ⁇ cln2 ⁇ cln3 cyh2 trpl leu2 ura2 adel his2 [pLEU2- CYH2 (CYH 3 ) -CLN3 + ] ) into which pJG4-7Cdil or a GAL1-CLN3 construct as a positive control had been introduced was used. Overnight cultures were diluted into glucose and galactose medium as above, and grown for five hours at 30°C.
  • Strain W303 was also transformed with a set of mammalian cDNAs that had been isolated by their ability to confer ⁇ factor resistance as a positive control. Overnight cultures were grown in glucose and galactose as above, and then plated on glucose and galactose medium, in the presence and absence of 10" 7 M factor. Colonies were counted after 3 days.
  • W303 contained either pJG4-4Cdil or a vector control, in combination with either a pJG14-2, a HIS3 + plasmid which directs the synthesis in yeast of native human Cdc2 under the control of the ADH1 promoter, or a vector control.
  • baits were produced constitutively under the control of the ADH1 promoter (Ammerer, Meth. Enzym. 101:192-210, 1983), and contained the LexA C-terminal oligomerization region, which contributes to operator occupancy by LexA- containing proteins, perhaps because it aids in the precise alignment of LexA amino termini of adjacent operator half sites (Golemis and Brent, Mol. Cell. Biol. 12:3006-3014, 1992). It is worth noting that all LexA- bait proteins so far examined enter the yeast nucleus in concentrations sufficient to permit operator binding, even though LexA derivatives are not specifically localized to the nucleus unless they contain other nuclear localization signals (see, e.g., Silver et al., Mol. Cell.
  • pL202pl has been described (Ruden et al. , Nature 350:426-430, 1991).
  • This plasmid a close relative of pMA424 and pSH2-l (Ma and Ptashne, Cell 51:113-119, 1987; Hanes and Brent, Cell 57:1275-1283, 1989) carries the HIS3 + marker and the 2 ⁇ replicator, and directs the synthesis in yeast of fusion proteins that carry the wild-type LexA protein at their amino terminus.
  • Baits used in this study were made as follows: human Cdc2 (Lee and Nurse, Nature 327:31-35, 1987), Cdk2 (Tsai et al., Nature 353:174-177, 1991) and the S . cerevisiae CDC28 genes (Lorincz and Reed, Nature 307:183-185, 1984) were amplified by PCR using Vent polymerase (New England Biolab ⁇ , Beverley, MA) and cloned into pL202pl as EcoRI- BamHI fragments. These proteins contained two amino acids (glu phe) inserted between the last amino acid of LexA and the bait proteins. The Drosophila Cdc2 (Jimenez et al., EMBO J.
  • LexA-cMyc-Cterm contained the carboxy-terminal 176 amino acids of human cMyc
  • LexA- Max contained all of the human Max coding sequence.
  • LexA-Bicoid (amino acid 2-160) has been described (Golemis and Brent, Mol. Cell. Biol. 12:3006-3014, 1992). Reporters In the interaction trap, one reporter, the LexAop- LEU2 construction, replaced the yeast chromosomal LEU2 gene. The other reporter, one of a series of LexAop- GALl-lacZ genes (Brent and Ptashne, Cell 43:729-736, 1985; Kamens et al., Mol.
  • the lacZ gene employed in the primary screen contained a single lower affinity consensus operator (Brent and Ptashne, Nature 312:612- 615, 1984) which binds a single dimer of the bait.
  • the LexA operators in the LEU2 reporter were closer to the transcription startpoint than they were in the lacZ reporter. These differences in the number, affinity, and position of the operators all contributed to making the LEU2 gene a more sensitive indicator than the lacZ gene, a property that is useful for ;this method. pl840 and pJK103 have been described (Brent and Ptashne, Cell 43:729-736, 1985, Kamens et al. , Mol. Cell. Biol. 10:2840-2847, 1990).
  • pHR33 (Ellerstrom et al., Plant Mol. Biol. 18:557-566, 1992) was cut with Hindlll and an ⁇ 1166bp fragment that contained the URA3 + gene from yEP24M13-2, a derivative of yEP24, was introduced into it to create pLEU2-0.
  • This plasmid contains a Bglll site 87 nucleotides upstream of the major LEU2 transcription startpoint.
  • pLEU2-0 was cut with Bglll, and a 42bp double stranded Bglll-ended oligomer 5'GATCCTGCTGTATATAAAACCAGTGGTTATATGTACAGTACG3' (SEQ ID NO
  • EGY12 (MATa trpl ura2 LEU2 : :pLEU2-0 (AUASLEU2 ) ) and EGY38 (as above but : : pLEU2-LexAop6) were constructed as follows.
  • pLEU2-0 and pLEU2-LexAop6 were linearized by digestion with Clal within the LEU2 gene, and the DNA was introduced into U457 (MATa SUP53-a ade2-l canl-100 ura3 - 52 trpl-1 lphi+2 ) by lithium acetate transformation (Ito et al., J. Bacter.
  • ura + colonies which presumably contained the plasmid DNA integrated into LEU2, were selected.
  • Several of these transformants were grown in YPD. Ura " cells were selected by plating these cultures on medium that contained 5-FOA (Ausubel et al., Current Protocols in Molecular Biology. New York, John Wiley & Sons, 1987) . Both plasmids carry a TYl element.
  • Trp colonies from each integration, EGY12 (no LexA operators) and EGY38 (6 operators) were saved. These were mated to GG100-14D (MAT his3 trpl pho5) .
  • EGY40 and EGY48 are products of this cross; EGY40 has no LexA operators, EGY48 has 6.
  • EGY48 was transformed with pl840 or pJK103 and with the different bait plasmids. Double transformants were selected on Glucose Ura " His " plates, and expression of the bait protein confirmed by Western blotting using anti-LexA antibody and standard techniques. Library (“prey”) expression vectors
  • pJG4- 5 a member of a series of expression plasmids designed to be used in the interaction trap and to facilitate analysis of isolated proteins. These plasmids all carried the 2 ⁇ replicator, to ensure high copy number in yeast, and the TRP1 marker.
  • pJG4-5 was designed to possess the following features: a galactose-inducible promoter to allow conditional expression of the library proteins, an epitope tag to facilitate their detection, a nuclear localization signal to maximize their intranuclear concentration in order to increase the sensitivity of the selection, and a weak acid blob activation domain (Ma and Ptashne, Cell 51:113-119, 1987) .
  • pJG4-5 was constructed as follows.
  • An "expression cassette" containing the GAL1 promoter and the ADH1 terminator and a 345 nt insert that encoded a 107 amino acid moiety was inserted into pJG4-0, a plasmid that carries the TRP1 gene, the 2 ⁇ replicator, the pUC13 replication origin, and the ampicillin resistance gene.
  • the pJG4-5 expression cassette directed the synthesis of fusion proteins, each of which carried at the amino terminus, amino to carboxy terminal, an ATG, an SV40 nuclear localization sequence (PPKKKRKVA) (SEQ ID NO: 5) (Kalderon et al., Cell 39:499-509, 1984), the B42 acid blob transcriptional activation domain (Ma and Ptashne, Cell 51:113-119, 1987) and the HA1 epitope tag (YPYDVPDYA) (SEQ ID NO: 6) (Green et al. , Cell 28:477- 487, 1980) ( Figure 3C) .
  • these experiments used two Cdil expression plasmids.
  • EcoRl-XhoI Cdil-containing fragments were introduced into pJG4-4 to make the plasmid pJG4-4Cdil; Cdil was transcribed from this plasmid as a native, unfused protein under the control of the GALl promoter.
  • EcoRI- Xhol Cdil-containing fragments were also introduced into pJG4-6 to make the plasmid pJG4-6Cdil; in this case, Cdil was expressed as an in-frame fusion containing, at its amino terminus, an ATG initiation codon and the hemagglutinin epitope tag.
  • the activation-tagged yeast cDNA expression library was made from RNA isolated from serum grown, proliferating HeLa cells that were grown on plates to 70% confluence. Total RNA was extracted as described in Chomczynski and Sacchi (Anal. Biochem. 162:156-159, 1987) , and polyA + mRNA was purified on an oligodT- cellulose column. cDNA synthesis was performed according to Gubler and Hoffman (Gene 25:263-269, 1983) as modified by Huse and Hansen (Strategies 1:1-3, 1988) using a linker primer that contained, 5' to 3', an 18nt polydT tract, an Xhol site, and a 25 nt long GA rich sequence to protect the Xhol site.
  • the first strand was synthesized in the presence of 5'-methyl-CTP (instead of CTP) with an RNAseH defective version of the Moloney virus reverse transcriptase (Superscript, BRL, Grand Island, NY) .
  • RNAseH defective version of the Moloney virus reverse transcriptase
  • Superscript BRL, Grand Island, NY
  • coli SURE cells by electroporation (Gene-Pulser, Bio-Rad, Hercules, CA) according to the manufacturer's instructions. 9.6 x 10 6 primary transformants were collected by scraping LB ampicillin plates. Colonies were pooled and grown in 6 liters of LB medium overnight (approximately three generations) , and plasmid DNA was purified sequentially by standard techniques on two CsCl gradients. Digestion of transformants of individual library members with EcoRI and Xhol revealed that >90% of the library members contained a cDNA insert whose typical size ranged between lkb-2kb. Western blots of individual yeast transformants using the anti-hemagglutinin monoclonal antibody suggested that between 1/4 and 1/3 of the members expressed fusion proteins. Selection of Cdc2 interactors
  • Transformants were selected on Glucose Ura" His “ Trp " plates, scraped, suspended in approximately 20 ml of 65% glycerol, lOmM Tris-HCl pH 7.5, lOmM MgCl 2 , and stored in 1ml aliquots at -80°. Plating efficiency was determined on Galactose Ura " His” Trp " after growing 50 ⁇ l of a cell suspension in 5 ml YP in the presence of 2% galactose.
  • Plasmid DNAs from these colonies were rescued as described (Hoffman and Winston, Gene 57:267-272, 1987), introduced into the bacterial strain KC8, and transformants were collected on Trp" ampicillin plates. Plasmid DNAs were analyzed and categorized by the pattern of restriction fragments they gave on 1.8% agarose 1/2X TBE gels after triple digestion with EcoRI and Xhol, and either Alul or Haelll. Characteristic plasmids from different restriction map classes of these cDNAs were retransformed into derivatives of EGY48 that expressed a panel of different LexA fusion proteins.
  • Plasmids that carried cDNAs whose encoded proteins interacted with the LexA-Cdc2 bait but not with other LexA fusion proteins, including LexA-Bicoid, LexA-Fus3, LexA-Cln3, LexA-cMyc- Cterm, and LexA-Max were characterized further. Microscopy
  • the fixed cells were either examined directly at lOOOx magnification with a Zeiss Axioscope microscope under Nomarski optics or by fluorescence after staining with 2.5 ⁇ g/ml DAPI as described in Silver et al. (Mol. Cell. Biol. 6:4763-4766, 1986). FACS analysis
  • Yeast cells were grown and fixed as described above and prepared for FACS analysis of DNA content essentially as in Lew et al. (Cell 63:317-328, 1992).
  • the cells were collected and washed three times in 0.8 mis 50mM Tris/HCl pH 8.0, then 200 ⁇ l 2mg/ml RNaseA was added and incubated at 37°C with continuous shaking for 5 hours.
  • the cells were pelleted, resuspended in 0.5 ml of 5mg/ml pepsin (freshly dissolved in 55mM HCl) and incubated in a 37° waterbath for 30 minutes.
  • the cells were spun down, washed with 1 ml of 200mM Tris/HCl pH 7.5, 211mM NaCl, 78mM MgCl 2 and resuspended in the same buffer.
  • HeLa cells were grown on plates and transfected (Ausubel et al. , Current Protocols in Molecular Biology. New York, John Wiley & Sons, 1987) either with pBNCdil, a DNA copy of a retroviral cloning vector (Morgenstern and Land, Nucl. Acids. Res. 18:3587-3596, 1990) that directs expression of native Cdil under the control of the MoMuLV promoter, or with the vector alone.
  • Clones of transfected cells were selected by growth in medium that contained 400 ⁇ g/ml of G418; Cdil expression did not diminish the number of G418 resistant cells recovered.
  • polypeptides according to the invention may be produced by transformation of a suitable host cell with all or part of a Cdil-encoding cDNA fragment (e.g., the cDNA described above) in a suitable expression vehicle.
  • a Cdil-encoding cDNA fragment e.g., the cDNA described above
  • the Cdil polypeptide may be produced in a prokaryotic host (e.g., E. coli) or in a eukaryotic host (e.g., Saccharomyces cerevisiae or mammalian cells, e.g., COS 1, NIH 3T3, or HeLa cells) .
  • a prokaryotic host e.g., E. coli
  • a eukaryotic host e.g., Saccharomyces cerevisiae or mammalian cells, e.g., COS 1, NIH 3T3, or HeLa cells
  • Such cells are available from a wide range of sources (e.g., the American Type Culture Collection, Rockland, MD; also, see, e.g., Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989).
  • the method of transformation or transfection and the choice of expression vehicle will depend on the host system selected. Transformation and transfection methods are described, e.g., in Ausubel et al. (Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989) ; expression vehicles may be chosen from those provided, e.g., in Cloning Vectors : A Laboratory Manual (P.H. Pouwels et al., 1985, Supp. 1987).
  • One preferred expression system is the mouse 3T3 fibroblast host cell transfected with a pMAMneo expression vector (Clontech, Palo Alto, CA) .
  • pMAMneo provides: an RSV-LTR enhancer linked to a dexamethasone- inducible MMTV-LTR promotor, an SV40 origin of replication which allows replication in mammalian systems, a selectable neomycin gene, and SV40 splicing and polyadenylation sites.
  • DNA encoding a Cdil polypeptide would be inserted into the pMAMneo vector in an orientation designed to allow expression.
  • the recombinant Cdil protein would be isolated as described below.
  • Other preferable host cells which may be used in conjunction with the pMAMneo expression vehicle include COS cells and CHO cells (ATCC Accession Nos. CRL 1650 and CCL 61, respectively) .
  • a Cdil polypeptide is produced by a stably-transfected mammalian cell line.
  • a number of vectors suitable for stable transfection of mammalian cells are available to the public, e.g., see Pouwels et al. (supra) ; methods for constructing such cell lines are also publicly available, e.g., in Ausubel et al. (supra) .
  • cDNA encoding the Cdil polypeptide is cloned into an expression vector which includes the dihydrofolate reductase (DHFR) gene.
  • DHFR dihydrofolate reductase
  • Integration of the plasmid and, therefore, the Cdil-encoding gene into the host cell chromosome is selected for by inclusion of 0.01-300 ⁇ M methotrexate in the cell culture medium (as described in Ausubel et al., supra) . This dominant selection can be accomplished in most cell types. Recombinant protein expression can be increased by DHFR- mediated amplification of the transfected gene. Methods for selecting cell lines bearing gene amplifications are described in Ausubel et al. (supra) ; such methods generally involve extended culture in medium containing gradually increasing levels of methotrexate.
  • DHFR-containing expression vectors commonly used for this purpose include pCVSEII-DHRF apd pAdD26SV(A) (described in Ausubel et al. , supra) .
  • Any of the host cells described above or, preferably, a DHFR-deficient CHO cell line e.g., CHO DHFR " cells, ATCC Accession No. CRL 9096
  • a DHFR-deficient CHO cell line e.g., CHO DHFR " cells, ATCC Accession No. CRL 9096
  • the recombinant Cdil protein is expressed, it is isolated, e.g., using affinity chromatography.
  • an anti-Cdil antibody e.g., produced as described herein
  • Lysis and fractionation of Cdil-harboring cells prior to affinity chromatography may be performed by standard methods (see, e.g., Ausubel et al., supra) .
  • a Cdil fusion protein for example, a Cdil-maltose binding protein, a Cdil-3- galactosidase, or a Cdil-trpE fusion protein, may be constructed and used for isolation of Cdil protein (see, e.g., Ausubel et al., supra; New England Biolabs, Beverly, MA) .
  • the recombinant protein can, if desired, be further purified, e.g., by high performance liquid chromatography (see, e.g., Fisher, Laboratory Techniques In Biochemistry And Molecular Biology, eds., Work and Burdon, Elsevier, 1980) .
  • Polypeptides of the invention can also be produced by chemical synthesis (e.g., by the methods described in Solid Phase Peptide Synthesis, 2nd ed. , 1984 The Pierce Chemical Co., Rockford, IL) .
  • Human Cdil may be used to raise antibodies useful in the invention; such polypeptides may be produced by recombinant or peptide synthetic techniques (see, e.g., Solid Phase Peptide Synthesis , supra; Ausubel et al., supra) .
  • the peptides may be coupled to a carrier protein, such as KLH as described in Ausubel et al, supra.
  • KLH-peptide is mixed with Freund's adjuvant and injected into guinea pigs, rats, or preferably rabbits.
  • Antibodies may be purified by peptide antigen affinity chromatography.
  • Monoclonal antibodies may be prepared using the Cdil polypeptides described above and standard hybridoma technology (see, e.g., Kohler et al., Nature 256:495.
  • the Cdil polypeptide of the invention has been shown to interact with a key regulator of human cell division and to inhibit the in vivo proliferation of yeast and human cells. Because of its role in the control of cell division, Cdil is an unusually good candidate for an anti-cancer therapeutic.
  • this therapeutic is delivered as a sense or antisense RNA product, for example, by expression from a retroviral vector delivered, for example,, to the bone marrow. Treatment may be combined with more traditional cancer therapies such as surgery, radiation, or other forms of chemotherapy.
  • a large number of potential drugs may be easily screened, e.g., in yeast, for those which increase or decrease the interaction between Cdil and Cdc2.
  • Drugs which increase Cdc2:Cdil interaction would increase reporter gene expression in the instant system, and conversely drugs which decrease Cdc2:Cdil interaction would decrease reporter gene expression.
  • Such drugs are then tested in animal models for efficacy and, if successful, may be used as anticancer therapeutics according to their normal dosage and route of administration.
  • Detection of A Malignant Condition Cdil polypeptides may also find diagnostic use in the detection or monitoring of cancerous conditions.
  • a change in the level of Cdil production may indicate a malignant or pre-malignant condition.
  • Levels of Cdil expression may be assayed by any standard technique. For example, its expression in a biological sample (e.g., a biopsy) may be monitored by standard Northern blot analysis or may be aided by PCR (see, e.g., Ausubel et al., supra; PCR Technology: Principles and Applications for DNA Amplification , ed. , H.A. Ehrlich, Stockton Press, NY; and Yap and McGee, Nucl . Acids . Res . 1 :4294, 1991).
  • immunoassays may be used to detect Cdil protein in a biological sample.
  • Cdil-specific polyclonal, or preferably monoclonal, antibodies produced as described above may be used in any standard immunoassay format (e.g., ELISA, Western blot, or RIA assay) to measure Cdil polypeptide levels; again comparison would be to wild type Cdil levels, and a change in Cdil production would be indicative of a malignant or pre-malignant condition. Examples of immunoassays are described, e.g., in Ausubel et al., supra. Immunohistochemical techniques may also be utilized for Cdil detection.
  • a tissue sample may be obtained from a patient, and a section stained for the presence of Cdil using an anti-Cdil antibody and any standard detection system (e.g., one which includes a secondary antibody conjugated to horseradish peroxidase) .
  • an anti-Cdil antibody and any standard detection system e.g., one which includes a secondary antibody conjugated to horseradish peroxidase
  • a diagnostic method may be targeted toward a determination of whether the Cdil gene of a mammal includes the N-terminal PEST domain- encoding sequence.
  • this sequence is very likely to stabilize the Cdil protein, its deletion may result in altered cellular levels of Cdil polypeptide and therefore be indicative of a malignant or premalignant condition.
  • PEST deletions may be identified either by standard nucleic acid or polypeptide analyses.
  • the Cdil polypeptide is also useful for identifying that compartment of a mammalian cell where important cell division control functions occur.
  • Antibodies specific for Cdil may be produced as described above.
  • the normal subcellular location of the protein is then determined either in situ or using fractionated cells by any standard immunological or immunohistochemical procedure (see, e.g., Ausubel et al., supra; Bancroft and Stevens, Theory and Practice of Histological Technigues. Churchill Livingstone, 1982) .
  • the methods of the instant invention may be used to reduce or diagnose the disorders described herein in any mammal, for example, humans, domestic pets, or livestock. Where a non-human mammal is treated, the Cdil polypeptide or the antibody employed is preferably specific for that species.
  • the invention includes any protein which is substantially homologous to human Cdil (Fig. 6, SEQ ID NO: 1); such homologs include other substantially pure naturally occurring mammalian Cdil proteins as well as allelic variations; natural mutants; induced mutants; proteins encoded by DNA that hybridizes to the Cdil sequence of Fig. 6 under high stringency conditions or low stringency conditions (e.g., washing at 2X SSC at 40°C with a probe length of at least 40 nucleotides) ; and polypeptides or proteins specifically bound by antisera directed to a Cdil polypeptide, especially by antisera to the active site or to the Cdc2 binding domain of Cdil.
  • human Cdil Fig. 6, SEQ ID NO: 1
  • homologs include other substantially pure naturally occurring mammalian Cdil proteins as well as allelic variations; natural mutants; induced mutants; proteins encoded by DNA that hybridizes to the Cdil sequence of Fig. 6 under high stringency conditions or low stringency conditions (e
  • the term also includes chimeric polypeptides that include a Cdil fragment.
  • the invention further includes analogs of any naturally occurring Cdil polypeptide. Analogs can differ from the naturally occurring Cdil protein by amino acid sequence differences, by post-translational modifications, or by both. Analogs of the invention will generally exhibit at least 70%, more preferably 80%, even more preferably 90%, and most preferably 95% or even 99%, homology with all or part of a naturally occurring Cdil sequence. The length of comparison sequences will be at least 8 amino acid residues, preferably at least 24 amino acid residues, and more preferably more than 35 amino acid residues.
  • Modifications include in vivo and in vitro chemical derivatization of polypeptides, e.g., acetylation, carboxylation, phosphorylation, or glycosylation; such modifications may occur during polypeptide synthesis or processing or following treatment with isolated modifying enzymes.
  • Analogs can also differ from the naturally occurring Cdil polypeptide by alterations in primary sequence.
  • cyclized peptides molecules and analogs which contain residues other than L-amino acids, e.g., D-amino acids or non-naturally occurring or synthetic amino acids, e.g., ⁇ or ⁇ amino acids.
  • the invention also includes Cdil polypeptide fragments.
  • fragment means at least 10 contiguous amino acids, preferably at least 30 contiguous amino acids, more preferably at least 50 contiguous amino acids, and most preferably at least 60 to 80 or more contiguous amino acids. Fragments of Cdil can be generated by methods known to those skilled in the art or may result from normal protein processing (e.g., removal of amino acids from the nascent polypeptide that are not required for biological activity or removal of amino acids by alternative mRNA splicing or alternative protein processing events) .
  • Preferable fragments or analogs according to the invention are those which exhibit biological activity (for example, the ability to interfere with mammalian cell division as assayed herein) .
  • a Cdil polypeptide, fragment, or analog exhibits at least 10%, more preferably 30%, and most preferably, 70% or more of the biological activity of a full length naturally occurring Cdil polypeptide.
  • AAG CTT ATG GGT GCT CCT CCA AAA AAG AAG AGA AAG GTA GCT GGT ATC 48 Lys Leu Met Gly Ala Pro Pro Lys Lys Lys Arg Lys Val Ala Gly He 1 5 10 15 AAT AAA GAT ATC GAG GAG TGC AAT GCC ATC ATT GAG CAG TTT ATC GAC 96 Asn Lys Asp He Glu Glu Cys Asn Ala He He Glu Gin Phe He Asp 20 25 30

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Immunology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Plant Pathology (AREA)
  • Toxicology (AREA)
  • Analytical Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Treatment Of Liquids With Adsorbents In General (AREA)

Abstract

Disclosed is a method for determining whether a first protein is capable of physically interacting with a second protein. The method involves: (a) providing a host cell which contains (i) a reporter gene operably linked to a protein binding site; (ii) a first fusion gene which expresses a first fusion protein, the first fusion protein including the first protein covalently bonded to a binding moiety which is capable of specifically binding to the protein binding site; and (iii) a second fusion gene which expresses a second fusion protein, the second fusion protein including the second protein covalently bonded to a weak gene activating moiety; and (b) measuring expression of the reporter gene as a measure of an interaction between the first and the second proteins. Such a determination facilitates the isolation of the gene encoding the interacting protein. Also disclosed herein is recombinant Cdi1 polypeptide, nucleic acid encoding the Cdi1 polypeptide, and uses thereof.

Description

INTERACTION TRAP SYSTEM FOR ISOLATING NOVEL PROTEINS
Background of the Invention This invention was made with Government support awarded by the National Institute of Health. The government has certain rights in the invention. This invention relates to methods for isolating novel proteins. This invention also relates to cancer diagnostics and therapeutics. In most eukaryotic cells, the cell cycle is governed by controls exerted during Gl and G2. During G2, cells decide whether to enter M in response to relatively uncharacterized intracellular signals, such as those that indicate completion, of DNA synthesis (Nurse, Nature 344:503-508, 1990; Enoch and Nurse, Cell 65:921- 923, 1991). During Gl, cells either enter S or withdraw from the cell cycle and enter a nondividing state known as GO (Pardee, Science 246:603-608, 1989). While the control mechanisms for these decisions are not yet well understood, their function is clearly central to processes of normal metazoa development and to carcinogenesis.
In yeast, and probably in all eukaryotes, the Gl/S and G2/M transitions depend on a family of ~34kd protein kinases, the Cdc2 proteins, encoded by the cdc2+ (in S. pojnJbe) and CDC28 (in S . cerevisiae) genes. Cdc2 family proteins from mammalian cells have been also identified. Some including Cdc2 (Lee and Nurse, Nature 327:31-35, 1987), Cdk2 (Elledge and Spotswood, EMBO J. 10:2653-2659, 1991; Tsai et al., Nature 353:174-177, 1991), and Cdk3 (Meyerson et al., EMBO J. 11:2909-2917, 1992) can complement a cdc28~ S. cerevisiae for growth.
The activity of the Cdc2 proteins at the G2/M transition point is regulated in two ways: positively, by association with regulatory proteins called cyclins, and negatively, by phosphorylation of a tyrosine near their ATP binding site. At least one of these regulatory mechanisms is operative during Gl (see Figure IA) . At this time, Cdc2 protein activity is regulated by facultative association with different Gl specific cyclins. In S . cerevisiae at least five putative Gl cyclins have been identified in genetic screens, including the products of the CLN1, CLN2, CLN3, HSC26 and CLB5 genes (Cross, Mol. Cell. Biol 8:4675-4684, 1988; Nash et al., EMBO J. 7:4335-4346, 1988; Hadwiger et al., Proc. Nat. Acad. Sci. USA 86:6255-6259, 1989; and Ogas et al., Cell 66:1015-1026, 1991). The CLN1, CLK2, and CLN3 proteins (here called Clnl, Cln2, and Cln3) are each individually sufficient to permit a cell to make the Gl to S transition (Richardson et al., Cell 59:1127-1133, 1989) , and at least one of them (Cln2) associates with Cdc28 in a complex that is active as a protein kinase (Wittenberg et al., Cell 62:225-237, 1990). Recently, putative Gl cyclins have been identified in mammalian cells: Cyclin C, Cyclin D (three forms) , and Cyclin E
(Koff et al., Cell 66:1217-1228, 1991; Xiong et al., Cell 65:691-699, 1991). Each of these three mammalian cyclins complement a yeast deficient in Clnl, Cln2, and Cln3, and each is expressed during Gl. In S. cerevisiae, the synthesis, and in some cases, the activity of the Gl cyclins is under the control of a network of genes that help to couple changes in the extracellular environment to Gl regulatory decisions (Figure IA) . For example, the SWI4 and SWI6 gene products positively regulate CLN1 and CLN2 transcription and may also positively modulate the activity of Cln3 (Nasmyth and Dirick, Cell 66:995-1013, 1991) , the FAR1 product negatively regulates both CLN2 transcription and the activity of its product (Chang and Herskowitz, Cell 63:999-1011, 1990), and the FUS3 product negatively regulates Cln3 activity (Elion et al., Cell 60:649-664, 1990).
Several lines of evidence suggest that mammalian Gl to S transitions may be regulated by similar mechanisms: regulatory molecules (Cdc2 kinases and cyclins) similar to those found in yeast are observed in mammalian Gl, and like S . cerevisiae, mammalian cells arrest in Gl when deprived of nutrients and in response to certain negative regulatory signals, including contact with other cells or treatment with negative growth factors (e.g., TGF-0) (Figure IB). However, several considerations suggest that the higher eukaryotic Gl regulatory machinery is likely to be more sophisticated than that of yeast. First, in mammalian cells there appear to be more proteins involved in the process. At least ten different Cdc2 family proteins and related protein kinases (see Meyerson et al., EMBO J. 11:2909- 2917, 1992) and at least three distinct classes of putative Gl cyclins (Koff et al., Cell 66:1217-1228, 1991; Matsushime et al., Cell 65:701-713, 1991; Motokura et al., Nature 339:512-518, 1991; Xiong et al., Cell 65:691-699, 1991) have been identified. Second, unlike yeast, the proliferation of most mammalian cells depends on extracellular protein factors (in particular, positive growth regulatory proteins) , deprivation of which leads to arrest in Gl. Third, arrest of many cell types during Gl can progress to a state, GO, that may not strictly parallel any phase of the yeast cell cycle.
Because proteins involved in controlling normal cell division decisions in mammals (e.g., humans) are also very likely to play a key role in malignant cell growth, identification and isolation of such proteins facilitate the development of useful cancer diagnostics as well as anti-cancer therapeutics. We now describe (i) a novel system for the identification of proteins which, at some time during their existence, participate in a particular protein-protein interaction; (ii) the use of this system to identify interacting proteins which are key regulators of mammalian cell division; and (iii) one such interacting protein, termed Cdil, a cell cycle control protein which provides a useful tool for cancer diagnosis and treatment.
Summary of the Invention In general, the invention features a method for determining whether a first protein is capable of physically interacting (i.e., directly or indirectly) with a second protein. The method involves: (a) providing a host cell which contains (i) a reporter gene operably linked to a protein binding site; (ii) a first fusion gene which expresses a first fusion protein, the first fusion protein including the first protein covalently bonded to a binding moiety which is capable of specifically binding to the protein binding site; and (iii) a second fusion gene which expresses a second fusion protein, the second fusion protein including the second protein covalently bonded to a weak gene activating moiety; and (b) measuring expression of the reporter gene as a measure of an interaction between the first and the second proteins. In a preferred embodiment, the method further involves isolating the gene encoding the second protein.
In other preferred embodiments, the weak gene activating moiety is of lesser activation potential than GAL4 activation region II and preferably is the gene activating moiety of B42 or a gene activating moiety of lesser activation potential; the host cell is a yeast cell; the reporter gene includes the LEU2 gene or the lacZ gene; the host cell further contains a second reporter gene operably linked to the protein binding site, for example, the host cell includes both a LEU2 reporter gene and a lacZ reporter gene; the protein binding site is a LexA binding site and the binding moiety includes a LexA DNA binding domain; the second protein is a protein involved in the control of eukaryotic cell division, for example, a Cdc2 cell division control protein.
In a second aspect, the invention features a substantially pure preparation of Cdil polypeptide. Preferably, the Cdil polypeptide includes an amino acid sequence substantially identical to the amino acid sequence shown in Figure 6 (SEQ ID NO: 1) ; and is derived from a mammal, for example, a human.
In a related aspect, the invention features purified DNA (for example, cDNA) which includes a sequence encoding a Cdil polypeptide, and preferably a human Cdil polypeptide, of the invention.
In other related aspects, the invention features a vector and a cell which includes a purified DNA of the invention; a purified antibody which specifically binds a Cdil polypeptide of the invention; and a method of producing a recombinant Cdil polypeptide invloving, providing a cell transformed with DNA encoding a Cdil polypeptide positioned for expression in the cell; culturing the transformed cell under conditions for expressing the DNA; and isolating the recombinant Cdil polypeptide. The invention further features recombinant Cdil polypeptide produced by such expression of a purified DNA of the invention.
In yet another aspect, the invention features a therapeutic composition which includes as an active ingredient a Cdil polypeptide of the invention, the active ingredient being formulated in a physiologically- acceptable carrier. Such a therapeutic composition is useful in a method of inhibiting cell proliferation in a mammal, involving administering the therapeutic composition to the mammal in a dosage effective to inhibit mammalian cell division.
In a final aspect, the invention features a method of detecting a malignant cell in a biological sample, involving measuring Cdil gene expression in the sample, a change in Cdil expression relative to a wild-type sample being indicative of the presence of the malignant cell.
As used herein, by "reporter gene" is meant a gene whose expression may be assayed; such genes include, without limitation, lacZ, amino acid biosynthetic genes, e.g. the yeast LEU2 , HIS3, LYS2, or E7.RA3 genes, nucleic acid biosynthetic genes, the mammalian chloramphenicol transacetylase (CAT) gene, or any surface antigen gene for which specific antibodies ,are available. By "operably linked" is meant that a gene and a regulatory sequence(s) are connected in such a way as to permit gene expression when the appropriate molecules (e.g., transcriptional activator proteins or proteins which include transcriptional activation domains) are bound to the regulatory sequence(s) .
By a "binding moiety" is meant a stretch of amino acids which is capable of directing specific polypeptide binding to a particular DNA sequence (i.e., a "protein binding site") . By "weak gene activating moiety" is meant a stretch of amino acids which is capable of weakly inducing the expression of a gene to whose control region it is bound. As used herein, "weakly" is meant below the level of activation effected by GAL4 activation region II (Ma and Ptashne, Cell 48:847, 1987) and is preferably at or below the level of activation effected by the B42 activation domain of Ma and Ptashne (Cell 51:113, 1987). Levels of activation may be measured using any downstream reporter gene system and comparing, in parallel assays, the level of expression stimulated by the GAL4 region II- polypeptide with the level of expression stimulated by the polypeptide to be tested.
By "substantially pure" is meant a preparation which is at least 60% by weight (dry weight) the compound of interest, e.g., a Cdil polypeptide. Preferably the preparation is at least 75%, more preferably at least 90%, and most preferably at least 99%, by weight the compound of interest. Purity can be measured by any appropriate method, e.g., column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis. By "purified DNA" is meant DNA that is not immediately contiguous with both of the coding sequences with which it is immediately contiguous (one on the 5' end and one on the 3' end) in ,the naturally occurring genome of the organism from which it is derived. The term therefore includes, for example, a recombinant DNA which is incorporated into a vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g., a cDNA or a genomic DNA fragment produced by PCR or restriction endonuclease treatment) independent of other sequences. It also includes a recombinant DNA which is part of a hybrid gene encoding additional polypeptide sequence. By "substantially identical" is meant an amino acid sequence which differs only by conservative amino acid substitutions, for example, substitution of one amino acid for another of the same class (e.g., valine for glycine, arginine for lysine, etc.) or by one or more non-conservative substitutions, deletions, or insertions located at positions of the amino acid sequence which do not destroy the function of the protein (assayed, e.g., as described herein) . A "substantially identical" nucleic acid sequence codes for a substantially identical amino acid sequence as defined above. By "transformed cell" is meant a cell into which (or into an ancestor of which) has been introduced, by means of recombinant DNA techniques, a DNA molecule encoding (as used herein) a Cdil polypeptide. By "positioned for expression" is meant that the DNA molecule is positioned adjacent to a DNA sequence which directs transcription and translation of the sequence (i.e., facilitates the production of, e.g., a Cdil polypeptide) . By "purified antibody" is meant antibody which is at least 60%, by weight, free from the proteins and naturally-occurring organic molecules with which it is naturally associated. Preferably, the preparation is at least 75%, more preferably at, least 90%, and most preferably at least 99%, by weight, antibody, e.g., Cdil- specific antibody. A purified Cdil antibody may be obtained, for example, by affinity chromatography using recombinantly-produced Cdil polypeptide and standard techniques. By "specifically binds" is meant an antibody which recognizes and binds Cdil polypeptide but which does not substantially recognize and bind other molecules in a sample, e.g., a biological sample, which naturally includes Cdil polypeptide. By a "malignant cell" is meant a cell which has been released from normal cell division control. Included in this definition are transformed and immortalized cells.
The interaction trap system described herein provides advantages over more conventional methods for isolating interacting proteins or genes encoding interacting proteins. Most notably, applicants' system provides a rapid and inexpensive method having very general utility for identifying and purifying genes encoding a wide range of useful proteins based on the protein's physical interaction with a polypeptide of known diagnostic or therapeutic usefulness. This general utility derives in part from the fact that the components of the system can be readily modified to facilitate detection of protein interactions of widely varying affinity (e.g., by using reporter genes which differ quantitatively in their sensitivity to a protein interaction) . The inducible nature of the promoter used to express the interacting proteins also increases the scope of candidate interactors which may be detected since even proteins whose chronic expression is toxic to the host cell may be isolated simply by inducing a short burst of the protein's expression and testing for its ability to interact and stimulate expression of a β- galactosidase reporter gene.
Moreover, detection of interacting proteins through the use of a weak gene activation domain tag avoids the restrictions on the pool of available candidate interacting proteins which is characteristically associated with stronger activation domains (such as GAL4 or VP16) ; although the mechanism is unclear, such a restriction apparently results from low to moderate levels of host cell toxicity mediated by the strong activation domain.
Other features and advantages of the invention will be apparent from the following detailed description thereof, and from the claims.
Brief Description of the Drawings The drawings are first briefly described.
FIGURE 1 illustrates cell cycle control systems. FIGURE 1(A) illustrates Gl control in yeast. FIGURE IB illustrates cell cycle control in yeast and mammals. FIGURE 2 A-C illustrates an interaction trap system according to the invention. FIGURE 3A is a diagrammatic representation of a "bait" protein useful in the invention; the numbers represent amino acids. FIGURE 3B is a diagrammatic representation of reporter genes useful in the invention. FIGURE 3C is a diagrammatic representation of a library expression plasmid useful in the invention and the N- terminal amino acid sequence of an exemplary "prey" protein according to the invention.
FIGURE 4 depicts yeast assays demonstrating the specificity of the Cdil/Cdc2 interaction.
FIGURE 5 shows the results of an immunoprecipitation experiment demonstrating that Cdil physically interacts with Cdc2.
FIGURE 6 shows the Cdil coding sequence together with the predicted amino-acid sequence of its open reading frame (SEQ ID NO:l).
In FIGURE 7A, the growth rates of yeast cells that express Cdil are depicted; open squares are cells transformed with expression vectors only; ovals are cells expressing Cdc2; triangles are cells expressing Cdil; and filled squares are cells expressing Cdil and Cdc2. In FIGURE 7B is shown a budding index of yeast that express Cdil. In FIGURE 7C is shown a FACS analysis of yeast that express Cdil; fluorescence (on the x-axis) is shown as a function of cell number (on the Y-axis) .
FIGURE 8A shows the morphology of control cells; FIGURE 8B shows the morphology of control cells stained with DAPI; FIGURE 8C shows the morphology of cells expressing Cdil; and FIGURE 8D shows the morphology of cells expressing Cdil stained with DAPI.
FIGURE 9A indicates the timing of Cdil expression in Hela cells; lanes represent different timepoints: (1) Oh, (2) 3h, (3) 6h, (4) 9h, (5) 12h, (6) 15h, (7) 18h, (8) 21h, (9) 24h, and (10) 27h after release. FIGURE 9B shows the effect of Cdil overexpression. FIGURE 10 shows an alignment of Cdc2 proteins and FUS3. Depicted is an alignment of the sequences of the bait proteins used herein. Amino acids are numbered as in human Cdc2. Abbreviations are as follows: HsCdc2, human Cdc2; HsCdk2, human Cdk2; ScCdc28, S . cerevisiae Cdc28; DmCdc2 and DmCdc2c, the two Drosophila Cdc2 isolates; and ScFus3, S . cerevisiae FUS3. Residues shown in boldface are conserved between the Cdc2 family members; residues present in Fus3 are also shown in bold. Asterisks indicate potential Cdil contact points, i.e., amino acids that are conserved among human Cdc2, Cdk2, S . cerevisiae Cdc28, and Drosophila Cdc2, but that differ in Drosophila Cdc2c and in Fus3.
There now follows a description of one example of an interaction trap system and its use for isolating a particular cell division protein. This example is designed to illustrate, not limit, the invention.
Detailed Description Applicants have developed an in vivo interaction trap system for the isolation of genes encoding proteins which physically interact with a second protein of known diagnostic or therapeutic utility. The system involves a eukaryotic host strain (e.g., a yeast strain) which is engineered to express the protein of therapeutic or diagnostic interest as a fusion protein covalently bonded to a known DNA binding domain; this protein is referred to as a "bait" protein because its purpose in the system is to "catch" useful, but as yet unknown or uncharacterized, interacting polypeptides (termed the "prey"; see below). The eukaryotic host strain also contains one or more "reporter genes", i.e., genes whose transcription is detected in response to a bait-prey interaction. Bait proteins, via their DNA binding domain, bind to their specific DNA site upstream of a reporter gene; reporter transcription is not stimulated, however, because the bait protein lacks its own activation domain.
To isolate genes encoding novel interacting proteins, cells of this strain (containing a reporter gene and expressing a bait protein) are transformed with individual members of a DNA (e.g., a cDNA) expression library; each member of the library directs the synthesis of a candidate interacting protein fused to a weak and invariant gene activation domain tag. Those library- encoded proteins that physically interact with the promoter-bound bait protein are referred to as "prey" proteins. Such bound prey proteins (via their activation domain tag) detectably activate the transcription of the downstream reporter gene and provide a ready assay for identifying particular cells which harbor a DNA clone encoding an interacting protein of interest.
One example of such an interaction trap system is shown in Figure 2. Figure 2A shows a yeast strain containing two reporter genes, LexAop-LEU2 and LexAop- lacZ, and a constitutively expressed bait protein, LexA- Cdc2. Synthesis of prey proteins is induced by growing the yeast in the presence of galactose. Figure 2B shows that if the prey protein does not interact with the transcriptionally-inert LexA-fusion bait protein, the reporter genes are not transcribed; the cell cannot grow into a colony on leu" medium, and it is white on Xgal medium because it contains no 0-galactosidase activity. Figure 2C shows that, if the prey protein interacts with the bait, then both reporter genes are active; the cell forms a colony on leu" medium, and cells in that colony have 0-galactosidase activity and are blue on Xgal medium.
As described herein, in developing the interaction trap system shown diagrammaticaUy in Figure 2, careful attention was paid to three classes of components: (i) use of bait proteins that contained a site-specific DNA binding domain that was known to be transcriptionally inert; (ii) use of reporter genes that had essentially no basal transcription and that were bound by the bait protein; and (iii) use of library-encoded prey proteins, all of which were expressed as chimeras whose amino termini contained the same weak activation domain and, preferably, other useful moieties, such as nuclear localization signals.
Each component of the system is now described in more detail. Bait Proteins
The selection host strain depicted in Figure 2 contains a Cdc2 bait and a DNA binding moiety derived from the bacterial LexA protein (see Figure 3A) . The use of a LexA DNA binding domain provides certain advantages. For example, in yeast, the LexA moiety contains no activation function and has no known effect on transcription of yeast genes (Brent and Ptashne, Nature 312:612-615, 1984; Brent and Ptashne, Cell 43:729-736, 1985) . In addition, use of the LexA rather than the GAL4 DNA-binding domain allows conditional expression of prey proteins in response to galactose induction; this facilitates detection of prey proteins which might be toxic to the host cell if expressed continuously. Finally, the use of LexA allows knowledge regarding the interaction between LexA and the LexA binding site (i.e., the LexA operator) to be exploited for the purpose of optimizing operator occupancy.
The bait protein illustrated in Figure 3A also includes a LexA dimerization domain; this optional domain facilitates efficient LexA dimer formation. Because LexA binds its DNA binding site as a dimer, inclusion of this domain in the bait protein also optimizes the efficiency of operator occupancy (Golemis and Brent, Mol. Cell Biol. 12:3006-3014, 1992).
LexA represents a preferred DNA binding domain in the invention. However, any other transcriptionally- inert or essentially transcriptionally-inert DNA binding domain may be used in the interaction trap system; such DNA binding domains are well known and include the DNA binding portions of the proteins ACE1 (CUP1) , lambda cl, lac repressor, jun fos, or GCN4. For the above-described reasons, the GAL4 DNA binding domain represents a slightly less preferred DNA binding moiety for the bait proteins.
Bait proteins may be chosen from any protein of known or suspected diagnostic,or therapeutic importance. Preferred bait proteins include oncoproteins (such as myc, particularly the C-terminus of myc, ras, src, fos, and particularly the oligomeric interaction domains of fos) or any other proteins involved in cell cycle regulation (such as kinases, phosphatases, the cytoplasmic portions of membrane-associated receptors, and other Cdc2 family members) . In each case, the protein of diagnostic or therapeutic importance would be fused to a known DNA binding domain as generally described for LexA-Cdc2. Reporters
As shown in Figure 3B, one preferred host strain according to the invention contains two different reporter genes, the LEU2 gene and the lacZ gene, each carrying an upstream binding site for the bait protein. The reporter genes depicted in Figure 3B each include, as an upstream binding site, one or more LexA operators in place of their native Upstream Activation Sequences (UASs) . These reporter genes may be integrated into the chromosome or may be carried on autonomously replicating plasmids (e.g., yeast 2μ plasmids) . A combination of two such reporters is preferred in the invention for a number of reasons. First, the LexAop-LEU2 construction allows cells that contain interacting proteins to select themselves by growth on medium that lacks leucine, facilitating the examination of large numbers of potential interactor protein- containing cells. Second, the LexAop-lacZ reporter allows LEU+ cells to be quickly screened to confirm an interaction. And, third, among other technical considerations (see below) , the LexAop-LEU2 reporter provides an extremely sensitive first selection, while the LexAop-lacZ reporter allows discrimination between proteins of different interaction affinities.
Although the reporter genes described herein represent a preferred embodiment of the invention, other equivalent genes whose expression may be detected or assayed by standard techniques may also be employed in conjunction with, or instead of, the LEU2 and lacZ genes. Examples of other useful genes whose transcription can be detected include amino acid and nucleic acid biosynthetic genes (such as yeast HIS3, URA3, and LYS2 ) GAL1, E. coli galK (which complements the yeast GAL1 gene) , and the higher cell reporter genes CAT, GUS, and any gene encoding a cell surface antigen for which antibodies are available (e.g., CD4) . Prey proteins
In the selection described herein, a fourth DNA construction was utilized which encoded a series of candidate interacting proteins, each fused to a weak activation domain (i.e., prey proteins). One such prey protein construct is shown in Figure 3C; this plasmid encodes a prey fusion protein which includes an invariant N-terminal moiety. This moiety carries, amino to carboxy terminal, an ATG for protein expression, an optional nuclear localization sequence, a weak activation domain (i.e., the B42 activation domain of Ma and Ptashne; Cell 51:113, 1987), and an optional epitope tag for rapid immunological detection of fusion protein synthesis. As described herein, a HeLa cDNA libraray was constructed, and random library sequences were inserted downstream of this N-terminal fragment to produce fusion genes encoding prey proteins.
Prey proteins other than those described herein are also useful in the invention. For example, cDNAs may be constructed from any mRNA population and inserted into an equivalent expression vector. Such a library of choice may be constructed de novo using commercially available kits (e.g., from Stratagene, La Jolla, CA) or using well established preparative procedures (see, e.g., Current Protocols in Molecular Biology, New York, John Wiley & Sons, 1987) . Alternatively, a number of cDNA libraries (from a number of different organisms) are publically and commercially available; sources of libraries include, e.g., Clontech (Palo Alto, CA) and Stratagene (La Jolla, CA) . It is also noted that prey proteins need not be naturally occurring full length polypeptides. For example, a prey protein may be encoded by a synthetic sequence or may be the product of a randomly generated open reading frame or a portion thereof. In one particular example, the prey protein includes only an interaction domain; such a domain may be useful as a therapeutic to modulate bait protein activity.
Similarly, other weak activation domains may be substituted for the B42 portion of the prey molecule; such activation domains must be weaker than the GAL4 activation region II moiety and preferably should be no stronger than B42 (as measured, e.g., by a comparison with GAL4 activation region II or B42 in parallel β- galactosidase assays using lacZ reporter genes) ; such a domain may, however, be weaker than B42. In particular, the extraordinary sensitivity of the LEU2 selection scheme (described above) allows even extremely weak activation domains to be utilized in the invention. Examples of other useful weak activation domains include B17, B112, and the amphipathic helix (AH) domains described in Ma and Ptashne (Cell 51:113, 1987), Ruden et al. (Nature 350:426-430, 1991), and Giniger and Ptashne (Nature 330:670, 1987). Finally, the prey proteins, if desired, may include other optional nuclear localization sequences (e.g., those derived from the GAL4 or MAT 2 genes) or other optional epitope tags (e.g., portions of the c-myc protein or the flag epitope available from Immunex) . These sequences optimize the efficiency of the system, but are not absolutely required for its operation. In particular, the nuclear localization sequence optimizes the efficiency with which prey molecules reach the nuclear-localized reporter gene construct(s) , thus increasing their effective concentration and allowing one to detect weaker protein interactions; and the epitope tag merely facilitates a simple immunoassay for fusion protein expression.
Those skilled in the art will also recognize that the above-described reporter gene, DNA binding domain, and gene activation domain components may be derived from any appropriate eukaryotic or prokaryotic source, including yeast, mammalian cell, and prokaryotic cell genomes or cDNAs as well as artificial sequences. Moreover, although yeast represents a preferred host organism for the interaction trap system (for reasons of ease of propagation, genetic manipulation, and large scale screening) , other host organisms such as mammalian cells may also be utilized. If a mammalian system is chosen, a preferred reporter gene is the sensitive and easily assayed CAT gene; useful DNA binding domains and gene activation domains may be chosen from those described above (e.g., the LexA DNA binding domain and the B42 or B112 activation domains) . The general type of interaction trap system described herein provides a number of advantages. For example, the system can be used to detect bait-prey interactions of varying affinity. This can be accomplished, e.g., by using reporter genes which differ quantitatively in their sensitivity to an interaction with a library protein. In particular, the equilibrium Kd with which a library-encoded protein must interact with the bait to activate the LexAop-LEU2 reporter is probably <10~6M. This value is clearly sufficient to detect protein interactions that are weaker and shorter lived than those detected, e.g., by typical physical methods. The lacZ reporters are less sensitive, allowing the selection of different prey proteins by utilizing reporters with the appropriate number, affinity, and position of LexA operators; in particular, sensitivity of the lacZ reporter gene is increased by either increasing the number of upstream LexA operators, utilizing LexA operators which have increased affinity for LexA binding dimers, and/or decreasing the distance between the LexA operator and the downstream reporter gene promoter. This ability to manipulate the sensitivity of the system provides a measure of control over the strength of the interactions detected and thus increases the range of proteins which may be isolated. The system provides at least three other advantages. First, the activation region on the library- encoded proteins is relatively weak, in order to avoid restrictions on the spectrum of library proteins detected; such restrictions are common when utilizing a strong, semi-toxic activation domain such as that of GAL4 or VP16 (Gill and Ptashne, Nature 334:721-724, 1988; Triezenberg et al., Genes Dev. 2:730-742, 1988; Berger et al., Cell 70:251-265, 1992). Second, the use of LexA to bind the bait to DNA allows the use of GAL4+ yeast hosts and the use of the GAL1 promoter to effect conditional expression of the library protein. This in turn allows the Leu or lacZ phenotypes to be unconditionally ascribed to expression of the library protein and minimizes the number of false positives; it also allows conditional expression and selection of interactor proteins which are toxic to the host cell if continuously produced. And third, placing the activation domain at the amino terminus, rather than at the carboxy terminus, of the fusion protein guarantees that; the activation domain portion of the protein will be translated in frame, and therefore that one out of three fusion genes will encode a candidate activation domain-tagged interactor protein.
One particular interaction trap system is now described. The use of this system to isolate a protein (termed Cdil) which physically interacts with a known cell division control protein (termed Cdc2) is also illustrated.
Isolation and Characterization of Cdil Isolation of the Cdil cDNA To isolate proteins which interact with the cell division control protein Cdc2, the yeast strain EGY48/pl840 was utilized. This strain contained both the LexAop-LEU2 and LexAop-lacZ reporters, as well as a plasmid that directed the synthesis of a LexA-Cdc2 bait protein (see below) . The LexAop-LEU2 reporter replaced the chromosomal LEU2 gene. This reporter carried 3 copies of the high affinity colEl double LexA operator (Ebina et al., J. Biol. Chem. 258:13258-13261, 1983) 40 nucleotides upstream of the major LEU2 transcription startpoint. The LexAop-lacZ reporter (pl840) was carried on a URA3+ 2μ plasmid. This reporter carried a single LexA operator 167 nucleotides upstream of the major GAL1 transcription startpoint.
A HeLa cDNA interaction library (described below) was also introduced into this strain using the plasmid depicted in Figure 3C (termed pJG4-5) ; this library vector was designed to direct the conditional expression of proteins under the control of a derivative of the GAL1 promoter. This plasmid carried a 2μ replicator and a TRP1+ selectable marker. cDNA was inserted into this plasmid on EcoRl-XhoI fragments. Downstream of the Xhol site, pJG4-5 contained the ADH1 transcription terminator. The sequence of an invariant 107 amino acid moiety, encoded by the plasmid and fused to the N-terminus of all library proteins, is shown below the plasmid map in Figure 3C. This moiety carries, amino to carboxy terminal, an ATG, the SV40 T nuclear localization sequence (Kalderon et al., Cell 39:499-509, 1984), the B42 transcription activation domain, (Ma and Ptashne, Cell 51:113-119, 1987; Ruden et al. , Nature 350:426-430, 1991) and the 12CA5 epitope tag from the influenza virus hemagglutinin protein (Green et al., Cell 28:477-487, 1982) .
Following introduction of the prey-encoding plasmids into EGY48/pl840, over a million transformants were isolated, of which 3-4 X 105 expressed fusion proteins (see experimental procedures below) . The colonies were pooled, diluted, and grown for five hours in liquid culture in the presence of galactose to induce synthesis of library-encoded proteins. The pool was then diluted again so that each original transformant was represented about 20 times and plated on galactose- containing medium without leucine. From about 2 X 107 cells, 412 LEU2+ colonies were isolated. 55 of these colonies were blue on galactose Xgal medium, presumably due to the lower sensitivity of the lacZ reporter. In all cells in which both reporters were active, both phenotypes were galactose-dependent, confirming that they required the library-encoded protein. Library plasmids were rescued from these cells, assigned to one of three classes by restriction mapping, and the plasmids identified from each class that contained the longest cDNA inserts. Synthesis of a fusion protein by the plasmid was verified in each case by Western blot analysis using anti-epitope antiserum.
Further analysis by detailed mapping and partial DNA sequencing showed that two of the recovered cDNA classes were identical to previously identified genes encoding CKSlhs and CKS2hs (Richardson et al., Genes Dev. 4:1332-1344, 1990), human homologs of the S. pombe sucl+ product. Sequencing of the third restriction map class showed it to be a previously unidentified gene. This gene was termed CDI1 , for Cdc2 Xnteractor 1; its protein product was termed Cdil. The CDJ1 gene was introduced into a panel of EGY48-derived strains (i.e., EGY48/1840 containing different LexA fusion baits) in order to test the reproducibility and specificity of the interaction between Cdc2 and Cdil. Cells from 8 individual transformed cells that contained Cdil plus a given bait (horizontal streaks) or the same bait plus the library vector as a control (adjacent vertical streaks) were streaked with toothpicks onto each of three plates (Figure 4) . The plates, shown in Figure 4, included a "control" plate, a Ura" Trp" His" glucose plate which selected for the presence of the bait plasmid, the LexAop-lacZ reporter, and the Cdil expression plasmid; a "glucose" plate, a Ura" Trp" His" Leu" glucose plate, which additionally selected for activation of the LexAop- LEU2 reporter; and a "galactose" plate, a Ura" Trp" His" Leu" galactose plate, which selected for the activation of the LexAop-LEU2 reporter, and which induced the expression of Cdil. Baits used in this test included: (1) LexA-Cdc2, (2) LexA-Bicoid, (3) LexA-Max, (4) LexA- Cln3, (5) LexA-Fus3, and (6) LexA-cMyc-Cterm (Figure 4).
As judged by the LEU2 and lacZ transcription phenotypes, Cdil interacted specifically with LexA-Cdc2, and did not interact with LexA-cMyc-Cterm, LexA-Max, LexA-Bicoid, LexA-Cln3, or LexA-Fus3 (Figure 4). Cdil also interacted with other Cdc2 family proteins, including LexA-Cdc28, as discussed below. Applicants also note that, on glucose, the LexA-Cln3 bait weakly activated the LexAop-LEU2 reporter, but that, on galactose, the inferiority of the carbon source and the dimished bait expression from the ADHl promoter eliminated this background.
The specificity of the Cdil/Cdc2 interaction was then confirmed by physical criteria, in particular, by immunoprecipitation experiments. Extracts were made from EGY48 cells that contained a library plasmid that directed the synthesis of tagged Cdil and that also contained either a LexA-Cdc2 or a LexA-Bicoid bait. In particular, 100 ml of cells were grown in glucose or galactose medium (in which Cdil expression was induced) to an OD600 of 0.6-0.8, pelleted by centrifugation, resuspended in 500μl RIPA, lysed by beating with glass beads five times for two minutes each, and spun twice for five minutes in a microfuge (10,000 X G) at 4° to remove the beads and cell debris. 5μl of this supernatant was taken as a control, and 15μl of rabbit anti-LexA antiserum was added to the remainder, which was incubated at 4°C for four hours on a rotating platform. LexA-containing proteins were first precipitated from this remainder with 50μl Staph A-coated sepharose beads (Pharmacia, Piscataway, NJ) as described in Wittenberg and Reed (Cell 54:1061-1072, 1988). The entire pellet was then dissolved in Laemmli sample buffer, run on a 12.5% protein gel (SDS/PAGE) , and blotted onto nitrocellulose. Tagged Cdil fusion proteins were identified by Western analysis of the blotted proteins with the 12CA5 monoclonal antihemagglutinin antibody essentially as described in Samson et al. (Cell 57:1045-1052, 1989). The results are shown in Figure 5; the lanes are as follows: (1) Galactose medium, LexA-Bicoid bait, im unoprecipitation; (2) Glucose medium, LexA-Bicoid bait, immunoprecipitation; (3) Galactose medium, LexA- Bicoid bait, cell extract; (4) Glucose medium, LexA- Bicoid bait, cell extract; (5) Galactose medium, LexA- Cdc2 bait, immunoprecipitation; (6) Glucose medium, LexA- Cdc2 bait, immunoprecipitation; (7) Galactose medium, LexA-Cdc2 bait, cell extract; and (8) Glucose medium, LexA-Cdc2 bait, cell extract. As shown in Figure 5, anti-LexA antiserum precipitated Cdil from a yeast extract that contained LexA-Cdc2 and Cdil, but not from one that contained LexA-Bicoid and Cdil, thus confirming that Cdil physically interacted only with the Cdc2- containing bait protein. The Cdil Protein Product
To analyze the Cdil protein product, the Cdil cDNA was isolated from 12 different library plasmids that contained cDNAs of 4 different lengths. Sequence analysis revealed that all of the cDNA inserts contained an open reading frame, and inspection of the sequence of the longest cDNAs (Figure 6) revealed an ATG with a perfect match to the Kozak consensus translation initiation sequence (PuCC/GATGG) (Kozak, Cell 44:283-292, 1986) . Careful analysis of the size of the Cdil mRNA in HeLa cells revealed that this ATG occurred between 15 and 45 nucleotides from the 5' end of the Cdil message, suggesting that the longest cDNAs spanned the entire open reading frame.
The Cdil gene is predicted to encode a protein of 212 amino acids. The Cdil amino acid sequence does not reveal compelling similarities to any previously identified proteins (Figure 6) . However, two facts about the protein sequence are worth noting. First, 19 of the amino-terminal 35 amino acids are either proline, gluta ic acid, serine, or threonine. Proteins that contain these stretches, called PEST sequences, are thought to be degraded rapidly (Rogers et al., Science 234:364-368, 1986); in fact, this stretch of Cdil is more enriched in these amino acids than the C-termini of the yeast Gl cyclins, in which the PEST sequences are known to be functional (Cross, Mol. Cell. Biol 8:4675-4684, 1988; Nash et al., EMBO J. 7:4335-4346, 1988; Hadwiger et al., Proc. Nat. Acad. Sci. USA 86:6255-6259, 1989). Second, since the cDNA library from which the plasmids that encoded Cdil were isolated was primed with oligo dT, and since all isolated Cdil cDNAs by definition encoded proteins that interacted with Cdc2, analysis of the sizes of Cdil cDNA inserts obtained in the screen necessarily localized the portion of the protein sufficient for interaction with Cdc2 to Cdil's C-terminal -170 amino acids. Analysis of Cdil Function in Yeast
In initial efforts to understand Cdil function, the effects of Cdil expression in yeast were examined. In particular, because Cdil interacts with Cdc2 family proteins, including S . cerevisiae Cdc28, an examination of whether Cdil affected phenotypes that depended on other known proteins that interact with Cdc28 was undertaken. Toward this end, the fact that expression of the S. pojnJe sucl+ or S . cerevisiae Cks proteins can rescue the temperature sensitivity of strains that bear certain cdc28ts alleles was exploited; this effect is thought to be due to the ability of these proteins to form complexes with the labile Cdc28ts protein, protecting it against thermal denaturation (Hadwiger et al., Proc. Nat. Acad. Sci. USA 86:6255-6259, 1989). It was found that Cdil expression did not rescue the temperature-sensitivity of any cdc28 allele tested, although human Cks2 did.
Next, the ability of Cdil to confer on yeast either of two phenotypes associated with expression of S . cerevisiae or higher eukaryotic cyclins was examined; such phenotypes include resistance to the arrest of MATa strains by α factor, and rescue of growth arrest of a strain deficient in Clnl, Cln2, and Cln3. Again, however, Cdil expression did not confer either phenotype.
During initial studies, it was noted that expression of Cdil inhibited yeast cell cycle progression. Cultures of cells that expressed Cdil increased their cell number and optical density more slowly than control populations (Figure 7A) .
To further investigate this growth retardation phenotype, the morphology of Cdil-expressing cells was examined. W303 cells were transformed with pJG4-4Cdil, a galactose-inducible vector that directs the synthesis of Cdil. Morphology of cells was examined with Nomarski optics at 1000X magnification. As shown in Figure 8, such microscopic examination of the cells showed that, compared with controls, cells in which Cdil was expressed were larger, and a subpopulation showed aberrant morphologies: 5% of the cells formed elongated schmoos, and 5% exhibited multiple buds. Immunofluorescent examination of a sample of these cells which had been DAPI stained (as described below) showed that the nuclei of some of the largest cells were not condensed.
Finally, cells were examined for their ability to bud. Samples of 400 cells from control populations and from populations expressing Cdil were examined by phase contrast microscopy, and the budding index was calculated as the percentage of budded cells in each population as described in Wittenberg and Reed (Mol. Cell. Biol. 9:4064-4068, 1989). As shown in Figure 7B, less than 10% of the cells in the Cdil-expressing population showed buds, as opposed to 30% of the cells in the control population, suggesting that fewer of the cells in the population expressing Cdil had passed through the Gl to S transition. This finding is consistent with the idea that the increased cell size and growth retardation were also due to a prolongation of Gl.
This hypothesis was further tested by FACS analysis of cellular DNA. In particular, W303 cells that contained Cdil were grown as described above and diluted to OD600=0.l in 2% glucose or 1% raffinose, 1% galactose, and grown to OD600=0.8-1.0. At this point, the cells were collected, sonicated, fixed in 70% ethanol, stained with propidium iodide, and subjected to FACS analysis to determine DNA content as previously described (Lew et al. Cell 63:317-328, 1992). Approximately 20,000 events were analyzed. These results, shown in Figure 7C, indicated that the majority of the cells in the Cdil-expressing population had increased amounts of cellular DNA. This may indicate that an increased number of cells were in S phase; alternatively, it may simply be the result of larger cell size and increased quantity of mitochondrial DNA.
Taken together, these experiments thus indicated that protracted Cdil expression in S . cerevisiae caused a retardation in the passage of cells through the cell cycle, most likely by increasing the proportion of cells in Gl; they thus also indicate that Cdil expression uncoupled the normal synchrony between these two metrics of cell cycle progression. Because Cdil interacts with Cdc2 family proteins, it was postulated that the Cdil growth retardation phenotype in S. cerevisiae might be explained by sequestration of Cdc28 into protein complexes that were not competent to cause the cell to traverse Gl. To test this hypothesis, the effect of native Cdil expression in cells containing Cdc28 with and without overexpressed native human Cdc2 was compared. Specifically, W303 cells that carried the indicated combinations of galactose- inducible Cdil expression vector and/or Cdc2 expression vector were grown for 14h in complete minimal medium lacking tryptophan and histidine in the presence of 2% raffinose. Cells were then washed and diluted to OD600==0.1 in the same media containing either 2% glucose, or 1% raffinose and 1% galactose. Optical densities were measured at two hour intervals for 12 hours. The results of these growth assay experiments are shown in Figure 7A.
Unexpectedly, it was found that the presence of additional Cdc2 increased the severity of the Cdil- dependent growth inhibition (Figure 7A) . This result suggested that Cdil endowed Cdc2 family proteins with a new function, at least in S . cerevisiae, one that inhibited their ability to cause cells to traverse Gl and S. The Cdil and Cdc2 expression plasmids together also caused some growth inhibition, even in glucose medium; this result was attributed to leaky expression from the GA1 promoter on the expression plasmid. Analysis of Cdil Function in Mammalian Cells
The above results in yeast suggested that Cdil might have a similar effect on the ability of mammalian cells to traverse Gl or S. Since Cdil was isolated from HeLa cDNA, the point in the cell cycle at which Cdil mRNA was expressed in these cells was first measured. Specifically, adherent HeLa cells were synchronized in late Gl by a double thymidine block (Rao and Johnson, Nature 225:159-164, 1970) as described in Lew et al. (Cell 66:1197-1206, 1991). Aliquots of cells were collected every three hours after release from the block. Released cells reentered the cell cycle 9 hours after release, as measured by FACS analysis of DNA content. Total RNA was prepared from each aliquot at different time points, run out on a formaldehyde agarose gel, and blotted onto nylon (Nytran, Schleider and Schuell, Keene, NH) as described in Ausubel et al. (Current Protocols in Molecular Biology, New York, John Wiley & Sons, 1987) . The blot was probed with random primed DNA probes (Feinberg and Vogelstein, Anal. Biochem. 132:6-13, 1983) made from a 690 bp EcoRI fragment that contained Cdil, a 1389 bp PstI fragment from of human cyclin E sequence (Lew et al., Cell
66:1197-1206, 1991), a 1228bp NcoI-SphI fragment from the coding sequence of the human Cyclin Bl gene (Pines and Hunder, Cell 58:833-846, 1989), and a 1268bp PstI fragment carrying the full length human glyceraldehyde- phosphate-dehydrogenase (GAPD) gene (Tokunaga et al., Cancer Res. 47:5616-5619, 1987) which served as a normalization control. As is shown in Figure 9A, expression of Cdil mRNA peaks at the end of Gl, immediately before the Gl to S transition, in parallel with the expression of the cyclin E message. This temporal expression pattern was consistent with the hypothesis that Cdil expression might affect the Gl to S transition.
To further test this idea, HeLa cells were transfected either with pBNCdil, a construction that directed the synthesis of Cdil under the control of the Moloney Murine Leukemia Virus LTR (see below) , or with the vector alone. Individual transformed clones were selected by their resistance to G418, and cells from these clones were stained with propidium-iodide and subjected to FACS analysis to determine DNA content (as described below) . The midpoint of Gl was defined as the mode of the distribution of each graph; the modes on the two panels were of different heights (272 counts for cells transformed with the vector, 101 counts for cells that contained Cdil) ; this broadened peak in the Cdil- expressing cells reflected the increased proportion of the population that contains approximately IX DNA content. 4 independent transfectants were analysed; all yielded similar results. These results, which are shown in Figure 9B, indicated that the populations of cells in which Cdil was expressed contained an increased proportion of cells in Gl relative to control populations. Cdc2-Cdil Interaction
To identify determinants of Cdc2 recognized by Cdil, Cdil was tested for its ability to interact with a panel of different bait proteins that included Cdc2 proteins from yeast, humans, and flies, as well as the yeast Fus3 protein kinase (a protein kinase of the ERK class which negatively regulates Cln3 and which, by sequence criteria, is less related to the Cdc2 proteins than those proteins are to one another (Elion et al., Cell 60:649-664, 1990). To perform these experiments, EGY48/JK103
(described below) containing a plasmid that directed the galactose-inducible synthesis of tagged Cdil was transformed with one of a series of different transcriptionally-inert LexA-Cdc2 family protein baits. Five individual transformants of each bait were grown to OD600=0.5-1.0 in minimal medium that contained 2% galactose but that lacked uracil, histidine, and tryptophan. Results are shown in Table 1 and are given in /3-galactosidase units; variation among individual transformants was less than 20%.
TABLE 1 Bait g-Galactosidase Activity
LexA-Cdc2 (Hs) 1580
LexA-Cdk2 (Hs) 440 LexA-Cdc28 (Sc) 480
LexA-Cdc2 (Dm) 40
LexA-Cdc2c (Dm) >2
LexA-Fus3 (Sc) >2
As shown in Table 1, tagged Cdil stimulated transcription from these baits to different levels; it activated strongly in strains that contained the human Cdc2 bait, against which it was selected, less strongly in strains that contained S. cerevisiae Cdc28 or human Cdk2 baits, and only weakly in strains that contained the DmCdc2 bait, one of the two Drosophila Cdc2 homologs (Jimenez et al., EMBO J. 9:3565-3571, 1990; Lehner and O'Farrell, EMBO J. 9:3573-3581, 1990). In strains that contained the DMCdc2c bait or Fus3, Cdil did not activate at all. Since baits in this panel were related in sequence, were made from the same vector, were translated from a message that had the same 5' untranslated sequence and the same LexA coding sequence, and were expressed in yeast in the same amounts, the differences in transcription among the bait strains very likely reflected differences in interaction with the tagged Cdil.
In order to identify residues on Cdc2 proteins that Cdil might recognize, the transcription interaction data was compared to the sequence of the baits. A lineup of the bait sequences was searched for residues that were conserved in the proteins with which Cdil interacted, but which differed in the proteins that Cdil did not touch. Use of this criterion identified 7 residues, which are indicated by asterisks in Figure 10. Of these residues, two, Glu 57 and Gly 154 (in human Cdc2) , are altered in the non-interacting baits to amino acids of different chemical type. In DmCdc2c, residue 57 is changed from Glu to Asn, and residue 154 from Gly to Asn; in Fus3, these residues are changed to His and Asp. In human Cdc2, both of these residues adjoin regions of the molecule necessary for interaction with cyclins (Ducommun et al., Mol. Cell. Biol. 11:6177-6184, 1991). Projection of the human Cdc2 primary sequence on the crystal structure solved by Knighton et al. for bovine cAMP dependent protein kinase (Science 253:407-413, 1991) suggests that residues 57 and 154 are in fact likely to be close to these cyclin contact points in the folded protein. These results are thus consistent with the idea that Cdil may exert its effects by changing the affinity of Cdc2 proteins for particular cyclins, thus potentially altering their substrate specificity.
In summary, Cdil is a protein which complexes with Cdc2 family proteins. It is expressed around the time of the Gl to S transition, and the above results suggest that it may negatively regulate passage of cells through this part of the cycle, thus linking the regulatory networks connecting extracellular signals with core cell cycle controls. If Cdil is in fact a negative regulator, it is interesting to note that its normal function may be to convey signals that retard or block the cell cycle during Gl. Since both normal differentiation and cancer can be considered consequences of changes in Gl regulation, this idea raises the possibilities that Cdil may function to remove cells from active cycle to allow differentiation (Pardee, Science 246:603-608, 1989); and that there are cancers in which lesions in the Gl regulatory machinery prevent Cdil from exerting its full effect.
Experimental procedures
Bacteria and veast
Manipulation of bacterial strains and of DNAs was by standard methods (see, e.g., Ausubel et al., Current Protocols in Molecular Biology. New York, John Wiley & Sons, 1987; and Sambrook et al., Molecular Cloning: a Laboratory Manual, Cold Spring Harbor, NY, Cold Spring Harbor Laboratory, 1989) unless otherwise noted. E. coli "Sure" mcrA Δ(mrr, hsdRMS, mcrBC) endAl supE44 thi-1 gyrA96 relAl lac recB recJ sbcC umuC: :Tn5 (kanR) uvrC /F' [proAB ,
Figure imgf000034_0001
: :Tnl0(tetR) (Stratagene Inc., LaJolla, CA) and KC8 (pyrF: :Tn5 hsdR leuB600 trpC9830 lacΔ74 εtrA galK hisB436) were used as bacterial hosts throughout. To determine whether Cdil complemented either Gl or G2 functions of cdc28 , the following yeast strains were used: cdc28-lN (MATa ura3 adel trpl cdc28-lN) , which at the restrictive temperature arrests predominantly in G2; and cdc28-13 (MATα leu2 trpl his3 ura3 adel tyrl cdc28-13 ) and cdc28-17 (MATa leu2 trpl his3 ura3 metl4 arg5 argβ tyrl cdc28-17) , which at the restrictive temperature arrests predominantly during Gl.
Into these strains was introduced pJG4-6Cdil (see below) , a yeast expression plasmid that directs the synthesis of Cdil that contains a hemagglutinin epitope tag at its amino terminus, and pJG4-7Cks2 (derived from the same selection) as a positive control. Overnight cultures of these strains were diluted 20:1 into trp" complete minimal medium with 2% glucose and 2% galactose and grown at 25°C for five hours. Dilutions of these cultures were plated onto duplicate plates of solid media that contained the same carbon sources; one plate was placed at 25°C and the other at 36°C. Colonies were counted after five days of incubation
In order to determine whether Cdil complemented a strain deficient in Gl cyclins, strain 3C-1AX (MATa barl Acini Δcln2 Δcln3 cyh2 trpl leu2 ura2 adel his2 [pLEU2- CYH2 (CYH3) -CLN3+] ) into which pJG4-7Cdil or a GAL1-CLN3 construct as a positive control had been introduced was used. Overnight cultures were diluted into glucose and galactose medium as above, and grown for five hours at 30°C. Cells were plated onto glucose- and galactose- containing medium as above, except that the medium also contained lOμg/ml cyclohexamide; cells were grown for three days and counted. Colonies can only arise on this medium when the CYHS-CLN3+ plasmid is lost, an event which itself can only occur if the other plasmid rescues the Cln deficiency. The ability of Cdil to cause resistance to arrest by α factor was tested using a derivative of W303 (MATa trpl ura3 his3 leu2 canl barl : :LEU2) into which pJG4- 4Cdil, a plasmid that directs the synthesis of native Cdil, had been introduced. Strain W303 was also transformed with a set of mammalian cDNAs that had been isolated by their ability to confer α factor resistance as a positive control. Overnight cultures were grown in glucose and galactose as above, and then plated on glucose and galactose medium, in the presence and absence of 10"7M factor. Colonies were counted after 3 days. For the growth rate experiments, W303 contained either pJG4-4Cdil or a vector control, in combination with either a pJG14-2, a HIS3+ plasmid which directs the synthesis in yeast of native human Cdc2 under the control of the ADH1 promoter, or a vector control. Overnight cultures which were grown in His" Trp" minimal medium that contained 2% raffinose were collected, washed, and diluted into fresh medium that contained either 2% glucose or 1% galactose + 1% raffinose to OD600=0.1. Growth kinetics were followed, measuring the OD of aliquots taken every 2 hours. Baits
In order to optimize operator occupancy, baits were produced constitutively under the control of the ADH1 promoter (Ammerer, Meth. Enzym. 101:192-210, 1983), and contained the LexA C-terminal oligomerization region, which contributes to operator occupancy by LexA- containing proteins, perhaps because it aids in the precise alignment of LexA amino termini of adjacent operator half sites (Golemis and Brent, Mol. Cell. Biol. 12:3006-3014, 1992). It is worth noting that all LexA- bait proteins so far examined enter the yeast nucleus in concentrations sufficient to permit operator binding, even though LexA derivatives are not specifically localized to the nucleus unless they contain other nuclear localization signals (see, e.g., Silver et al., Mol. Cell. Biol. 6:4763-4766, 1986). pL202pl has been described (Ruden et al. , Nature 350:426-430, 1991). This plasmid, a close relative of pMA424 and pSH2-l (Ma and Ptashne, Cell 51:113-119, 1987; Hanes and Brent, Cell 57:1275-1283, 1989) carries the HIS3+ marker and the 2μ replicator, and directs the synthesis in yeast of fusion proteins that carry the wild-type LexA protein at their amino terminus. Baits used in this study were made as follows: human Cdc2 (Lee and Nurse, Nature 327:31-35, 1987), Cdk2 (Tsai et al., Nature 353:174-177, 1991) and the S . cerevisiae CDC28 genes (Lorincz and Reed, Nature 307:183-185, 1984) were amplified by PCR using Vent polymerase (New England Biolabε, Beverley, MA) and cloned into pL202pl as EcoRI- BamHI fragments. These proteins contained two amino acids (glu phe) inserted between the last amino acid of LexA and the bait proteins. The Drosophila Cdc2 (Jimenez et al., EMBO J. 9:3565-3571, 1990; Lehner and O'Farrell, EMBO J. 9:3573-3581, 1990) baits were cloned as BamHI- Sall fragments following PCR amplification. LexA-Fus3 (Elion, Cell 60:649-664, 1990) and LexA-Cln3 (Cross, Mol. Cell. Biol 8:4675-4684, 1988, Nash et al., EMBO J. 7:4335-4346, 1988) were made in a similar way except they were cloned as BamHI fragments. These plasmids contained five amino acids (glu phe pro gly ile) (SEQ ID NO:2) inserted between LexA and the baits. All these fusions contained the entire coding region from the second amino acid to the stop codon. LexA-cMyc-Cterm contained the carboxy-terminal 176 amino acids of human cMyc, and LexA- Max contained all of the human Max coding sequence. LexA-Bicoid (amino acid 2-160) has been described (Golemis and Brent, Mol. Cell. Biol. 12:3006-3014, 1992). Reporters In the interaction trap, one reporter, the LexAop- LEU2 construction, replaced the yeast chromosomal LEU2 gene. The other reporter, one of a series of LexAop- GALl-lacZ genes (Brent and Ptashne, Cell 43:729-736, 1985; Kamens et al., Mol. Cell. Biol. 10:2840-2847, 1990) , was carried on a 2μ plasmid. The reporters were designed so that their basal transcription was extremely low, presumably due both to the removal of the entirety of the UAS from both reporters, and to the fact (whose cause is unknown) that LexA operators introduced into promoters tend to decrease transcription (Brent and
Ptashne, Nature 312:612-615, 1984; Lech, Gene activation by DNA-bound Fos and Myc proteins. Ph.D. thesis, Harvard University, 1990) . Reporters were selected to differ in their response to activation by LexA fusion proteins. In this study, the LEU2 reporter contained three copies of the high-affinity LexA binding site found upstream of E. coli colEl (Ebina et al., J. Biol. Chem. 258:13258-13261, 1983; Kamens et al., Mol. Cell. Biol. 10:2840-2847, 1990) , and thus presumably binds a total of 6 dimers of the bait. In contrast, the lacZ gene employed in the primary screen contained a single lower affinity consensus operator (Brent and Ptashne, Nature 312:612- 615, 1984) which binds a single dimer of the bait. The LexA operators in the LEU2 reporter were closer to the transcription startpoint than they were in the lacZ reporter. These differences in the number, affinity, and position of the operators all contributed to making the LEU2 gene a more sensitive indicator than the lacZ gene, a property that is useful for ;this method. pl840 and pJK103 have been described (Brent and Ptashne, Cell 43:729-736, 1985, Kamens et al. , Mol. Cell. Biol. 10:2840-2847, 1990). pHR33 (Ellerstrom et al., Plant Mol. Biol. 18:557-566, 1992) was cut with Hindlll and an ~1166bp fragment that contained the URA3+ gene from yEP24M13-2, a derivative of yEP24, was introduced into it to create pLEU2-0. This plasmid contains a Bglll site 87 nucleotides upstream of the major LEU2 transcription startpoint. pLEU2-0 was cut with Bglll, and a 42bp double stranded Bglll-ended oligomer 5'GATCCTGCTGTATATAAAACCAGTGGTTATATGTACAGTACG3' (SEQ ID NO
3)
3' GACGACATATATTTTGGTCACCAATATACATGTCATGCCTAG 5' (SEQ ID N0:4) that contains the overlapping LexA operators found upstream of the colecin El gene (Ebina et al., J. Biol. Chem. 258:13258-13261. 1983) and which presumably binds 2 LexA dimers, was introduced into it. One plasmid, pLEU2- LexAopδ, that contained three copies of this oligomer was picked; it presumably binds 6 dimers of LexA fusion proteins. Selection strains
EGY12 (MATa trpl ura2 LEU2 : :pLEU2-0 (AUASLEU2 ) ) and EGY38 (as above but : : pLEU2-LexAop6) were constructed as follows. pLEU2-0 and pLEU2-LexAop6 were linearized by digestion with Clal within the LEU2 gene, and the DNA was introduced into U457 (MATa SUP53-a ade2-l canl-100 ura3 - 52 trpl-1 lphi+2 ) by lithium acetate transformation (Ito et al., J. Bacter. 153:163-168, 1983); ura+ colonies, which presumably contained the plasmid DNA integrated into LEU2, were selected. Several of these transformants were grown in YPD. Ura" cells were selected by plating these cultures on medium that contained 5-FOA (Ausubel et al., Current Protocols in Molecular Biology. New York, John Wiley & Sons, 1987) . Both plasmids carry a TYl element. For each integration, -some of the ura3~ revertants were also trpl', suggesting that the ϋJ?A3+ marker was deleted in a homologous recombination event that involved the TYl sequences on the LEU2 plasmids and the chromosomal TYl element upstream of SUP53-a (Oliver et al. , Nature 357:38-46, 1992). Trp" colonies from each integration, EGY12 (no LexA operators) and EGY38 (6 operators) were saved. These were mated to GG100-14D (MAT his3 trpl pho5) . The resulting diploids were sporulated, and a number of random (MATα leu2- ura3- trpl- his3- GAL+) spore products were recovered. EGY40 and EGY48 are products of this cross; EGY40 has no LexA operators, EGY48 has 6. To make the bait strains, EGY48 was transformed with pl840 or pJK103 and with the different bait plasmids. Double transformants were selected on Glucose Ura" His" plates, and expression of the bait protein confirmed by Western blotting using anti-LexA antibody and standard techniques. Library ("prey") expression vectors
Library-encoded proteins were expressed from pJG4- 5, a member of a series of expression plasmids designed to be used in the interaction trap and to facilitate analysis of isolated proteins. These plasmids all carried the 2μ replicator, to ensure high copy number in yeast, and the TRP1 marker. pJG4-5 was designed to possess the following features: a galactose-inducible promoter to allow conditional expression of the library proteins, an epitope tag to facilitate their detection, a nuclear localization signal to maximize their intranuclear concentration in order to increase the sensitivity of the selection, and a weak acid blob activation domain (Ma and Ptashne, Cell 51:113-119, 1987) . This domain was chosen for two reasons: because its activity is not subject to known regulation by yeast proteins as is the major GAL4.activation domain, and, more importantly, because it is a weak activator, presumably avoiding toxicity due to squelching or other mechanisms (Gill and Ptashne, Nature 334:721-724, 1988, Berger et al., Cell 70:251-265, 1992) very likely to restrict the number or type of interacting proteins recovered. pJG4-5 was constructed as follows. An "expression cassette" containing the GAL1 promoter and the ADH1 terminator and a 345 nt insert that encoded a 107 amino acid moiety was inserted into pJG4-0, a plasmid that carries the TRP1 gene, the 2μ replicator, the pUC13 replication origin, and the ampicillin resistance gene. The pJG4-5 expression cassette directed the synthesis of fusion proteins, each of which carried at the amino terminus, amino to carboxy terminal, an ATG, an SV40 nuclear localization sequence (PPKKKRKVA) (SEQ ID NO: 5) (Kalderon et al., Cell 39:499-509, 1984), the B42 acid blob transcriptional activation domain (Ma and Ptashne, Cell 51:113-119, 1987) and the HA1 epitope tag (YPYDVPDYA) (SEQ ID NO: 6) (Green et al. , Cell 28:477- 487, 1980) (Figure 3C) . In addition to this plasmid, these experiments used two Cdil expression plasmids. EcoRl-XhoI Cdil-containing fragments were introduced into pJG4-4 to make the plasmid pJG4-4Cdil; Cdil was transcribed from this plasmid as a native, unfused protein under the control of the GALl promoter. EcoRI- Xhol Cdil-containing fragments were also introduced into pJG4-6 to make the plasmid pJG4-6Cdil; in this case, Cdil was expressed as an in-frame fusion containing, at its amino terminus, an ATG initiation codon and the hemagglutinin epitope tag. Library construction
The activation-tagged yeast cDNA expression library was made from RNA isolated from serum grown, proliferating HeLa cells that were grown on plates to 70% confluence. Total RNA was extracted as described in Chomczynski and Sacchi (Anal. Biochem. 162:156-159, 1987) , and polyA+ mRNA was purified on an oligodT- cellulose column. cDNA synthesis was performed according to Gubler and Hoffman (Gene 25:263-269, 1983) as modified by Huse and Hansen (Strategies 1:1-3, 1988) using a linker primer that contained, 5' to 3', an 18nt polydT tract, an Xhol site, and a 25 nt long GA rich sequence to protect the Xhol site. To protect any internal Xhol sites, the first strand was synthesized in the presence of 5'-methyl-CTP (instead of CTP) with an RNAseH defective version of the Moloney virus reverse transcriptase (Superscript, BRL, Grand Island, NY) . For second strand synthesis, the mRNA/cDNA hybrid was treated with RNAseH and E. coli DNA polymerase I, and the resulting ends were made flush by sequential treatment with Klenow, Mung Bean exonuclease, and Klenow onto which
EcoRI adaptors:
5' AATTCGGCACGAGGCG 3' (SEQ ID NO: 7) 3' GCCGTGCTCCGC 5' (SEQ ID NO: 8) were ligated, and the cDNA was digested with Xhol. This DNA was further purified on a Sephacryl S-400 spin column in order to remove excess adaptor sequences, and fractionated on a 5-20% KoAc gradient. Fractions containing >700 bp cDNAs were collected, and approximately 1/5 of the cDNA was ligated into EcoRI- and Xhol-digested pJG4-5. This ligation mixture was introduced into E. coli SURE cells by electroporation (Gene-Pulser, Bio-Rad, Hercules, CA) according to the manufacturer's instructions. 9.6 x 106 primary transformants were collected by scraping LB ampicillin plates. Colonies were pooled and grown in 6 liters of LB medium overnight (approximately three generations) , and plasmid DNA was purified sequentially by standard techniques on two CsCl gradients. Digestion of transformants of individual library members with EcoRI and Xhol revealed that >90% of the library members contained a cDNA insert whose typical size ranged between lkb-2kb. Western blots of individual yeast transformants using the anti-hemagglutinin monoclonal antibody suggested that between 1/4 and 1/3 of the members expressed fusion proteins. Selection of Cdc2 interactors
Library transformation of the above-described strain was performed according to the procedure described by Ito et al. (J. Bacter. 153:163-168, 1983), except that the cells were grown to a higher OD as described in Schiestl and Gietz (Curr. Genet 16:339-346, 1989) and single stranded carrier DNA was included in the transformation mix also as described in Schiestl and Gietz (Curr. Genet 16:339-346, 1989). This procedure gave 1.2 x 106 primary library transformants (104 library transformants/μg DNA) . Transformants were selected on Glucose Ura" His" Trp" plates, scraped, suspended in approximately 20 ml of 65% glycerol, lOmM Tris-HCl pH 7.5, lOmM MgCl2, and stored in 1ml aliquots at -80°. Plating efficiency was determined on Galactose Ura" His" Trp" after growing 50μl of a cell suspension in 5 ml YP in the presence of 2% galactose. For screening the library, approximately 20 colony forming units on this medium/original transformant (about 2 X 107 cells) were plated on 4 standard circular 10cm Galactose Ura" His" Trp" Leu" plates after the YP/galactose induction described above. 412 Leu+ colonies appeared after a 4 day incubation at 30°C. These colonies were collected on Glucose Ura" His" Trp" master plates and retested on Glucose Ura" His" Trp" Leu", Galactose Ura" His" Trp" Leu", Glucose Xgal Ura" His" Trp", and Galactose Xgal Ura" His" Trp" plates. 55 of these colonies showed galactose- dependent growth on leu" media and galactose-dependent blue color on Xgal medium, and were analyzed further.
Plasmid DNAs from these colonies were rescued as described (Hoffman and Winston, Gene 57:267-272, 1987), introduced into the bacterial strain KC8, and transformants were collected on Trp" ampicillin plates. Plasmid DNAs were analyzed and categorized by the pattern of restriction fragments they gave on 1.8% agarose 1/2X TBE gels after triple digestion with EcoRI and Xhol, and either Alul or Haelll. Characteristic plasmids from different restriction map classes of these cDNAs were retransformed into derivatives of EGY48 that expressed a panel of different LexA fusion proteins. Plasmids that carried cDNAs whose encoded proteins interacted with the LexA-Cdc2 bait but not with other LexA fusion proteins, including LexA-Bicoid, LexA-Fus3, LexA-Cln3, LexA-cMyc- Cterm, and LexA-Max were characterized further. Microscopy
5ml cultures of yeast cells were grown in the appropriate complete minimal medium up OD600 = 0.8-1 and sonicated in a short burst to disrupt the clumps (Ausubel et al., Current Protocols in Molecular Biology. New York, John Wiley & Sons, 1987) . The cells were collected by centrifugation, washed in 1ml TE, resuspended in 1ml 70% ethanol, and shaken for 1 hour at room temperature to fix them, then collected and resuspended in TE. The fixed cells were either examined directly at lOOOx magnification with a Zeiss Axioscope microscope under Nomarski optics or by fluorescence after staining with 2.5μg/ml DAPI as described in Silver et al. (Mol. Cell. Biol. 6:4763-4766, 1986). FACS analysis
Yeast cells were grown and fixed as described above and prepared for FACS analysis of DNA content essentially as in Lew et al. (Cell 63:317-328, 1992).
After fixation the cells were collected and washed three times in 0.8 mis 50mM Tris/HCl pH 8.0, then 200μl 2mg/ml RNaseA was added and incubated at 37°C with continuous shaking for 5 hours. The cells were pelleted, resuspended in 0.5 ml of 5mg/ml pepsin (freshly dissolved in 55mM HCl) and incubated in a 37° waterbath for 30 minutes. The cells were spun down, washed with 1 ml of 200mM Tris/HCl pH 7.5, 211mM NaCl, 78mM MgCl2 and resuspended in the same buffer. 55μl of 500 μg/ml propidium iodide was then added, and cells were stained overnight at 4°C. Typically 10,000-20,000 events were read and analysed in a Becton Dickinson Fluorescence Activated Cell Sorter (Becton Dickinson, Lincoln Park, NJ) with a CellFIT Cell-Cycle Analysis program Version 2.01.2.
For FACS analysis of DNA content, HeLa cells were grown on plates and transfected (Ausubel et al. , Current Protocols in Molecular Biology. New York, John Wiley & Sons, 1987) either with pBNCdil, a DNA copy of a retroviral cloning vector (Morgenstern and Land, Nucl. Acids. Res. 18:3587-3596, 1990) that directs expression of native Cdil under the control of the MoMuLV promoter, or with the vector alone. Clones of transfected cells were selected by growth in medium that contained 400μg/ml of G418; Cdil expression did not diminish the number of G418 resistant cells recovered. Individual clones of each transfection (about 20) were rescued and grown on plates in DMEM + 10% calf serum, collected using 0.05% trypsin, 0.02% EDTA and washed once with IX PBS. Cells from four clones derived from the Cdil transfection and four from the control transfection were suspended in 225μl of 30 μg/ml trypsin dissolved in 3.4mM citrate, 0.1% NP40, 1.5mM spermine and 0.5mM Tris, and incubated on a rotator for 10 minutes at room temperature. 188μl of 0.5mg/ml of trypsin inhibitor and 0.1 mg/ml RNAse A was then added and the suspension was vortexed. After adding 188μl of 0.4 mg/ml of propidium iodide and lmg/ml spermine, the samples were incubated for 30 minutes at 4°C. FACS analysis was carried out as described above.
Cdil Polypeptides and Antibodies
Polypeptide Expression
In general, polypeptides according to the invention may be produced by transformation of a suitable host cell with all or part of a Cdil-encoding cDNA fragment (e.g., the cDNA described above) in a suitable expression vehicle.
Those skilled in the field of molecular biology will understand that any of a wide variety of expression systems may be used to provide the recombinant protein. The precise host cell used is not critical to the invention. The Cdil polypeptide may be produced in a prokaryotic host (e.g., E. coli) or in a eukaryotic host (e.g., Saccharomyces cerevisiae or mammalian cells, e.g., COS 1, NIH 3T3, or HeLa cells) . Such cells are available from a wide range of sources (e.g., the American Type Culture Collection, Rockland, MD; also, see, e.g., Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989). The method of transformation or transfection and the choice of expression vehicle will depend on the host system selected. Transformation and transfection methods are described, e.g., in Ausubel et al. (Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989) ; expression vehicles may be chosen from those provided, e.g., in Cloning Vectors : A Laboratory Manual (P.H. Pouwels et al., 1985, Supp. 1987).
One preferred expression system is the mouse 3T3 fibroblast host cell transfected with a pMAMneo expression vector (Clontech, Palo Alto, CA) . pMAMneo provides: an RSV-LTR enhancer linked to a dexamethasone- inducible MMTV-LTR promotor, an SV40 origin of replication which allows replication in mammalian systems, a selectable neomycin gene, and SV40 splicing and polyadenylation sites. DNA encoding a Cdil polypeptide would be inserted into the pMAMneo vector in an orientation designed to allow expression. The recombinant Cdil protein would be isolated as described below. Other preferable host cells which may be used in conjunction with the pMAMneo expression vehicle include COS cells and CHO cells (ATCC Accession Nos. CRL 1650 and CCL 61, respectively) .
Alternatively, a Cdil polypeptide is produced by a stably-transfected mammalian cell line. A number of vectors suitable for stable transfection of mammalian cells are available to the public, e.g., see Pouwels et al. (supra) ; methods for constructing such cell lines are also publicly available, e.g., in Ausubel et al. (supra) . In one example, cDNA encoding the Cdil polypeptide is cloned into an expression vector which includes the dihydrofolate reductase (DHFR) gene. Integration of the plasmid and, therefore, the Cdil-encoding gene into the host cell chromosome is selected for by inclusion of 0.01-300 μM methotrexate in the cell culture medium (as described in Ausubel et al., supra) . This dominant selection can be accomplished in most cell types. Recombinant protein expression can be increased by DHFR- mediated amplification of the transfected gene. Methods for selecting cell lines bearing gene amplifications are described in Ausubel et al. (supra) ; such methods generally involve extended culture in medium containing gradually increasing levels of methotrexate. DHFR-containing expression vectors commonly used for this purpose include pCVSEII-DHRF apd pAdD26SV(A) (described in Ausubel et al. , supra) . Any of the host cells described above or, preferably, a DHFR-deficient CHO cell line (e.g., CHO DHFR"cells, ATCC Accession No. CRL 9096) are among the host cells preferred for DHFR selection of a stably-transfected cell line or DHFR-mediated gene amplification.
Once the recombinant Cdil protein is expressed, it is isolated, e.g., using affinity chromatography. In one example, an anti-Cdil antibody (e.g., produced as described herein) may be attached to a column and used to isolate the Cdil polypeptide. Lysis and fractionation of Cdil-harboring cells prior to affinity chromatography may be performed by standard methods (see, e.g., Ausubel et al., supra) . Alternatively, a Cdil fusion protein, for example, a Cdil-maltose binding protein, a Cdil-3- galactosidase, or a Cdil-trpE fusion protein, may be constructed and used for isolation of Cdil protein (see, e.g., Ausubel et al., supra; New England Biolabs, Beverly, MA) .
Once isolated, the recombinant protein can, if desired, be further purified, e.g., by high performance liquid chromatography (see, e.g., Fisher, Laboratory Techniques In Biochemistry And Molecular Biology, eds., Work and Burdon, Elsevier, 1980) .
Polypeptides of the invention, particularly short Cdil fragments, can also be produced by chemical synthesis (e.g., by the methods described in Solid Phase Peptide Synthesis, 2nd ed. , 1984 The Pierce Chemical Co., Rockford, IL) .
These general techniques of polypeptide expression and purification can also be used to produce and isolate useful Cdil fragments or analogs (described below) . Anti-Cdil Antibodies
Human Cdil (or immunogenic fragments or analogues) may be used to raise antibodies useful in the invention; such polypeptides may be produced by recombinant or peptide synthetic techniques (see, e.g., Solid Phase Peptide Synthesis , supra; Ausubel et al., supra) . The peptides may be coupled to a carrier protein, such as KLH as described in Ausubel et al, supra. The KLH-peptide is mixed with Freund's adjuvant and injected into guinea pigs, rats, or preferably rabbits. Antibodies may be purified by peptide antigen affinity chromatography.
Monoclonal antibodies may be prepared using the Cdil polypeptides described above and standard hybridoma technology (see, e.g., Kohler et al., Nature 256:495.
1975; Kohler et al., Eur. J. Immunol . 6_:511, 1976; Kohler et al., Eur. J. Immunol . 6_:292, 1976; Hammerling et al., In Monoclonal Antibodies and T Cell Hybridomas , Elsevier, NY, 1981; Ausubel et al., supra) . Once produced, polyclonal or monoclonal antibodies are tested for specific Cdil recognition by Western blot or immunoprecipitation analysis (by the methods described in Ausubel et al., supra) . Antibodies which specifically recognize a Cdil polypeptide are considered to be useful in the invention; such antibodies may be used, e.g., in an immunoassay to monitor the level of Cdil produced by a mammal.
Therapeutic and Diagnostic Uses for the Cdil Polypeptide
Therapy The Cdil polypeptide of the invention has been shown to interact with a key regulator of human cell division and to inhibit the in vivo proliferation of yeast and human cells. Because of its role in the control of cell division, Cdil is an unusually good candidate for an anti-cancer therapeutic. Preferably, this therapeutic is delivered as a sense or antisense RNA product, for example, by expression from a retroviral vector delivered, for example,, to the bone marrow. Treatment may be combined with more traditional cancer therapies such as surgery, radiation, or other forms of chemotherapy.
Alternatively, using the interaction trap system described herein, a large number of potential drugs may be easily screened, e.g., in yeast, for those which increase or decrease the interaction between Cdil and Cdc2. Drugs which increase Cdc2:Cdil interaction would increase reporter gene expression in the instant system, and conversely drugs which decrease Cdc2:Cdil interaction would decrease reporter gene expression. Such drugs are then tested in animal models for efficacy and, if successful, may be used as anticancer therapeutics according to their normal dosage and route of administration. Detection of A Malignant Condition Cdil polypeptides may also find diagnostic use in the detection or monitoring of cancerous conditions. In particular, because Cdil is involved in the control of cell division, a change in the level of Cdil production may indicate a malignant or pre-malignant condition. Levels of Cdil expression may be assayed by any standard technique. For example, its expression in a biological sample (e.g., a biopsy) may be monitored by standard Northern blot analysis or may be aided by PCR (see, e.g., Ausubel et al., supra; PCR Technology: Principles and Applications for DNA Amplification , ed. , H.A. Ehrlich, Stockton Press, NY; and Yap and McGee, Nucl . Acids . Res . 1 :4294, 1991). These techniques are enabled by the provision of the Cdil sequence. Alternatively, immunoassays may be used to detect Cdil protein in a biological sample. Cdil-specific polyclonal, or preferably monoclonal, antibodies (produced as described above) may be used in any standard immunoassay format (e.g., ELISA, Western blot, or RIA assay) to measure Cdil polypeptide levels; again comparison would be to wild type Cdil levels, and a change in Cdil production would be indicative of a malignant or pre-malignant condition. Examples of immunoassays are described, e.g., in Ausubel et al., supra. Immunohistochemical techniques may also be utilized for Cdil detection. For example, a tissue sample may be obtained from a patient, and a section stained for the presence of Cdil using an anti-Cdil antibody and any standard detection system (e.g., one which includes a secondary antibody conjugated to horseradish peroxidase) . General guidance regarding such techniques can be found in, e.g., Bancroft and Stevens (Theory and Practice of Histological Techniques , Churchill Livingstone, 1982) and Ausubel et al. (supra) . In one particular example, a diagnostic method may be targeted toward a determination of whether the Cdil gene of a mammal includes the N-terminal PEST domain- encoding sequence. Because this sequence is very likely to stabilize the Cdil protein, its deletion may result in altered cellular levels of Cdil polypeptide and therefore be indicative of a malignant or premalignant condition. PEST deletions may be identified either by standard nucleic acid or polypeptide analyses.
The Cdil polypeptide is also useful for identifying that compartment of a mammalian cell where important cell division control functions occur. Antibodies specific for Cdil may be produced as described above. The normal subcellular location of the protein is then determined either in situ or using fractionated cells by any standard immunological or immunohistochemical procedure (see, e.g., Ausubel et al., supra; Bancroft and Stevens, Theory and Practice of Histological Technigues. Churchill Livingstone, 1982) .
The methods of the instant invention may be used to reduce or diagnose the disorders described herein in any mammal, for example, humans, domestic pets, or livestock. Where a non-human mammal is treated, the Cdil polypeptide or the antibody employed is preferably specific for that species.
Other Embodiments
In other embodiments, the invention includes any protein which is substantially homologous to human Cdil (Fig. 6, SEQ ID NO: 1); such homologs include other substantially pure naturally occurring mammalian Cdil proteins as well as allelic variations; natural mutants; induced mutants; proteins encoded by DNA that hybridizes to the Cdil sequence of Fig. 6 under high stringency conditions or low stringency conditions (e.g., washing at 2X SSC at 40°C with a probe length of at least 40 nucleotides) ; and polypeptides or proteins specifically bound by antisera directed to a Cdil polypeptide, especially by antisera to the active site or to the Cdc2 binding domain of Cdil. The term also includes chimeric polypeptides that include a Cdil fragment. The invention further includes analogs of any naturally occurring Cdil polypeptide. Analogs can differ from the naturally occurring Cdil protein by amino acid sequence differences, by post-translational modifications, or by both. Analogs of the invention will generally exhibit at least 70%, more preferably 80%, even more preferably 90%, and most preferably 95% or even 99%, homology with all or part of a naturally occurring Cdil sequence. The length of comparison sequences will be at least 8 amino acid residues, preferably at least 24 amino acid residues, and more preferably more than 35 amino acid residues. Modifications include in vivo and in vitro chemical derivatization of polypeptides, e.g., acetylation, carboxylation, phosphorylation, or glycosylation; such modifications may occur during polypeptide synthesis or processing or following treatment with isolated modifying enzymes. Analogs can also differ from the naturally occurring Cdil polypeptide by alterations in primary sequence. These include genetic variants, both natural and induced (for example, resulting from random mutagenesis by irradiation or exposure to ethanemethylsulfate or by site-specific mutagenesis as described in Sambrook, Fritsch and Maniatis, Molecular Cloning: A Laboratory Manual (2d ed.), CSH Press, 1989, hereby incorporated by reference; or Ausubel et al., Current Protocols in Molecular Biology. John Wiley & Sons, 1989, hereby incorporated by reference) . Also included are cyclized peptides molecules and analogs which contain residues other than L-amino acids, e.g., D-amino acids or non-naturally occurring or synthetic amino acids, e.g., β or γ amino acids.
In addition to full-length polypeptides, the invention also includes Cdil polypeptide fragments. As used herein, the term "fragment", means at least 10 contiguous amino acids, preferably at least 30 contiguous amino acids, more preferably at least 50 contiguous amino acids, and most preferably at least 60 to 80 or more contiguous amino acids. Fragments of Cdil can be generated by methods known to those skilled in the art or may result from normal protein processing (e.g., removal of amino acids from the nascent polypeptide that are not required for biological activity or removal of amino acids by alternative mRNA splicing or alternative protein processing events) .
Preferable fragments or analogs according to the invention are those which exhibit biological activity (for example, the ability to interfere with mammalian cell division as assayed herein) . Preferably, a Cdil polypeptide, fragment, or analog exhibits at least 10%, more preferably 30%, and most preferably, 70% or more of the biological activity of a full length naturally occurring Cdil polypeptide.
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: Brent, Roger Gyuris, Jeno Golemis, Erica
(ii) TITLE OF INVENTION: Interaction Trap System for
Isolating Novel Proteins
(iii) NUMBER OF SEQUENCES: 33
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Fish & Richardson
(B) STREET: 225 Franklin Street
(C) CITY: Boston
(D) STATE: Massachusetts
(E) COUNTRY: U.S.A.
(F) ZIP: 02110-2804
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: 3.5" Diskette, 1.44 Mb
(B) COMPUTER: IBM PS/2 Model 50Z or 55SX
(C) OPERATING SYSTEM: MS-DOS (Version 5.0)
(D) SOFTWARE: WordPerfect (Version 5.1)
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: 07/969,038
(B) FILING DATE: 10/30/92
(C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Clark, Paul T.
(B) REGISTRATION NUMBER: 30,162
(C) REFERENCE/DOCKET NUMBER: 00786/143001
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (617) 542-5070
(B) TELEFAX: (617) 542-8906
(C) TELEX: 200154
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 804
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:
GGC ACT GGT CTC GAC GTG GGG CGG CCA GCG ATG GAG CCG CCC AGT TCA 48 Gly Thr Gly Leu Asp Val Gly Arg Pro Ala Met Glu Pro Pro Ser Ser 1 5 10 15
ATA CAA ACA AGT GAG TTT GAC TCA TCA GAT GAA GAG CCT ATT GAA GAT 96 lie Gin Thr Ser Glu Phe Asp Ser Ser Asp Glu Glu Pro lie Glu Asp 20 25 30
GAA CAG ACT CCA ATT CAT ATA TCA TGG CTA TCT TTG TCA CGA GTG AAT 144 Glu Gin Thr Pro lie His He Ser Trp Leu Ser Leu Ser Arg Val Asn 35 40 45
TGT TCT CAG TTT CTC GGT TTA TGT GCT CTT CCA GGT TGT AAA TTT AAA 192 Cys Ser Gin Phe Leu Gly Leu Cys Ala Leu Pro Gly Cys Lys Phe Lys 50 55 60
GAT GTT AGA AGA AAT GTC CAA AAA GAT ACA GAA GAA CTA AAG AGC TGT 240 Asp Val Arg Arg Asn Val Gin Lys Asp Thr Glu Glu Leu Lys Ser Cys 65 70 75 80
GGT ATA CAA GAC ATA TTT GTT TTC TGC ACC AGA GGG GAA CTG TCA AAA 288 Gly He Gin Asp He Phe Val Phe Cys Thr Arg Gly Glu Leu Ser Lys 85 90 95
TAT AGA GTC CCA AAC CTT CTG GAT CTC TAC CAG CAA TGT GGA ATT ATC 336 Tyr Arg Val Pro Asn Leu Leu Asp Leu Tyr Gin Gin Cys Gly He He 100 105 110
ACC CAT CAT CAT CCA ATC GCA GAT GGA GGG ACT CCT GAC ATA GCC AGC 384 Thr His His His Pro He Ala Asp Gly Gly Thr Pro Asp He Ala Ser 115 120 125
TGC TGT GAA ATA ATG GAA GAG CTT ACA ACC TGC CTT AAA AAT TAC CGA 432 Cys Cys Glu He Met Glu Glu Leu Thr Thr Cys Leu Lys Asn Tyr Arg 130 135 140
AAA ACC TTA ATA CAC TGC TAT GGA GGA CTT GGG AGA TCT TGT CTT GTA 480 Lys Thr Leu He His Cys Tyr Gly Gly Leu Gly Arg Ser Cys Leu Val 145 150 155 160
GCT GCT TGT CTC CTA CTA TAC CTG TCT GAC ACA ATA TCA CCA GAG CAA 528 Ala Ala Cys Leu Leu Leu Tyr Leu Ser Asp Thr He Ser Pro Glu Gin 165 170 175
GCC ATA GAC AGC CTG CGA GAC CTA AGA GGA TCC GGG GCA ATA CAG ACC 576 Ala He Asp Ser Leu Arg Asp Leu Arg Gly Ser Gly Ala He Gin Thr 180 185 190
ATC AAG CAA TAC AAT TAT CTT CAT GAG TTT CGG GAC AAA TTA GCT GCA 624 He Lys Gin Tyr Asn Tyr Leu His Glu Phe Arg Asp Lys Leu Ala Ala 195 200 205
CAT CTA TCA TCA AGA GAT TCA CAA TCA AGA TCT GTA TCA AGA 666
His Leu Ser Ser Arg Asp Ser Gin Ser Arg Ser Val Ser Arg 210 215 220
TAAAGGAATT CAAATAGCAT ATATATGACC ATGTCTGAAA TGTCAGTTCT CTAGCATAAT 726
TTGTATTGAA ATGAAACCAC CAGTGTTATC AACTTGAATG TAAATGTACA TGTGCAGATA 786 TTCCTAAAGT TTTATTGA 804
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 2: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5
(B) TYPE: amino acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:
Glu Phe Pro Gly He 1 5
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 42
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3: GATCCTGCTG TATATAAAAC CAGTGGTTAT ATGTACAGTA CG 42
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 4: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 42
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4: GACGACATAT ATTTTGGTCA CCAATATACA TGTCATGCCT AG 42
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 5: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9
(B) TYPE: amino acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:
Pro Pro Lys Lys Lys Arg Lys Val Ala 1 5
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 6:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 9
(B) TYPE: amino acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:
Tyr Pro Tyr Asp Val Pro Asp Tyr Ala 1 5
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 7: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 16
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7: AATTCGGCAC GAGGCG 16
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 8: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 12
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8: GCCGTGCTCC GC 12
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 9: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 73
(B) TYPE: amino acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9:
Met Glu Asp Tyr Thr Lys He Glu Lys He Gly Glu Gly Thr Tyr Gly 1 5 10 15
Val Val Tyr Lys Gly Arg Lys Lys Thr Thr Gly Gin Val Val Ala Met 20 25 30
Lys Lys He Arg Leu Glu Ser Glu Glu Glu Gly Val Pro Ser Thr Ala 35 40 45
He Arg Glu He Ser Leu Leu Lys Glu Leu Arg His Pro Asn He Val
50 55 60
Ser Leu Gin Asp Val Leu Met Gin Asp 65 70
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 10: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 73
(B) TYPE: amino acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10:
Met Glu Asn Phe Gin Lys Val Glu Lys He Gly Glu Gly Thr Tyr Gly 1 5 10 15
Val Val Tyr Lys Ala Arg Asn Lys Leu Thr Gly Glu Val Val Ala Leu 20 25 30
Lys Lys He Arg Leu Asp Thr Glu Thr Glu Gly Val Pro Ser Thr Ala 35 40 45
He Arg Glu He Ser Leu Leu Lys Glu Leu Asn His Pro Asn He Val 50 55 ' 60
Lys Leu Leu Asp Val He His Thr Glu 65 70
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 11: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 82
(B) TYPE: amino acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11:
Met Ser Gly Glu Leu Ala Asn Tyr Lys Arg Leu Glu Lys Val Gly Glu 1 5 10 15
Gly Thr Tyr Gly Val Val Tyr Lys Ala Leu Asp Leu Arg Pro Gly Gin 20 25 30
Gly Gin Arg Val Val Ala Leu Leu Lys Lys He Arg Leu Glu Ser Glu 35 40 45
Asp Glu Gly Val Pro Ser Thr Ala He Arg Glu He Ser Leu Leu Lys 50 55 60
Glu Leu Lys Asp Asp Asn He Val Arg Leu Tyr Asp He Val His Ser 65 70 75 80
Asp Ala
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 12: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 73
(B) TYPE: amino acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12:
Met Glu Asp Phe Glu Lys He Glu Lys He Gly Glu Gly Thr Tyr Gly 1 5 10 15
Val Val Tyr Lys Gly Arg Asn Arg Leu Thr Gly Gin He Val Ala Met 20 25 30
Lys Lys He Arg Leu Glu Ser Asp Asp Glu Gly Val Pro Ser Thr Ala 35 40 45
He Arg Glu He Ser Leu Leu Lys Glu Leu Lys His Glu Asn He Val 50 55 60
Cys Leu Glu Asp Val Leu Met Glu Glu 65 70
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 13: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 77
(B) TYPE: amino acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13:
Met Thr Thr He Leu Asp Asn Phe Gin Arg Ala Glu Lys He Gly Glu 1 5 10 15
Gly Thr Tyr Gly He Val Tyr Lys Ala Arg Ser Asn Ser Thr Gly Gin 20 25 30
Asp Val Ala Leu Lys Lys He Arg Glu Leu Gly Glu Thr Glu Gly Val 35 40 45
Pro Ser Thr Ala He Arg Glu He Ser Leu Leu Lys Asn Leu Lys His 50 55 60
Pro Asn Val Val Gin Leu Phe Asp Val Val He Ser Gly 65 70 75
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 14: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 86
(B) TYPE: amino acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14: Met Pro Lys Arg He Val Tyr Asn He Ser Ser Asp Phe Gin Leu Lys
1 5 10 15
Ser Leu Leu Gly Glu Gly Ala Tyr Gly Val Val Cys Ser Ala Thr His 20 25 30
Lys Pro Thr Gly Glu He Val Ala He Lys Lys He Glu Pro Phe Asp 35 40 45
Lys Pro Leu Phe Ala Leu Arg Thr Leu Arg Glu He Lys He Leu Lys 50 55 60
His Phe Lys His Glu Asn He He Thr He Phe Asn He Gin Arg Pro 65 70 75 80
Asp Ser Phe Glu Asn Phe 85
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 15: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 84
(B) TYPE: amino acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 15:
Ser Arg Leu Tyr Leu He Phe Glu Phe Leu Ser Met Asp Leu Lys Lys 1 5 10 15
Tyr Leu Asp Ser He Pro Pro Gly Gin Tyr Met Asp Ser Ser Leu Val 20 25 30
Lys Ser Tyr Leu Tyr Gin He Leu Gin Gly He Val Phe Cys His Ser 35 40 45
Arg Arg Val Leu His Arg Asp Leu Lys Pro Gin Asn Leu Leu He Asp 50 55 60
Asp Lys Gly Thr He Lys Leu Ala Asp Phe Gly Leu Ala Arg Ala Phe 65 70 75 80
Gly He Pro He
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 16: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 83
(B) TYPE: amino acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 16:
Asn Lys Leu Tyr Leu Val Phe Glu Phe Leu His Gin Asp Leu Lys Lys 1 5 10 15
Phe Met Asp Ala Ser Ala Leu Thr Gly He Pro Leu Pro Leu He Lys 20 25 30
Ser Tyr Leu Phe Gin Leu Leu Gin Gly Leu Ala Pro Cys His Ser His 35 40 45
Arg Val Leu His Arg Asp Leu Lys Pro Gin Asn Leu Leu He Asn Thr 50 55 60
Glu Gly Ala He Lys Leu Ala Asp Phe Gly Leu Ala Arg Ala Phe Gly 65 70 75 80
Val Pro Val
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 17: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 84
(B) TYPE: amino acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 17:
His Lys Leu Tyr Leu Val Phe Glu Phe Leu Asp Leu Asp Leu Lys Arg 1 5 10 15
Tyr Met Glu Gly He Pro Lys Asp Gin Pro Leu Gly Ala Asp He Val 20 25 30
Lys Lys Phe Met Met Gin Leu Cys Lys Gly He Ala Tyr Cys His Ser 35 40 45
His Arg He Leu His Arg Asp Leu Lys Pro Gin Asn Leu Leu He Asn 50 55 60
Lys Asp Gly Asn Leu Lys Leu Gly Asp Phe Gly Leu Ala Arg Ala Phe 65 70 75 80
Gly Val Pro Leu
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 18: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 84
(B) TYPE: amino acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 18 :
Asn Arg He Tyr Leu He Phe Glu Phe Leu Ser Met Asp Leu Lys Lys 1 5 10 15
Tyr Met Asp Ser Leu Pro Val Asp Lys His Met Glu Ser Glu Leu Val 20 25 30
Arg Ser Tyr Leu Tyr Gin He Thr Ser Ala He Leu Phe Cys His Arg 35 40 45
Arg Arg Val Leu His Arg Asp Leu Lys Pro Gin Asn Leu Leu He Asp 50 55 60
Lys Ser Gly Leu He Lys Val Ala Asp Phe Gly Leu Gly Arg Ser Phe 65 70 75 80
Gly He Pro Val
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 19: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 82
(B) TYPE: amino acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 19:
Asn Asn Leu Tyr Met He Phe Glu Tyr Leu Asn Met Asp Leu Lys Lys 1 5 10 15
Leu Met Asp Lys Lys Lys Asp Val Phe Thr Pro Gin Leu He Lys Ser 20 25 30
Tyr Met His Gin He Leu Asp Ala Val Gly Phe Cys His Thr Asn Arg 35 40 45
He Leu His Arg Asp Leu Lys Pro Gin Asn Leu Leu Val Asp Thr Ala 50 55 60
Gly Lys He Lys Leu Ala Asp Phe Gly Leu Ala Arg He Phe Asn Val 65 70 75 80
Pro Met
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 20: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 86
(B) TYPE: amino acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 20:
Asn Glu Val Tyr He He Gin Glu Leu Met Gin Thr Asp Leu His Arg 1 5 10 15
Val He Ser Thr Gin Met Leu Ser Asp Asp His He Gin Tyr Phe He 20 25 30
Tyr Gin Thr Leu Arg Ala Val Lys Val Leu Glu Gly Ser Asn Val He 35 40 45
His Arg Asp Leu Lys Pro Ser Asn Leu Leu He Asn Ser Asn Cys Asp 50 55 60
Leu Lys Val Cys Asp Phe Gly Leu Ala Arg He He Asp Glu Ser Ala 65 70 75 80
Ala Asp Asn Ser Glu Pro 85
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 21: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 83
(B) TYPE: amino acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 21:
Arg Val Tyr Thr His Glu Val Val Thr Leu Trp Tyr Arg Ser Pro Glu 1 5 10 15
Val Leu Leu Gly Ser Ala Arg Tyr Ser Thr Pro Val Asp He Trp Ser 20 25 30
He Gly Thr He Phe Ala Glu Leu Ala Thr Lys Lys Pro Leu Phe His 35 40 45
Gly Asp Ser Glu He Asp Gin Leu Phe Arg He Phe Arg Ala Leu Gly 50 55 60
Thr Pro Asn Asn Glu Val Trp Pro Glu Val Glu Ser Leu Gin Asp Tyr 65 70 75 80
Lys Asn Thr
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 22: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 83
(B) TYPE: amino acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 22:
Arg Thr Tyr Thr His Glu Val Val Thr Leu Trp Tyr Arg Ala Pro Glu 1 5 10 15
He Leu Leu Gly Cys Lys Tyr Tyr Ser Thr Ala Val Asp He Trp Ser 20 25 30
Leu Gly Cys He Phe Ala Glu Met Val Thr Arg Arg Ala Leu Phe Pro 35 40 45
Gly Asp Ser Glu He Asp Gin Leu Phe Arg He Phe Arg Thr Leu Gly 50 55 60
Thr Pro Asp Glu Val Val Trp Pro Gly Val Thr Ser Met Pro Asp Tyr 65 70 75 80
Lys Pro Ser
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 23: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 83
(B) TYPE: amino acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 23:
Arg Ala Tyr Thr His Glu He Val Thr Leu Trp Tyr Arg Ala Pro Glu 1 5 10 15
Val Leu Leu Gly Gly Lys Gin Tyr Ser Thr Gly Val Asp Thr Trp Ser 20 25 30
He Gly Cys He Phe Ala Glu Met Cys Asn Arg Lys Pro He Phe Ser 35 40 45
Gly Asp Ser Glu He Asp Gin Leu Phe Lys He Phe Arg Val Leu Gly 50 55 60
Thr Pro Asn Glu Ala He Trp Pro Asp He Val Tyr Leu Pro Asp Phe 65 70 75 80
Lys Pro Ser
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 24: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 83
(B) TYPE: amino acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 24:
Arg He Tyr Thr His Glu He Val Thr Leu Trp Tyr Arg Ala Pro Glu 1 5 10 15
Val Leu Leu Gly Ser Pro Arg Tyr Ser Cys Pro Val Asp He Trp Ser 20 25 30
He Gly Cys He Phe Ala Glu Met Ala Thr Arg Lys Pro Leu Phe Gin 35 40 45
Gly Asp Ser Glu He Asp Gin Leu Phe Lys He Phe Arg Val Leu Gly 50 55 60
Thr Pro Asn Glu Ala He Trp Pro Asp He Val Tyr Leu Pro Asp Phe 65 70 75 80
Lys Pro Ser
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 25: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 83
(B) TYPE: amino acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 25:
Arg Ala Tyr Thr His Glu Val Val Thr Leu Trp Tyr Arg Ala Pro Glu 1 5 10 15
He Leu Leu Gly Thr Lys Phe Tyr Ser Thr Gly Val Asp He Trp Ser 20 25 30
Leu Gly Cys He Phe Ser Glu Met He Met Arg Arg Ser Leu Phe Pro 35 40 45
Gly Asp Ser Glu He Asp Gin Leu Tyr Arg He Phe Arg Thr Leu Ser 50 55 60
Thr Pro Asp Glu Thr Asn Trp Pro Gly Val Thr Gin Leu Pro Asp Phe 65 70 75 80
Lys Thr Lys
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 26:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 90
(B) TYPE: amino acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 26:
Thr Gly Gin Gin Ser Gly Met Thr Glu Tyr Val Ala Thr Arg Trp Tyr 1 5 10 15
Arg Ala Pro Glu Val Met Leu Thr Ser Ala Lys Tyr Ser Arg Ala Met 20 25 30
Asp Val Trp Ser Cys Gly Cys He Leu Ala Glu Leu Phe Leu Arg Arg 35 40 45
Pro He Phe Pro Gly Arg Asp Tyr Arg His Gin Leu Leu Leu He Phe 50 55 60
Gly He He Gly Thr Pro His Ser Asp Asn Asp Leu Arg Cys He Glu 65 70 75 80
Ser Pro Arg Ala Arg Glu Tyr He Lys Ser 85 90
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 27: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 57
(B) TYPE: amino acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 27:
Phe Pro Lys Trp Lys Pro Gly Ser Leu Ala Ser His Val Lys Asn Leu 1 5 10 15
Asp Glu Asn Gly Leu Asp Leu Leu Ser Lys Met Leu He Tyr Asp Pro 20 25 30
Ala Lys Arg He Ser Gly Lys Met Ala Leu Asn His Pro Tyr Phe Asn 35 40 45
Asp Leu Asp Asn Gin He Lys Lys Met 50 55
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 28: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 59
(B) TYPE: amino acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 28:
Phe Pro Lys Trp Ala Arg Gin Asp Phe Ser Lys Val Val Pro Pro Leu 1 5 10 15
Asp Glu Asp Gly He Asp Leu Leu Asp Lys Leu Leu Ala Tyr Asp Pro 20 25 30 Asn Lys Arg He Ser Ala Lys Ala Ala Leu Ala His Pro Phe Thr Gin 35 40 45
Asp Val Thr Lys Pro Val Pro His Leu Arg Leu 50 55
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 29: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 57
(B) TYPE: amino acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 29:
Phe Pro Gin Trp Arg Arg Lys Asp Leu Ser Asn Gin Leu Lys Asn Leu 1 5 10 15
Asp Ala Asn Gly He Asp Leu He Gin Lys Met Leu He Tyr Asp Pro 20 25 30
Val His Arg He Ser Ala Lys Asp He Leu Glu His Pro Tyr Phe Asn 35 40 45
Gly Phe Gin Ser Gly Leu Val Arg Asn 50 55
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 30: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 57
(B) TYPE: amino acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 30:
Phe Pro Gin Trp Arg Arg Lys Asp Leu Ser Asn Gin Leu Lys Asn Leu 1 5 10 15
Asp Ala Asn Gly He Asp Leu He Gin Lys Met Leu He Tyr Asp Pro 20 25 30
Val His Arg He Ser Ala Lys Asp He Leu Glu His Pro Tyr Phe Asn 35 40 45
Gly Phe Gin Ser Gly Leu Val Arg Asn 50 55
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 31:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 72
(B) TYPE: amino acid
(C) STRANDEDNESS: (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 31:
Phe Pro Arg Trp Glu Gly Thr Asn Met Pro Gin Pro He Thr Glu His 1 5 10 15
Glu Ala His Glu Leu He Met Ser Met Leu Cys Tyr Asp Pro Asn Leu 20 25 30
Arg He Ser Ala Lys Asp Ala Leu Gin His Ala Tyr Phe Arg Asn Val 35 40 45
Gin His Val Asp His Val Ala Leu Pro Val Asp Pro Asn Ala Gly Ser 50 55 60
Ala Ser Arg Leu Thr Arg Leu Val 65 70
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 32: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 60
(B) TYPE: amino acid
(C) STRANDEDNESS:
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 32:
Leu Pro Met Tyr Pro Ala Ala Pro Leu Glu Lys Met Phe Pro Arg Val 1 5 10 15
Asn Pro Lys Gly He Asp Leu Leu Gin Arg Met Leu Val Phe Asp Pro 20 25 30
Ala Lys Arg He Thr Ala Lys Glu Ala Leu Glu His Pro Tyr Leu Gin 35 40 45
Thr Tyr His Asp Pro Asn Asp Glu Pro Glu Gly Glu 50 55 60
(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 33: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 345
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 33:
AAG CTT ATG GGT GCT CCT CCA AAA AAG AAG AGA AAG GTA GCT GGT ATC 48 Lys Leu Met Gly Ala Pro Pro Lys Lys Lys Arg Lys Val Ala Gly He 1 5 10 15 AAT AAA GAT ATC GAG GAG TGC AAT GCC ATC ATT GAG CAG TTT ATC GAC 96 Asn Lys Asp He Glu Glu Cys Asn Ala He He Glu Gin Phe He Asp 20 25 30
TAC CTG CGC ACC GGA CAG GAG ATG CCG ATG GAA ATG GCG GAT CAG GCG 144 Tyr Leu Arg Thr Gly Gin Glu Met Pro Met Glu Met Ala Asp Gin Ala 35 40 45
ATT AAC GTG GTG CCG GGC ATG ACG CCG AAA ACC ATT CTT CAC GCC GGG 192 He Asn Val Val Pro Gly Met Thr Pro Lys Thr He Leu His Ala Gly 50 55 60
CCG CCG ATC CAG CCT GAC TGG CTG AAA TCG AAT GGT TTT CAT GAA ATT 240 Pro Pro He Gin Pro Asp Trp Leu Lys Ser Asn Gly Phe His Glu He 65 70 75 80
GAA GCG GAT GTT AAC GAT ACC AGC CTC TTG CTG AGT GGA GAT GCC TCC 288 Glu Ala Asp Val Asn Asp Thr Ser Leu Leu Leu Ser Gly Asp Ala Ser 85 90 95
TAC CCT TAT GAT GTG CCA GAT TAT GCC TCT CCC GAA TTC GGC CGA CTC 336 Tyr Pro Tyr Asp Val Pro Asp Tyr Ala Ser Pro Glu Phe Gly Arg Leu 100 105 110
GAG AAG CTT ' 345
Glu Lys Leu 115

Claims

Claims
1. A method for determining whether a first protein is capable of physically interacting with a second protein, comprising:
(a) providing a host cell which contains (i) a reporter gene operably linked to a protein binding site;
(ii) a first fusion gene which expresses a first fusion protein, said first fusion protein comprising said first protein covalently bonded to a binding moiety which is capable of specifically binding to said protein binding site; and
(iii) a second fusion gene which expresses a second fusion protein, said second fusion protein comprising said second protein covalently bonded to a weak gene activating moiety; and
(b) measuring expression of said reporter gene as a measure of an interaction between said first and said second proteins.
2. The method of claim 1, further comprising isolating the gene encoding said second protein.
3. The method of claim 1, wherein said weak gene activating moiety is of lesser activation potential than GAL4 activation region II.
4. The method of claim 3, wherein said weak gene activating moiety is the B42 activation domain.
5. The method of claim 1, wherein said host cell is a yeast cell.
6. The method of claim 1, wherein said reporter gene comprises the LEU2 gene or the lacZ gene.
7. The method of claim 1, wherein said host cell further contains a second reporter gene operably linked to said protein binding site.
8. The method of claim 1, wherein said protein binding site is a LexA binding site and said binding moiety comprises a LexA DNA binding domain.
9. The method of claim 1, wherein said second protein is a protein involved in the control of eukaryotic cell division.
10. The method of claim 9, wherein said cell division control protein is encoded by a Cdc2 gene.
11. A substantially pure preparation of Cdil polypeptide.
12. The polypeptide of claim 11, comprising an amino acid sequence substantially identical to the amino acid sequence shown in Figure 6 (SEQ ID NO: 1) .
13. Purified DNA comprising a sequence encoding a polypeptide of claims 11 or 12.
14. The purified DNA of claim 13, wherein said DNA is cDNA.
15. The purified DNA of claim 11, wherein said DNA encodes a human Cdil polypeptide.
16. A vector comprising the purified DNA of claim 15.
17. A cell containing the purified DNA of claim 15.
18. A method of producing a recombinant Cdil polypeptide comprising, providing a cell transformed with DNA encoding a Cdil polypeptide positioned for expression in said cell; culturing said transformed cell under conditions for expressing said DNA; and isolating said recombinant Cdil polypeptide.
19. A purified antibody which binds specifically to a polypeptide of claims 11 or 12.
20. A method of detecting a malignant cell in a biological sample, said method comprising measuring Cdil gene expression in said sample, a change in Cdil expression relative to a wild-type sample being indicative of the presence of said malignant cell.
PCT/US1993/010069 1992-10-30 1993-10-20 Interaction trap system for isolating novel proteins WO1994010300A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
AT93900596T ATE256738T1 (en) 1992-10-30 1993-10-20 A NEW CELL CYCLE CONTROL PROTEIN
EP93900596A EP0672131B1 (en) 1992-10-30 1993-10-20 A novel cell cycle control protein
DE69333366T DE69333366T2 (en) 1992-10-30 1993-10-20 A NEW CELL CYCLE CONTROL PROTEIN
CA002148252A CA2148252C (en) 1992-10-30 1993-10-20 Interaction trap system for isolating novel proteins
JP51116194A JP3537141B2 (en) 1992-10-30 1993-10-20 Interaction-based capture system for separation of new proteins
HK98113234A HK1012027A1 (en) 1992-10-30 1998-12-11 A novel cell cycle control protein.

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US96903892A 1992-10-30 1992-10-30
US07/969,038 1992-10-30

Publications (1)

Publication Number Publication Date
WO1994010300A1 true WO1994010300A1 (en) 1994-05-11

Family

ID=25515091

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1993/010069 WO1994010300A1 (en) 1992-10-30 1993-10-20 Interaction trap system for isolating novel proteins

Country Status (8)

Country Link
US (2) US5580736A (en)
EP (2) EP1362913B1 (en)
JP (1) JP3537141B2 (en)
AT (2) ATE316573T1 (en)
CA (1) CA2148252C (en)
DE (2) DE69333366T2 (en)
HK (2) HK1012027A1 (en)
WO (1) WO1994010300A1 (en)

Cited By (172)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995033052A1 (en) * 1994-05-27 1995-12-07 Mitotix, Inc. Immunosuppressant target proteins
WO1996003501A1 (en) * 1994-07-22 1996-02-08 Ciba-Geigy Ag Dual hybrid system
EP0773952A1 (en) * 1994-07-20 1997-05-21 The General Hospital Corporation Interaction trap systems for detecting protein interactions
US5637463A (en) * 1995-05-04 1997-06-10 Hoffmann-La Roche Inc. Method to detect protein-protein interactions
WO1997023609A1 (en) * 1995-12-21 1997-07-03 Amersham International Plc Improvements relating to assay systems
WO1997044447A2 (en) * 1996-05-03 1997-11-27 President And Fellows Of Harvard College Transcriptional activation system, activators, and uses therefor
WO1998007845A1 (en) * 1996-08-23 1998-02-26 President And Fellows Of Harvard College Interaction trap assay, reagents and uses thereof
US5807708A (en) * 1996-07-30 1998-09-15 Millennium Pharmaceuticals, Inc. Conservin nucleic acid molecules and compositions
US5821048A (en) * 1995-06-07 1998-10-13 President And Fellows Of Harvard College Methods, kits, and compositions for diagnosing papillomavirus infection
US5925523A (en) * 1996-08-23 1999-07-20 President & Fellows Of Harvard College Intraction trap assay, reagents and uses thereof
US5955280A (en) * 1995-04-11 1999-09-21 The General Hospital Corporation Reverse two-hybrid system
US5968802A (en) * 1995-06-07 1999-10-19 Wang; Bruce Nuclear cyclophilin
EP1009858A1 (en) * 1997-06-16 2000-06-21 Diversa Corporation High throughput screening for novel enzymes
WO2001092488A2 (en) 2000-05-30 2001-12-06 Bayer Aktiengesellschaft Regulation of human plc delta-1
US6332897B1 (en) * 1998-03-27 2001-12-25 Glaxo Wellcome Inc. Assay methods
US6399296B1 (en) 1994-07-20 2002-06-04 The General Hospital Corporation Interaction trap systems for detecting protein interactions
WO2002070678A2 (en) 2001-02-05 2002-09-12 Bayer Aktiengesellschaft Regulation of human serine/threonine protein kinase
WO2003042362A2 (en) 2001-11-09 2003-05-22 Dana-Farber Cancer Institute, Inc. PGC-1β, A NOVEL PGC-1 HOMOLOGUE AND USES THEREFOR
US6733991B1 (en) 1998-05-08 2004-05-11 Osi Pharmaceuticals, Inc. AGS proteins and nucleic acid molecules and uses therefor
US6746852B1 (en) 1998-05-08 2004-06-08 Osi Pharmaceuticals, Inc. AGS proteins and nucleic acid molecules and uses thereof
EP1657252A2 (en) 1998-12-01 2006-05-17 Dana-Farber Cancer Institute, Inc. PGC-1, a novel brown fat PPAR gamma coactivator
WO2006057500A1 (en) 2004-11-24 2006-06-01 Seoul National University Industry Foundation Use of aimp2dx2 for the diagnosis and treatment of cancer
US7087418B2 (en) 2001-12-19 2006-08-08 Bristol-Myers Squibb Company Pichia pastoris formate dehydrogenase and uses therefor
WO2006089801A2 (en) 2005-02-25 2006-08-31 Forschungsverbund Berlin E.V. Method for the redox potential-dependent detection of target molecules by interactive peptides
WO2006113559A2 (en) 2005-04-15 2006-10-26 President And Fellows Of Harvard College Methods for modulating bone formation and mineralization by modulating krc activity
WO2007033187A2 (en) 2005-09-12 2007-03-22 The Regents Of The University Of Michigan Recurrent gene fusions in prostate cancer
US7256280B2 (en) 2000-11-07 2007-08-14 Pioneer Hi-Bred International, Inc. Cell cycle nucleic acids, polypeptides and uses thereof
EP1852507A1 (en) 1997-04-16 2007-11-07 Millennium Pharmaceuticals, Inc. CRSP protein (cysteine-rich secreted proteins), nucleic acid molecules encoding them and uses therefor
EP1892306A2 (en) 2003-10-06 2008-02-27 Bayer HealthCare AG Methods and kits for investigating cancer
EP1900827A2 (en) 2002-05-21 2008-03-19 Bayer HealthCare AG Methods and compositions for the prediction, diagnosis, prognosis, prevention and treatment of malignant neoplasia
WO2008051511A2 (en) 2006-10-20 2008-05-02 Applera Corporation Genetic polymorphisms associated with venous thrombosis, methods of detection and uses thereof
US7396905B1 (en) 1999-05-21 2008-07-08 Mckeon Frank Calcipressins: endogenous inhibitors of calcineurin, uses and reagents related thereto
EP1953244A1 (en) 2002-01-09 2008-08-06 Nakamura, Yusuke Cancer profiles
EP1958966A2 (en) 1994-07-01 2008-08-20 Dana-Farber Cancer Institute Methods for modulating T cell responses by manipulating a common cytokine receptor gamma chain
EP1961428A1 (en) 2002-04-02 2008-08-27 Ucb S.A. SC6 antibody for treatment of cancer
EP2003196A2 (en) 2003-06-09 2008-12-17 The Regents of the University of Michigan Compositions and methods for treating and diagnosing cancer
EP2003213A2 (en) 2001-08-02 2008-12-17 The Regents of the University of Michigan Expression profile of prostate cancer
WO2009009432A2 (en) 2007-07-06 2009-01-15 The Regents Of The University Of Michigan Recurrent gene fusions in prostate cancer
EP2051077A2 (en) 2003-10-07 2009-04-22 Millennium Pharmaceuticals, Inc. Nucleic acid molecules and proteins for the identification, assessment, prevention, and therapy of ovarian cancer
US7527962B2 (en) 2001-12-19 2009-05-05 Millenium Pharmaceuticals, Inc. Human diacylglycerol acyltransferase 2 (DGAT2) family members and uses therefor
WO2009061799A2 (en) 2007-11-05 2009-05-14 Celera Corporation Genetic polymorphisms associated with liver fibrosis, methods of detection and uses thereof
EP2080766A1 (en) 2001-06-06 2009-07-22 Bristol-Myers Squibb Company B7-related nucleic acids and polypeptides useful for immunomodulation
US7572886B2 (en) 2001-12-18 2009-08-11 Centre National De La Recherche Scientifique Death associated proteins, and THAP1 and PAR4 pathways in apoptosis control
EP2110667A1 (en) 2005-01-20 2009-10-21 University Of Rochester Thoredoxin interacting protein (TXNIP) as regulator of vascular function
EP2112229A2 (en) 2002-11-25 2009-10-28 Sequenom, Inc. Methods for identifying risk of breast cancer and treatments thereof
EP2113572A1 (en) 2005-03-11 2009-11-04 Celera Corporation Genetic polymorphisms associated with coronary heart disease, methods of detection and uses thereof
EP2123763A1 (en) 2001-05-31 2009-11-25 Performance Plants, Inc. Compositions and methods of increasing stress tolerance in plants
EP2128270A1 (en) 2003-08-08 2009-12-02 Genenews Inc. Osteoarthritis biomarkers and uses thereof
EP2130926A2 (en) 2004-06-09 2009-12-09 The Regents of the University of Michigan Phage microarray profiling of the humoral response to disease
EP2143796A2 (en) 2000-02-29 2010-01-13 Millennium Pharmaceuticals, Inc. 1983, 52881, 2398, 45449, 50289, and 52872, G protein-coupled receptors and uses therefor
EP2151507A1 (en) 2002-12-20 2010-02-10 Celera Corporation Genetic polymorphisms associated with myocardial infarction, methods of detection and uses thereof
WO2010040277A1 (en) 2008-10-09 2010-04-15 The University Of Hong Kong Cadherin-17 as diagnostic marker and therapeutic target for liver cancer
EP2186913A2 (en) 2003-11-26 2010-05-19 Celera Corporation Genetic polymorphisms associated with cardiovascular disorders and drug response, methods of detection and uses thereof
US7723055B2 (en) 2002-11-21 2010-05-25 University Of Massachusetts Diagnosing and treating hematopoietic cancers
US7745391B2 (en) 2001-09-14 2010-06-29 Compugen Ltd. Human thrombospondin polypeptide
WO2010081001A2 (en) 2009-01-09 2010-07-15 The Regents Of The University Of Michigan Recurrent gene fusions in cancer
WO2010080985A1 (en) 2009-01-08 2010-07-15 Dana-Farber Cancer Institute, Inc. Compositions and methods for induced brown fat differentiation
WO2010084408A2 (en) 2009-01-21 2010-07-29 Oxford Biotherapeutics Ltd. Pta089 protein
EP2236623A1 (en) 2006-06-05 2010-10-06 Cancer Care Ontario Assessment of risk for colorectal cancer
EP2243834A1 (en) 2007-03-05 2010-10-27 Cancer Care Ontario Assessment of risk for colorectal cancer
EP2258842A1 (en) 2001-04-16 2010-12-08 Wyeth Holdings Corporation Streptococcus pneumoniae open reading frames encoding polypeptide antigens and uses thereof
US7850961B2 (en) 2000-08-03 2010-12-14 The Regents Of The University Of Michigan Methods for targeting solid tumor stem cells in a solid tumor using a notch4 receptor antagonist
US7858297B2 (en) 2001-12-18 2010-12-28 Centre National De La Recherche Scientifique Cnrs Chemokine-binding protein and methods of use
EP2270208A2 (en) 2006-02-13 2011-01-05 Divergence, Inc. Plant chimeric binding polypeptides for universal molecular recognition
EP2301947A2 (en) 1999-02-26 2011-03-30 Millennium Pharmaceuticals, Inc. Secreted proteins and uses thereof
EP2305836A1 (en) 2002-08-20 2011-04-06 Millennium Pharmaceuticals, Inc. Compositions, kits and methods for identification, assessment, prevention and therapy of cervical cancer
WO2011054007A1 (en) 2009-11-02 2011-05-05 Oxford Biotherapeutics Ltd. Ror1 as therapeutic and diagnostic target
US7939263B2 (en) 2005-06-13 2011-05-10 The Regents Of The University Of Michigan Compositions and methods for treating and diagnosing cancer
EP2319526A1 (en) 2004-06-17 2011-05-11 Thrasos Therapeutics, Inc. Tdf-related compounds and analogs thereof
EP2319941A2 (en) 2005-10-21 2011-05-11 GeneNews Inc. Method and apparatus for correlating levels of biomarker products with disease
EP2322558A1 (en) 1999-06-30 2011-05-18 Millennium Pharmaceuticals, Inc. Antibodies directed against glycoprotein VI and uses thereof
EP2325317A1 (en) 2000-09-18 2011-05-25 Biogen Idec MA Inc. Receptor nucleic acids and polypeptides
WO2011063198A2 (en) 2009-11-20 2011-05-26 St. Jude Children's Research Hospital Methods and compositions for modulating the activity of the interleukin-35 receptor complex
WO2011088163A1 (en) 2010-01-14 2011-07-21 President And Fellows Of Harvard College Methods for modulating skeletal remodeling and patterning by modulating shn2 activity, shn3 activity, or shn2 and shn3 activity in combination
WO2011091134A2 (en) 2010-01-22 2011-07-28 Dana-Farber Cancer Institute, Inc. Compositions,kits, and methods for identification, assessment, prevention, and therapy of metabolic disorders
EP2360254A1 (en) 1999-08-23 2011-08-24 Dana-Farber Cancer Institute, Inc. Assays for screening anti-pd-1 antibodies and uses thereof
EP2368912A1 (en) 2006-01-05 2011-09-28 Immune Disease Institute, Inc. Regulators of NFAT
WO2011130340A1 (en) 2010-04-15 2011-10-20 St. Jude Children's Research Hospital Methods and compositions for the diagnosis and treatment of cancer resistant to anaplastic lymphoma kinase (alk) kinase inhibitors
WO2011133418A1 (en) 2010-04-19 2011-10-27 Celera Corporation Genetic polymorphisms associated with statin response and cardiovascular diseases, methods of detection and uses thereof
EP2388590A1 (en) 2001-04-02 2011-11-23 Dana Farber Cancer Institute PD-1, a receptor for B7-4, and uses thereof
EP2392659A2 (en) 2002-06-17 2011-12-07 Thrasos, Inc. Single domain TDF-related compounds and analogs thereof
WO2012010321A1 (en) 2010-07-23 2012-01-26 Erasmus University Medical Center Rotterdam Foetal haemoglobin inhibitor
EP2412826A2 (en) 2004-05-07 2012-02-01 Celera Corporation Genetic polymorphisms associated with liver fibrosis methods of detection and uses thereof
EP2441775A1 (en) 2007-02-26 2012-04-18 Oxford Biotherapeutics Ltd. Protein
WO2012051301A1 (en) 2010-10-12 2012-04-19 President And Fellows Of Harvard College Methods for identifying modulators of triglyceride metabolism, for modulating triglyceride metabolism and for identifying subjects at risk for abnormal triglyceride metabolism
EP2447719A1 (en) 2007-02-26 2012-05-02 Oxford Biotherapeutics Ltd. Proteins
WO2012061502A2 (en) 2010-11-02 2012-05-10 Celera Corporation Genetic polymorphisms associated with venous thrombosis and statin response, methods of detection and uses thereof
US8178579B2 (en) 2001-05-09 2012-05-15 President And Fellows Of Harvard College Dioxanes and uses thereof
EP2471953A1 (en) 2005-09-23 2012-07-04 Celera Corporation Genetic polymorphisms associated with cardiovascular disorders and drug response, methods of detection and uses thereof
US8222423B2 (en) 2006-02-14 2012-07-17 Dana-Farber Cancer Institute, Inc. Bifunctional histone deacetylase inhibitors
EP2497780A1 (en) 2005-09-20 2012-09-12 Thrasos Therapeutics, Inc. TDF-related compounds and analogs thereof
WO2012142233A1 (en) 2011-04-14 2012-10-18 St. Jude Children's Research Hospital Methods and compositions for detecting and modulating a novel mtor complex
US8304451B2 (en) 2006-05-03 2012-11-06 President And Fellows Of Harvard College Histone deacetylase and tubulin deacetylase inhibitors
EP2520669A2 (en) 2005-02-07 2012-11-07 GeneNews Inc. Mild osteoathritis biomarkers and uses thereof
WO2012160448A2 (en) 2011-05-25 2012-11-29 Innate Pharma, S.A. Anti-kir antibodies for the treatment of inflammatory disorders
US8324361B2 (en) 2005-10-31 2012-12-04 Oncomed Pharmaceuticals, Inc. Nucleic acid molecules encoding soluble frizzled (FZD) receptors
US8329945B2 (en) 1996-03-26 2012-12-11 President And Fellows Of Harvard College Histone deacetylases, and uses related thereto
WO2013001369A2 (en) 2011-06-28 2013-01-03 Oxford Biotherapeutics Ltd. Therapeutic and diagnostic target
WO2013039996A1 (en) 2011-09-13 2013-03-21 Dana-Farber Cancer Institute, Inc. Compositions and methods for brown fat induction and activity using fndc5
EP2572712A2 (en) 2007-06-01 2013-03-27 The Trustees Of Princeton University Treatment of viral infections by modulation of host cell metabolic pathways
WO2013043720A1 (en) 2011-09-20 2013-03-28 The University Of North Carolina At Chapel Hill Regulation of sodium channels by plunc proteins
US8435780B2 (en) 2000-03-03 2013-05-07 President And Fellows Of Harvard College Class II human histone deacetylases, and uses related thereto
US8440716B2 (en) 2008-07-23 2013-05-14 President And Fellows Of Harvard College Deacetylase inhibitors and uses thereof
US8507442B2 (en) 2008-09-26 2013-08-13 Oncomed Pharmaceuticals, Inc. Methods of use for an antibody against human frizzled receptors 1, 2. 5, 7 or 8
WO2013138463A1 (en) 2012-03-14 2013-09-19 University Of Central Florida Research Foundation, Inc. Neurofibromatoses therapeutic agents and screening for same
US8551789B2 (en) 2010-04-01 2013-10-08 OncoMed Pharmaceuticals Frizzled-binding agents and their use in screening for WNT inhibitors
US8586081B2 (en) 2007-09-20 2013-11-19 University Of Massachusetts Detoxified recombinant botulinum neurotoxin
WO2013185055A1 (en) 2012-06-07 2013-12-12 Beth Israel Deaconess Medical Center, Inc. Methods and compositions for the inhibition of pin1
WO2014020331A1 (en) 2012-08-01 2014-02-06 Oxford Biotherapeutics Ltd. Therapeutic and diagnostic target
US8652467B2 (en) 2005-10-14 2014-02-18 The Regents Of The University Of Michigan Dek protein compositions and methods of using the same
WO2014039983A1 (en) 2012-09-07 2014-03-13 The Trustees Of Dartmouth College Vista modulators for diagnosis and treatment of cancer
US8716344B2 (en) 2009-08-11 2014-05-06 President And Fellows Of Harvard College Class- and isoform-specific HDAC inhibitors and uses thereof
EP2728017A1 (en) 2007-11-19 2014-05-07 Celera Corporation Lung cancer markers and uses thereof
WO2014072832A2 (en) 2012-10-18 2014-05-15 Oslo Universitetstssykehus Hf Biomarkers for cervical cancer
EP2733222A1 (en) 2008-07-09 2014-05-21 Celera Corporation Genetic polymorphisms associated with cardiovascular diseases, methods of detection and uses thereof
US8815794B2 (en) 2008-08-28 2014-08-26 The Research Foundation For The State University Of New York Treatment of amyloidoses using myelin basic protein and fragments thereof
US8945556B2 (en) 2010-11-19 2015-02-03 The Regents Of The University Of Michigan RAF gene fusions
WO2015017529A2 (en) 2013-07-31 2015-02-05 Dana-Farber Cancer Institute, Inc. Compositions and methods for modulating thermogenesis using pth-related and egf-related molecules
US8962247B2 (en) 2008-09-16 2015-02-24 Sequenom, Inc. Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non invasive prenatal diagnoses
US8981061B2 (en) 2001-03-20 2015-03-17 Novo Nordisk A/S Receptor TREM (triggering receptor expressed on myeloid cells) and uses thereof
US9000127B2 (en) 2012-02-15 2015-04-07 Novo Nordisk A/S Antibodies that bind and block triggering receptor expressed on myeloid cells-1 (TREM-1)
US8999289B2 (en) 2005-03-22 2015-04-07 President And Fellows Of Harvard College Treatment of protein degradation disorders
US9157904B2 (en) 2010-01-12 2015-10-13 Oncomed Pharmaceuticals, Inc. Wnt antagonists and methods of treatment and screening
US9168300B2 (en) 2013-03-14 2015-10-27 Oncomed Pharmaceuticals, Inc. MET-binding agents and uses thereof
US9266959B2 (en) 2012-10-23 2016-02-23 Oncomed Pharmaceuticals, Inc. Methods of treating neuroendocrine tumors using frizzled-binding agents
US9273111B2 (en) 2004-11-29 2016-03-01 Universite De Lorraine Therapeutic TREM-1 peptides
EP2990051A1 (en) 2009-04-10 2016-03-02 Tufts Medical Center, Inc. Par-1 activation by metalloproteinase-1 (mmp-1)
US9303291B2 (en) 2007-07-06 2016-04-05 The Regents Of The University Of Michigan MIPOL1-ETV1 gene rearrangements
EP3009148A1 (en) 2007-07-02 2016-04-20 Oncomed Pharmaceuticals, Inc. Compositions and methods for treating and diagnosing cancer
US9359444B2 (en) 2013-02-04 2016-06-07 Oncomed Pharmaceuticals Inc. Methods and monitoring of treatment with a Wnt pathway inhibitor
EP3048175A1 (en) 2008-02-20 2016-07-27 Celera Corporation Genetic polymorphism associated with stroke, therapy based on the detection of the polymorphism and use of kits containing reagents for detecting the polymorphism
WO2016144917A1 (en) 2015-03-10 2016-09-15 University Of Massachusetts Targeting gdf6 and bmp signaling for anti-melanoma therapy
US9550830B2 (en) 2012-02-15 2017-01-24 Novo Nordisk A/S Antibodies that bind and block triggering receptor expressed on myeloid cells-1 (TREM-1)
US9605313B2 (en) 2012-03-02 2017-03-28 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
EP3153862A1 (en) 2008-11-11 2017-04-12 The Regents of the University of Michigan Anti-cxcr1 compositions and methods
EP3153521A1 (en) 2010-03-26 2017-04-12 Trustees of Dartmouth College Vista regulatory t cell mediator protein, vista binding agents and use thereof
WO2017075329A2 (en) 2015-10-29 2017-05-04 Dana-Farber Cancer Institute, Inc. Methods for identification, assessment, prevention, and treatment of metabolic disorders using pm20d1 and n-lipidated amino acids
EP3168232A1 (en) 2009-11-13 2017-05-17 Dana-Farber Cancer Institute, Inc. Compositions, kits, and methods for the diagnosis, prognosis, monitoring, treatment and modulation of post-transplant lymphoproliferative disorders and hypoxia associated angiogenesis disorders using galectin-1
US9658231B2 (en) 2010-03-17 2017-05-23 The Regents Of The University Of Michigan Using phage epitopes to profile the immune response
US9663568B2 (en) 2012-02-15 2017-05-30 Novo Nordisk A/S Antibodies that bind peptidoglycan recognition protein 1
WO2017162659A1 (en) 2016-03-24 2017-09-28 Bayer Pharma Aktiengesellschaft Intracellular hepsin as therapeutic target for the treatment of cancer with centrosome amplification
US9850311B2 (en) 2005-10-31 2017-12-26 Oncomed Pharmaceuticals, Inc. Compositions and methods for diagnosing and treating cancer
EP3293275A1 (en) 2013-06-06 2018-03-14 Dana-Farber Cancer Institute, Inc. Compositions and methods for identification, assessment prevention, and treatment of cancer using pd-l1 isoforms
US9920361B2 (en) 2012-05-21 2018-03-20 Sequenom, Inc. Methods and compositions for analyzing nucleic acid
US9926593B2 (en) 2009-12-22 2018-03-27 Sequenom, Inc. Processes and kits for identifying aneuploidy
US9926602B2 (en) 2009-09-17 2018-03-27 The Regents Of The University Of Michigan Recurrent gene fusions in prostate cancer
US9944713B2 (en) 2004-11-24 2018-04-17 Medicinal Bioconvergence Research Center Antibody specific to the AIMP2-DX2
US9957506B2 (en) 2013-09-25 2018-05-01 Cornell University Compounds for inducing anti-tumor immunity and methods thereof
US9956236B2 (en) 2011-02-07 2018-05-01 Cornell University Methods for increasing immune responses using agents that directly bind to and activate IRE-1
US9957569B2 (en) 2005-09-12 2018-05-01 The Regents Of The University Of Michigan Recurrent gene fusions in prostate cancer
US9968579B2 (en) 2014-07-17 2018-05-15 Beth Isreal Deaconess Medical Center, Inc. ATRA for modulating Pin1 activity and stability
EP3421486A1 (en) 2012-06-22 2019-01-02 The Trustees Of Dartmouth College Novel vista-ig constructs and the use of vista-ig for treatment of autoimmune, allergic and inflammatory disorders
US10179814B2 (en) 2014-07-17 2019-01-15 Novo Nordisk A/S Site directed mutagenesis of TREM-1 antibodies for decreasing viscosity
US10351914B2 (en) 2014-07-17 2019-07-16 Beth Israel Deaconess Medical Center, Inc. Biomarkers for Pin1-associated disorders
US10370455B2 (en) 2014-12-05 2019-08-06 Immunext, Inc. Identification of VSIG8 as the putative VISTA receptor (V-R) and use thereof to produce VISTA/VSIG8 agonists and antagonists
US10548864B2 (en) 2015-03-12 2020-02-04 Beth Israel Deaconess Medical Center, Inc. Enhanced ATRA-related compounds for the treatment of proliferative diseases, autoimmune diseases, and addiction conditions
US10738358B2 (en) 2008-09-16 2020-08-11 Sequenom, Inc. Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses
US10745467B2 (en) 2010-03-26 2020-08-18 The Trustees Of Dartmouth College VISTA-Ig for treatment of autoimmune, allergic and inflammatory disorders
EP3736293A1 (en) 2013-02-12 2020-11-11 Boehringer Ingelheim International Gmbh Therapeutic and diagnostic target for cancer comprising dll3 binding reagents
US10899836B2 (en) 2016-02-12 2021-01-26 Janssen Pharmaceutica Nv Method of identifying anti-VISTA antibodies
US10933115B2 (en) 2012-06-22 2021-03-02 The Trustees Of Dartmouth College VISTA antagonist and methods of use
US11009509B2 (en) 2015-06-24 2021-05-18 Janssen Pharmaceutica Nv Anti-VISTA antibodies and fragments
US11014987B2 (en) 2013-12-24 2021-05-25 Janssen Pharmaceutics Nv Anti-vista antibodies and fragments, uses thereof, and methods of identifying same
US11060145B2 (en) 2013-03-13 2021-07-13 Sequenom, Inc. Methods and compositions for identifying presence or absence of hypermethylation or hypomethylation locus
US11123426B2 (en) 2014-06-11 2021-09-21 The Trustees Of Dartmouth College Use of vista agonists and antagonists to suppress or enhance humoral immunity
US11155618B2 (en) 2018-04-02 2021-10-26 Bristol-Myers Squibb Company Anti-TREM-1 antibodies and uses thereof
US11180557B2 (en) 2012-06-22 2021-11-23 King's College London Vista modulators for diagnosis and treatment of cancer
US11242392B2 (en) 2013-12-24 2022-02-08 Janssen Pharmaceutica Nv Anti-vista antibodies and fragments
US11332791B2 (en) 2012-07-13 2022-05-17 Sequenom, Inc. Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses
US11365447B2 (en) 2014-03-13 2022-06-21 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US11525000B2 (en) 2016-04-15 2022-12-13 Immunext, Inc. Anti-human VISTA antibodies and use thereof
US12006550B2 (en) 2020-10-12 2024-06-11 University Of South Carolina Targeting treatment for ADAM30 in pathological cells

Families Citing this family (38)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6864060B1 (en) 1993-03-31 2005-03-08 Cadus Technologies, Inc. Yeast cells expressing modified G proteins and methods of use therefor
US5789184A (en) * 1993-03-31 1998-08-04 Cadus Pharmaceutical Corporation Yeast cells engineered to produce pheromone system protein surrogates, and uses therefor
US5876951A (en) * 1993-03-31 1999-03-02 Cadus Pharmaceutical Corporation Yeast cells engineered to produce pheromone system protein surrogates and uses therefor
US7235648B1 (en) 1993-03-31 2007-06-26 Cadus Technologies, Inc. Yeast cells engineered to produce pheromone system protein surrogates, and uses therefor
US7416881B1 (en) 1993-03-31 2008-08-26 Cadus Technologies, Inc. Yeast cells engineered to produce pheromone system protein surrogates, and uses therefor
US6255059B1 (en) 1993-03-31 2001-07-03 Cadus Pharmaceutical Corporation Methods for identifying G protein coupled receptor effectors
US20030054402A1 (en) * 1993-03-31 2003-03-20 Cadus Pharmaceutical Corporation Methods and compositions for identifying receptor effectors
US6100042A (en) * 1993-03-31 2000-08-08 Cadus Pharmaceutical Corporation Yeast cells engineered to produce pheromone system protein surrogates, and uses therefor
US5989808A (en) * 1994-06-14 1999-11-23 American Cyanamid Company Identification of compounds affecting specific interaction of peptide binding pairs
US5695941A (en) * 1994-06-22 1997-12-09 The General Hospital Corporation Interaction trap systems for analysis of protein networks
US6083693A (en) 1996-06-14 2000-07-04 Curagen Corporation Identification and comparison of protein-protein interactions that occur in populations
DE69731960T2 (en) * 1996-09-24 2005-12-15 Cadus Pharmaceutical Corp. METHOD AND COMPOSITIONS FOR IDENTIFYING RECEPTOR EFFECTORS
US6048693A (en) * 1996-10-16 2000-04-11 Bittech, Inc. Phenotypic assays of cyclin/cyclin-dependent kinase function
AU4903897A (en) * 1996-10-16 1998-05-11 Bittech, Inc. Phenotypic assays of cyclin/cyclin-dependent kinase function
US20020137890A1 (en) * 1997-03-31 2002-09-26 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
US5885779A (en) * 1997-09-09 1999-03-23 University Of British Columbia Repressed trans-activator system for characterization of protein-protein interactions
US6344554B1 (en) 1997-10-02 2002-02-05 Regents Of The University Of California Polynucleotide sequences from Candida albicans encoding polypeptides associated with filamentous growth
US6355473B1 (en) 1998-05-06 2002-03-12 Cadus Pharmaceutical Corp. Yeast cells having mutations in stp22 and uses therefor
CA2256121A1 (en) * 1998-06-08 1999-12-08 Hong Wang Cyclin-dependent kinase inhibitors as plant growth regulators
US7273747B2 (en) * 1998-08-27 2007-09-25 Cadus Technologies, Inc. Cell having amplified signal transduction pathway responses and uses therefor
US6251605B1 (en) 1998-10-27 2001-06-26 Cadus Pharmaceutical Corporation Yeast cells having mutations in Cav1 and uses therefor
WO2000031261A2 (en) * 1998-11-25 2000-06-02 Cadus Pharmaceutical Corporation Methods and compositions for identifying effectors of the formyl peptide receptor like-1 (fprl-1) receptor
US6504008B1 (en) 1999-02-01 2003-01-07 Cadus Technologies, Inc. Cell based signal generation
CA2362414A1 (en) 1999-03-12 2000-09-14 Gpc Biotech, Inc. Methods and reagents for identifying synthetic genetic elements
US6555325B1 (en) 1999-06-14 2003-04-29 Cadus Technologies, Inc. System for detection of a functional interaction between a compound and a cellular signal transduction component
US7223533B2 (en) 1999-09-10 2007-05-29 Cadus Technologies, Inc. Cell surface proteins and use thereof as indicators of activation of cellular signal transduction pathways
US20020061512A1 (en) * 2000-02-18 2002-05-23 Kim Jin-Soo Zinc finger domains and methods of identifying same
AU2001263155A1 (en) * 2000-05-16 2001-11-26 Massachusetts Institute Of Technology Methods and compositions for interaction trap assays
US7029847B2 (en) * 2000-05-16 2006-04-18 Massachusetts Institute Of Technology Methods and compositions for interaction trap assays
WO2002046434A2 (en) * 2000-12-08 2002-06-13 Alexion Pharmaceuticals, Inc. Plasmid vectors
EP1370678A4 (en) * 2001-03-02 2005-09-07 Mds Proteomics Inc Methods and reagents for regulating apoptosis
ATE421091T1 (en) 2001-07-16 2009-01-15 Caprotec Bioanalytics Gmbh CAUGHT COMPOUNDS, THEIR COLLECTION AND METHODS FOR ANALYZING THE PROTEOME AND COMPLEX COMPOSITIONS
CA2457095A1 (en) * 2001-08-17 2003-02-27 Toolgen, Inc. Zinc finger domain libraries
US20020094519A1 (en) * 2002-03-07 2002-07-18 Agencourt Bioscience Corporation Detection of protein interactions
ATE421088T1 (en) * 2002-03-11 2009-01-15 Caprotec Bioanalytics Gmbh COMPOUNDS AND METHODS FOR ANALYZING THE PROTEOME
US20040116658A1 (en) * 2002-03-22 2004-06-17 Ken-Shwo Dai Human KAP/Cdi1-related gene variant associated with small cell lung cancer
EP2259068B1 (en) * 2003-01-16 2013-08-14 caprotec bioanalytics GmbH Capture compounds and methods for analyzing the proteome
CN115066434A (en) 2019-12-03 2022-09-16 阿拉玛生物科学公司 Nucleic acid linked immuno-sandwich assays (NULISA)

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5283173A (en) * 1990-01-24 1994-02-01 The Research Foundation Of State University Of New York System to detect protein-protein interactions

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
Cell, Volume 51, issued 09 October 1987, J. MA et al., "A New Class of Yeast Transcriptional Activators", pages 113-119, entire document. *
Cell, Volume 70, issued 24 July 1992, S.L. BERGER et al., "Genetic Isolation of ADA2: A Potential Transcriptional Adaptor Required for Function of Certain Acidic Activation Domains", pages 251-265, entire document. *
Journal of NIH Research, Volume 3, No. 12, issued December 1991, NANCY TOUCHETTE, "New Approach Detects Protein Interactions In Vivo", pages 44-46, entire document. *
Nature, Volume 334, issued 25 August 1988, G. GILL et al., "Negative Effect of the Transcriptional Activator GAL4", pages 721-724, entire document. *
Nature, Volume 340, issued July 1989, S. FIELDS et al., "A Novel Genetic System to Detect Protein-Protein Interactions", pages 245-246, entire document. *
Proceedings of the National Academy of Science, Volume 88, issued November 1991, C. CHIEN et al., "The Two-Hybrid System: A Method to Identify and Clone Genes for Proteins that Interact with a Protein of Interest", pages 9578-9582, entire document. *
Proceedings of the National Academy of Science, Volume 89, issued September 1992, E.R. FEARON et al., "Karyoplasmic Interaction Selection Strategy: A General Strategy to Detect Protein-Protein Interactions in Mammalian Cells", pages 7958-7962, entire document. *
Trends in Biochemical Science, Volume 15, issued 1990, G. DRAETTA, "Cell Cycle Control in Eukaryotes: Molecular Mechanisms of Cdc2 Activation", pages 378-383, entire document. *

Cited By (310)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1514931A1 (en) * 1994-05-27 2005-03-16 Ariad Gene Therapeutics, Inc. Immunosuppressant target proteins
US6464974B1 (en) 1994-05-27 2002-10-15 Ariad Pharmaceuticals Immunosuppressant target proteins
US6509152B1 (en) 1994-05-27 2003-01-21 Ariad Gene Therapeutics, Inc. Immunosuppressant target proteins
US6150137A (en) * 1994-05-27 2000-11-21 Ariad Pharmaceuticals, Inc. Immunosuppressant target proteins
US6127521A (en) * 1994-05-27 2000-10-03 Ariad Pharmaceuticals, Inc. Immunosuppressant target proteins
WO1995033052A1 (en) * 1994-05-27 1995-12-07 Mitotix, Inc. Immunosuppressant target proteins
EP1958966A2 (en) 1994-07-01 2008-08-20 Dana-Farber Cancer Institute Methods for modulating T cell responses by manipulating a common cytokine receptor gamma chain
US6242183B1 (en) 1994-07-20 2001-06-05 The General Hospital Corporation Interaction trap systems for detecting protein interactions
US6399296B1 (en) 1994-07-20 2002-06-04 The General Hospital Corporation Interaction trap systems for detecting protein interactions
EP1405911A1 (en) * 1994-07-20 2004-04-07 The General Hospital Corporation Interaction trap systems for detecting protein interactions
EP0773952A1 (en) * 1994-07-20 1997-05-21 The General Hospital Corporation Interaction trap systems for detecting protein interactions
EP0773952A4 (en) * 1994-07-20 2000-01-19 Gen Hospital Corp Interaction trap systems for detecting protein interactions
WO1996003501A1 (en) * 1994-07-22 1996-02-08 Ciba-Geigy Ag Dual hybrid system
US7601533B2 (en) 1995-04-11 2009-10-13 The General Hospital Corporation Reverse two-hybrid systems
US5965368A (en) * 1995-04-11 1999-10-12 The General Hospital Corporation Reverse two-hybrid systems
US5955280A (en) * 1995-04-11 1999-09-21 The General Hospital Corporation Reverse two-hybrid system
US7033768B2 (en) 1995-04-11 2006-04-25 The General Hospital Corporation Reverse two-hybrid systems
US5637463A (en) * 1995-05-04 1997-06-10 Hoffmann-La Roche Inc. Method to detect protein-protein interactions
US5968802A (en) * 1995-06-07 1999-10-19 Wang; Bruce Nuclear cyclophilin
US5821048A (en) * 1995-06-07 1998-10-13 President And Fellows Of Harvard College Methods, kits, and compositions for diagnosing papillomavirus infection
EP0790304A1 (en) * 1995-12-21 1997-08-20 AMERSHAM INTERNATIONAL plc Improvements relating to assay systems
US6074829A (en) * 1995-12-21 2000-06-13 Amersham International Plc Relating to assay systems
WO1997023609A1 (en) * 1995-12-21 1997-07-03 Amersham International Plc Improvements relating to assay systems
US8362084B2 (en) 1996-03-26 2013-01-29 President And Fellows Of Harvard College Histone deacetylases, and uses related thereto
US8426592B2 (en) 1996-03-26 2013-04-23 President And Fellows Of Harvard College Histone deacetylases, and uses related thereto
US8329945B2 (en) 1996-03-26 2012-12-11 President And Fellows Of Harvard College Histone deacetylases, and uses related thereto
US8329946B2 (en) 1996-03-26 2012-12-11 President And Fellows Of Harvard College Histone deacetylases, and uses related thereto
US8399233B2 (en) 1996-03-26 2013-03-19 President And Fellows Of Harvard College Histone deacetylases, and uses related thereto
WO1997044447A3 (en) * 1996-05-03 1998-03-26 Harvard College Transcriptional activation system, activators, and uses therefor
WO1997044447A2 (en) * 1996-05-03 1997-11-27 President And Fellows Of Harvard College Transcriptional activation system, activators, and uses therefor
US6031076A (en) * 1996-07-30 2000-02-29 Millenium Pharmaceuticals, Inc. Conservin compositions
US5807708A (en) * 1996-07-30 1998-09-15 Millennium Pharmaceuticals, Inc. Conservin nucleic acid molecules and compositions
US5925523A (en) * 1996-08-23 1999-07-20 President & Fellows Of Harvard College Intraction trap assay, reagents and uses thereof
WO1998007845A1 (en) * 1996-08-23 1998-02-26 President And Fellows Of Harvard College Interaction trap assay, reagents and uses thereof
US6200759B1 (en) 1996-08-23 2001-03-13 President And Fellows Of Harvard College Interaction trap assay, reagents and uses thereof
EP2298899A2 (en) 1997-04-16 2011-03-23 Millennium Pharmaceuticals, Inc. CRSP proteins (cysteine-rich secreted proteins), nucleic acid molecules encoding them and uses therefor
EP1852507A1 (en) 1997-04-16 2007-11-07 Millennium Pharmaceuticals, Inc. CRSP protein (cysteine-rich secreted proteins), nucleic acid molecules encoding them and uses therefor
EP1009858A4 (en) * 1997-06-16 2001-03-07 Diversa Corp High throughput screening for novel enzymes
EP1009858A1 (en) * 1997-06-16 2000-06-21 Diversa Corporation High throughput screening for novel enzymes
US6332897B1 (en) * 1998-03-27 2001-12-25 Glaxo Wellcome Inc. Assay methods
US6746852B1 (en) 1998-05-08 2004-06-08 Osi Pharmaceuticals, Inc. AGS proteins and nucleic acid molecules and uses thereof
US7144711B2 (en) 1998-05-08 2006-12-05 Osi Pharmaceuticals, Inc. AGS proteins and nucleic acid molecules and uses therefor
US6733991B1 (en) 1998-05-08 2004-05-11 Osi Pharmaceuticals, Inc. AGS proteins and nucleic acid molecules and uses therefor
EP1657252A2 (en) 1998-12-01 2006-05-17 Dana-Farber Cancer Institute, Inc. PGC-1, a novel brown fat PPAR gamma coactivator
EP2301947A2 (en) 1999-02-26 2011-03-30 Millennium Pharmaceuticals, Inc. Secreted proteins and uses thereof
US7396905B1 (en) 1999-05-21 2008-07-08 Mckeon Frank Calcipressins: endogenous inhibitors of calcineurin, uses and reagents related thereto
EP2902414A1 (en) 1999-06-30 2015-08-05 Millennium Pharmaceuticals, Inc. Antibodies directed against glycoprotein VI and uses thereof
EP2322558A1 (en) 1999-06-30 2011-05-18 Millennium Pharmaceuticals, Inc. Antibodies directed against glycoprotein VI and uses thereof
EP2360254A1 (en) 1999-08-23 2011-08-24 Dana-Farber Cancer Institute, Inc. Assays for screening anti-pd-1 antibodies and uses thereof
EP2143796A2 (en) 2000-02-29 2010-01-13 Millennium Pharmaceuticals, Inc. 1983, 52881, 2398, 45449, 50289, and 52872, G protein-coupled receptors and uses therefor
US8895284B2 (en) 2000-03-03 2014-11-25 President And Fellows Of Harvard College Class II human histone deacetylases, and uses related thereto
US8435780B2 (en) 2000-03-03 2013-05-07 President And Fellows Of Harvard College Class II human histone deacetylases, and uses related thereto
WO2001092488A2 (en) 2000-05-30 2001-12-06 Bayer Aktiengesellschaft Regulation of human plc delta-1
US9492538B2 (en) 2000-08-03 2016-11-15 The Regents Of The University Of Michigan Isolation and use of solid tumor stem cells
US7850961B2 (en) 2000-08-03 2010-12-14 The Regents Of The University Of Michigan Methods for targeting solid tumor stem cells in a solid tumor using a notch4 receptor antagonist
US9089556B2 (en) 2000-08-03 2015-07-28 The Regents Of The University Of Michigan Method for treating cancer using an antibody that inhibits notch4 signaling
US10227567B2 (en) 2000-08-03 2019-03-12 The Regents Of The University Of Michigan Isolation and use of solid tumor stem cells
EP2325317A1 (en) 2000-09-18 2011-05-25 Biogen Idec MA Inc. Receptor nucleic acids and polypeptides
US7256280B2 (en) 2000-11-07 2007-08-14 Pioneer Hi-Bred International, Inc. Cell cycle nucleic acids, polypeptides and uses thereof
WO2002070678A2 (en) 2001-02-05 2002-09-12 Bayer Aktiengesellschaft Regulation of human serine/threonine protein kinase
US8981061B2 (en) 2001-03-20 2015-03-17 Novo Nordisk A/S Receptor TREM (triggering receptor expressed on myeloid cells) and uses thereof
EP2388590A1 (en) 2001-04-02 2011-11-23 Dana Farber Cancer Institute PD-1, a receptor for B7-4, and uses thereof
EP2261241A1 (en) 2001-04-16 2010-12-15 Wyeth Holdings Corporation Streptococcus pneumoniae open reading frames encoding polypeptide antigens and uses thereof
EP2258842A1 (en) 2001-04-16 2010-12-08 Wyeth Holdings Corporation Streptococcus pneumoniae open reading frames encoding polypeptide antigens and uses thereof
EP2277897A1 (en) 2001-04-16 2011-01-26 Wyeth Holdings Corporation Streptococcus pneumoniae open reading frames encoding polypeptide antigens and uses thereof
EP2278013A1 (en) 2001-04-16 2011-01-26 Wyeth Holdings Corporation Streptococcus pneumoniae open reading frames encoding polypeptide antigens and uses thereof
EP2258718A1 (en) 2001-04-16 2010-12-08 Wyeth Holdings Corporation Streptococcus pneumoniae open reading frames encoding polypeptide antigens and uses thereof
US8178579B2 (en) 2001-05-09 2012-05-15 President And Fellows Of Harvard College Dioxanes and uses thereof
EP2123763A1 (en) 2001-05-31 2009-11-25 Performance Plants, Inc. Compositions and methods of increasing stress tolerance in plants
EP2080766A1 (en) 2001-06-06 2009-07-22 Bristol-Myers Squibb Company B7-related nucleic acids and polypeptides useful for immunomodulation
EP2003213A2 (en) 2001-08-02 2008-12-17 The Regents of the University of Michigan Expression profile of prostate cancer
US7745391B2 (en) 2001-09-14 2010-06-29 Compugen Ltd. Human thrombospondin polypeptide
WO2003042362A2 (en) 2001-11-09 2003-05-22 Dana-Farber Cancer Institute, Inc. PGC-1β, A NOVEL PGC-1 HOMOLOGUE AND USES THEREFOR
US7892727B2 (en) 2001-12-18 2011-02-22 Centre National De La Recherche Scientifique Cnrs Chemokine-binding protein and methods of use
US7572886B2 (en) 2001-12-18 2009-08-11 Centre National De La Recherche Scientifique Death associated proteins, and THAP1 and PAR4 pathways in apoptosis control
US7858297B2 (en) 2001-12-18 2010-12-28 Centre National De La Recherche Scientifique Cnrs Chemokine-binding protein and methods of use
US7527962B2 (en) 2001-12-19 2009-05-05 Millenium Pharmaceuticals, Inc. Human diacylglycerol acyltransferase 2 (DGAT2) family members and uses therefor
EP2436393A1 (en) 2001-12-19 2012-04-04 Millennium Pharmaceuticals, Inc. Human diacylglycerol acyltransferase 2 (DGAT2) family members and uses therefor
US7087418B2 (en) 2001-12-19 2006-08-08 Bristol-Myers Squibb Company Pichia pastoris formate dehydrogenase and uses therefor
US7910346B2 (en) 2001-12-19 2011-03-22 Millennium Pharmaceuticals, Inc. Human diacylglycerol acyltransferase 2 (DGAT2) family members and uses therefor
US8334111B2 (en) 2001-12-19 2012-12-18 Millennium Pharmaceuticals, Inc. Human diacylglycerol acyltransferase 2 (DGAT2) family members and uses therefor
EP1953244A1 (en) 2002-01-09 2008-08-06 Nakamura, Yusuke Cancer profiles
EP1961428A1 (en) 2002-04-02 2008-08-27 Ucb S.A. SC6 antibody for treatment of cancer
EP1900827A2 (en) 2002-05-21 2008-03-19 Bayer HealthCare AG Methods and compositions for the prediction, diagnosis, prognosis, prevention and treatment of malignant neoplasia
EP2392659A2 (en) 2002-06-17 2011-12-07 Thrasos, Inc. Single domain TDF-related compounds and analogs thereof
EP2801616A1 (en) 2002-06-17 2014-11-12 Thrasos Innovation, Inc. Single domain TDF-related compounds and analogs thereof
EP2311978A1 (en) 2002-08-20 2011-04-20 Millennium Pharmaceuticals, Inc. Compositions, kits, and methods for identification, assessment, prevention, and therapy of cervical cancer
EP2314716A1 (en) 2002-08-20 2011-04-27 Millennium Pharmaceuticals, Inc. Compositions, kits, and methods for identification, assessment, prevention, and therapy of cervical cancer
EP2311979A1 (en) 2002-08-20 2011-04-20 Millennium Pharmaceuticals, Inc. Compositions, kits and methods for identification, assessment, prevention and therapy of cervical cancer
EP2305836A1 (en) 2002-08-20 2011-04-06 Millennium Pharmaceuticals, Inc. Compositions, kits and methods for identification, assessment, prevention and therapy of cervical cancer
EP2311980A1 (en) 2002-08-20 2011-04-20 Millennium Pharmaceuticals, Inc. Compositions, kits, and methods for identification, assessment, prevention, and therapy of cervical cancer
US7723055B2 (en) 2002-11-21 2010-05-25 University Of Massachusetts Diagnosing and treating hematopoietic cancers
EP2112229A2 (en) 2002-11-25 2009-10-28 Sequenom, Inc. Methods for identifying risk of breast cancer and treatments thereof
EP2474631A2 (en) 2002-12-20 2012-07-11 Celera Corporation Genetic polymorphisms associated with myocardial infarction, methods of detection and uses thereof
EP2151507A1 (en) 2002-12-20 2010-02-10 Celera Corporation Genetic polymorphisms associated with myocardial infarction, methods of detection and uses thereof
EP2474632A2 (en) 2002-12-20 2012-07-11 Celera Corporation Genetic polymorphisms associated with myocardial infarction, methods of detection and uses thereof
EP2500440A2 (en) 2002-12-20 2012-09-19 Celera Corporation Genetic polymorphisms associated with myocardial infarction, methods of detection and uses thereof
EP2474630A2 (en) 2002-12-20 2012-07-11 Celera Corporation Genetic polymorphisms associated with myocardial infarction, methods of detection and uses thereof
EP2003196A2 (en) 2003-06-09 2008-12-17 The Regents of the University of Michigan Compositions and methods for treating and diagnosing cancer
EP2128270A1 (en) 2003-08-08 2009-12-02 Genenews Inc. Osteoarthritis biomarkers and uses thereof
EP1892306A2 (en) 2003-10-06 2008-02-27 Bayer HealthCare AG Methods and kits for investigating cancer
EP2051077A2 (en) 2003-10-07 2009-04-22 Millennium Pharmaceuticals, Inc. Nucleic acid molecules and proteins for the identification, assessment, prevention, and therapy of ovarian cancer
EP2261667A2 (en) 2003-10-07 2010-12-15 Millennium Pharmaceuticals, Inc. Nucleic acid molecules and proteins for the identification, assessment, prevention, and their therapy of ovarian cancer
EP2405023A2 (en) 2003-11-26 2012-01-11 Celera Corporation Genetic Polymorphisms Associated with Cardiovascular Disorders and Drug Response, Methods of Detection and Uses Thereof
EP2186913A2 (en) 2003-11-26 2010-05-19 Celera Corporation Genetic polymorphisms associated with cardiovascular disorders and drug response, methods of detection and uses thereof
EP2386659A2 (en) 2003-11-26 2011-11-16 Celera Corporation Genetic Polymorphisms Associated with Cardiovascular Disorders and Drug Response, Methods of Detection and Uses Thereof
EP2386658A2 (en) 2003-11-26 2011-11-16 Celera Corporation Genetic Polymorphisms Associated with Cardiovascular Disorders and Drug Response, Methods of Detection and Uses Thereof
EP2386657A2 (en) 2003-11-26 2011-11-16 Celera Corporation Genetic Polymorphisms Associated with Cardiovascular Disorders and Drug Response, Methods of Detection and Uses Thereof
EP2386656A2 (en) 2003-11-26 2011-11-16 Celera Corporation Genetic Polymorphisms Associated with Cardiovascular Disorders and Drug Response, Methods of Detection and Uses Thereof
EP2423327A2 (en) 2004-05-07 2012-02-29 Celera Corporation Genetic polymorphisms associated with liver fibrosis methods of detection and uses thereof
EP2412826A2 (en) 2004-05-07 2012-02-01 Celera Corporation Genetic polymorphisms associated with liver fibrosis methods of detection and uses thereof
EP2423326A2 (en) 2004-05-07 2012-02-29 Celera Corporation Genetic polymorphisms associated with liver fibrosis methods of detection and uses thereof
EP2412827A2 (en) 2004-05-07 2012-02-01 Celera Corporation Genetic polymorphisms associated with liver fibrosis methods of detection and uses thereof
EP3628743A1 (en) 2004-06-09 2020-04-01 The Regents of The University of Michigan Phage microarray profiling of the humoral response to disease
EP2130926A2 (en) 2004-06-09 2009-12-09 The Regents of the University of Michigan Phage microarray profiling of the humoral response to disease
US10006023B2 (en) 2004-06-09 2018-06-26 The Regents Of The University Of Michigan Phage microarray profiling of the humoral response to disease
US9267133B2 (en) 2004-06-09 2016-02-23 The Regents Of The University Of Michigan Phage microarray profiling of the humoral response to disease
EP3064591A1 (en) 2004-06-09 2016-09-07 The Regents of the University of Michigan Phage microarray profiling of the humoral response to disease
EP2319526A1 (en) 2004-06-17 2011-05-11 Thrasos Therapeutics, Inc. Tdf-related compounds and analogs thereof
EP2789342A1 (en) 2004-06-17 2014-10-15 Thrasos Innovation, Inc. TDF-related compounds and analogs thereof
WO2006057500A1 (en) 2004-11-24 2006-06-01 Seoul National University Industry Foundation Use of aimp2dx2 for the diagnosis and treatment of cancer
US9944713B2 (en) 2004-11-24 2018-04-17 Medicinal Bioconvergence Research Center Antibody specific to the AIMP2-DX2
US9273111B2 (en) 2004-11-29 2016-03-01 Universite De Lorraine Therapeutic TREM-1 peptides
US10603357B2 (en) 2004-11-29 2020-03-31 Bristol-Myers Squibb Company Therapeutic TREM-1 peptides
EP2110667A1 (en) 2005-01-20 2009-10-21 University Of Rochester Thoredoxin interacting protein (TXNIP) as regulator of vascular function
EP2520669A2 (en) 2005-02-07 2012-11-07 GeneNews Inc. Mild osteoathritis biomarkers and uses thereof
WO2006089801A2 (en) 2005-02-25 2006-08-31 Forschungsverbund Berlin E.V. Method for the redox potential-dependent detection of target molecules by interactive peptides
EP2113572A1 (en) 2005-03-11 2009-11-04 Celera Corporation Genetic polymorphisms associated with coronary heart disease, methods of detection and uses thereof
US8999289B2 (en) 2005-03-22 2015-04-07 President And Fellows Of Harvard College Treatment of protein degradation disorders
US10172905B1 (en) 2005-03-22 2019-01-08 President And Fellows Of Harvard College Treatment of protein degradation disorders
US9572854B2 (en) 2005-03-22 2017-02-21 President And Fellows Of Harvard College Treatment of protein degradation disorders
WO2006113559A2 (en) 2005-04-15 2006-10-26 President And Fellows Of Harvard College Methods for modulating bone formation and mineralization by modulating krc activity
US7939263B2 (en) 2005-06-13 2011-05-10 The Regents Of The University Of Michigan Compositions and methods for treating and diagnosing cancer
WO2007033187A2 (en) 2005-09-12 2007-03-22 The Regents Of The University Of Michigan Recurrent gene fusions in prostate cancer
US10190173B2 (en) 2005-09-12 2019-01-29 The Regents Of The University Of Michigan Recurrent gene fusions in prostate cancer
US9957569B2 (en) 2005-09-12 2018-05-01 The Regents Of The University Of Michigan Recurrent gene fusions in prostate cancer
US8969527B2 (en) 2005-09-12 2015-03-03 The Regents Of The University Of Michigan Recurrent gene fusions in prostate cancer
US8580509B2 (en) 2005-09-12 2013-11-12 The Regents Of The University Of Michigan Recurrent gene fusions in prostate cancer
US10041123B2 (en) 2005-09-12 2018-08-07 The Regents Of The University Of Michigan Recurrent gene fusions in prostate cancer
EP2612870A1 (en) 2005-09-12 2013-07-10 The Regents of the University of Michigan Recurrent gene fusions in prostate cancer
US9745635B2 (en) 2005-09-12 2017-08-29 The Regents Of The University Of Michigan Recurrent gene fusions in prostate cancer
US9284609B2 (en) 2005-09-12 2016-03-15 The Brigham And Women's Hospital, Inc. Recurrent gene fusions in prostate cancer
US8211645B2 (en) 2005-09-12 2012-07-03 The Regents Of The University Of Michigan Recurrent gene fusions in prostate cancer
EP2927241A1 (en) 2005-09-20 2015-10-07 Thrasos Innovation, Inc. TDF-related compounds and analogs thereof
EP2497780A1 (en) 2005-09-20 2012-09-12 Thrasos Therapeutics, Inc. TDF-related compounds and analogs thereof
EP2471952A1 (en) 2005-09-23 2012-07-04 Celera Corporation Genetic polymorphisms associated with cardiovascular disorders and drug response, methods of detection and uses thereof
EP2471953A1 (en) 2005-09-23 2012-07-04 Celera Corporation Genetic polymorphisms associated with cardiovascular disorders and drug response, methods of detection and uses thereof
US8652467B2 (en) 2005-10-14 2014-02-18 The Regents Of The University Of Michigan Dek protein compositions and methods of using the same
EP2319941A2 (en) 2005-10-21 2011-05-11 GeneNews Inc. Method and apparatus for correlating levels of biomarker products with disease
US9850311B2 (en) 2005-10-31 2017-12-26 Oncomed Pharmaceuticals, Inc. Compositions and methods for diagnosing and treating cancer
US8324361B2 (en) 2005-10-31 2012-12-04 Oncomed Pharmaceuticals, Inc. Nucleic acid molecules encoding soluble frizzled (FZD) receptors
US9228013B2 (en) 2005-10-31 2016-01-05 OncoMed Pharmaceuticals Methods of using the FRI domain of human frizzled receptor for inhibiting Wnt signaling in a tumor or tumor cell
US9732139B2 (en) 2005-10-31 2017-08-15 Oncomed Pharmaceuticals, Inc. Methods of treating cancer by administering a soluble receptor comprising a human Fc domain and the Fri domain from human frizzled receptor
US8765913B2 (en) 2005-10-31 2014-07-01 Oncomed Pharmaceuticals, Inc. Human frizzled (FZD) receptor polypeptides and methods of use thereof for treating cancer and inhibiting growth of tumor cells
EP2368912A1 (en) 2006-01-05 2011-09-28 Immune Disease Institute, Inc. Regulators of NFAT
US8399385B2 (en) 2006-02-13 2013-03-19 Monsanto Technology Llc Plant chimeric binding polypeptides for universal molecular recognition
US7951753B2 (en) 2006-02-13 2011-05-31 Divergence, Inc. Plant chimeric binding polypeptides for universal molecular recognition
US9090892B2 (en) 2006-02-13 2015-07-28 Monsanto Technology Llc Plant chimeric binding polypeptides for universal molecular recognition
EP2270208A2 (en) 2006-02-13 2011-01-05 Divergence, Inc. Plant chimeric binding polypeptides for universal molecular recognition
US8754237B2 (en) 2006-02-14 2014-06-17 President And Fellows Of Harvard College Bifunctional histone deacetylase inhibitors
US8222423B2 (en) 2006-02-14 2012-07-17 Dana-Farber Cancer Institute, Inc. Bifunctional histone deacetylase inhibitors
US8304451B2 (en) 2006-05-03 2012-11-06 President And Fellows Of Harvard College Histone deacetylase and tubulin deacetylase inhibitors
EP2236623A1 (en) 2006-06-05 2010-10-06 Cancer Care Ontario Assessment of risk for colorectal cancer
WO2008051511A2 (en) 2006-10-20 2008-05-02 Applera Corporation Genetic polymorphisms associated with venous thrombosis, methods of detection and uses thereof
EP2431483A1 (en) 2006-10-20 2012-03-21 Celera Corporation Genetic polymorphisms associated with venous thrombosis, methods of detection and uses thereof
EP2441775A1 (en) 2007-02-26 2012-04-18 Oxford Biotherapeutics Ltd. Protein
EP3118221A1 (en) 2007-02-26 2017-01-18 Oxford BioTherapeutics Ltd Proteins
EP3118220A1 (en) 2007-02-26 2017-01-18 Oxford BioTherapeutics Ltd Protein
EP2447719A1 (en) 2007-02-26 2012-05-02 Oxford Biotherapeutics Ltd. Proteins
EP2243834A1 (en) 2007-03-05 2010-10-27 Cancer Care Ontario Assessment of risk for colorectal cancer
EP2581081A2 (en) 2007-06-01 2013-04-17 The Trustees Of Princeton University Treatment of viral infections by modulation of host cell metabolic pathways
EP2572712A2 (en) 2007-06-01 2013-03-27 The Trustees Of Princeton University Treatment of viral infections by modulation of host cell metabolic pathways
EP3009148A1 (en) 2007-07-02 2016-04-20 Oncomed Pharmaceuticals, Inc. Compositions and methods for treating and diagnosing cancer
EP3424529A1 (en) 2007-07-02 2019-01-09 Oncomed Pharmaceuticals, Inc. Compositions and methods for treating and diagnosing cancer
US9303291B2 (en) 2007-07-06 2016-04-05 The Regents Of The University Of Michigan MIPOL1-ETV1 gene rearrangements
WO2009009432A2 (en) 2007-07-06 2009-01-15 The Regents Of The University Of Michigan Recurrent gene fusions in prostate cancer
EP2604701A2 (en) 2007-07-06 2013-06-19 The Regents Of The University Of Michigan Recurrent gene fusions in prostate cancer
US10167517B2 (en) 2007-07-06 2019-01-01 The Regents Of The University Of Michigan MIPOL1-ETV1 gene rearrangements
US9719143B2 (en) 2007-07-06 2017-08-01 The Regents Of The University Of Michigan MIPOL1-ETV1 gene rearrangements
US8586081B2 (en) 2007-09-20 2013-11-19 University Of Massachusetts Detoxified recombinant botulinum neurotoxin
EP2602332A1 (en) 2007-11-05 2013-06-12 Celera Corporation Genetic polymorphisms associated with liver fibrosis, methods of detection and uses thereof
WO2009061799A2 (en) 2007-11-05 2009-05-14 Celera Corporation Genetic polymorphisms associated with liver fibrosis, methods of detection and uses thereof
EP2728017A1 (en) 2007-11-19 2014-05-07 Celera Corporation Lung cancer markers and uses thereof
EP3115469A1 (en) 2007-11-19 2017-01-11 Celera Corporation Lung cancer markers and uses thereof
EP3048175A1 (en) 2008-02-20 2016-07-27 Celera Corporation Genetic polymorphism associated with stroke, therapy based on the detection of the polymorphism and use of kits containing reagents for detecting the polymorphism
EP3093351A1 (en) 2008-07-09 2016-11-16 Celera Corporation Genetic polymorphisms associated with cardiovascular diseases, methods of detection and uses thereof
EP2878680A1 (en) 2008-07-09 2015-06-03 Celera Corporation Genetic polymorphisms associated with cardiovascular diseases, methods of detection and uses thereof
EP2733222A1 (en) 2008-07-09 2014-05-21 Celera Corporation Genetic polymorphisms associated with cardiovascular diseases, methods of detection and uses thereof
US8440716B2 (en) 2008-07-23 2013-05-14 President And Fellows Of Harvard College Deacetylase inhibitors and uses thereof
US9434686B2 (en) 2008-07-23 2016-09-06 President And Fellows Of Harvard College Deacetylase inhibitors and uses thereof
US8815794B2 (en) 2008-08-28 2014-08-26 The Research Foundation For The State University Of New York Treatment of amyloidoses using myelin basic protein and fragments thereof
US10612086B2 (en) 2008-09-16 2020-04-07 Sequenom, Inc. Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses
US10738358B2 (en) 2008-09-16 2020-08-11 Sequenom, Inc. Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses
US8962247B2 (en) 2008-09-16 2015-02-24 Sequenom, Inc. Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non invasive prenatal diagnoses
US8507442B2 (en) 2008-09-26 2013-08-13 Oncomed Pharmaceuticals, Inc. Methods of use for an antibody against human frizzled receptors 1, 2. 5, 7 or 8
US9573998B2 (en) 2008-09-26 2017-02-21 Oncomed Pharmaceuticals, Inc. Antibodies against human FZD5 and FZD8
US9273139B2 (en) 2008-09-26 2016-03-01 Oncomed Pharmaceuticals, Inc. Monoclonal antibodies against frizzled
US8975044B2 (en) 2008-09-26 2015-03-10 Oncomed Pharmaceuticals, Inc. Polynucleotides encoding for frizzled-binding agents and uses thereof
WO2010040277A1 (en) 2008-10-09 2010-04-15 The University Of Hong Kong Cadherin-17 as diagnostic marker and therapeutic target for liver cancer
EP3153862A1 (en) 2008-11-11 2017-04-12 The Regents of the University of Michigan Anti-cxcr1 compositions and methods
WO2010080985A1 (en) 2009-01-08 2010-07-15 Dana-Farber Cancer Institute, Inc. Compositions and methods for induced brown fat differentiation
WO2010081001A2 (en) 2009-01-09 2010-07-15 The Regents Of The University Of Michigan Recurrent gene fusions in cancer
WO2010084408A2 (en) 2009-01-21 2010-07-29 Oxford Biotherapeutics Ltd. Pta089 protein
DE202010018378U1 (en) 2009-04-10 2016-04-07 Tufts Medical Center, Inc. PAR-1 activation by metalloproteinase-1 (MMP-1)
EP2990051A1 (en) 2009-04-10 2016-03-02 Tufts Medical Center, Inc. Par-1 activation by metalloproteinase-1 (mmp-1)
EP3061460A1 (en) 2009-04-10 2016-08-31 Tufts Medical Center, Inc. Par-1 activation by metalloproteinase-1 (mmp-1)
US8716344B2 (en) 2009-08-11 2014-05-06 President And Fellows Of Harvard College Class- and isoform-specific HDAC inhibitors and uses thereof
US10059657B2 (en) 2009-08-11 2018-08-28 President And Fellows Of Harvard College Class-and isoform-specific HDAC inhibitors and uses thereof
US9540317B2 (en) 2009-08-11 2017-01-10 President And Fellows Of Harvard College Class- and isoform-specific HDAC inhibitors and uses thereof
US9926602B2 (en) 2009-09-17 2018-03-27 The Regents Of The University Of Michigan Recurrent gene fusions in prostate cancer
US9938582B2 (en) 2009-09-17 2018-04-10 The Regents Of The University Of Michigan Recurrent gene fusions in prostate cancer
WO2011054007A1 (en) 2009-11-02 2011-05-05 Oxford Biotherapeutics Ltd. Ror1 as therapeutic and diagnostic target
EP3168232A1 (en) 2009-11-13 2017-05-17 Dana-Farber Cancer Institute, Inc. Compositions, kits, and methods for the diagnosis, prognosis, monitoring, treatment and modulation of post-transplant lymphoproliferative disorders and hypoxia associated angiogenesis disorders using galectin-1
WO2011063198A2 (en) 2009-11-20 2011-05-26 St. Jude Children's Research Hospital Methods and compositions for modulating the activity of the interleukin-35 receptor complex
US9926593B2 (en) 2009-12-22 2018-03-27 Sequenom, Inc. Processes and kits for identifying aneuploidy
US11180799B2 (en) 2009-12-22 2021-11-23 Sequenom, Inc. Processes and kits for identifying aneuploidy
US9579361B2 (en) 2010-01-12 2017-02-28 Oncomed Pharmaceuticals, Inc. Wnt antagonist and methods of treatment and screening
US9157904B2 (en) 2010-01-12 2015-10-13 Oncomed Pharmaceuticals, Inc. Wnt antagonists and methods of treatment and screening
WO2011088163A1 (en) 2010-01-14 2011-07-21 President And Fellows Of Harvard College Methods for modulating skeletal remodeling and patterning by modulating shn2 activity, shn3 activity, or shn2 and shn3 activity in combination
WO2011091134A2 (en) 2010-01-22 2011-07-28 Dana-Farber Cancer Institute, Inc. Compositions,kits, and methods for identification, assessment, prevention, and therapy of metabolic disorders
US9658231B2 (en) 2010-03-17 2017-05-23 The Regents Of The University Of Michigan Using phage epitopes to profile the immune response
US11307203B2 (en) 2010-03-17 2022-04-19 The Regents Of The University Of Michigan Using phage epitopes to profile the immune response
US10781254B2 (en) 2010-03-26 2020-09-22 The Trustees Of Dartmouth College VISTA regulatory T cell mediator protein, VISTA binding agents and use thereof
US12071473B2 (en) 2010-03-26 2024-08-27 The Trustees Of Darmouth College VISTA-Ig for treatment of autoimmune, allergic and inflammatory disorders
EP3153521A1 (en) 2010-03-26 2017-04-12 Trustees of Dartmouth College Vista regulatory t cell mediator protein, vista binding agents and use thereof
US10745467B2 (en) 2010-03-26 2020-08-18 The Trustees Of Dartmouth College VISTA-Ig for treatment of autoimmune, allergic and inflammatory disorders
US8551789B2 (en) 2010-04-01 2013-10-08 OncoMed Pharmaceuticals Frizzled-binding agents and their use in screening for WNT inhibitors
US9499630B2 (en) 2010-04-01 2016-11-22 Oncomed Pharmaceuticals, Inc. Frizzled-binding agents and uses thereof
WO2011130340A1 (en) 2010-04-15 2011-10-20 St. Jude Children's Research Hospital Methods and compositions for the diagnosis and treatment of cancer resistant to anaplastic lymphoma kinase (alk) kinase inhibitors
EP3056899A1 (en) 2010-04-19 2016-08-17 Celera Corporation Genetic polymorphisms associated with statin response and cardiovascular diseases, methods of detection and uses thereof
EP3660508A1 (en) 2010-04-19 2020-06-03 Celera Corporation Genetic polymorphisms associated with statin response and cardiovascular diseases
WO2011133418A1 (en) 2010-04-19 2011-10-27 Celera Corporation Genetic polymorphisms associated with statin response and cardiovascular diseases, methods of detection and uses thereof
WO2012010321A1 (en) 2010-07-23 2012-01-26 Erasmus University Medical Center Rotterdam Foetal haemoglobin inhibitor
WO2012051301A1 (en) 2010-10-12 2012-04-19 President And Fellows Of Harvard College Methods for identifying modulators of triglyceride metabolism, for modulating triglyceride metabolism and for identifying subjects at risk for abnormal triglyceride metabolism
WO2012061502A2 (en) 2010-11-02 2012-05-10 Celera Corporation Genetic polymorphisms associated with venous thrombosis and statin response, methods of detection and uses thereof
EP3495500A1 (en) 2010-11-02 2019-06-12 Celera Corporation Genetic polymorphisms associated with venous thrombosis and statin response, methods of detection and uses thereof
US9567644B2 (en) 2010-11-19 2017-02-14 The Regents Of The University Of Michigan RAF gene fusions
US8945556B2 (en) 2010-11-19 2015-02-03 The Regents Of The University Of Michigan RAF gene fusions
US11015224B2 (en) 2010-11-19 2021-05-25 The Regents Of The University Of Michigan RAF gene fusions
US9956236B2 (en) 2011-02-07 2018-05-01 Cornell University Methods for increasing immune responses using agents that directly bind to and activate IRE-1
WO2012142233A1 (en) 2011-04-14 2012-10-18 St. Jude Children's Research Hospital Methods and compositions for detecting and modulating a novel mtor complex
WO2012160448A2 (en) 2011-05-25 2012-11-29 Innate Pharma, S.A. Anti-kir antibodies for the treatment of inflammatory disorders
WO2013001369A2 (en) 2011-06-28 2013-01-03 Oxford Biotherapeutics Ltd. Therapeutic and diagnostic target
WO2013039996A1 (en) 2011-09-13 2013-03-21 Dana-Farber Cancer Institute, Inc. Compositions and methods for brown fat induction and activity using fndc5
WO2013043720A1 (en) 2011-09-20 2013-03-28 The University Of North Carolina At Chapel Hill Regulation of sodium channels by plunc proteins
US9663568B2 (en) 2012-02-15 2017-05-30 Novo Nordisk A/S Antibodies that bind peptidoglycan recognition protein 1
US9550830B2 (en) 2012-02-15 2017-01-24 Novo Nordisk A/S Antibodies that bind and block triggering receptor expressed on myeloid cells-1 (TREM-1)
US10189904B2 (en) 2012-02-15 2019-01-29 Novo Nordisk A/S Antibodies that bind and block triggering receptor expressed on myeloid cells-1 (TREM-1)
US10906975B2 (en) 2012-02-15 2021-02-02 Novo Nordisk A/S Methods of treating autoimmune disease or chronic inflammation with antibodies that bind and block triggering receptor expressed on myeloid cells-1 (TREM-1)
US9000127B2 (en) 2012-02-15 2015-04-07 Novo Nordisk A/S Antibodies that bind and block triggering receptor expressed on myeloid cells-1 (TREM-1)
US10906965B2 (en) 2012-02-15 2021-02-02 Novo Nordisk A/S Methods of treating autoimmune disease or chronic inflammation wtih antibodies that bind peptidoglycan recognition protein 1
US10150809B2 (en) 2012-02-15 2018-12-11 Bristol-Myers Squibb Company Antibodies that bind peptidoglycan recognition protein 1
US10738359B2 (en) 2012-03-02 2020-08-11 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US11312997B2 (en) 2012-03-02 2022-04-26 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US9605313B2 (en) 2012-03-02 2017-03-28 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
WO2013138463A1 (en) 2012-03-14 2013-09-19 University Of Central Florida Research Foundation, Inc. Neurofibromatoses therapeutic agents and screening for same
WO2013138456A1 (en) 2012-03-14 2013-09-19 University Of Central Florida Research Foundation, Inc. Lim kinasemodulating agents for neurofibromatoses therapy and methods for screening for same
US9920361B2 (en) 2012-05-21 2018-03-20 Sequenom, Inc. Methods and compositions for analyzing nucleic acid
US11306354B2 (en) 2012-05-21 2022-04-19 Sequenom, Inc. Methods and compositions for analyzing nucleic acid
US10413548B2 (en) 2012-06-07 2019-09-17 Beth Israel Deaconess Medical Center, Inc. Methods and compositions for the inhibition of Pin1
US11129835B2 (en) 2012-06-07 2021-09-28 Beth Israel Deaconess Medical Center, Inc. Methods and compositions for the inhibition of PIN1
US9730941B2 (en) 2012-06-07 2017-08-15 Beth Israel Deaconess Medical Center, Inc. Methods and compositions for the inhibition of Pin1
WO2013185055A1 (en) 2012-06-07 2013-12-12 Beth Israel Deaconess Medical Center, Inc. Methods and compositions for the inhibition of pin1
US11752189B2 (en) 2012-06-22 2023-09-12 The Trustees Of Dartmouth College Vista antagonist and methods of use
US12064463B2 (en) 2012-06-22 2024-08-20 King's College London Vista antagonist and methods of use
US10933115B2 (en) 2012-06-22 2021-03-02 The Trustees Of Dartmouth College VISTA antagonist and methods of use
US11180557B2 (en) 2012-06-22 2021-11-23 King's College London Vista modulators for diagnosis and treatment of cancer
EP3421486A1 (en) 2012-06-22 2019-01-02 The Trustees Of Dartmouth College Novel vista-ig constructs and the use of vista-ig for treatment of autoimmune, allergic and inflammatory disorders
US11332791B2 (en) 2012-07-13 2022-05-17 Sequenom, Inc. Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses
WO2014020331A1 (en) 2012-08-01 2014-02-06 Oxford Biotherapeutics Ltd. Therapeutic and diagnostic target
US11529416B2 (en) 2012-09-07 2022-12-20 Kings College London Vista modulators for diagnosis and treatment of cancer
WO2014039983A1 (en) 2012-09-07 2014-03-13 The Trustees Of Dartmouth College Vista modulators for diagnosis and treatment of cancer
WO2014072832A2 (en) 2012-10-18 2014-05-15 Oslo Universitetstssykehus Hf Biomarkers for cervical cancer
US9266959B2 (en) 2012-10-23 2016-02-23 Oncomed Pharmaceuticals, Inc. Methods of treating neuroendocrine tumors using frizzled-binding agents
US9987357B2 (en) 2013-02-04 2018-06-05 Oncomed Pharmaceuticals, Inc. Methods and monitoring of treatment with a WNT pathway inhibitor
US9359444B2 (en) 2013-02-04 2016-06-07 Oncomed Pharmaceuticals Inc. Methods and monitoring of treatment with a Wnt pathway inhibitor
EP3736293A1 (en) 2013-02-12 2020-11-11 Boehringer Ingelheim International Gmbh Therapeutic and diagnostic target for cancer comprising dll3 binding reagents
US11060145B2 (en) 2013-03-13 2021-07-13 Sequenom, Inc. Methods and compositions for identifying presence or absence of hypermethylation or hypomethylation locus
US9168300B2 (en) 2013-03-14 2015-10-27 Oncomed Pharmaceuticals, Inc. MET-binding agents and uses thereof
EP3293275A1 (en) 2013-06-06 2018-03-14 Dana-Farber Cancer Institute, Inc. Compositions and methods for identification, assessment prevention, and treatment of cancer using pd-l1 isoforms
WO2015017529A2 (en) 2013-07-31 2015-02-05 Dana-Farber Cancer Institute, Inc. Compositions and methods for modulating thermogenesis using pth-related and egf-related molecules
US10421965B2 (en) 2013-09-25 2019-09-24 Cornell University Compounds for inducing anti-tumor immunity and methods thereof
US9957506B2 (en) 2013-09-25 2018-05-01 Cornell University Compounds for inducing anti-tumor immunity and methods thereof
US10450566B2 (en) 2013-09-25 2019-10-22 Cornell University Compounds for inducing anti-tumor immunity and methods thereof
US11242392B2 (en) 2013-12-24 2022-02-08 Janssen Pharmaceutica Nv Anti-vista antibodies and fragments
US11014987B2 (en) 2013-12-24 2021-05-25 Janssen Pharmaceutics Nv Anti-vista antibodies and fragments, uses thereof, and methods of identifying same
US11365447B2 (en) 2014-03-13 2022-06-21 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
US11123426B2 (en) 2014-06-11 2021-09-21 The Trustees Of Dartmouth College Use of vista agonists and antagonists to suppress or enhance humoral immunity
US11072654B2 (en) 2014-07-17 2021-07-27 Novo Nordisk A/S Site directed mutagenesis of TREM-1 antibodies for decreasing viscosity
US12116408B2 (en) 2014-07-17 2024-10-15 Novo Nordisk A/S Site directed mutagenesis of TREM-1 antibodies for decreasing viscosity
US10351914B2 (en) 2014-07-17 2019-07-16 Beth Israel Deaconess Medical Center, Inc. Biomarkers for Pin1-associated disorders
US10179814B2 (en) 2014-07-17 2019-01-15 Novo Nordisk A/S Site directed mutagenesis of TREM-1 antibodies for decreasing viscosity
US9968579B2 (en) 2014-07-17 2018-05-15 Beth Isreal Deaconess Medical Center, Inc. ATRA for modulating Pin1 activity and stability
US10370455B2 (en) 2014-12-05 2019-08-06 Immunext, Inc. Identification of VSIG8 as the putative VISTA receptor (V-R) and use thereof to produce VISTA/VSIG8 agonists and antagonists
EP3735982A1 (en) 2015-03-10 2020-11-11 The University of Massachusetts Targeting gdf6 and bmp signaling for anti-melanoma therapy
WO2016144917A1 (en) 2015-03-10 2016-09-15 University Of Massachusetts Targeting gdf6 and bmp signaling for anti-melanoma therapy
US10548864B2 (en) 2015-03-12 2020-02-04 Beth Israel Deaconess Medical Center, Inc. Enhanced ATRA-related compounds for the treatment of proliferative diseases, autoimmune diseases, and addiction conditions
US11009509B2 (en) 2015-06-24 2021-05-18 Janssen Pharmaceutica Nv Anti-VISTA antibodies and fragments
WO2017075329A2 (en) 2015-10-29 2017-05-04 Dana-Farber Cancer Institute, Inc. Methods for identification, assessment, prevention, and treatment of metabolic disorders using pm20d1 and n-lipidated amino acids
US10899836B2 (en) 2016-02-12 2021-01-26 Janssen Pharmaceutica Nv Method of identifying anti-VISTA antibodies
US11987630B2 (en) 2016-02-12 2024-05-21 Janssen Pharmaceutica Nv Anti-vista antibodies and fragments, uses thereof, and methods of identifying same
WO2017162659A1 (en) 2016-03-24 2017-09-28 Bayer Pharma Aktiengesellschaft Intracellular hepsin as therapeutic target for the treatment of cancer with centrosome amplification
US11603402B2 (en) 2016-04-15 2023-03-14 Immunext, Inc. Anti-human vista antibodies and use thereof
US11603403B2 (en) 2016-04-15 2023-03-14 Immunext, Inc. Anti-human vista antibodies and use thereof
US11649283B2 (en) 2016-04-15 2023-05-16 Immunext, Inc. Anti-human vista antibodies and use thereof
US11525000B2 (en) 2016-04-15 2022-12-13 Immunext, Inc. Anti-human VISTA antibodies and use thereof
US11919954B2 (en) 2018-04-02 2024-03-05 Bristol-Myers Squibb Company Anti-TREM-1 antibodies and uses thereof
US11952420B2 (en) 2018-04-02 2024-04-09 Bristol-Myers Squibb Company Nucleic acids encoding anti-TREM-1 antibodies
US11155618B2 (en) 2018-04-02 2021-10-26 Bristol-Myers Squibb Company Anti-TREM-1 antibodies and uses thereof
US12006550B2 (en) 2020-10-12 2024-06-11 University Of South Carolina Targeting treatment for ADAM30 in pathological cells

Also Published As

Publication number Publication date
EP0672131A4 (en) 1995-11-15
DE69333969D1 (en) 2006-04-13
EP0672131A1 (en) 1995-09-20
EP0672131B1 (en) 2003-12-17
DE69333969T2 (en) 2006-09-14
US5786169A (en) 1998-07-28
DE69333366T2 (en) 2004-09-16
ATE256738T1 (en) 2004-01-15
JPH08506480A (en) 1996-07-16
DE69333366D1 (en) 2004-01-29
HK1059635A1 (en) 2004-07-09
ATE316573T1 (en) 2006-02-15
CA2148252C (en) 2007-06-12
HK1012027A1 (en) 1999-07-23
US5580736A (en) 1996-12-03
CA2148252A1 (en) 1994-05-11
EP1362913A3 (en) 2003-11-26
EP1362913A2 (en) 2003-11-19
JP3537141B2 (en) 2004-06-14
EP1362913B1 (en) 2006-01-25

Similar Documents

Publication Publication Date Title
CA2148252C (en) Interaction trap system for isolating novel proteins
EP0690876B1 (en) Protein kinases
US5512473A (en) Max-interacting proteins and related molecules and methods
Roussel et al. A point mutation at tyrosine-809 in the human colony-stimulating factor 1 receptor impairs mitogenesis without abrogating tyrosine kinase activity, association with phosphatidylinositol 3-kinase, or induction of c-fos and junB genes.
US5637463A (en) Method to detect protein-protein interactions
Wang et al. p53 modulation of TFIIH–associated nucleotide excision repair activity
US5702897A (en) Interaction of proteins involved in a cell death pathway
Minakuchi et al. Identification and characterization of SEB, a novel protein that binds to the acute undifferentiated leukemia‐associated protein SET
US6071700A (en) Heterologous polypeptide production in the absence of nonsense-mediated MRNA decay functions
US20020019005A1 (en) Process for identification of genes encoding proteins having cell proliferation-promoting activity
JP2001515718A (en) Suppressed transactivator system for characterizing protein-protein interactions
WO1998007886A1 (en) Process for identification of genes encoding proteins having cell proliferation-promoting activity
US5747245A (en) Nucleic acids encoding Fas associated proteins and screening assays using same
WO1993024514A1 (en) D-type cyclin and uses related thereto
WO1995032284A9 (en) Factor interacting with nuclear proteins
US5770720A (en) Ubiquitin conjugating enzymes having transcriptional repressor activity
CA2351627A1 (en) Methods and compositions for diagnosis and treatment of cancer based on the transcription factor ets2
Wen et al. RBP95, a novel leucine zipper protein, binds to the retinoblastoma protein
AU713686B2 (en) EB1 gene product binds to APC
US20020081688A1 (en) Retinoid pathway assays, and compositions therefrom
CA2429515A1 (en) Retinoid pathway assays, and compositions therefrom
McCright The identification and characterization of B56, a new family of protein phosphatase 2A regulatory subunits
Fu Identification and characterization of E2a-Pbx1 target genes in NIH3T3 fibroblasts and pre-B ALL cells

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): CA JP

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 1993900596

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2148252

Country of ref document: CA

WWP Wipo information: published in national office

Ref document number: 1993900596

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: 1993900596

Country of ref document: EP