WO2017162659A1 - Intracellular hepsin as therapeutic target for the treatment of cancer with centrosome amplification - Google Patents

Abstract

The present invention relates to intracellular isoform of Hepsin and its role in centrosomal clustering. The invention provides methods of screening for a candidate compound effective for the treatment and/or the prevention of cancer with centrosome amplification. The present invention also relates to methods for treating and preventing cancer with centrosome amplification.

Description

Intracellular Hepsin as therapeutic target for the treatment of cancer with centrosome amplification

Technical field of the invention

The present invention relates to the field of biological science, more specifically to the field of cancer research and cancer therapy. In particular, the present invention relates to methods of screening for a candidate compound effective for the treatment of cancer and/or the prevention of cancer. The present invention also relates to methods for treating and preventing cancer.

Background of the invention

Centrosomes are the cell's microtubule-organizing centers. Normal cells possess only one centrosome in Gl phase, consisting of two orthogonally arranged centrioles which are embedded in pericentriolar material. The centrosome and DNA cycles are tightly controlled and take place once per cell cycle. Centrosomes function as spindle poles, organizing the formation of bipolar spindles during mitosis. Amplification of centrosomes has frequently been observed in tumor cells and was correlated with chromosomal instability, aneuploidy and tumor genesis. Centrosome amplification can lead to multipolar spindles, subsequent segregation of chromosomes and apoptosis [Leber B et al. Proteins required for centrosome clustering in cancer cells; Sci Transl Med. 2010 May 26;2(33), Kwon M et al, Mechanisms to suppress multipolar divisions in cancer cells with extra centrosomes, Genes Dev. 2008 Sep 15;68(18):7332-41]. Tumor cells have developed a mechanism termed centrosomal clustering, which prevents the formation of multipolar spindles by coalescence of multiple centrosomes into two functional spindle poles. Centrosomal clustering is vital for proper chromosome distribution and cell survival in cells with centrosome amplification. Inhibition of centrosomal clustering with subsequent cell death is expected to offer the opportunity to develop tumor cell selective therapeutics.

Proteases play a central role in several important cellular and intracellular processes and the value as pharmaceutical targets has been proven for several proteases. Hepsin (HSP), also known as TMPRSS1, is a member of the type Π transmembrane serine protease family (Leytus, S.P. et al. (1988) Biochemistry 27:1067). It consists of an N- terminal cytoplasmatic domain, a transmembrane domain, and an extracellular domain with a C-terminal protease domain (Herter S. et al. (2005) Biochemistry Journal 390: 125-136). Hepsin is most highly expressed in liver, but is also present in many other tissues, notably lung, kidney, and skeletal muscle (Tsuji, A. et al. (1991) J. Biol. Chem. 266: 16948). Hepsin is overexpressed in prostate cancer (Dhanasekaran, S.M. et al. (2001) Nature 412:822, Parekh DJ et al. (2007) J Urol 178, 2252-2259) and considered to be a biomarker for prostate cancer (Wu, Q. and Parry, G. (2007) Front. Biosci. 12:5052.). Hepsin is also upregulated in other tumor entities, for example ovarian carcinoma (Miao J et al. (2008) Int J Cancer 123, 2041- 2047).

Hepsin catalyses the cleavage of proteins after basic amino-acid residues, with arginine strongly preferred to lysine. Substrate profiling using a combinatorial peptide library resulted in a consensus peptide sequence (P/K)-(K/Q)-(T/L/N)-R (Herter S. et al. (2005) Biochemistry Journal 390: 125-136). The biological function of Hepsin is unknown, however via proteolytic processing it can activate several extracellular proteins like hepatocyte growth factor (HGF; Herter S. et al. (2005) Biochemistry Journal 390: 125-136), pro urokinase type plasminogen activator (pro- uPA; Moran P. et al. (2006) The Journal of Biologocal Chemistry 281 : 30439- 30446), Laminin-332 (Tripathi M et al. (2008) The Journal of Biologocal Chemistry 283:30576-30584), pro-macrophage-stimulating protein (Ganesan R. et al. (2011) Molecular Cancer Research 9: 1175 - 1186), or uromodulin (Brunati M. et al. 2015 PMID: 26673890 (Epub ahead of print)). However, no intracellular target of Hepsin has been described so far.

Leber et al. (Leber B et al. Proteins required for centrosome clustering in cancer cells; Sci Transl Med. 2010 May 26; 2(33) identified 82 genes among them hepsin which were associated with induction of spindle multipolarity, indicating that hepsin is involved in centrosomal clustering in cancer cells with centrosome amplification which is an intracellular process.

Li et al. (Li Y et al. Biochim Biophys Acta. 2005 1681(2-3): 157-65) described for the first time the identification of an intracellular hepsin splice variant (Gene Bank™ accession number: AL557891), that does not contain exons 4 and 5 which together encode the transmembrane domain. In contrast to transmembrane hepsin isoform, which is located in the cell membrane, intracellular Hepsin isoform was found to be mainly distributed within the cytoplasm and its expression was restricted to kidney, brain, and lung tissue. Intracellular Hepsin isoform is not expressed in liver where transmembrane Hepsin isoform was originally identified. Both transmembrane and intracellular isoform of Hepsin were expressed in a range of colon adenocarcinoma cell lines but with different pattern. However, the role of intracellular hepsin isoform in tumor genesis remains unclear.

Dynactin 4 (DCTN4, p62) is an intracellular expressed protein and an integral component of the Dynactin multisubunit complex. The Dynactin complex binds to cytoplasmic Dynein, which is involved in localization and motility of endomembranes. Blocking of dynactin-complex-dynein-interaction has been shown to inhibit several cellular processes among them spindle assembly. Dynactin 4 is important for the binding of the Dynactin complex to the nuclear envelop prior to mitosis. SiRNA-mediated knockdown of dynactin 4 has been shown to lead to mitotic spindle defects. (Karki S, Tokito MK, Holzbaur EL, J Biol Chem. 2000 Feb 18; 275(7):4834-9, Garces JA, Clark IB, Meyer DI, Vallee RB. Curr Biol. 1999 Dec 16-30; 9(24): 1497-500, Yeh TY, Quintyne NJ, Scipioni BR, Eckley DM, Schroer TA. Mol Biol Cell. 2012 Oct; 23(19):3827-37).

Although Hepsin has been implicated with cancer in the past (WOO 157194 (Corvas International Inc.), US6423543 (ISIS Pharmaceuticals Inc.), WO2004086035 (Bayer)) and therapeutic approaches targeting Hepsin were investigated:

- WO2011050188, WO2011161189 (Genentech) relates to Hepsin antibodies defined by amino acid sequence, useful for treating cancer

- WO2015184222 (SOUTHERN RES INST) relates to cyclic urea compounds that are capable of inhibiting certain serine proteases among them hepsin WO2007149935 (Genentech) relates to methods and compositions for modulating hepsin activity and the uPA/plasmin pathway, in particular by regulating pro-uPA activation by hepsin

- WO2009151920 (HUTCHINSON FRED CANCER RES) relates to specific hepsin inhibitors for the treatment of prostate cancer

- WO2011050194 (DZHENENTEK, INK) relates to antagonist molecule that inhibits interaction of hepsin and pro-MSP and method of identifying such antagonists - WO2011073283 relates on a method for diagnosing prostate cancer comprising the analysis of the expression of the marker gene hepsin in a urine sample

no successful Hepsin- Inhibitor for the treatment of cancer has been developed so far. Whereas the development of novel hepsin inhibitors concentrates on the inhibition of extracellular proteolytic activity of the transmembrane isoform of Hepsin the aim of the present invention is the identification of hepsin inhibitors which inhibit the intracellular biological activity of an intracellular isoform of Hepsin.

Summary of the invention

The present invention relates to the discovery that not the extracellular activity of Hepsin but the intracellular activity of a Hepsin splice variant plays a role in centrosomal clustering. In course of the present invention it could be confirmed that knockdown Hepsin (including the transmembrane and intracellular isoform of Hepsin) induces apoptosis and inhibits proliferation in cell lines with centrosome amplification (see example 1, Fig. 1.1 ; example 2, Fig. 2.1), but not in non-cancer cell lines with normal number of centrosomes. In view of these findings, it was postulated that the oncogenic activity of Hepsin is due to its involvement in centrosomal clustering. In course of the invention it was discovered that the knockdown of Hepsin (including the transmembrane and intracellular isoform of Hepsin) induces multipolar mitoses only in tumor cells lines with high centrosome amplification but not in tumor cell lines with low centrosome amplification (see Example 3; Figure 3.1). Surprisingly, the incubation of PC-3 cells (prostate cancer cell line) with the Hepsin inhibitor l-(3-chlorophenyl)-3-{5-[(3,4- dimethylphenoxy)methyl]-l,3,4-thiadiazol-2-yl}urea (Compound 2, Compound 2 is described and characterized in "Chevillet JR et al. (2008) Mol Cancer Ther, 7(10), 3343-51" as Hepsin inhibitor), induces multipolar mitoses in a dose dependent manner (see example 4, Fig. 4.1).

Compound 2

In contrast the incubation of PC-3 cells with anti-Hepsin antibody A174, which only binds to the transmembrane Hepsin isoform did not induce multipolar mitoses (see example 5, Fig. 5.1). That finding was not expected and shows that the intracellular enzymatic activity of Hepsin and not the extracellular enzymatic activity of Hepsin alone is responsible for the Hepsin-mediated centrosomal clustering. These data show that targeting an intracellular Hepsin-splice variant is a promising target for the development of a new diagnostic and therapeutic strategy in the clinical management of cancer. Therefore, the invention relates to novel disease associations of an intracellular Hepsin-splice variant to cancer with centrosome amplification. One embodiment of the invention is a screening method for the identification of compounds that modulate or regulate the activity of an intracellular Hepsin-splice variant. The invention also relates to the use of a compound identified by such screening method for the development of pharmaceuticals for the treatment of cancer with centrosome amplification. Another aspect of the invention is a method of diagnosing or determining the presence or predisposition for developing cancer. An increase in the expression level of an intracellular Hepsin-splice variant as compared to a normal control indicates that the subject suffers from or is at risk of developing cancer. For example, normal liver tissue expresses hardly any Hepsin/-TM whereas liver tumours (e.g. HepG2 hepatocellular carcinoma cells) express high amounts of Hepsin/-TM (Fig. 6.1).

Furthermore the invention relates to the identification of Dynactin 4 as an intracellular target of intracellular proteolytic activity of a Hepsin-splice variant and the identification of a Hepsin cleavage site in Dynactin 4. According to the invention the cleavage site can be used in an enzymatic assay to identify compounds that interfere with the intracellular proteolytic activity of a Hepsin splice variant. Detailed description of the invention

Definition of terms

"Hyperproliferative disorders" include but are not limited to haematological tumours, solid tumours and/or metastases thereof, for example: tumours of male reproductive organs, cancers of the respiratory tract, breast cancers, tumours of the digestive tract, tumours of the urinary tract, liver cancers, head and neck cancers, skin cancers, pancreatic cancer, lymphoma, tumours of the female reproductive organs, leukaemia's, and multiple myeloma.

• Examples of breast cancers include, but are not limited to, invasive ductal carcinoma, invasive lobular carcinoma, ductal carcinoma in situ, and lobular carcinoma in situ.

• Examples of cancers of the respiratory tract include, but are not limited to, small-cell and non-small-cell lung carcinoma, as well as bronchial adenoma and pleuropulmonary blastoma.

· Examples of brain cancers include, but are not limited to, brain stem and hypophtalmic glioma, cerebellar and cerebral astrocytoma, medulloblastoma, ependymoma, as well as neuroectodermal and pineal tumour.

• Tumours of the male reproductive organs include, but are not limited to, prostate and testicular cancer.

· Tumours of the female reproductive organs include, but are not limited to, endometrial, cervical, ovarian, vaginal, and vulvar cancer, as well as sarcoma of the uterus.

• Tumours of the digestive tract include, but are not limited to, anal, colon, colorectal, oesophageal, gallbladder, gastric, pancreatic, rectal, small- intestine, and salivary gland cancers.

• Tumours of the urinary tract include, but are not limited to, bladder, penile, kidney, renal pelvis, ureter, urethral and human papillary renal cancers.

• Eye cancers include, but are not limited to, intraocular melanoma and retinoblastoma.

· Examples of liver cancers include, but are not limited to, hepatocellular carcinoma (liver cell carcinomas with or without fibrolamellar variant), cholangiocarcinoma (intrahepatic bile duct carcinoma), and mixed hepatocellular cholangiocarcinoma.

• Skin cancers include, but are not limited to, squamous cell carcinoma, Kaposi's sarcoma, malignant melanoma, Merkel cell skin cancer, and non- melanoma skin cancer.

• Head-and-neck cancers include, but are not limited to, laryngeal, hypopharyngeal, nasopharyngeal, oropharyngeal cancer, lip and oral cavity cancer and squamous cell.

• Lymphomas include, but are not limited to, AIDS-related lymphoma, non- Hodgkin's lymphoma, cutaneous T-cell lymphoma, Burkitt lymphoma,

Hodgkin's disease, and lymphoma of the central nervous system.

• Sarcomas include, but are not limited to, sarcoma of the soft tissue, osteosarcoma, malignant fibrous histiocytoma, lymphosarcoma, and rhabdomyos arcoma.

· Leukemias include, but are not limited to, acute myeloid leukemia, acute lymphoblastic leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, and hairy cell leukemia.

• Unless otherwise defined, the term "cancer" refers to cancers over-expressing the Hepsin/-TM gene or cancers that are characterized by centrosome amplification.

The terms "cancer with supernumerary centrosomes", "cancer with centrosome amplification", "cancer with numeric centrosome aberrations", "centrosome abnormalities", and "centrosomal amplification" have the same meaning and comprise cancer cells which are characterized by the presence of an increased number of centrosomes, i.e. cells un-physiologically harboring more than one centrosome during Gl or S phase and more than two centrosomes during G2 phase and mitosis. Centrosomes can be visualized by immunohistochemistry or immunofluorescence, e.g. by staining for gamma-tubulin as a centrosome marker or centrin-2 as a centriole marker. Centrosome number can be determined by counting gamma-tubulin or centrin-positive spots in cells after immunhistological staining, ideally during mitosis. Centrosome staining is the preferred method. More than 1 centrosome during Gl or S phase and more than 2 centrosomes during G2 phase and mitosis are considered supernumery. During multipolar mitosis, the dividing cells do not only form two spindle poles (= bipolar mitosis) but three or higher numbers of spindle poles.

The term "treating" or "treatment" as stated throughout this document is used conventionally, for example the management or care of a subject for the purpose of combating, alleviating, reducing, relieving, improving the condition of a disease or disorder, such as a carcinoma.

The terms "gene", "polynucleotide", "nucleic acid", and "nucleic acid molecule" are used interchangeably herein to refer to a polymer of nucleic acid residues and, unless otherwise specifically indicated, are referred to by their commonly accepted single- letter codes. The terms apply to nucleic acid (nucleotide) polymers in which one or more nucleic acids are linked by ester bonding. The nucleic acid polymers may be composed of DNA, RNA or a combination thereof and encompass both naturally- occurring and non-naturally occurring nucleic acid polymers. The terms "polypeptide", "peptide", and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms refer to naturally occurring and synthetic amino acids, as well as amino acids analogues and amino acids mimetics amino acid polymers in which one or more amino acid residue is a modified residue, or a non-naturally occurring residue, such as an artificial chemical mimetic of a corresponding naturally occurring amino acid.

The term "amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogues and amino acid mimetics that similarly functions to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those modified after translation in cells (e.g., hydroxyproline, gammacarboxyglutamate, and phosphoserine). The phrase "amino acid analog" refers to compounds that have the same basic chemical structure (an alpha carbon bound to a hydrogen, a carboxyl group, an amino group, and an R group) as a naturally occurring amino acid but have a modified R group or modified backbones (e.g., homoserine, norleucine, methionine, sulfoxide, methionine methyl sulfonium). The phrase "amino acid mimetic" refers to chemical compounds that have different structures but similar functions to general amino acids. Amino acids may be referred to herein by their commonly known three letter symbols or the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission.

Terms "isolated" and "purified" used in relation with a substance (e.g. polypeptide, antibody, polynucleotide, etc.) indicates that the substance is removed from its original environment (e.g., the natural environment if naturally occurring) and thus alternated from its natural state. Examples of isolated nucleic acids include DNA (such as cDNA), RNA (such as mRNA), and derivatives thereof that are substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. In a preferred embodiment, nucleic acid molecules encoding peptides of the present invention are isolated or purified. According to an aspect of the present invention, functional equivalents are also considered to be above "polypeptides". Herein, a "functional equivalent" of a polypeptide is a polypeptide that has a biological activity equivalent to the polypeptide. Namely, any polypeptide that retains the biological ability of the original reference peptide may be used as such a functional equivalent in the present invention.

In the context of the present invention, the phrase "Hepsin gene" and "TMPRSS1 gene" encompass polynucleotides that encode the human hepsin gene or any of the functional equivalents. The human Hepsin gene is located in chromosome 19 (GenBank accession number for chromosome 19, NC_000019) and consists of 14 exons. Transcript variant 1 and 2 (NM_182983 and NM_002151) encode the same transmembrane Hepsin polypeptide (NP_002142 or NP_892028), which consists of 417 amino acids. Hepsin nucleotide sequence data is also available under Entrez Gene IDs: 3249 (Human); 15451 (Mouse); 29135 (Rat). Further synonyms for Hepsin are: type II transmembrane serine protease, serine protease hepsin, serine protease hepsin catalytic chain, serine protease hepsin non-catalytic chain, transmembrane protease serine 1.

The present invention relates to intracellular splice variants/isoforms of Hepsin called "Hepsin/-TM". "Hepsin/- TM" includes all intracellular splice variants/isoforms of the hepsin gene and functional equivalents thereof. The nucleotide sequence and the amino acid sequence of one example of such Hepsin/-TM splice variant is shown in Fig 10.1 - 10.3 (Seq.-ID 1 - 3). Transcript variant 1 (HepsinATM (1); Seq.-ID 1) and Transcript variant 2 (Hepsin/- TM (2); Seq.-ID 2) encode the same transmembrane Hepsin polypeptide. This Hepsin/- TM polypeptide (Hepsin/-TM(p); Seq-ID. 3) lacks the transmembrane domain and consists of 369 amino acids. In the context of the present invention, the phrase "Dynactin 4", and "DCTN4 gene" encompass polynucleotides that encode the human dynactin 4 gene or any of the functional equivalents. Transcript variant 1, 2 and 3 (NM_001135643, NM_016221, and NM_001135644) encode the Dynactin polypeptide isoforms a, b, and c, respectively (NP_001129115, NP_057305, and NP_001129116). Dynactin 4 nucleotide sequence data is also available under Entrez Gene IDs: 51164. Further synonyms for Dynactin 4 are: dynactin 4 (p62), DYN4, P62, dynactin p62 subunit, dynactin subunit 4, dynactin subunit p62.

Obtaining Polypeptides

Hepsin, Hepsin/- TM, and DCTN4 polypeptides can be obtained, for example, by purification from mammalian cells or from cells expressing HepsinATM polynucleotides. The Hepsin gene the Hepsin/-TM gene and DCTN4 gene can be obtained from nature as naturally occurring polynucleotides via conventional cloning methods or through chemical synthesis based on the selected nucleotide sequence. Methods for cloning genes using cDNA libraries and such are well known in the art. All methods described below for obtaining Hepsin/- TM polypeptide can also be applied to obtain Hepsin and functional equivalents thereof or DCTN4 or functional equivalents thereof.

Preparation of Polynucleotides

A HepsinATM polynucleotide can be isolated free of other cellular components such as membrane components, proteins, and lipids. Polynucleotides can be made by a cell and isolated using standard nucleic acid purification techniques, or synthesised using an amplification technique, such as the polymerase chain reaction (PCR), or by using an automatic synthesiser. Methods for isolating polynucleotides are routine and are known in the art. Any such technique for obtaining a poly-nucleotide can be used to obtain isolated Hepsin/- TM polynucleotides. For example, restriction enzymes and probes can be used to isolate polynucleotide fragments, which comprise HepsinATM nucleotide sequences. Isolated polynucleotides are in preparations that are free or at least 70, 80, or 90% free of other molecules.

Hepsin/-TM cDNA molecules can be made with standard molecular biology techniques, using Hepsin/-TM mRNA as a template. Hepsin/-TM cDNA molecules can thereafter be replicated using molecular biology techniques known in the art and disclosed in manuals such as Sambrook et al. (1989). An amplification technique, such as PCR, can be used to obtain additional copies of polynucleotides of the invention, using either genomic DNA or cDNA as a template.

Expression of Polynucleotides

To express a Hepsin/-TM polynucleotide, the polynucleotide can be inserted into an expression vector that contains the necessary elements for the transcription and translation of the inserted coding sequence. Methods that are well known to those skilled in the art can be used to construct expression vectors containing sequences encoding Hepsin/-TM polypeptides and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic re-combination. Such techniques are described, for example, in Sambrook et al. (1989) and in Ausubel et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, N.Y., 1989. A variety of expression vector/host systems can be utilized to contain and express sequences encoding a Hepsin/-TM polypeptide. These include, but are not limited to, microorganisms, such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors, insect cell systems infected with virus expression vectors (e.g., baculovirus), plant cell systems transformed with virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or with bacterial expression vectors (e.g., Ti or pBR322 plasmids), or animal cell systems.

The control elements or regulatory sequences are those non-translated regions of the vector-enhancers, promoters, 5' and 3' untranslated regions-which interact with host cellular proteins to carry out transcription and translation. Such elements can vary in their strength and specificity. Depending on the vector system and host utilized, any number of suitable transcription and translation elements, including constitutive and inducible promoters, can be used. For example, when cloning in bacterial systems, inducible promoters such as the hybrid lacZ promoter of the BLUESCRIPT phagemid (Stratagene, LaJolla, Calif.) or pSPORTl plasmid (Life Technologies) and the like can be used. The baculovirus polyhedrin promoter can be used in insect cells. Promoters or enhancers derived from the genomes of plant cells (e.g., heat shock, RUBISCO, and storage protein genes) or from plant viruses (e.g., viral promoters or leader sequences) can be cloned into the vector. In mammalian cell systems, promoters from mammalian genes or from mammalian viruses are preferable. If it is necessary to generate a cell line that contains multiple copies of a nucleotide sequence encoding a Hepsin/-TM polypeptide, vectors based on SV40 or EBV can be used with an appropriate selectable marker.

Bacterial and Yeast Expression Systems

In bacterial systems, a number of expression vectors can be selected depending upon the use intended for the Hepsin/-TM polypeptide. For example, when a large quantity of a Hepsin/-TM polypeptide is needed for the induction of antibodies, vectors which direct high level expression of fusion proteins that are readily purified can be used. Such vectors include, but are not limited to, multifunctional E. coli cloning and expression vectors such as BLUESCRIPT (Stratagene). In a BLUESCRIPT vector, a sequence encoding the Hepsin/-TM polypeptide can be ligated into the vector in frame with sequences for the amino-terminal Met and the subsequent 7 residues of [beta]-galactosidase so that a hybrid protein is produced. pF vectors (Van Heeke & Schuster, J. Biol. Chem. 264, 5503-5509, 1989) or pGEX vectors (Promega, Madison, Wis.) also can be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST). In general, such fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione. Proteins made in such systems can be designed to include heparin, thrombin, or factor Xa protease cleavage sites so that the cloned polypeptide of interest can be released from the GST moiety at will.

In the yeast Saccharomyces cerevisiae, a number of vectors containing constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH can be used. For reviews, see Ausubel et al. (1989) and Grant et al., Methods Enzymol. 153, 516-544, 1987.

Plant and Insect Expression Systems

If plant expression vectors are used, the expression of sequences encoding Hepsin/- TM polypeptides can be driven by any of a number of promoters. For example, viral promoters such as the 35S and 19S promoters of CaMV can be used alone or in combination with the omega leader sequence from TMV (Takamatsu, EMBO J. 6, 307-311, 1987). Alternatively, plant promoters such as the small subunit of RUBISCO or heat shock promoters can be used (Coruzzi et al., EMBO J. 3, 1671- 1680, 1984; Broglie et al., Science 224, 838-843, 1984; Winter et al., Results Probl. Cell Differ. 17, 85-105, 1991). These constructs can be introduced into plant cells by direct DNA transformation or by pathogen-mediated transfection. Such techniques are described in a number of generally available reviews (e.g., Hobbs or Murray, in MCGRAW HILL YEARBOOK OF SCIENCE AND TECHNOLOGY, McGraw Hill, New York, N.Y., pp. 191-196, 1992).

An insect system also can be used to express a Hepsin/-TM polypeptide. For example, in one such system Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes in Spodoptera frugiperda cells or in Trichoplusia larvae. Sequences encoding Hepsin/-TM polypeptides can be cloned into a non-essential region of the virus, such as the polyhedrin gene, and placed under control of the polyhedrin promoter. Successful insertion of Hepsin/-TM polypeptides will render the polyhedrin gene inactive and produce recombinant virus lacking coat protein. The recombinant viruses can then be used to infect S. frugiperda cells or Trichoplusia larvae in which Hepsin/-TM polypeptides can be expressed (Engelhard et al., Proc. Nat. Acad. Sci. 91, 3224-3227, 1994).

Mammalian Expression Systems

A number of viral-based expression systems can be used to express Hepsin/-TM polypeptides in mammalian host cells. For example, if an adenovirus is used as an expression vector, sequences encoding Hepsin/-TM poly-peptides can be ligated into an adenovirus transcription/translation complex comprising the late promoter and tripartite leader sequence. Insertion in a non-essential El or E3 region of the viral genome can be used to obtain a viable virus that is capable of expressing a Hepsin/- TM polypeptide in infected host cells (Logan & Shenk, Proc. Natl. Acad. Sci. 81, 3655-3659, 1984). If desired, transcription enhancers, such as the Rous sarcoma virus (RSV) enhancer, can be used to increase expression in mammalian host cells.

Specific initiation signals also can be used to achieve more efficient translation of sequences encoding Hepsin/-TM polypeptides. Such signals include the ATG initiation codon and adjacent sequences. In cases where sequences encoding a Hepsin/-TM polypeptide, its initiation codon, and upstream sequences are inserted into the appropriate expression vector, no additional transcriptional or translational control signals may be needed. However, in cases where only coding sequence, or a fragment thereof, is inserted, exogenous translational control signals (including the ATG initiation codon) should be provided. The initiation codon should be in the correct reading frame to ensure translation of the entire insert.

Exogenous translational elements and initiation codons can be of various origins, both natural and synthetic. The efficiency of expression can be enhanced by the inclusion of enhancers which are appropriate for the particular cell system which is used (see Scharf et al., Results Probl. Cell Differ. 20, 125-162, 1994).

Host Cells

A host cell strain can be chosen for its ability to regulate the expression of the inserted sequences or to process the expressed Hepsin/-TM polypeptide in the desired fashion. Such modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation. Post-translational processing which cleaves a "prepro" form of the poly-peptide also can be used to facilitate correct insertion, folding and/or function. Different host cells that have specific cellular machinery and characteristic mechanisms for post- translational activities (e.g., CHO, HeLa, MDCK, HEK293, and W138), are available from the American Type Culture Collection (ATCC; 10801 University Boulevard, Manassas, Va. 20110-2209) and can be chosen to ensure the correct modification and processing of the foreign protein.

Stable expression is preferred for long-term, high-yield production of recombinant proteins. For example, cell lines which stably express Hepsin/-TM poly-peptides can be transformed using expression vectors which can contain viral origins of replication and/or endogenous expression elements and a selectable marker gene on the same or on a separate vector. Following the introduction of the vector, cells can be allowed to grow for 1 -2 days in an enriched medium before they are switched to a selective medium. The purpose of the selectable marker is to confer resistance to selection, and its presence allows growth and recovery of cells which successfully express the introduced Hepsin/-TM sequences. Resistant clones of stably transformed cells can be proliferated using tissue culture techniques appropriate to the cell type. See, for example, ANIMAL CELL CULTURE, R. I. Freshney, ed., 1986.

Any number of selection systems can be used to recover transformed cell lines. These include, but are not limited to, the herpes simplex virus thymidine kinase (Wigler et al., Cell 11 , 223-32, 1977) and adenine phosphoribosyltransferase (Lowy et al., Cell 22, 817-23, 1980) genes. Also, antimetabolite, antibiotic, or herbicide resistance can be used as the basis for selection. For example, dhfr confers resistance to methotrexate (Wigler et al., Proc. Natl. Acad. Sci. 77, 3567-70, 1980), npt confers resistance to the aminoglycosides, neomycin and G-418 (Colbere-Garapin et al., J. Mol. Biol. 150, 1-14, 1981), and als and pat confer resistance to chlorsulfuron and phosphinotricin acetyltransferase, respectively (Murray, 1992, supra). Additional selectable genes have been described. For example, trpB allows cells to utilize indole in place of tryptophan, or hisD, which allows cells to utilize histinol in place of histidine (Hartman & Mulligan, Proc. Natl. Acad. Sci. 85, 8047-51, 1988). Visible markers such as anthocyanins, [beta] -glucuronidase and its substrate GUS, and luciferase and its substrate luciferin, can be used to identify transformants and to quantify the amount of transient or stable protein expression attributable to a specific vector system (Rhodes et al., Methods Mol. Biol. 55, 121-131, 1995). Detecting Expression

Although the presence of marker gene expression suggests that the Hepsin/-TM polynucleotide is also present, its presence and expression may need to be confirmed. For example, if a sequence encoding a Hepsin/-TM poly-peptide is inserted within a marker gene sequence, transformed cells containing sequences that encode a Hepsin/- TM polypeptide can be identified by the absence of marker gene function. Alternatively, a marker gene can be placed in tandem with a sequence encoding a Hepsin/-TM polypeptide under the control of a single promoter. Expression of the marker gene in response to induction or selection usually indicates expression of the Hepsin/-TM poly-nucleotide.

Alternatively, host cells which contain a Hepsin/-TM polynucleotide and which express a Hepsin/-TM polypeptide can be identified by a variety of procedures known to those of skill in the art. These procedures include, but are not limited to, DNA-DNA or DNA-RNA hybridizations and protein bioassay or immunoassay techniques that include membrane, solution, or chip-based technologies for the detection and/or quantification of nucleic acid or protein. For example, the presence of a polynucleotide sequence encoding a Hepsin/-TM polypeptide can be detected by DNA-DNA or DNA-RNA hybridization or amplification using probes or fragments or fragments of polynucleotides encoding a Hepsin/-TM polypeptide. Nucleic acid amplification-based assays involve the use of oligonucleotides selected from sequences encoding a Hepsin/-TM polypeptide to detect transformants that contain a Hepsin/-TM polynucleotide. A variety of protocols for detecting and measuring the expression of a Hepsin/-TM polypeptide, using either polyclonal or monoclonal antibodies specific for the polypeptide, are known in the art. Examples include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and fluorescence activated cell sorting (FACS). immunohistochemical assays, A two-site, monoclonal-based immunoassay using monoclonal antibodies reactive to two non-interfering epitopes on a Hepsin/- TM polypeptide can be used, immunoprecipitations or a competitive binding assay can be employed. These and other assays are described in Hampton et al., SEROLOGICAL METHODS: A LABORATORY MANUAL, APS Press, St. Paul, Minn., 1990) and Maddox et al., J. Exp. Med. 158, 1211-1216, 1983) and typically involve the measurement of complex formation between an immunogen and an antibody that specifically binds to the immunogen.

A wide variety of labels and conjugation techniques are known by those skilled in the art and can be used in various nucleic acid and amino acid assays. Means for producing labelled hybridization or PCR probes for detecting sequences related to polynucleotides encoding Hepsin/-TM polypeptides include oligolabeling, nick translation, end-labelling, or PCR amplification using a labelled nucleotide. Expression and Purification of Polypeptides

Hepsin/-TM polypeptides can be purified from any cell that ex -press the polypeptide, including host cells that have been transfected with Hepsin/-TM expression constructs. Host cells transformed with nucleotide sequences encoding a Hepsin/-TM polypeptide can be cultured under conditions suitable for the expression and recovery of the protein from cell culture. The polypeptide produced by a transformed cell can be secreted or contained intracellularly depending on the sequence and/or the vector used. As will be understood by those of skill in the art, expression vectors containing polynucleotides which encode Hepsin/-TM polypeptides can be designed to contain signal sequences which direct secretion of soluble Hepsin/-TM polypeptides through a prokaryotic or eukaryotic cell membrane or which direct the membrane insertion of membrane-bound Hepsin/-TM polypeptide.

A purified Hepsin/-TM polypeptide is separated from other compounds that normally associate with the Hepsin/-TM polypeptide in the cell, such as certain proteins, carbohydrates, or lipids, using methods well-known in the art. Such methods include, but are not limited to, size exclusion chromatography, ammonium sulphate fractionation, ion exchange chromatography, affinity chromatography, and preparative gel electrophoresis.

As discussed above, other constructions can be used to join a sequence encoding a Hepsin/-TM polypeptide to a nucleotide sequence encoding a polypeptide domain which will facilitate purification of soluble proteins. Such purification facilitating domains include, but are not limited to, metal chelating peptides such as histidine- tryptophan modules that allow purification on immobilized metals, protein A domains that allow purification on immobilized immunoglobulin, and the domain utilized in the FLAGS extension/affinity purification system (Immunex Corp., Seattle, Wash.). Inclusion of cleavable linker sequences such as those specific for Factor Xa or enterokinase (Invitrogen, San Diego, Calif.) between the purification domain and the Hepsin/-TM polypeptide also can be used to facilitate purification. One such expression vector provides for expression of a fusion protein containing a Hepsin/-TM polypeptide and 6 histidine residues preceding a thioredoxin or an enterokinase cleavage site. The histidine residues facilitate purification by IMAC (immobilized metal ion affinity chromatography, as described in Porath et al., Prot. Exp. Purif. 3, 263-281, 1992), while the enterokinase cleavage site provides a means for purifying the Hepsin/-TM polypeptide from the fusion protein. Vectors that contain fusion proteins are disclosed in Kroll et al., DNA Cell Biol. 12, 441-453, 1993. A preparation of purified Hepsin/-TM polypeptides is at least 80% pure; preferably, the preparations are 90%, 95%, or 99% pure. Purity of the preparations can be assessed by any means known in the art, such as SDS-polyacrylamide gel electrophoresis.

Chemical Synthesis

Sequences encoding a Hepsin/-TM polypeptide can be synthesised, in whole or in part, using chemical methods well known in the art (see Caruthers et al., Nucl. Acids Res. Symp. Ser. 215-223, 1980; Horn et al. Nucl. Acids Res. Symp. Ser. 225-232, 1980). Alternatively, a Hepsin/-TM polypeptide itself can be produced using chemical methods to synthesize its amino acid sequence, such as by direct peptide synthesis using solid-phase techniques (Merrifield, J. Am. Chem. Soc. 85, 2149- 2154, 1963; Roberge et al., Science 269, 202-204, 1995). Protein synthesis can be performed using manual techniques or by automation. Automated synthesis can be achieved, for example, using Applied Biosystems 431 A Peptide Synthesizer (Perkin Elmer). Optionally, fragments of Hepsin/-TM polypeptides can be separately synthesised and combined using chemical methods to produce a full-length molecule.

The newly synthesised peptide can be substantially purified by preparative high performance liquid chromatography (e.g., Creighton, PROTEINS: STRUCTURES AND MOLECULAR PRINCIPLES, WH Freeman and Co., New York, N.Y., 1983). The composition of a synthetic Hepsin/-TM polypeptide can be confirmed by amino acid analysis or sequencing (e.g., the Edman degradation procedure; see Creighton, supra). Additionally, any portion of the amino acid sequence of the Hepsin/-TM polypeptide can be altered during direct synthesis and/or combined using chemical methods with sequences from other proteins to produce a variant polypeptide or a fusion protein. Production of Altered Polypeptides

As will be understood by those of skill in the art, it may be advantageous to produce Hepsin/- TM polypeptide-encoding nucleotide sequences possessing non-naturally occurring codons. For example, codons preferred by a particular prokaryotic or eukaryotic host can be selected to increase the rate of protein expression or to produce an RNA transcript having desirable properties, such as a half-life that is longer than that of a transcript generated from the naturally occurring sequence.

The nucleotide sequences disclosed herein can be engineered using methods generally known in the art to alter Hepsin/- TM polypeptide-encoding sequences for a variety of reasons, including but not limited to, alterations which modify the cloning, processing, and/or expression of the polypeptide or mRNA product. DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides can be used to engineer the nucleotide sequences. For example, site- directed mutagenesis can be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, introduce mutations, and so forth.

Intracellular splice variant/isoform of Hepsin as target for the development of pharmaceuticals for the treatment of cancer with centrosome amplification

The present invention relates to the discovery that the intracellular activity and not the extracellular activity of Hepsin is involved in centrosomal clustering. Therefore an intracellular splice variant/isoform of Hepsin (Hepsin/- TM) is a target for the diagnosis and treatment of diseases of uncontrolled cell growth, proliferation and/or survival, or diseases which are accompanied with uncontrolled cell growth, proliferation and/or survival such as haematological tumours, solid tumours, and/or metastases thereof, especially tumors with centrosome amplification.

Over-expression of Hepsin/-TM was detected in breast cancer, colon cancer, liver cancer, and prostate cancer (see Fig. 6.1 ; Li Y et al. Biochim Biophys Acta. 2005 1681(2-3): 157-65) in spite of no expression in normal organs except kidney, brain, and lung tissue. In context of the present invention, it was discovered that the knockdown of Hepsin (including the transmembrane and intracellular isoform of Hepsin) multipolar mitoses only in tumour cell lines with high centrosome amplification but not in tumour cell lines with low centrosome amplification (see Example 3; Figure 3.1). Surprisingly, the incubation of PC-3 cells with the Hepsin inhibitor l-(3-chlorophenyl)-3-{5-[(3,4-dimethylphenoxy)methyl]-l,3,4-thiadiazol-2- yl}urea (Compound 2, described in Chevillet JR et al., Mol Cancer Ther. 2008 Oct;7(10):3343-51. doi: 10.1158/1535-7163.MCT-08-0446, PMID 18852137) but not the incubation with anti-Hepsin antibody A174, which only binds to the transmembrane isoform of Hepsin, inhibited centrosomal clustering. That finding shows that an intracellular enzymatic activity of Hepsin and not an extracellular enzymatic activity of Hepsin is responsible for the Hepsin-mediated centrosomal clustering. Screening for compounds that alter the expression or activity of Hepsin/-TM

Hepsin or Hepsin/- TM polypeptide or functional equivalent thereof (in the following called "HEP-polypeptide"), a Hepsin or Hepsin/- TM polynucleotide or transcriptional regulatory region of the Hepsin or Hepsin/-TM genes can be used to screen test compounds in order to identify candidate compounds that:

· regulate Hepsin/- TM polypeptide expression by binding to the Hepsin/-TM polynucleotide or

• regulate an activity (activation/inhibition/modulation) of a Hepsin/-TM polypeptide by binding to Hepsin/- TM polypeptide or by inhibiting the binding between Hepsin/- TM polypeptide and its binding partners. Test Compounds

Test compounds can be pharmacological agents already known in the art or can be compounds previously unknown to have any pharmacological activity. The compounds can be naturally occurring or designed in the laboratory. They can be isolated from microorganisms, animals, or plants, and can be produced recombinantly, or synthesized by chemical methods known in the art. Examples of test compounds include, but are not limited to, small molecules synthesized by chemical methods, oligo-peptides, peptides, or peptide-like molecules, antibodies or antibody fragments or a polynucleotide such as antisense nucleotide or mRNA molecule. If desired, test compounds can be obtained using any of the numerous combinatorial library methods known in the art, including but not limited to, biological libraries, spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the "one-bead one-compound" library method, and synthetic library methods using affinity chromatography selection. The biological library approach is limited to polypeptide libraries, while the other four approaches are applicable to polypeptide, non-peptide oligomer, or small molecule libraries of compounds. (See Lam, Anticancer Drug Des. 12, 145, 1997).

Methods for the synthesis of molecular libraries are well known in the art (see, for example, DeWitt et al., Proc. Natl. Acad. Sci. U.S.A. 90, 6909, 1993; Erb et al. Proc. Natl. Acad. Sci. U.S.A. 91, 11422, 1994; Zuckermann et al., J. Med. Chem. 37, 2678, 1994; Cho et al., Science 261, 1303, 1993; Carell et al., Angew. Chem. Int. Ed. Engl. 33, 2059, 1994; Carell et al., Angew. Chem. Int. Ed. Engl. 33, 2061; Gallop et al., J. Med. Chem. 37, 1233, 1994). Libraries of compounds can be presented in solution (see, e.g., Houghten, BioTechniques 13, 412-421, 1992), or on beads (Lam, Nature 354, 82-84, 1991), chips (Fodor, Nature 364, 555-556, 1993), bacteria or spores (Ladner, U.S. Pat. No. 5,223,409), plasmids (Cull et al., Proc. Natl. Acad. Sci. U.S.A. 89, 1865-1869, 1992), or phage (Scott & Smith, Science 249, 386-390, 1990; Devlin, Science 249, 404-406, 1990); Cwirla et al., Proc. Natl. Acad. Sci. 97, 6378-6382, 1990; Felici, J. Mol. Biol. 222, 301-310, 1991 ; and Ladner, U.S. Pat. No. 5,223,409).

Compounds isolated and identified by the screening method of the present invention as suitable candidates are expected to reduce, modulate suppress, and/or inhibit the expression of the Hepsin/-TM gene, or the activity of the translation product of the Hepsin/-TM gene, or the binding of the translation product of the Hepsin/-TM gene to its binding partners and thus, are a candidate for either or both of treating and preventing cancer.

In the context of the present invention, compounds to be identified through the present screening methods include any compound or composition including several compounds. Furthermore, the test compound exposed to a cell or protein according to the screening methods of the present invention may be a single compound or a combination of compounds. When a combination of compounds is used in the methods, the compounds may be contacted sequentially or simultaneously. Antibodies

Any type of antibody known in the art can be generated to bind specifically to an epitope of a Hepsin/-TM polypeptide. "Antibody" as used herein includes intact immunoglobulin molecules, as well as fragments thereof, such as but not limited to Fab, Fab', F(ab')2 and Fv fragments, Diabodies, single domain antibodies (DAbs), linear antibodies, single-chain antibody molecules (scFv); multispecific (bi- and tri- specific) antibodies formed from antibody fragments, scFv-Fc comprising antibodies and antibody mimetics such as but not limited to affibodies, adnectins, anticalins, DARPins, avimers, nanobodies which are capable of binding an epitope of a Hepsin/- TM polypeptide.

Methods for generating antibodies are well known in the art. Hepsin/-TM polypeptides can be used to immunize a mammal, such as a mouse, rat, rabbit, guinea pig, monkey, or human, to produce polyclonal antibodies. If desired, a Hepsin/-TM polypeptide can be conjugated to a carrier protein, such as bovine serum albumin, thyroglobulin, and keyhole limpet hemocyanin. Depending on the host species, various adjuvants can be used to increase the immunological response. Such adjuvants include, but are not limited to, Freund's adjuvant, mineral gels (e.g., aluminium hydroxide), and surface active substances (e.g. lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and dinitrophenol). Among adjuvants used in humans, BCG (bacilli Calmette-Guerin) and Corynebacterium parvum are especially useful.

Monoclonal antibodies that specifically bind to a Hepsin/-TM polypeptide can be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These techniques include, but are not limited to, the hybridoma technique, the human B-cell hybridoma technique, and the EBV-hybridoma technique (Kohler et al., Nature 256, 495-497, 1985; Kozbor et al., J. Immunol. Methods 81, 31-42, 1985; Cote et al., Proc. Natl. Acad. Sci. 80, 2026- 2030, 1983; Cole et al., Mol. Cell. Biol. 62, 109-120, 1984).

Alternatively, techniques described for the production of single chain antibodies can be adapted using methods known in the art to produce single chain antibodies that specifically bind to Hepsin/-TM polypeptides. Antibodies with related specificity, but of distinct idiotypic composition, can be generated by chain shuffling from random combinatorial immunoglobin libraries (Burton, Proc. Natl. Acad. Sci. 88, 11120-23, 1991).

Single-chain antibodies also can be constructed using a DNA amplification method, such as PCR, using hybridoma cDNA as a template (Thirion et al., 1996, Eur. J. Cancer Prev. 5, 507-11). Single-chain antibodies can be mono- or bispecific, and can be bivalent or tetravalent. Construction of tetravalent, bispecific single-chain antibodies is taught, for example, in Coloma & Morrison, 1997, Nat. Biotechnol. 15, 159-63. Construction of bivalent, bispecific single-chain antibodies is taught in Mallender & Voss, 1994, J. Biol. Chem. 269, 199-206. Antibodies according to the invention can be purified by methods well known in the art. For example, antibodies can be affinity purified by passage over a column to which a Hepsin/-TM polypeptide is bound. The bound antibodies can then be eluted from the column using a buffer with a high salt concentration.

Antisense Oligonucleotides

Antisense oligonucleotides are nucleotide sequences that are complementary to a specific DNA or RNA sequence. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form complexes and block either transcription or translation. Preferably, an antisense oligonucleotide is at least 11 nucleotides in length, but can be at least 12, 15, 20, 25, 30, 35, 40, 45, or 50 or more nucleotides long. Longer sequences also can be used.

Antisense oligonucleotides can be deoxyribonucleotides, ribonucleotides, or a combination of both. Oligonucleotides can be synthesized manually or by an automated synthesizer, by covalently linking the 5' end of one nucleotide with the 3' end of another nucleotide with non-phosphodiester internucleotide linkages such alkylphosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, alkylphosphonates, phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters. See Brown, Meth. Mol. Biol. 20, 1-8, 1994; Sonveaux, Meth. Mol. Biol. 26, 1-72, 1994; Uhlmann et al., Chem. Rev. 90, 543-583, 1990. Antisense oligonucleotides can be modified without affecting their ability to hybridize to a Hepsin/-TM polynucleotide. These modifications can be internal or at one or both ends of the antisense molecule. For example, inter-nucleoside phosphate linkages can be modified by adding cholesteryl or diamine moieties with varying numbers of carbon residues between the amino groups and terminal ribose. Modified bases and/or sugars, such as arabinose instead of ribose, or a 3',5'-substituted oligonucleotide in which the 3' hydroxyl group or the 5' phosphate group are substituted, also can be employed in a modified antisense oligo-nucleotide. These modified oligonucleotides can be prepared by methods well known in the art. See, e.g., Agrawal et al., Trends Biotechnol. 10, 152-158, 1992; Uhlmann et al., Chem. Rev. 90, 543-584, 1990; Uhlmann et al., Tetrahedron. Lett. 215, 3539-3542, 1987. Screening Methods

The invention provides assays for screening test compounds which

• regulate Hepsin/-TM polypeptide expression by binding to the Hepsin/-TM polynucleotide or

• regulate an biological activity (activation/inhibition/modulation) of a Hepsin/- TM by binding to Hepsin/-TM or by inhibiting the binding between Hepsin/-

TM and one or more of its binding partners.

The screening methods can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtiter plates, test tubes, and microcentrifuge tubes. High throughput screening (HTS) is used for analysing many discrete compounds in parallel, so that large numbers of test compounds can be quickly screened. The most widely established techniques utilise 96- well, 384-well or 1536- well microtiter plates. The wells of the microtiter plates typically require assay volumes that range from 5 to 500 [microjl. In addition to the plates, many instruments, materials, pipettors, robotics, plate washers, and plate readers are commercially available to fit the micro well formats.

Immobilization of HEP-polypeptide

It may be desirable to immobilize the HEP-polypeptide to facilitate separation of bound from unbound forms of one or both of the interactants, as well as to accommodate automation of the assay. Thus, HEP-polypeptide can be bound to a solid support. Suitable solid supports include, but are not limited to, glass or plastic slides, tissue culture plates, microtiter wells, tubes, silicon chips, chips suitable for Surface Plasmon Resonance (SPR, Biacore) or particles such as beads (including, but not limited to, latex, polystyrene, or glass beads). Any method known in the art can be used to attach the enzyme polypeptide to a solid support, including use of covalent and non-covalent linkages, passive absorption, or pairs of binding moieties attached to the polypeptide and the solid support. Such binding moieties attached to the HEP- polypeptide and the solid support, respectively, include, but are not limited to, polyhistidine-tag - transition metal ions, glutathione-S-transferase-tag (GST-tag) - glutathione, or biotin-tag - streptavidin: Polyhistidine-tag (His-tag) - transition metal ions: The amino acid sequence of a His-tag comprises at least 6 histidines, preferable 6 - 14 histidine's. The His- tag can be fused to the N- or C-terminal end of HEP -polypeptide or it can be inserted into an exposed loop of HEP-polypeptide. The imidazole side chains of a His-tag can engage coordinative bonds to certain transition metal ions, such as Ni²⁺-, Co^2"1"-, or Zn²⁺ Iones, Ni²⁺-Ions shows the highest affinity and selectivity for His-tags and are therefore preferred. The avidity of the His-tag increases with the number of histidine' s in the His-tag. Using certain chelators covalently linked to the solid support, the transition metal ion can be immobilized in a way that still allows the transition metal ion to interact with histidine side chains. For example Ni²⁺-Ions can be complexed with

Nitrilotriacetic acid (Ni-NTA). When His-tagged proteins are applied to the transition metal ion matrix, they specifically bind to the resin. Bound proteins can be released from the matrix using mild conditions. Imidazole competes for coordination sites on Ni²⁺ displacing His-tagged proteins from the matrix. Alternatively, lowering pH will protonate His-tags and hence elute the His- tagged proteins.

Glutathione-S-transferase-tag (GST-tag) - glutathione: Glutathione is a tripeptide (Glu-Cys-Gly) that is the specific substrate for glutathione-S- transferase (GST). When reduced glutathione (GSH) is immobilized through its sulfhydryl group to a solid support, such as cross-linked beaded agarose like glutathione sepharose beads or glutathione derivatized microtiter plates,, it can be used to capture GST-tagged HEP-polypeptide via the enzyme- substrate binding reaction. Binding of GST-tagged HEP-polypeptide to Glutathione is most effective in near-neutral buffers (physiologic conditions) such as, but not limited to, Tris-buffered saline (TBS) pH 7.5. Because binding depends on preserving the essential structure and enzymatic function of GST, protein denaturants are not compatible. GST-Hepsin/-TM fusion protein is obtained by the use of an expression vector comprising the GST DNA sequence and the Hepsin/-TM DNA sequence. The result of expression from this vector is a GST-tagged fusion protein in which the functional GST protein (26kDa) is fused to the N-terminus of Hepsin/-TM. Biotin-taq - Streptavidin For example, either a HEP-polypeptide can be immobilized utilizing conjugation of biotin and streptavidin. Biotinylated HEP- polypeptide can be prepared from biotin-NHS(N-hydroxysuccinimide) using techniques well known in the art (e.g., biotinylation kit, EZ-Link kits, Thermo Fisher Scientific.) and immobilized in the wells of streptavidin-coated support such as 96 well plates (Pierce Chemical).

Alternatively, solid supports comprising antibodies which specifically bind to a HEP- polypeptide, but which do not interfere with a desired binding site, such as the active site of the HEP-polypeptide, can be used to attach HEP-polypeptide to the solid support. One embodiment of the invention is a method of screening for a candidate compound useful for treating and/or preventing cancer, wherein a first step comprises contacting a test compound with Hepsin polypeptide, Hepsin/-TM polypeptide or functional equivalent thereof (HEP-polypeptide).

According to the invention screening for compounds that alter the expression or activity of Hepsin/- TM can be performed with any HEP-polypeptide preferably with Hepsin/- TM polypeptide.

According to the invention screening methods can be carried out with a purified HEP-polypeptide, a cell membrane preparation, a cell lysate or intact cells, expressing HEP-polypeptide. A HEP-polypeptide can be naturally occurring in the cell or can be introduced using techniques such as those described above. In a preferred embodiment screening methods are carried out with intact cells. Binding Assays

One embodiment of the invention is a method of screening for a candidate compound useful for treating and/or preventing cancer, comprising the steps of

(i) contacting a test compound with Hepsin polypeptide, Hepsin/-TM polypeptide or functional equivalent thereof,

(ii) detecting the binding of said test compound to said Hepsin polypeptide, Hepsin/- TM polypeptide or functional equivalent thereof, and

(iii) selecting as a candidate compound the test compound that binds to the Hepsin polypeptide, Hepsin/- TM polypeptide, or functional equivalent thereof. According to the invention the test compound can displace a ligand which binds to the HEP-polypeptide or functional equivalent thereof by at least 20%, preferably about 50, more preferably about 75, 90, or 100%. According to the invention the ligand can comprise a label.

In a binding assay an unlabeled test compound can displace a ligand which binds to HEP-polypeptide. The ligand occupies, for example, the active site of the HEP- polypeptide, in a way that normal biological activity is inhibited. Any compound that binds to the HEP-polypeptide with high affinity can be used as ligand. The ligand can comprise a label, such as fluorescent (e.g. Fluorescein, Alexa fluor 532 or Alexa fluor 633), radioisotopic (e.g. 1-125, H-3), chemiluminescent (e.g. Acridinium esters; luminol or isoluminol), or enzymatic label (such as horseradish peroxidase, alkaline phosphatase, or luciferase). The displacement of the labeled ligand by the test compound can be measured for example by fluorescence polarization, direct counting of radioemmission by scintillation counting, or by determining conversion of an appropriate substrate of the enzymatic label. Alternatively, either the test compound or the HEP-polypeptide can comprise the detectable label and detection of a test compound that is bound to the HEP-polypeptide can then be accomplished for example by fluorescence polarization, direct counting of radioemmission by scintillation counting, by determining conversion of an appropriate substrate of the enzymatic label. A test compound that displaces ligand from HEP-polypeptide by at least about 20, preferably about 50, more preferably about 75, 90, or 100% is identified as a candidate compound. Alternatively, binding of a test compound to a Hepsin/-TM polypeptide can be determined without labeling. For example, determining the ability of a test compound to bind to a HEP-polypeptide also can be accomplished using a technology such as real-time Bimolecular Interaction Analysis (BIA) (Sjolander & Urbaniczky, Anal. Chem. 63, 2338-2345, 1991, and Szabo et al., Curr. Opin. Struct. Biol. 5, 699-705, 1995). BIA is a technology for studying biospecific interactions in real time, without labeling any of the interactants (e.g., BIAcore(TM)). Changes in the optical phenomenon surface plasmon resonance (SPR) can be used as an indication of realtime reactions between biological molecules. In order to perform the assay HEP- polypeptide is immobilized to chips suitable for SPR by the use of example, but not limited to His-tag, GST-tag, biotin-tag, or anti-HEP-polypep tide- antibodies as described above.

Screening of test compounds which bind to a HEP-polypeptide can be also carried out with intact cells, a cell membrane preparation, or a cell lysate. Any cell which comprises a HEP-polypeptide can be used for such purpose e.g. in a cell-based assay system. A HEP-polypeptide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Binding of the test compound to a HEP- polypeptide is determined as described above.

Enzyme Assays

One embodiment of the invention is a method of screening for a candidate compound useful for treating and/or preventing cancer, comprising the steps of:

(i) contacting a test compound with Hepsin polypeptide, Hepsin/-TM polypeptide, or functional equivalent thereof (HEP-polypeptide),

(ii) detecting a biological activity of the HEP-polypeptide, and

(iii) selecting as a candidate compound the test compound that inhibits the biological activity of HEP-polypeptide in comparison with the biological activity detected in the absence of the test compound by at least 20%.

Test compounds can be tested for their ability to regulate (modulate, increase or decrease) a biologic activity of a HEP-polypeptide. A test compound that regulates (modulate, increase or decrease) a biologic activity of a HEP-polypeptide by at least about 20, preferably about 50, more preferably about 75, 90, or 100% is identified as candidate compound.

Screening of test compounds which regulates (modulate, increase or decrease) a biologic activity of HEP-polypeptide can be also carried out with intact cells, a cell membrane preparation, or a cell lysate. Any cell which comprises a HEP-polypeptide can be used for such purpose e.g. in a cell-based assay system. A HEP-polypeptide can be naturally occurring in the cell or can be introduced using techniques such as those described above. According to the invention the biological activity can be a peptidase activity. In that case the HEP-polypeptide is contacted with a proteolytic substrate to be cleaved in the presence of a test compound and the proteolytic cleavage of the proteolytic substrate by the HEP-polypeptide is detected.

Hepsin/-TM peptidase activity can be measured by incubating the HEP-polypeptide with an oligopeptide substrate or a naturally occurring hepsin substrate such as Dynactin-4. The substrate can be labeled for example with fluorescent (e.g. Fluorescein, Alexa fluor 532 or Alexa fluor 633), radioisotopic (e.g. 1-125, H-3), chemiluminescent (e.g. Acridinium esters; luminol or isoluminol), or enzymatic label (such as horseradish peroxidase, alkaline phosphatase, or luciferase) label, preferably such label include a pair of FRET (Fluorescence Resonance Energy Transfer) fluorophors as described in literature for different kinds of proteases (e.g. in Jaulent et al., Analytical Biochemistry; 368, 2, September 2007, 130-137). FRET is a mechanism describing energy transfer between two light-sensitive molecules (fluorophors). A donor chromophore, initially in its electronic excited state, may transfer energy to an acceptor chromophore. The efficiency of this energy transfer is inversely proportional to the distance between donor and acceptor, making FRET sensitive to small changes in distance. This phenomena is used to measure the hydrolysis of an oligopeptide, by measurement the fluorescence generated by the hydrolysis of the peptide bound between donor/acceptor pair. In such an assay, HEP- polypeptide mediated cleavage of the oligopeptide substrate leads to an increase of the FRET donor fluorescence and the slope of the increase is proportional to the enzymatic turnover velocity. An inhibition or activation of the enzymatic turnover can be determined by fluorescence readout. An inhibition of the peptidase activity by a test compound of HEP-polypeptide is detected by a decrease in initial slopes in comparison to the initial slope of control reaction without test compound. IC50 values are determined by plotting the compound concentration versus the percentage of inhibition of peptidase activity by interpolation. The concentration of added inhibitor which caused a 50% decrease in the initial peptidase activity is defined as IC50 value.

According to the invention the proteolytic substrate can be either a synthetic oligopeptide substrate or an intracellularly expressed hepsin substrate.

Oligopeptide substrate

According to the invention an oligopeptide substrate comprises at least one

Hepsin cleavage site.

Furthermore according to the invention said oligopeptide substrate comprises 8 to 14 amino acids, preferably 8 to 10 amino acids and at least one basic amino acid of general formula (1)

wherein

X and Y: means any amino acids

B: means any basic amino acid

R: means arginine

m: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13

n: 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12

p: 0, 1 or 2

q: 1 or 2

"Amino acids" mean naturally occurring and synthetic amino acids, as well as amino acids analogues and amino acids mimetics amino acid polymers in which one or more amino acid residue is a modified residue, or a non-naturally occurring residue, such as an artificial chemical mimetic of a corresponding naturally occurring amino acid.

Further oligopeptide substrates are oligopeptides of formula (1), wherein B is selected from the group of arginine, lysine, asparagine, and glutamine. Further preferred oligopeptide substrates are oligopeptides of formula (1), wherein m: 2, 3, 4, 5, or 6

p: 0

Further oligopeptide substrates are oligopeptides of formula (1), wherein p: 2

q: l

Further oligopeptide substrates are oligopeptides of formula (1), selected from a group of

QRPRAGAS LQRPRAGASIST

RMRRYADA

LTAPRSLRRS

ARRHSDGT

AATRRQAV QLQKRFGG

RQRYGKRS

LRNRAQSG

According to the invention the oligopeptide substrate of formula (1) can be labelled with at least one label such as fluorescent (e.g. Fluorescein, Alexa fluor 532 or Alexa fluor 633), radioisotopic (e.g. 1-125, H-3), chemiluminescent (e.g.

Acridinium esters; luminol or isoluminol), or enzymatic label (such as horseradish peroxidase, alkaline phosphatase, or luciferase) label, preferably with a pair of Fluorescence Resonance Energy Transfer fluorophors such as EDANS (5-((2- Aminoethyl)amino)-naphthalene- 1 -sulfonic acid) as donor moiety attached to the N-terminal side of the cleavage site and DABCYL (4-((4-

(dimethylamino)phenyl)azo)benzoic acid) as acceptor moiety attached to the C- terminus of cleavage site resulting for e.g. into the oligopeptide substrate DABCYL- RMRRYADA-(Glu)EDANS.

Intracellular ly expressed Hepsin substrate

One embodiment of the invention is a method of screening for a candidate compound useful treating and/or preventing cancer, comprising the steps of: (i) contacting a cell expressing Hepsin/-TM polypeptide or functional equivalent thereof and expressing intracellularly a proteolytic substrate comprising a hepsin cleavage site

(ii) detecting the proteolytic cleavage of the substrate by the Hepsin/-TM polypeptide or functional equivalent thereof, and

(iii) selecting as a candidate compound the test compound that inhibits the proteolytic activity of Hepsin/- TM polypeptide or functional equivalent thereof in comparison with the proteolytic activity detected in the absence of the test compound. The utilization of a cell based assay with an intracellularly expressed proteolytic substrate of Hepsin/- TM can be used to screen for a candidate compound, which specifically inhibits/activates the proteolytic activity of Hepsin/-TM polypeptide or functional equivalent thereof. The proteolytic substrate can be an intracellular target of Hepsin/-TM such as Dynactin 4. An antibody binding specifically to the Hepsin cleavage site of the substrate or binding specifically to a proteolytic product can be used to determine the Hepsin/-TM proteolytic activity. The antibody can be labeled for example with a fluorescent label (e.g. Fluorescein, Alexa fluor 532 or Alexa fluor 633), radioisotopic (e.g. 1-125, H-3), chemiluminescent (e.g. Acridinium esters; luminol or isoluminol) or enzymatic label (such as horseradish peroxidase, alkaline phosphatase, or luciferase) label.

Such an antibody can be used for analyses of the proteolytic activity of Hepsin- TM polypeptide in an ELISA, radioimmune assay, or Western Blot. Peptides comprising a Hepsin/-TM cleavage site can be used to generate an antibody which specifically binds to the cleavage site. Alternatively, an oligopeptide substrate comprising a Hepsin cleavage site for example the cleavage site in Dynactin 4 can be used. Such an oligopeptide substrate can be constructed as a reporter substrate which comprises the oligopeptide substrate. A reporter substrate can be a blue fluorescent-green- fluorescent-fusion construct such as, but not limited to, pCasper3-BG system (Evrogen, Moscow, Russia; published in Subach OM, Gundorov IS, Yoshimura

M, Subach FV, Zhang J, Griienwald D, Souslova EA, Chudakov DM, Verkhusha VV. Chem Biol. 2008 Oct 20;15(10): 1116-24) or the proteolytic cleavage is detected by activation of a luciferase construct carrying a Hepsin cleavage site (GloSensor system, Promega, Mannheim, Germany; published in Wigdal SS, Anderson JL, Vidugiris GJ, Shultz J, Wood KV, Fan F. Curr Chem Genomics. 2008 Oct 17;2:16-28). According to the invention the proteolytic substrate can be Dynactin 4 polypeptide or functional equivalent thereof. Alternatively, according to the invention the proteolytic substrate is reporter substrate, preferably a blue-fluorescent-green- fluorescent fusion construct, comprising a Hepsin cleavage site in Dynactin 4.

In the course of the invention, Dynactin 4 was identified as an intracellular target of Hepsin proteolytic activity (see example 7). The amino acid sequence

QRPR/AGAS was identified as cleavage site of Hepsin in Dynactin 4 (Example 8). Dynactin 4 itself or polypeptides comprising a Hepsin cleavage site of Dynactin 4 can be used to measure the intracellular activity of Hepsin/-TM polypeptide, either by direct measurement of Dynactin 4 cleavage or by measurement of the cleavage of an intracellular reporter substrate comprising the cleavage site of Hepsin in Dynactin 4.

Assays for the identification of Hepsin/-TM binding partners, which can be potential HepsinZ-TM substrates

A Hepsin/- TM polypeptide can be used as a "bait protein" in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Pat. No. 5,283,317; Zervos et al.,

Cell 72, 223-232, 1993; Madura et al., J. Biol. Chem. 268, 12046-12054, 1993; Bartel et al., BioTechniques 14, 920-924, 1993; Iwabuchi et al., Oncogene 8, 1693-1696, 1993; and Brent W094/10300), to identify other proteins which bind to or interact with the Hepsin/- TM polypeptide and regulate its activity. The two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains. Briefly, the assay utilizes two different DNA constructs. For example, in one construct, a polynucleotide encoding a Hepsin/-TM polypeptide can be fused to a polynucleotide encoding the DNA binding domain of a known transcription factor (e.g., GAL-4). In the other construct a DNA sequence that encodes an unidentified protein ("prey" or "sample") can be fused to a polynucleotide that codes for the activation domain of the known transcription factor. If the "bait" and the "prey" proteins are able to interact in vivo to form a protein-dependent complex, the DNA-binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g., LacZ), which is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected, and cell colonies containing the functional transcription factor can be isolated and used to obtain the DNA sequence encoding the protein that interacts with the Hepsin/-TM polypeptide. Methods for detecting such complexes include immunodetection of complexes using antibodies which specifically bind to the Hepsin/-TM polypeptide or test compound, and SDS gel electrophoresis under non-reducing conditions.

Gene Expression

Test compounds can be tested for their ability to increase or decrease Hepsin/-TM gene expression. A Hepsin/-TM polynucleotide is contacted with a test compound, and the expression of an RNA or polypeptide product of the Hepsin/-TM polynucleotide is determined. The level of expression of appropriate mRNA or polypeptide in the presence of the test compound is compared to the level of expression of mRNA or polypeptide in the absence of the test compound. The test compound can then be identified as a regulator of expression based on this comparison. For example, when expression of mRNA or polypeptide is greater in the presence of the test compound than in its absence, the test compound is identified as a stimulator or enhancer of the mRNA or polypeptide expression. Alternatively, when expression of the mRNA or polypeptide is less in the presence of the test compound than in its absence, the test compound is identified as an inhibitor of the mRNA or polypeptide expression.

The level of Hepsin/-TM mRNA or polypeptide expression in the cells can be determined by methods well known in the art for detecting mRNA or polypeptide. Either qualitative or quantitative methods can be used. The presence of polypeptide products of a Hepsin/-TM polynucleotide can be determined, for example, using a variety of techniques known in the art, including immuno-chemical methods such as radioimmunoassay, Western blotting, and immunohistochemistry. Alternatively, polypeptide synthesis can be determined in vivo, in a cell culture, or in an in vitro translation system by detecting incorporation of labeled amino acids into a Hepsin/- TM polypeptide.

Such screening can be carried out either in a cell-free assay system or in an intact cell. Any cell that expresses a Hepsin/-TM polynucleotide can be used in a cell-based assay system. The Hepsin/-TM polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Either a primary culture or an established cell line, such as CHO or human embryonic kidney 293 cells, can be used. Method of treatment of cancer with centrosome amplification

One embodiment of the invention is a compound, which has been identified by one of the methods described above, for use in the treatment of cancer with centrosome amplification.

Another embodiment of the invention is the use of a compound, which has been identified by one of the methods described above, for the manufacture of a medicament for the treatment of cancer with centrosome amplification.

Another embodiment of the invention is a method for the treatment of cancer with centrosome amplification comprising administering an effective amount of a compound, which has been identified by one of the methods described above. According to the invention said compound regulates a biological activity (activation/inhibition/modulation) of Hepsin/-TM by binding to Hepsin/-TM polypeptide or by inhibiting the binding between Hepsin/-TM polypeptide and one or more of its binding partners. Alternatively, said compound regulate Hepsin/-TM polypeptide expression by binding to the Hepsin/-TM polynucleotide or According to the invention said compound is selected from a small molecule synthesized by chemical methods, a RNA molecule, an antisense nucleotide, a polypeptide or peptide-like molecule and an antibody or an antibody fragment.

According to the invention cancer with centrosome amplification include haematological tumours, solid tumours and/or metastases thereof, comprising: tumours of male reproductive organs, cancers of the respiratory tract, breast cancers, tumours of the digestive tract, tumours of the urinary tract, liver cancers, head and neck cancers, skin cancers, pancreatic cancer, lymphoma, tumours of the female reproductive organs, leukaemia's, and multiple myeloma, including primary tumours and metastases. Permeation of cell membrane

A compound that is able to regulate a biological activity (activation/inhibition/ modulation) of an intracellular target needs to permeate/diffuse through/cross a cell membrane. The compound can permeate the cell membrane via simple passive diffusion or by active transport by carrier proteins imbedded in the membrane. Assays for prediction of cell permeability of a compound, such as the Caco-2 cell permeability assay (Wang Z. et al. J Mass Spectrom. 2000 Jan;35(l):71-6), are well known in the art. Methods for modifying a compound in order to increase the cell permeability of the compound are also well known in the art.

Dose and administration

Based upon standard laboratory techniques known to evaluate compounds useful for the treatment of hyper-proliferative disorders, such as standard toxicity tests, standard pharmacokinetic tests and by standard pharmacological assays for the determination of treatment of the conditions identified above in mammals, and based on comparison of these results with the results of known medicaments that are used to treat these conditions, the effective dosage of the compounds of this invention can readily be determined for treatment of each desired indication. The amount of the active ingredient to be administered in the treatment of one of these conditions can vary widely according to such considerations as the particular compound and dosage unit employed, the mode of administration, the period of treatment, the age and sex of the patient treated, and the nature and extent of the condition treated.

Of course the specific initial and continuing dosage regimen for each patient will vary according to the nature and severity of the condition as determined by the attending diagnostician/physician, the activity of the specific compound employed, the age and general condition of the patient, time of administration, route of administration, rate of excretion of the drug, drug combinations, and the like. The desired mode of treatment and number of doses of a compound of the present invention or a pharmaceutically acceptable salt or ester or composition thereof can be ascertained by those skilled in the art using conventional treatment tests.

Methods of testing for a particular pharmacological or pharmaceutical property are well known to persons skilled in the art. Pharmaceutical Compositions

The invention also provides pharmaceutical compositions that can be administered to a patient to achieve a therapeutic effect. Pharmaceutical compositions of the invention can comprise, for example, a small molecule, a polypeptide,

polynucleotide, such as antisense nucleotides or RNA molecules, antibodies or antibody fragments which inhibits the expression of the Hepsin/-TM gene for example via binding to the Hepsin/-TM gene or inhibits an activity of the Hepsin/- TM gene product, such as proteolytic activity of Hepsin/-TM. Pharmaceutical compositions of the invention can be utilized to inhibit, block, reduce, decrease, etc., cell proliferation and/or cell division, and/or produce apoptosis. The compositions can be administered alone or in combination with at least one other agent, such as stabilizing compound, which can be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water. The compositions can be administered to a patient alone, or in combination with other agents, drugs or hormones. It is possible for the compounds according to the invention to have systemic and/or local activity. For this purpose, they can be administered in a suitable manner, such as, for example, via the oral, parenteral, pulmonary, nasal, sublingual, lingual, buccal, rectal, vaginal, dermal, transdermal, conjunctival, otic route or as an implant or stent.

For these administration routes, it is possible for the compounds according to the invention to be administered in suitable administration forms.

For oral administration, it is possible to formulate the compounds according to the invention to dosage forms known in the art that deliver the compounds of the invention rapidly and/or in a modified manner, such as, for example, tablets (uncoated or coated tablets, for example with enteric or controlled release coatings that dissolve with a delay or are insoluble), orally-disintegrating tablets, films/wafers, films/lyophylisates, capsules (for example hard or soft gelatine capsules), sugar- coated tablets, granules, pellets, powders, emulsions, suspensions, aerosols or solutions. It is possible to incorporate the compounds according to the invention in crystalline and/or amorphised and/or dissolved form into said dosage forms. Parenteral administration can be effected with avoidance of an absorption step (for example intravenous, intraarterial, intracardial, intraspinal or intralumbal) or with inclusion of absorption (for example intramuscular, subcutaneous, intracutaneous, percutaneous or intraperitoneal). Administration forms which are suitable for parenteral administration are, inter alia, preparations for injection and infusion in the form of solutions, suspensions, emulsions, lyophylisates or sterile powders.

Examples which are suitable for other administration routes are pharmaceutical forms for inhalation [inter alia powder inhalers, nebulizers], nasal drops, nasal solutions, nasal sprays; tablets/films/wafers/capsules for lingual, sublingual or buccal administration; suppositories; eye drops, eye ointments, eye baths, ocular inserts, ear drops, ear sprays, ear powders, ear-rinses, ear tampons; vaginal capsules, aqueous suspensions (lotions, mixturae agitandae), lipophilic suspensions, emulsions, ointments, creams, transdermal therapeutic systems (such as, for example, patches), milk, pastes, foams, dusting powders, implants or stents.

The compounds according to the invention can be incorporated into the stated administration forms. This can be effected in a manner known per se by mixing with inert, non-toxic, pharmaceutically suitable adjuvants. These adjuvants include, inter alia,

• fillers and excipients (for example cellulose, microcrystalline cellulose (such as, for example, Avicel^®), lactose, mannitol, starch, calcium phosphate (such as, for example, Di-Cafos^®)),

• ointment bases (for example petroleum jelly, paraffins, triglycerides, waxes, wool wax, wool wax alcohols, lanolin, hydrophilic ointment, polyethylene glycols),

• bases for suppositories (for example polyethylene glycols, cacao butter, hard fat) solvents (for example water, ethanol, isopropanol, glycerol, propylene glycol, medium chain-length triglycerides fatty oils, liquid polyethylene glycols, paraffins),

surfactants, emulsifiers, dispersants or wetters (for example sodium dodecyl sulphate), lecithin, phospholipids, fatty alcohols (such as, for example, Lanette^®), sorbitan fatty acid esters (such as, for example, Span^®), polyoxyethylene sorbitan fatty acid esters (such as, for example, Tween^®), polyoxyethylene fatty acid glycerides (such as, for example, Cremophor^®), polyoxethylene fatty acid esters, polyoxyethylene fatty alcohol ethers, glycerol fatty acid esters, poloxamers (such as, for example, Pluronic^®),

buffers, acids and bases (for example phosphates, carbonates, citric acid, acetic acid, hydrochloric acid, sodium hydroxide solution, ammonium carbonate, trometamol, triethanolamine),

isotonicity agents (for example glucose, sodium chloride),

adsorbents (for example highly-disperse silicas)

viscosity-increasing agents, gel formers, thickeners and/or binders (for example polyvinylpyrrolidone, methylcellulose, hydroxypropyl- methylcellulose, hydroxypropylcellulose, carboxymethylcellulose-sodium, starch, carbomers, polyacrylic acids (such as, for example, Carbopol^®); alginates, gelatine),

disintegrants (for example modified starch, carboxymethylcellulose-sodium, sodium starch glycolate (such as, for example, Explotab^®), cross- linked polyvinylpyrrolidone, croscarmellose-sodium (such as, for example, AcDiSol^®)),

flow regulators, lubricants, glidants and mould release agents (for example magnesium stearate, stearic acid, talc, highly-disperse silicas (such as, for example, Aerosil^®)),

coating materials (for example sugar, shellac) and film formers for films or diffusion membranes which dissolve rapidly or in a modified manner (for example polyvinylpyrrolidones (such as, for example, Kollidon^®), polyvinyl alcohol, hydroxypropylmethylcellulose, hydroxypropylcellulose, ethyl- cellulose, hydroxypropylmethylcellulose phthalate, cellulose acetate, cellulose acetate phthalate, polyacrylates, polymethacrylates such as, for example, Eudragit^®)),

• capsule materials (for example gelatine, hydroxypropylmethylcellulose),

• synthetic polymers (for example polylactides, polyglycolides, polyacrylates, polymethacrylates (such as, for example, Eudragit^®), polyvinylpyrrolidones

(such as, for example, Kollidon^®), polyvinyl alcohols, polyvinyl acetates, polyethylene oxides, polyethylene glycols and their copolymers and blockcopolymers) ,

• plasticizers (for example polyethylene glycols, propylene glycol, glycerol, triacetine, triacetyl citrate, dibutyl phthalate),

• penetration enhancers,

• stabilisers (for example antioxidants such as, for example, ascorbic acid, ascorbyl palmitate, sodium ascorbate, butylhydroxyanisole, butylhydroxy- toluene, propyl gallate),

· preservatives (for example parabens, sorbic acid, thiomersal, benzalkonium chloride, chlorhexidine acetate, sodium benzoate),

• colourants (for example inorganic pigments such as, for example, iron oxides, titanium dioxide),

• flavourings, sweeteners, flavour- and/or odour-masking agents. The present invention furthermore relates to medicaments which comprise at least one compound according to the invention, conventionally together with one or more inert, non-toxic, pharmaceutically suitable adjuvants, and to their use according to the present invention. Further excipients and procedures are described in the following references, each of which is incorporated herein by reference: Powell, M.F. et al., "Compendium of Excipients for Parenteral Formulations" PDA Journal of Pharmaceutical Science & Technology 1998, 52(5), 238-311 ; Strickley, R.G "Parenteral Formulations of Small Molecule Therapeutics Marketed in the United States (1999)-Part-1 " PDA Journal of Pharmaceutical Science & Technology 1999, 53(6), 324-349 ; and Nema, S. et al, "Excipients and Their Use in Injectable Products" PDA Journal of Pharmaceutical Science & Technology 1997, 51(4), 166- 171. Method for diagnosing cancer

One embodiment of the invention is a method for determining whether a subject having cancer or a predisposition for developing cancer, said method comprising

(i) determining an expression level of a Hepsin/-TM gene in a biological sample derived from said subject and

(ii) comparing the expression level of a Hepsin/-TM gene in said sample with the expression level of a polynucleotide encoding Hepsin/-TM of a sample derived from a healthy control,

wherein an increase of at least 10% in said expression level in said subject-derived biological sample compared to said healthy control sample indicates that said subject suffers from or is at a risk of developing cancer.

According to the invention an increase of the expression level of an Hepsin/-TM gene in the subject derived sample of at least 10 %, preferably of at least 15% or at least 20% compared to the expression level of an Hepsin/-TM gene in the healthy control derived sample indicates that said subject suffers from or is at a risk of developing cancer.

According to the invention the biological sample can be a biopsy specimen, saliva, sputum, blood, serum, plasma, pleural effusion or urine sample.

According to the invention the said expression level can be determined by detecting the amount of:

(a) an mRNA encoded by the Hepsin/-TM gene,

(b) a polypeptide encoded by the Hepsin/-TM gene, or

(c) a biological activity of a polypeptide encoded by the Hepsin/-TM gene.

According to the invention the amount of Hepsin/-TM polynucleotide in the biological sample can be determined by the use of

(i) quantitative polymerase chain reaction or

(ii) quantitative RNA sequencing.

The amount of Hepsin/-TM polynucleotides in a sample can be determined by direct quantitative sequencing methods. Total RNA or, preferably, mRNA is isolated from biological sample of interest. Any RNA isolation technique that does not select against the isolation of mRNA may be utilized for the purification of such RNA samples. See, for example, Ausubel et al., ed., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, Inc. New York, 1987-1993. Large numbers of tissue samples may readily be processed using techniques well known to those of skill in the art, for example, the single-step RNA isolation process of Chomczynski, U.S. Pat. No. 4,843,155. Transcripts within the collected RNA samples that represent RNA produced by Hepsin/-TM gene are identified by methods well known to those skilled in the art. They include, for example but not limited to, direct quantitative sequencing methods, such as quantitative RT (real time)-PCR. Such nucleic acid amplification-based methods are well known to those skilled in the art and involve the use of oligonucleotides selected from sequences encoding a Hepsin/-TM polypeptide to detect transformants that contain a Hepsin/-TM polynucleotide.

According to the invention expression level of a Hepsin/-TM gene can be determined by the analyses of the amount of Hepsin/-TM polypeptide in the biological sample by the use of

(i) immunoblotting,

(ii) an antibody-based assay, such as ELISA or RIA.

The amount of Hepsin/-TM polypeptide can be determined by methods using either polyclonal or monoclonal antibodies specific for the Hepsin/-TM polypeptide. Examples for such methods include but are not limited to enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), fluorescence activated cell sorting (FACS), and immunohistochemical assays. These and other assays are well known in the art and for example described in Hampton et al., SEROLOGICAL METHODS: A LABORATORY MANUAL, APS Press, St. Paul, Minn., 1990 and Maddox et al., J. Exp. Med. 158, 1211-1216, 1983. Such methods typically involve the measurement of complex formation between an immunogen and an antibody that specifically binds to the immunogen.

Another embodiment of the invention is a kit for conducting method for detecting an expression level of a Hepsin/-TM gene in a biological sample as described above. According to the invention the kit can comprise a reagent selected from the group consisting of:

(a) a reagent for detecting an mRNA encoded by the Hepsin/-TM gene; (b) a reagent for detecting a polypeptide encoded by the Hepsin/-TM gene and

(c) a reagent for detecting a biological activity of the polypeptide encoded by the Hepsin/-TM gene.

The reagent can be a probe or primer set that bind to the mRNA of the Hepsin/- TM gene or an antibody or antibody fragment against the protein encoded by the Hepsin/- TM gene or a fragment thereof.

Brief description of the drawings

Fig 1.1: Cell number of PC-3 which were transfected with 4 different Hepsin siRNA 's for 6 days are shown. Untreated control (column 1), lipofection control (column 2), non-target siRNA control (column 3), Hepsin siRNA #1 (column 4), Hepsin siRNA #2 (column 5), Hepsin siRNA #3 (column 6), Hepsin siRNA #4 (column 7)

Fig 1.2: The apoptotic index compared to control for PC-3 cells which were transfected with 4 different Hepsin siRNA 's for 6 days are shown. Untreated control (column 1), lipo control (column 2), non-target siRNA control (column 3), Hepsin siRNA #1 (column 4), Hepsin siRNA #2 (column 5), Hepsin siRNA #3 (column 6), Hepsin siRNA #4 (column 7) is shown.

Fig: 2.1: Pictures of cell colonies which were transfected with the following shRNA's: shQiagen (column 1), shHepsin #1790 (column 2), shHepsin #1795 (column3), shHepsin #1796 (column 4). Pictures of crystal violet stained cell colonies were taken 2-4 weeks of growth when colonies were clearly visible. The following cell lines were used: PC-3 (row a), DU145 (row b), MCF10A (row c), HaCat (row d)

Fig. 3.1: The Multipolarity (% of counted mitoses) determined 2 days after transfection with either control siRNA (siLuciferase, grey columns) or Hepsin targeting siRNA (siHepsin, black columns) is shown. The following cell lines with high centrosome amplification were used: SCC114 (column 1), MDA-MB-231 (column 2), DU145 (column 3), PC-3 (column 4). The following cell lines with low centrosome amplification were used: MCF7 (column 5), hTERT-RPE (column 6), BJ (column 7). Fig. 4.1: Multipolar mitosis [% of counted mitoses] of PC-3 cells incubated with Compound 2 for 24 h is shown. Columnl : DMSO control, Column2 10 μΜ compound 2, Column3 50 μΜ compound 2, Column4 100 μΜ compound 2

Fig 5.1.: Multipolar mitosis [% of counted mitoses] of PC-3 cells incubated with an isotype control (column 1) the inactive anti-Hepsin-antibody 94A7 (column 2) or the active anti-Hepsin-antibody 174A6 (column 3) for 24 h is shown. The following concentrations of the antibodies were used: 0.7 nM (light grey columns), 70 nM (dark grey columns), and 700 nM (black columns).

Fig. 6.1 mRNA levels of Hepsin (grey bars) and Hepsin/- TM (black bars) normalized to HMBS (hydroxymethylbilane synthase) in the following cell lines: 1) CaCo2 (human epithelial colorectal adenocarcinoma), 2) DU145 (human prostate carcinoma); 3) HT29 (human colon adenocarcinoma), 4) LoVo (human colon adenocarcinoma), 5) Lsl74T(human colorectal adenocarcinoma), 6) MDA MB 231 (human mammary adenocarcinoma), 7) SW403 (human colon adenocarcinoma), 8) Hep G2 (human hepatocellular carcinoma), 9) PC-3 (human prostate adenocarcinoma). Depicted are delta Ct values (cycle threshold values, i.e. intersection of the amplification curve and the predefined threshold line of Hepsin or Hepsin/- TM, respectively, normalized to the Ct value of HMBS) of the respective cell lines. Fig. 7.1: Diagonal 2 D gel with in gel digest with Hepsin of PC-3 whole cell lysate.

Numbers indicate the spots that were excised and analyzed by mass spectrometry.

PC-3 whole cell lysates were separated in a 10% acrylamide gel. After completion of the run, the lane was completely excised, SDS was removed and the gel was incubated over night with 100 nM Hepsin at 37°C. Gel lane was poured into a new SDS gel and a second gel run was performed. After completion of the run the gel was silver stained. Spots from an untreated and a Hepsin digested gel were compared.

New spots (marked with 1-7 on the gel) were excised and analyzed by mass spectrometry.

Fig. 8.1: The amino acid sequence of Dynactin 4 (Isoform b) modified with a FLAG- taq is shown. The polypeptide was used to identify the hepsin cleavage site between Arginine and alanine (shown in bold). Fig. 9.1: The inhibition of Hepsin peptidase activity by antibody A174 in comparison to Hepsin peptidase activity without A 174 (control reaction) is plotted over logarithmic concentration of A 174.

Fig. 10.1: The nucleotide sequence of the intracellular splice variant Hepsin/-TM(1) transcript variant 1 is shown.

Fig. 10.2: The nucleotide sequence of the intracellular splice variant Hepsin/- TM(2) transcript variant 2 is shown.

Fig. 10.3: The amino acid sequence of the intracellular splice variant Hepsin/- TM(p) is shown. Transcript variant 1 and 2 (FiglO.l and Fig 10.2) encode the same Hepsin/- TM polypeptide which lacks the transmembrane domain and consists of 369 amino acids.

Examples

Example 1: Hepsin short-term knockdown induces apoptosis and inhibits proliferation

PC-3 cells were plated at 150.000 cells per well on 6well plates in 2 ml of RPMI-1640 (PAA # E15-840), L-glutamine (PAA # Ml 1-004) 10% FCS (PAA # A15-023) and Penicillin/Streptomycin (PAA # PI 1-01). After 24 hours they were transfected with DharmaFECT 2 transfection reagent (Dharmacon # T-2002-03) according to the manufacturer. In brief, 2.5 μΐ siRNA and OptiMEM (Gibco # 11058; ad 200 μΐ) (25 nM siRNA) were mixed with 1,5 μΐ DharmaFECT 2 and OptiMEM (ad 200 μΐ) and incubated at room temperature for 20 minutes. This mixture was added to the cells and cells were cultivated for 60 hours at 37°C in an incubator. The following siRNAs were used:

Hepsin siRNA #1 Dharmacon # D-004332-01

Hepsin siRNA #2 Dharmacon # D-004332-02

Hepsin siRNA #3 Dharmacon # D-004332-03

Hepsin siRNA #4 Dharmacon # D-004332-04

NT (non target) siRNA #1 Dharmacon # D-001810-01-05

For the assays cells were trypsinized from the plates, counted and plated on 96well plates at cell densities of 1500 and 3000 cells/ well (triplicates) for crystal violet growth curves and Cell Death Detection ELISA (AE), respectively.

Crystal violet growth curves:

Material:

11 % Glutaraldehyde, Sigma G7651, 0,1 % Kristallviolett pH 4,5, Sigma C3886, 30x stock solution diluted 0,1 % with H20, 10% Acetic acid, Merck, Infinite M200 Plate Reader, TECAN. Protocol:

Cells were fixed by addition of 1/10 volume of 11% gluteraldehyde (final concentration 1 %) to the medium and incubation for 30 min at room temperature. Glutaraldehyde was removed and the plate was washed with water 3 times and subsequently dried. 100 μΐ 0.1 % crystal violet solution was added and 30 min incubated at room temperature. The crystal violet staining solution was removed and the plates were washed with water 3 times and subsequently dried. 100 μΐ 10% acetic acid were added to dissolve the crystal violet and after 10 min incubation at room temperature the plates were read at 595 nm in a plate reader. Cell Death Detection ELISAPLUS

Material

Cell death Detection ELISAPLUS Roche # 11 774 425 001, Kit for 96 tests, Infinite M200 Plate Reader Fa. TECAN

Protocol:

96well plate with cells was centrifuged for 10 min at 200 x g. Supernatant was removed, 200 μΐ lysis buffer (kit component) was added to the cells and the cells were incubated for 30 min at room temperature. The plate was centrifuged at 200 x g for 10 min. 20 μΐ of the lysate were transferred to the pre-coated strips (kit component) and 80μ1 of immunoreagent (prepared from kit components) was added. After incubation for 2 h at room temperature the solution was removed and washed 3 times with 250 μΐ incubation buffer (kit component). ΙΟΟμΙ ABTS solution was added and after 10-20 min incubation at room temperature in the dark 100 μΐ stop solution (kit components) was added. OD was measured at 405nm with reference wave length of 490nm. The apoptotic index (apoptosis, normalized to cell number) was calculated by normalizing measured apoptosis (by Cell Death ELISA) to crystal violet measurement.

Results

1) Hepsin knockdown results in strong antiproliferative effects in PC-3 cells (> 50% of the cells harbor centrosomal amplifications). siRNAs 1, 2 and 4 reduce cell numbers by 40 to 80% as compared to control cells (Fig 1.1). 2) Hepsin knockdown results in strong induction of apoptosis in PC-3 cells (> 50% of the cells harbor centrosomal amplifications). All Hepsin siRNAs induce at least a 6-fold increase of apoptotic index (apoptosis measured, normalized to cell umbers) (Fig 1.2). The results indicate that Hepsin knockdown induces proliferation arrest and reduces viability in the centrosomally amplified cell line PC-3. Therefore strong antitumor effects can be expected by inhibition of Hepsin in tumor cells with supernumerary centrosomes.

Example 2: Hepsin long-term knockdown selectively reduces cell and clone number in tumor cells, but not in non-transformed cells

Cells carrying centrosome amplifications (DU145, PC-3) and cells with low centrosome amplification (HaCat, MCF10A) were plated at a cell density of 100.000 per well in 1 ml medium per well in 12 well plates After plating, cells were incubated for 24 h in an incubator (37°C, 5% C02). Medium was removed and cells were transduced with lentiviral vectors (BLOCK-iT, pLenti6, Life Technologies) with a titer of 2 μg/ml p24 for 6 hours. Virus was removed and cells were incubated for 72 hours. Then 5000 transduced cells were mixed with 300000 untransduced (feeder) cells of the same cell line and plated on 6well plates with 2 ml of medium. 24 hours later antibiotic (blasticidin, final 5 μg/ml) was added to the culture medium. Medium replaced twice a week. After 2-4 weeks of growth when colonies were clearly visible, cells were fixed with 1 % Glutaraldehyde for 30 min at room temperature. Colonies were made visibly by crystal violet staining.

The following shRNA sequences were used:

shRNA sequences: Hepsin

NM_182983_shrna_1790_top (shHepsin #1790)

GCAATGGCGCTGACTTCTATGCGAACATAGAAGTCAGCGCCATTGC NM_182983_shRna_1795_top (shHepsin #1795)

GGCGCTGACTTCTATGGAAACCGAAGTTTCCATAGAAGTCAGCGCC NM_182983_shRna_1796_top (shHepsin #1796)

GCGCTGACTTCTATGGAAACCCGAAGGTTTCCATAGAAGTCAGCGC shQiagenCo

TTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAA

Results

1) 3 out of 3 shRNA targeting Hepsin strongly reduce the number of clones in cells with centosomal amplification (PC-3, DU145; see Fig. 2.1). These cells depend on Hepsin for survival and proliferation.

2) No significant change in number of clones was observed in cell lines with normal centrosome numbers (HaCat, MCF10A; see Fig 2.1). These cells do not depend on Hepsin for survival and proliferation.

The results show that Hepsin knockdown impairs the long-term survival of cells with centrosome amplifications (PC-3, DU145) but not in cells with a normal centrosomal status (HaCat, MCF10A). That shows that the sensitivity of the cells to Hepsin depletion depends on centrosomal amplification status.

Example 3: siRNA knockdown of Hepsin induces multipolar mitoses only in cells with extra centrosomes

Cells carrying centrosome amplifications (SCC114, MDA-MB-231, DU145, PC-3) and cells with low centrosome amplification (MCF7, hTERT-RPE, BJ) were reverse transfected with DharmaFECT 1 (Dharmacon # T-2001-01) with siRNAs (in house designed, synthesized at Life Technologies, Darmstadt, Germany) targeting Hepsin (CAAUGGCGCUGACUUCUAU) or luciferase (CUUACGCUGAGUACUUCGA) as a control in 6 well plates at coverslips which have been coated with poly-L-lysine for 20 min. (100 μΐ per coverslip, Sigma, P4707). 403 μΐ OptiMem (Gibco # 11058) were mixed with 2 μΐ DharmaFECT 1 and incubated at room temperature for 10 minutes. Then another 810 μΐ OptiMem were added, mixed and combined with 405 μΐ of 500 nM siRNA per well. The mixture was incubated at room temperature for 30 minutes. Afterwards, 200000 cells were added to the mixture per well and cultivated for 48 h at 37°C and 5% C0₂ in an incubator with a media exchange after 24 h. Cells were stained with antibodies binding to centrin and oc-tubulin. All steps were done at room temperature in a dark chamber. Cells were fixed for 15 min by addition of 4% paraformaldehyde in PBS solution, permeabilized for 5 min with PHEM buffer

(60mM PIPES, 25mM HEPES, 8mM EGTA, 2mM MgC12, pH = 6.9) supplemented with 0.5% Triton X-100, and blocked for 20 min with 10% goat serum in PBS. Primary antibody staining (mouse-anti-centrin, J. Salisbury + rabbit-anti-oc-tubulin, Millipore, 04-1117) was done for 60 min in blocking solution. 3 washing steps with PBS were followed by secondary antibody treatment for 30 min (goat-anti-rabbit- Alexa Fluor 488, Invitrogen, Al 1034 + goat-anti-mouse-Alexa Fluor 568, Invitrogen, A11031). After 3 washing steps with PBS and a desalting step with water, cells were mounted in vectashield with D API/without DAPI in a ratio of 1 :3 (Vectorlabs, H- 1200, H-1000) and coverslips were fixed with nail polish on the slides. Samples were analyzed under a Zeiss Axiovert 200M fluorescence microscope. 100-200 mitoses per sample were counted and the percentage of normal and multicentrosomal mitoses was determined.

Results

1) Transfection and subsequent knockdown of Hepsin results in 3-7.9 times increase in multipolar mitoses in cells with centrosomal amplifications (SCC114, MDA-MB-231, DU145, PC-3, see Fig. 3.1). Up to 32% of the mitotic PC-3 cells display multipolar mitoses, which also represents the portion of cells with centrosomal amplification in these cells, indicating the dependence of the clustering mechanism on the presence of Hepsin.

2) No abnormal increase of multipolarity in cells with normal numbers of centrosomes (MCF7, hTERT-RPE, BJ, see Fig. 3.1). This indicates an expected low effect for Hepsin inhibitors with respect to induction of multipolarity in cells with normal/low centrosome amplification.

The results demonstrate that Hepsin knockdown leads to increased multipolarity in cells with centrosome amplification (SCC114, MDA-MB-231, DU145, PC-3) but not in cells with a normal centrosomal status (MCF7, hTERT-RPE, BJ). That shows that knockdown of Hepsin specifically targets cells with supernumerary centrosomes and has no influence on normal cells.

Example 4: Compound 2 treatment induces multipolar mitoses in PC-3 cells

PC-3 cells were grown in DMEM / Ham's F12; (Biochrom; # FG 4815, with stable glutamine) and 10% fetal calf serum (Biochrom; # S 0415). PC-3 cells were plated at a cell density of 100.000 per well in 1 ml medium per well in 12 well plates with a coverslip. After plating, cells were incubated for 24 h in an incubator (37°C, 5% C0₂) and thereafter treated with 10 μΜ, 50 μΜ and 100 μΜ, with Compound 2 (1- (3-chlorophenyl)-3-{5-[(3,4-dimethylphenoxy)methyl]-l,3,4-thiadiazol-2-yl}urea; Compound 2 is described and characterized in "Chevillet JR et al. (2008) Mol Cancer Ther, 7(10), 3343-51" as Hepsin inhibitor) induces multipolar mitoses in a dose dependent manner or DMSO control, respectively. After an incubation period of 24 hours in the tissue culture incubator (37°C, 5% CO2), cells were fixed and stained for immunofluorescence as described in example 3 and subsequently mitoses were analysed for multipolarity. Results

1) A dose-dependent increase of multipolar mitoses can be detected after compound 2 treatment. At 100 μΜ, beginning toxicity of Compound 2 can be observed (see Fig.4.1).

This result indicates that the enzymatic activity of Hepsin is essential for Hepsin- mediated centrosomal clustering.

Example 5: Antibody treatment does not induce multipolar mitoses in PC-3 cells

PC-3 cells were plated at a cell density of 100.000 per well in 1 ml medium per well in 12 well plates with a coverslip. After plating, cells were incubated for 24 h in an incubator (37°C, 5% C0₂) and thereafter treated with 0,7 nM, 70 nM and 700 nM, respectively with either function blocking anti-Hepsin antibody (A174), a functionally inactive variant (94A7) or isotype control, respectively. After an incubation period of 24 hours in the tissue culture incubator (37°C, 5% CO2), cells were fixed and stained for immunofluorescence as described in example 3 and subsequently mitoses were analysed for multipolarity. The antibodies are described and characterized in "Xuan JA et al (2006) Cancer Res, 66(7), 3611-19, PMID: 16585186". Additionally, antibody 94A7 is described in WO2004033630 and antibody A174 and 94A7 are referenced in US 8,124,352.

Results

1) The variation of the assay is indicated by the variability of the results obtained with the isotype control (see Fig. 5.1). 2) The observed percentage of multipolarity between the cleavage inactive and the cleavage active antibodies is basically identical (see Fig. 5.1).

No significant differences with respect to the induction of multipolar mitoses can be detected between isotype control, non-function-blocking and function blocking antibodies. This result indicates that the extracellular Hepsin does not play a role in Hepsin-mediated centrosomal clustering.

Example 6: Detection of the intracellular splice variant HepsinATM by quantitative reverse transcription PCR in several cancer cell lines

The respective cells were plated at 200.000 cells per well on 6well plates. The following day, RNA was isolated using the RNeasy Plus Mini Kit (Qiagen #74136) according to the manufacturer's manual. 500 ng of RNA were reverse transcribed into cDNA using RevertAid M-MuL Reverse Transcriptase (Life Technologies) according to the manufacturer's protocol. Subsequently, each cDNA sample was amplified in triplicate using the QuantiFast SYBRGreen PCR Kit with the Hepsin primers indicated below. PCR cycle program was as follows: 95°C, 20 s, the 40 cycles with 95 °C, lsec followed by 60°C, 20sec. HMBS (hydroxymethylbilane synthase) used as endogenous control and cDNA was amplified using Taqman expression assays (Life Technologies). Expression levels were calculated and normalized to HMBS with the deltaCt method (Livak, K. J., and Schmittgen, T. D. (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402-408).

In addition, PCR products were visualized by FlashGel (5ng DNA/lane, diluted in lx loading Dye, run3min at 275V) to confirm the presence and correct size of PCR products. Primers used for PCR (based on (Y. Li et al./ Biochemica et Biophysica Acta 1681 (2005) 157-165) were synthesized by and purchased from Invitrogen:

Primer* Seq Name Seq Length MW

A3775H01 Hepsin Exon3_4F CATTGTGGCTGTTCTCCTA 20 6051

A3775H02 Hepsin Exon6R CAGCTCGGAGTGGGTCAGT 19 5885.8

A3775H03 Hepsin_TM TGACATGGCGCAGAAGGAGGTGCAGG 26 8151.2 HMBS TaqMan probe: #Hs00609296_gl (Applied Biosystems) was used as reference.

Results:

1) Both transmembrane Hepsin and intracellular Hepsin/-TM mRNA levels can be detected in all cell lines tested.

2) Hepsin expression levels vary between different cell lines with CaCo2 and HepG2 cell showing highest Hepsin expression and PC-3 cells showing lowest expression.

3) A rather homogenous expression of Hepsin/-TM can be observed between the cell lines, indicating a vital role for this splice variant in the tested cell lines.

Example 7: Identification of DCTN4 as intracellular target of HepsinATM

Preparation of PC-3 protein lysates

PC-3 cells were grown in DMEM / Ham's F12; (Biochrom; # FG 4815, with stable glutamine) and 10% fetal calf serum (Biochrom; # S 0415). 6*10e6 PC-3 cells were harvested by scraping the cells and pelleting at 500 x g for 5 minutes in a centrifuge. The pellet was lysed in 300 μΐ RIPA buffer (50 mM Tris-Cl pH 7,4, 1% NP-40, 0,25% Sodiumdeoxycholate, 150 mM NaCl, 1 mM EDTA, "Complete protease inhibitor cocktail, Roche, 1 tablet for 50 ml buffer) and "Phospho-Stop" (Roche, 5 tablets for 50 ml buffer), filled with distilled water to 50 ml. The pellet was resuspended in the buffer and incubated on ice for 20 minutes. Afterwards, the lysate was centrifuged for 15 minutes at max. speed in an Eppendorf centrifuge 5415R at 4°C. The supernatant was transferred into a new tube and protein concentration was determined (Quick Start Bradford Dye Reagent, Bio-Rad # 500-0205). 1 μΐ lysate was mixed with 1 ml Bradford-reagent, mixed, incubated at room temperature and measured in a photometer according to the manufacturer. Chemicals were purchased from Sigma unless otherwise indicated.

Diagonal 2D gel electrophoresis

Chemicals were purchased from Sigma unless otherwise indicated. The 2D gel electrophoresis was performed according to: Shao, W et al., The caspase-1 digestome identifies the glycolysis pathway as a target during infection and septic shock, J Biol Chem, 2007, Dec 14, 282, 36321-36329. The following setup was prepared twice: one for subsequent Hepsin digest, the other one as a control.

400 μg PC-3 lysate in 32 μΐ were mixed with 6.4 μΐ 6x SDS (sodium dodecyl sulfate) loading buffer (preparation: 7 ml 1M Tris-HCl, 0.4% SDS, pH 6.8, 3 ml glycerol, 1 g SDS, 0.93 g DTT (dithiothreitol), 1.2 mg Bromphenol blue, filled to a final volume of 10 ml with water) and boiled for 5 minutes at 95 °C. The 1.5 mm thick polyacrylamide gel was prepared as follows: 10% separating gel: 16.25 ml 30% acrylamide, 12.5 ml 1.5 M Tris, pH 8.8, 250 μΐ 20% sodium dodecylsulfate, 21 ml distilled water, 30 μΐ TEMED (Tetramethylethylenediamine) and 500 μΐ 10% APS (ammonium peroxodisulfate). Stacking gel: 2.55 ml 30% acrylamide, 1.0 ml 1.0 M Tris, pH 6.8, 75 μΐ 20% sodium dodecylsulfate, 10.35 ml distilled water, 15 μΐ TEMED (Tetramethylethylenediamine) and 150 μΐ 10% APS (ammonium peroxodisulfate). The gel was run at 40 milliamperes until the Bromphenol blue front had moved approximately 1/3 of the total distance of the separating gel. The stacking gel was removed and the gel lane (i.e. from top to bottom of the gel) was cut as narrowly as possible. The gel strip was washed for 10 minutes in 40% ethanol/10% acetic acid, afterwards for 10 minutes in 30% ethanol and finally twice for 10 minutes each in distilled water.

The strips were subsequently transferred to Hepsin digestion buffer (buffer was prepared as follows: 100 mM Tris, pH 8.0, 150 mM NaCl, 0.01% (v/v) BSA (bovine serum albumin), 0.05% (v/v) Brij 35, filled with distilled water to 500 ml). For the control sample, Hepsin digestion buffer was used, for the Hepsin digestion sample the buffer was supplemented with 100 nM Hepsin (R&D systems, Cat no. 4776-SE, Minneapolis, MN, USA) and incubated over night at 37°C. Afterwards, the strips were washed in distilled water and incubated for 10 min at 95°C in a water bath in lx SDS loading buffer (see above).

For each of the gel strips, a new SDS separating gel was prepared as described above. After the gel had polymerized, a 1 cm high spacer gel (7.8 ml 30% acrylamide, 7.52 ml 1.5 M Tris, pH 8.8, 30 μΐ 10% sodium dodecylsulfate, 14.04 ml distilled water, 30 μΐ TEMED (Tetramethylethylenediamine) and 300 μΐ 10% APS (ammonium peroxodisulfate) was prepared and poured above the separating gel. After this gel had polymerized, the digested slice was inserted horizontally on top of the spacer gel and filled with 0,8% agarose. The 2 gels were run at 80 milliampere in parallel until the Bromphenol blue front had moved approximately 1/3 of the total distance of the separating gel. The gel was subsequently silver stained.

Silver staining: The gel was fixed for 20 minutes in 100 ml fixation solution (25 ml ethanol and 5 ml glacial acetic acid, mixed with 20 ml distille water). Afterwared the gel was washed for 10 minutes in 100 ml 30% ethanol, followed by a 10 minutes washing step in distilled water. Afterwards the gel was incubated for 10 minutes in sensibilization solution (1 ml ProteoSilver (Sigma Aldrich) sensibilization solution, mixed with 99 ml distilled water), followed by two washing steps in 200 ml destilled water. The gel was then equilibrated in 100 ml silver solution (1 ml ProteoSilver silver solution with 99 distilled water), washed for one minute in distilled water and developed for 3 to 7 minutes in 100 ml development solution (5 ml ProteoSilver developer 1 und 0.1 ml ProteoSilver developer 2 with 95 ml distilled water). Finally, the development process was stopped by addition of 5 ml ProteoSilver Stop solution for 5 minutes. Differential spots (spots visible on the gel after Hepsin treatment, but not without Hepsin treatment) were excised and analyzed by mass spectrometry.

Results

1) The new spot number 5 (see Fig. 7.1), which was detected after digestion of the PC-3 lysate in comparison to the undigested PC-3 lysate contained DCTN4. In a confirmatory experiment, in vitro digestion of PC-3 cell lysates with recombinant Hepsin (R&D systems, Cat No 4776-SE, Minneapolis, MN,

USA) followed by Western Blot analysis (using anti-DCTN4-antibody ab 126949, Abeam, Cambridge, UK) confirmed cleavage of DCTN4 by Hepsin.

The results show that DCTN4 is a proteolytic target for Hepsin. It is also a potential intracellular target for Hepsin/-TM, because it is expressed intracellularly. Based on dynein-dynactin' s role for centrosomal clustering, DCTN4 represents an attractive target for development of an intracellular assay.

Example 8: Identification of hepsin cleavage site in DCTN4

Expression and Purification of recombinant N -terminal FLAG-tagged DCTN4 The isoform b of Dynactin 4 modified with a FLAG-tag was used to identify the Hepsin cleavage site in Dynactin 4. A transfer vector (pVL1392) encoding an N- terminal FLAG-tagged DCTN4 DNA sequence was used to generate a recombinant Baculovirus by cotransfection with viral DNA (Flash BAC Gold, Oxford Expression Technologies) in Sf9 cells according to standard procedures. For production Sf9 cells were grown in a 20 L wave bag bioreactor filled with 8 L of Insect-Xpress media (Lonza) to a density of 2xl0⁶cells/mL and infected with recombinant baculovirus encoding N-terminal FLAG-tagged DCTN4 (multiplicity of infection, MOI 1). Cells were shaken at 27°C for 48h. After 72 hours post-infection cells were harvested by centrifugation and the cells pellets derived from 8 x 1 L cell culture were frozen in liquid nitrogen and stored at -80 °C.

For purification the cell pellet derived from 1 L of cell culture was thawed and resuspended in 40 mL of lysis buffer containing 50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM dithiothreitol (DTT), 2 mM MgCl₂, complete Protease inhibitor cocktail w/o ethylenediaminetetraacetic acid (EDTA) (Roche) and 0.1% nonyl phenoxypolyethoxylethanol (NP-40). Cells were lyzed by 5 x 5 s sonication intervals and 30 min shaking on ice. The lysed cells were cleared by centrifugation at 40,000xg at 4 °C for 60 min and loaded on 10 mL M2 beads (Sigma, A2220) equilibrated with water and lysis buffer. The beads were washed with 10 mL lysis buffer, 200 mL wash buffer Al (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM DTT, 2 mM MgCh), 30 mL wash buffer A2 (50 mM Tris-HCl, pH 7.5, 1 M NaCl, 1 mM DTT, 2 mM MgCk), 50 mL HMP buffer (25 mM Tris-HCl, pH 7.5, 75 mM NaCl, 1 mM DTT, 10 mM MgCl₂, 10 mM ethylene glycol tetraacetic acid (EOT A), 500 mM piperazine-N,N'-bis(2-ethanesulfonic acid) (PIPES) and 40 mL wash buffer Al again. The protein was eluted with 40 mL of 50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM DTT, 2 mM MgCl₂ containing 150 μg/mL FLAG peptide (Sigma, F3290). DCTN4 was concentrated to 2.5 mg/mL using centrifugal filter units with 30 kDa cut off (Amicon, Z648035).

Treatment of recombinant DCTN4 with Hepsin and analysis by mass spectrometry 6 μg recombinant FLAG-tagged DCTN4 were treated with 6 ng recombinant human hepsin (R&D systems, Cat No 4776-SE, Minneapolis, MN, USA) according to the manufacturer and incubated for 1 hour at 37 °C. The proteolytic cleavage was quenched by acidification with trifluoroacetic acid and the cleavage products were separated on a Waters Mass Prep C4 column (2.1 x 5 mm) running at a flow rate of 100 μί/ιηίη (buffer A: water / 0.1 % formic acid; buffer B; acetonitrile / 0.1 % formic acid) with a gradient from 20% to 80% buffer B and measured by electrospray-mass spectrometry (ESI-MS) using a Waters SYNAPT G2-S quadrupol time-of-flight instrument.

The cleavage site has been confirmed by treating a synthesized peptide (Biosyntan, 50628) containing the potential cleavage site (LQRPRAGASIST) with recombinant human hepsin (R&D systems, Cat No 4776-SE, Minneapolis, MN, USA) in an enzyme: substrate ration of 1 :4000 for lh at 37 °C and subsequent analysis by LC- MS.

The masses of the cleavage products have been analyzed by MassLynx v4.1 and GPMAW v9 software.

Results

By comparing a measured DCTN4 fragment mass of 30246.2 Da with the amino acid sequence of FLAG-tagged full length protein using GPMAW v9 software it was possible to allocate this mass to a sequence stretch comprising amino acids 193 to 460 (Uniprot: Q9UJW0) with a theoretical average mass of 30247.7 Da. This fragment indicates a cleave site at QRPR / AGAS (amino acids 189-196 in NP_057305).

The treatment of the synthesized peptide (LQRPRAGASIST) with recombinant human hepsin resulted in the expected cleavage products with masses of 604.34 Da and 668.43 Da, respectively.

Example 9: Biochemical cleavage assay with fluorescently labelled substrate

Enzymatic activity of TMPRSS-l/Hepsin was determined in a biochemical assay using a fluorescently labelled substrate. The substrate consisted of the 8-mer peptide that was N-terminally labelled with a DABCYL fluorescence quencher (4-((4- (dimethylamino)phenyl)azo)benzoic acid, succinimidyl ester) and C-terminally with an EDANS (5 -((2-Aminoethyl)amino)naphthalene-l -sulfonic acid) fluorescence donor. The sequence of the 8-mer peptide (RMRRYADA) contained a centrally located Arginine located in a di-basic motif to fulfill substrate recognition requirements described for TMPRSS-l/Hepsin.

To recombinant human Hepsin (R&D systems, Cat No 4776-SE, Minneapolis, MN, USA) at a final concentration e.g. 0.0125 - 1 nM in reaction buffer (50 mM Tris/HCl pH 8.0; 10 mM CaC12; 150 mM NaCl; 1,5 mM Glutathion; 0,05% BSA and 0,01 % Brij 35) compound of interest (in DMSO, suitable concentrations e.g. 1 nM to 30 uM, 1 ul) was added in a 384-MTP white plate. The reaction was started by addition of above described substrate (final concentration 11 μΜ) to yield a total volume of 51 μΐ. Progress of the Hepsin reaction was monitored by fluorescence intensity measurement (excitation: 340 nm, emission: 480 nm) over e.g. 120 min at 32°C.

As a reference for enzyme inhibition, the Hepsin function blocking anti-Hepsin antibody (A 174) (see example 5 for details) in a range of 1 - 1000 nM was used to inhibit the substrate turnover.

The enzymatic turnover of the fluorogenic peptide substrate was monitored by fluorescence intensity measurement. Enzyme activity was determined by recording the initial slopes of fluorescence increase. Inhibition Hepsin peptidase activity was detected by a decrease in initial slopes in comparison to the initial slope of control reaction without A 174. IC50 values were determined by plotting the A 174 concentration versus the percentage inhibition of Hepsin activity by interpolation.

Results The reference inhibitory antibody A174 showed a dose dependent inhibition of Hepsin catalyzed substrate turnover with nearly complete inhibition at the highest used concentration. A typical dose response curve for Hepsin enzymatic activity in response to A174 titration is depicted in graph 9.1. The IC50 was determined using nonlinear fit of the activity data with the analysis software Graph Pad Prism 6 for Windows. The calculated IC50 value of the antibody A174 under the given conditions was between 45 nM and 150 nM (see Fig. 9.1), which is in line with previously published data on the antibody (Xuan et al., Cancer Res. 2006, PMID: 16585186).

Claims

Claims

1. A method of screening for a candidate compound useful for treating and/or preventing cancer, wherein a first step comprises contacting a test compound with Hepsin polypeptide, Hepsin/-TM polypeptide or functional equivalent thereof.

2. A method according to claim 1, wherein further steps comprise:

(i) detecting the binding of the test compound to the Hepsin polypeptide, Hepsin/-TM polypeptide or functional equivalent thereof, and

(ii) selecting as a candidate compound the test compound that binds to the Hepsin polypeptide, Hepsin/- TM polypeptide, or functional equivalent thereof.

3. A method according to claim 2, wherein the test compound displaces a ligand which binds to the Hepsin polypeptide, Hepsin/- TM polypeptide, or functional equivalent thereof by at least 20%.

4. A method according to claim 3, wherein the ligand comprises a label.

5. A method according to claim 1 , wherein further steps comprise:

(i) detecting a biological activity of the Hepsin polypeptide, Hepsin/-TM polypeptide, or functional equivalent thereof, and

(ii) selecting as the candidate compound the test compound that inhibits the biological activity of Hepsin polypeptide, Hepsin/-TM polypeptide or functional equivalent thereof in comparison with the biological activity detected in the absence of the test compound by at least 20%.

6. A method according to claim 5 wherein

(a) the biological activity is a peptidase activity,

(b) Hepsin polypeptide, Hepsin/-TM polypeptide, or functional equivalent thereof is contacted with a proteolytic substrate to be cleaved in the presence of a test compound and

(c) the proteolytic cleavage of the proteolytic substrate by the Hepsin polypeptide, Hepsin/-TM polypeptide, or functional equivalent thereof is detected.

7. A method according to claim 6, wherein the proteolytic substrate is a peptide comprising at least one Hepsin cleavage site.

8. A method according to claim 7, wherein the peptide comprises 8 to 14 amino acids, preferably 8 to 10 amino acids, of general formula (1)

wherein

X and Y: means any amino acid

B: means any basic amino acid

R: means arginine

m: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13

n: 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12

p: 0, 1 or 2

q: 1 or 2

9. A method according to claim 8, wherein B is selected from the group of arginine, lysine, asparagine, and glutamine.

10. A method according to claim 9, wherein the peptide is selected from a group of QRPRAGAS

LQRPRAGASIST RMRRYADA LTAPRSLRRS ARRHSDGT AATRRQAV QLQKRFGG RQRYGKRS LRNRAQSG

11. A method according to any of the claims 7 - 10, wherein the peptide is labelled with at least one label.

12. A method according to claim 11, wherein the peptide is labelled with a pair of Fluorescence Resonance Energy Transfer fluorophors, preferably with 5((2- Aminoethyl)amino)-naphthalene- 1 -sulfonic acid (EDANS) as donor moiety attached to the N-terminus of the peptide and 4-((4- (dimethylamino)phenyl)azo)benzoic acid (DABCYL) as acceptor moiety attached to the C-terminus of the peptide.

13. A method according to claim any of the claims 1 - 12 wherein the polypeptide is Hepsin/-TM polypeptide or functional equivalent thereof.

14. A method according to claim 6, wherein an intact cell intracellularly expresses the Hepsin/-TM polypeptide or functional equivalent thereof and the proteolytic substrate comprising a Hepsin cleavage site.

15. A method according to claim 14, wherein the proteolytic substrate is reporter substrate, preferably a blue-fluorescent-green- fluorescent fusion construct comprising a Hepsin cleavage site of Dynactin 4.

16. A method according to claim 14, wherein the proteolytic substrate is Dynactin 4 polypeptide or functional equivalent thereof.

17. A compound, which has been identified by the method according to any of the claims 1 - 16 for use in the treatment of cancer with centrosome amplification.

18. Use of a compound, which has been identified by the method according to any of the claims 1 - 16, for the manufacture of a medicament for the treatment of cancer with centrosome amplification.

19. A method for the treatment of cancer with centrosome amplification comprising administering an effective amount of a compound, which has been identified by the method according to any of the claims 1 - 16.

20. A method for the treatment of cancer with centrosome amplification according to claim 19 wherein the compound is selected from

i. ) a small molecule synthesized by chemical methods

ii. ) a RNA molecule

iii) an antisense nucleotide

iv) a polypeptide or peptide-like molecule and

v) an antibody or an antibody fragment

21. A method for the treatment of cancer with centrosome amplification according to claim 19 or 20, wherein the cancer with centrosome amplification is selected from the group of haematological tumours, solid tumours and/or metastases thereof comprising tumours of male reproductive organs, cancers of the respiratory tract, breast cancers, tumours of the digestive tract, tumours of the urinary tract, liver cancers, head and neck cancers, skin cancers, pancreatic cancer, lymphoma, tumours of the female reproductive organs, leukaemia's, and multiple myeloma.