WO1994009811A1 - Molecule d'adherence - Google Patents

Molecule d'adherence Download PDF

Info

Publication number
WO1994009811A1
WO1994009811A1 PCT/US1993/010412 US9310412W WO9409811A1 WO 1994009811 A1 WO1994009811 A1 WO 1994009811A1 US 9310412 W US9310412 W US 9310412W WO 9409811 A1 WO9409811 A1 WO 9409811A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
peptide
cell
protein
binding
Prior art date
Application number
PCT/US1993/010412
Other languages
English (en)
Inventor
Barton F. Haynes
Laura P. Hale
Karen L. Patton
Marilyn J. Telen
Hua-Xin Liao
Original Assignee
Duke University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Duke University filed Critical Duke University
Priority to AU55435/94A priority Critical patent/AU5543594A/en
Publication of WO1994009811A1 publication Critical patent/WO1994009811A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70585—CD44
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2884—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against CD44
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/34—Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues

Definitions

  • the present invention relates to methods of suppressing T cell activation, inhibiting CD44- mediated cell adhesion and CD44-monocyte IL1 release, treating inflammation, and transporting a drug or cytotoxic agent to a site of inflammation.
  • cell adhesion molecules mediate a wide variety of normal cell functions including cell movement, adherence to other cells, adherence to extracellular matrix proteins, mononuclear cell homing and monocyte cytokine release (reviewed in Springer (1990) Nature 346:425-434; Haynes et al.
  • the CD44 molecule has been of recent interest because this protein has multiple proinflammatory functions, exists in soluble form in serum and plasma, and regulates the function of other adhesion molecules (reviewed in Haynes et al. (1989) Springer Sem. Immunopathol. 11:163-185; Haynes et al. (1989) Immuno. Today 10:423-428) .
  • the CD44 molecule is an 85kd glycosylated molecule with N-terminal sequence homology to cartilage link proteins (Stamenkovic et al. (1989) Cell 56:1057-1062; Goldstein et al. (1989) Cell 56:1063-1072). Forms of CD44 of varying sizes have been described on many cell types (Haynes et al.
  • CD44 isoforms have been suggested to be due to glycosylation differences, the addition of chondroitin sulfate molecules to CD44 (Jalkanan et al. (1988) J. Immunol. 141:1615-1623), and in some cases, to alternative splicing of CD44 mRNA (Dougherty et al. (1988) Exp. Hemat. 18:703, St.
  • PBMC peripheral blood mononuclear cells
  • CD44H is the hematopoietic form of the molecule, and additional forms are created by alternative splicing and insertion of up to 5 additional domains (Stamenkovic et al. EMBO J. (1991)10:343-348; Gunthert et al. Cell (1991) 65:13-24; Dougherty et al. J. Exp. Med. (1991) 174:1-5; Hoffman et al. Cancer Res. (1991) 51:5292-5297;
  • CD44 molecule has been shown to be a central molecule involved in T lymphocyte adhesion, T lymphocyte activation and monocyte cytokine release (Haynes et al. (1989) Immunol. Today 10:423-428; Jalkanen et al. (1986) Science 233:556- 558; Jalkanen et al. (1987) J. Cell Biol. 983-990; Aruffo et al. (1990) Cell 61:1303-1313; Miyake et al. (1990) J. Exp. Med. 172:69-75; Lesley et al. (1990) Exp.
  • CD44 intracellular domain with the cytoskeletal protein, ankyrin, and with the enzyme protein kinase C (PKC) ( alomiris et al. (1989) J. Biol. Chem. 264:8113- 8119) has suggested a role for CD44 in signal transduction of surface events to intracellular molecules.
  • PKC protein kinase C
  • CD44 Ligand binding to the CD44 molecule promotes T cell adherence to monocytes via other adhesion molecule pathways (ICAM-l/LFA-1 and LFA-3/CD2) (Denning et al.; Koopman et al (1990) J. Immunol. 145:3589-3593) suggesting that CD44 can serve as a regulator of function of other adhesion molecules (reviewed in Haynes et al. (1989) Springer Sem. Immunopathol. 11:163-185; Haynes et al. (1989) Immunol. Today 109-113).
  • CD44 protein is the primary receptor for hyaluronate in rodents and humans (Aruffo et al. (1990) Cell 61:1303-1313; Miyake et al. (1990) J. Exp. Med. 172:69-75; Lesley et al. (1990) Exp. Cell Res. 187:224-233). Both hyaluronate (Hiro et al. (1986) Biochem. Biophys. Res. Comm. 715-722) and CD44 mAB
  • CD44 mABs augment T cell triggering (Huet et al. (1989) J. Immunol. 798-801; Shimuzu et al. (1989) J. Immunol. 143:2457-2463) while hyaluronate suppresses T cell triggering (Anastassiades et al. (1984) Rheumatol. 11:734-729) .
  • lymphocyte CD44 mabs and polyclonal anti-CD44 serum have been shown to inhibit the binding of lymphocytes to high endothelial venules in inflammatory sites such as synovium (Jalkanen et al. (1986) Science 233:556-558; Jalkanen et al. (1987) J. Cell Biol. 983-990; Jalkanan et al. (1988) J. Immunol. 141:1615- 1623) , suggesting lymphocyte CD44 is one of several molecules involved in organ-specific lymphocyte homing.
  • the hyaluronate receptor (CD44) molecule by existing in several isoforms, and by virtue of wide cellular distribution, functional association with other adhesion molecules, and physical association with ankryin and PKC, is a multifunctional proinflammatory molecule involved in immune cell activation (reviewed in Haynes et al. (1989) Immunol. Today 10:423-428) as well as metastasis of certain tumor cell types (reviewed in Haynes et al. (1991) Cancer Cells 3:347-350).
  • Hyaluronate the ligand for CD44, is an important component of synovial fluid and plays a critical role in maintaining high viscosity of synovial fluid in normal diarthroidal joints (reviewed in Schuber and Hammerman (1964) Bull. Rheum. Dis. 14:345-348; Castor et al. (1966) Arth. Rheum. 9:783-794).
  • RA rheumatoid arthritis
  • CD44 is upregulated in RA on many synovial cell types and that the level of CD44 present in synovial tissue is directly proportional to the degree of synovial inflammation in RA. Applicants have also demonstrated that CD44 is immunosuppressive to T cells.
  • the present invention relates, at least in part, to a method of interdiction of proinflammatory functions of the CD44 molecule.
  • the present invention relates to a method of suppressing T cell activation in an human comprising administering to the human CD44 protein peptide or derivative thereof in an amount sufficient to suppress T cell activation.
  • the present invention relates to a method of inhibiting CD44-mediated cell adhesion or CD44-mediated monocyte IL1 release in an animal comprising administering to the human CD44 protein or peptide or derivative thereof in an amount sufficient to inhibit CD44-mediated cell adhesion or CD44-monocyte IL1 release.
  • the present invention relates to a method of treating inflammation in an human comprising administering to the human CD44 protein or peptide or derivative thereof in an amount sufficient to reduce the inflammation.
  • the present invention relates to a method of transporting a drug or cytotoxic agent to a site of inflammation in an human comprising administering to the human CD44 protein or peptide or derivative thereof linked to the drug or cytotoxic agent.
  • the CD44 protein or peptide or derivative thereof and the drug or cytotoxic agent are incorporated into a liposome.
  • the present invention relates to a method of inhibiting T-cell function in a human comprising administering to the human antibodies against CD44, preferably antibodies against CD44H or CD44E or portion or derivative thereof in an amount sufficient to inhibit T-cell function.
  • the present invention relates to a method of determining the metastatic potential of hematopoietic cell types comprising contacting test cells with antibodies against synthetic peptides of CD44H or CD44E, separately or together, and measuring the amount of binding between the cells and the antibodies.
  • the present invention relates to a peptide represented by any one of SEQ ID NO:l-28. In further embodiment, the present invention relates to a peptide having the sequence set forth in SEQ ID NO:25 or SEQ ID NO:26 or portion thereof that includes at least the sequence set forth in SEQ ID NO:23.
  • the present invention relates to a hybridoma cell that produces an antibody having the characteristics of 5F12, ATCC deposit no.
  • the present invention relates to a method of inhibiting binding of hyaluronan to a molecule of CD44 comprising contacting the molecule of CD44 with at least one peptide represented in SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:25 or SEQ ID NO:26, or portion thereof that includes at least SEQ ID NO:23, under conditions such that the binding is inhibited.
  • the present invention relates to a method of inhibiting binding of hyaluronan to a molecule of CD44 comprising contacting the hyaluronan with a CD4 mimetope recognized, by the antigen binding site of the Fab fragment of antibody 5F12 under conditions such that the binding is inhibited.
  • Figure 1 Upregulation of CD44 Expression in RA But Not in Non-inflammatory OA or Trauma.
  • Panel A shows hematoxylin and eosin (H and E) stain
  • Panel D shows H and E stain
  • panel E shows fibronectin expression
  • Panel G shows H and E stain
  • Figure J shows H and E stain
  • All panels showing fibronectin and CD44 expression are indirect IF. All panels 400X.
  • Figure 2 Quantitative Western Blot Analysis of CD44 Protein in Synovial Tissue. Equal amounts of tissue were extracted from each synovium and run on SDS-PAGE followed by Western blot analysis with anti-CD44 mab A3D8.
  • Figure 2B shows the area under the densitometry curve (arbitrary units) of the CD 4 bands shown in Figure 2A.
  • FIG. 3 Western Blot Analysis of CD44 Protein in Trauma, OA and RA Synovial Fluid.
  • Lanes A, C, and E are control lanes in which CD44 protein was immunoprecipitated with CD44 mab and then run in Western blot analysis and blotted with control P3X63/Ag8 IgGl paraprotein.
  • Lanes B, D, and F are CD44 protein immunoprecipitated with CD44 mab and then blotted with CD44 mab.
  • Figure 6. Shows a western blot analysis of recombinantly produced CD44-Rg-2 protein that could be used as an immunosuppressive agent to inhibit CD44-mediated proinflammatory functions.
  • Figure 7. Schematic representation of formation of splice variants of CD44 resulting in deletion of a small segment of CD44H (ATR) .
  • C-terminal open box is the CD44 cytoplasmic domain. Shaded C-terminal box is the CD44 transmembrane region.
  • Solid and open boxes represent the portions of domains 4 and 5 of CD44 that are in CD44 forms CD44E(R1) and CD44R2.
  • FIG. 8 Sequences of CD44-6A and CD44-19A peptides relative to the intact CD44E(R1) and CD44H molecules.
  • the CD44-6A peptide contains an ala-thr- arg (ATR) sequence that is deleted in the process of splicing in the various inserts to form CD44 splice variants.
  • the CD44-19A peptide is amino acids 287- 304 of the insert of domains 4 and 5 that is present in the CD44E(R1) form.
  • Figure 9 Flow cytometric analysis of reactivity of the anti-CD44 mab A3D8 and antisera against peptides 6A and 19A with HSB and HT29 cells.
  • the anti-CD44 mab, A3D8, reacted with cells expressing CD44H (A) and CD44E (B)
  • the anti-6A serum reacted only with the cells expressing CD44H (C) but not cells expressing CD44E (D)
  • the anti-19A serum reacted with only with cells expressing the CD44E (F) but not with cells expressing CD44H (E) .
  • Pre-immune sera or P3 mab were used as controls (labelled leftmost plot) and post- immune sera or A3D8 is rightmost plot.
  • FIG. 10 Specificity of anti-6A and anti-19A sera with CD44H and CD44E Jurkat transfectants examined by flow cytometry. Anti-19A serum was tested on Jurkat cells (A) , CD44H (B) and CD44E (C) Jurkat transfectants. Anti-6A serum was tested on Jurkat cells (D) , CD44H (E) and CD44E (F) transfectants (pre-immune sera were used as controls and leftmost plot and post-immune sera or A3D8 is rightmost plot) .
  • FIG. 11 Effects of CD44 mab 5F12 on the binding of HA to CD44H transfected T cells.
  • Cells (lxlO 6 ) were incubated with 1.25 ⁇ g of the purified whole 5F12 IgG. Fab 2 or Fab mab fragments for 30 min at 4°C followed by incubation of HA-FITC. Results were expressed as linear MFC analyzed by flow cytometry, and are representative of three separate experiments.
  • Figure 12 Ability of CD44 mabs A3D8 and 5F12 to block 5F12-FITC binding to CD44 on the CD44H transfected Jurkat T cells. Cells were incubated with 5 ⁇ g of the unlabelled mabs as indicated for 30 min at 4°C followed by incubated with 3.5 ⁇ g of FITC labelled 5F12 IgG. Results were expressed as linear MFC analyzed by flow cytometry, and are representative of three separate experiments.
  • FIG. 13 Western blot analysis of reactivity of CD44 mabs with CD44 protein in CD44H transfected Jurkat T Cells and CD44-Rg. Cell lysates (apprxomately 1x10 s cells/lane, lanes 2,4,6) and
  • CD44-Rg (lOOng/lane, lanes 1,3,5) were run on a 7.5% SDS-PAGE under non-reducing conditions, followed by transfer to nitrocellulose membranes. The protein bands of CD44 were revealed by the indicated CD44 mabs. The P3 mab was used as a negative control.
  • Figure 14 Reactivity of CD44 mabs on human CD44 transfected Jurkat T cells, African Green Monkey cos cells and baboon 26 CB-1 cells.
  • the indicated cells (lxl ⁇ cells/sample) were incubated with 50 ⁇ l of CD44 mabs at the concentration of 7 ⁇ g/ml for purified S314, 5F12 and P3 IgG or at 1:300 dilution for ascites of S317, S318 and S324, followed by goat anti-mouse IgG labelled with FITC. Data are representative of three separate experiments.
  • the present invention relates to a method of treating inflammation and immune-mediated tissue damage, such as occurs, for example, in the course of autoimmune diseases.
  • the present invention relates to a method of suppressing T cell activation in an human comprising administering to the human the CD44 protein, or derivative or peptide portion thereof, in an amount sufficient to effect suppression.
  • CD44 peptides CD44H form
  • suitable for use in the present method include those set forth in Table 1.
  • Peptides from the CD44E form, containing domains 4 and 5 are also suitable for use in the present invention and are set forth in Table 2.
  • CD44-17 (C)RTNMDSSHSTTLQPTANPNTGLVEDLDR
  • CD44-18 (C)TGPLSMTTQQSNSQSFSTSHEGLEEDKDH
  • CD44-19 (C)PTTSTLTSSNRNDVTGGRRDPNHSEGS
  • CD44-20 (C)THLLEGYTSHYPHTKESRTFIPVTSAK
  • CD44-21 (C)TGSFGVTAVTVGDSNSNVNRSL
  • the CD44-6A peptide contains an ala-thr-arg (ATR) sequence that is deleted in the process of splicing in various inserts to form CD44 splice variants.
  • ATR ala-thr-arg
  • Antibodies that include the ATR 5 sequence as targets for antibody responses will be CD44H specific, since the splice variants do not contain the ATR sequence.
  • Administration of the proteins/peptides of the invention can be by injection or topical 0 application (for example topically applied to the eye) . Injection can be made directly into a skin lesion.
  • CD44 molecule that may be used as an immunosuppressive agent is a 5 recombinantly produced CD44 molecule or a portion of the CD44 molecule produced by recombinant DNA technology.
  • An example of such a form of CD44 has been reported by Aruffo et al. Cell (1990) 61:1303-1313. This form of CD44 has been recombinately engineered to contain portions of the immunoglobulin protein constant domains.
  • CD44-Rg-2 The addition of immunoglobulin domains to the extracellular domain of CD44 yielded in molecule called CD44-Rg-2 that has the properties of being secluded by COS cells when a plasmid containing this CD44-Rg2 gene was transfected into COS cells (Aruffo et al. Cell (1990) 61:1303-1313).
  • the presence of immunoglobulin on the extracellular domain of CD44 would also have the potential advantage of increasing the circulating half-life of the CD44 molecule when administered to humans or animals.
  • CD44-Rg-2 plasmid can be transfected into COS cells using DEAE dextran as described in Seed PNAS (1987) 84:3365-3369, and Aruffo, et al. Cell (1990) 61:1303-1313, 1990.
  • Semi-confluent COS cells plated on 100mm plates will be transfected. Twelve hours after transfection, cells are trypsinized, seeded onto fresh 100mm dishes and allowed to grow for 7-10 days. On the fourth day 5ml fresh media, 10% calf serum are added per dish. Supernatants are harvested and stored at 4°C .
  • CD44-Rg protein Twelve hours following transfection, a fraction of the COS cells transfected are seeded into flasks. Thirty- six hours post-transfection, the cells are washed with PBS and overlayed with cystein-methionine media for 30 min. [ 35 Methionine and [ 35 S]Methionine and [ 35 S] Cysteine will be added to a final concentration of 150 ⁇ Cl/ml, and the cells will be allowed to incorporate the label overnight. The supernatants will be harvested and incubated with 200 ⁇ l of protein A-Trisacryl at 4°C for 12 horus. The beads will be collected by centrifugation and washed in 10 ml of PBS, 1 Nonidet P-40. The beads will then be eluted 200 ⁇ l of 1% SDS.
  • the present invention relates to a method of inhibiting various types of cellular interactions including macrophage T cell interactions and lymphocyte and macrophage interactions with endothelial cells.
  • the invention further relates to a method of inhibiting CD44-monocyte IL1 release. These methods also involve the administration of an effective amount of the CD44 protein or derivative or portion thereof to an animal in need of such treatment.
  • CD44 protein suitable for use in the present invention can be isolated from synovial tissue (preferably, human synovial tissue) or the protein can be produced recombinantly. Synthetic peptides reflective of discrete regions of the CD44 molecule can be made by standard techniques. Antibodies (monoclonal or polyclonal) against discrete regions of the CD44 molecule (for example, those shown in Tables 1 and 2) may be made by known methods and may be tagged with markers (e.g., fluorescent, radioactive, etc.) by means known in the art. One skilled in the art will appreciate that the amounts to be administered for any particular treatment protocol can readily be determined. The CD44 protein, peptide or derivative can be administered together with a pharmaceutically acceptable carrier.
  • the present invention relates to a method of transporting a drug or cytotoxic agent to a site of inflammation in an animal comprising administering to the animal the CD44 protein, or peptide or derivative thereof, linked, preferably covalently, to the drug or cytotoxic agent.
  • drugs to be targeted to organ- specific sites of inlammation are non-steroidal anti-inflammatory agents, forms of glucocorticosteroids, and cytoxic agents such as cyclophosphamide.
  • the present invention relates to a method of transporting a drug or cytotoxic agent to a site of inflammation in an animal comprising administering to the animal CD44 protein, or peptide or derivative thereof, and a drug or cytotoxic agent wherein both are incorporated into a liposome.
  • the present invention relates to a method of inhibiting T cell function in a human comprising administering to the human antibodies against CD44, preferably CD44H or CD44E peptides, in an amount sufficient to inhibit T cell function.
  • antibodies against the CD44-6A or the CD44-19A peptides can be used in vivo as immunotherapeutic agents to inhibit T cell function in the therapy of autoimmune or inflammatory disease.
  • Arch et al. Science (1992) 257:682-685
  • a rodent monoclonal antibody (1.1ASML) against a rat CD44 isoform containing domain 3 of CD44 insert (Hoffman et al. Cancer Res. (1991) 51:5292-5297) will inhibit the in vivo activation of T and B cells.
  • Mab 1.1ASML reacts with a different CD44 sequence than CD44-6A or CD44-19A peptides.
  • the present invention relates to a method of determining the metastatic potential of hematopoietic cell types comprising contacting test cells with antibodies (which may be attached to markers) against CD44, preferably antibodies against CD44H or CD44E peptides, most preferably antibodies against CD44-6A or CD44-19A peptides, either alone or together, and measuring the amount of binding between the cells and the antibodies by, for example, fluorescent or radioactive means.
  • antibodies which may be attached to markers
  • CD44H or CD44E peptides most preferably antibodies against CD44-6A or CD44-19A peptides
  • antibodies against the CD44-6A or the CD44-19A peptides can be used to make monoclonal or polyclonal antibodies that are specific for cells that express these isoforms of CD44.
  • CD44H isoform confers the ability to metastasize to B cell lymphoma cells, while the CD44E(R1) form does not.
  • CD44H specific antisera can be used to determine the metastatic potential of malignant hematopoietic cell types.
  • anti-CD44- 19A monoclonal or polyclonal antibodies raised against the CD44-19A peptide can be used to identify cells that mediate functions associated with expression of CD44 domains 4 or 5, such as metastasis of a particular cell type.
  • CD44 peptides and anti-sera such as CD44-6A peptide or anti-CD44-6A polyclonal or monoclonal antisera can be used to treat hematopoietic malignancies in vivo that involve CD44H+ cells.
  • anti-CD44-6A anti-sera can be used to purge bone marrow in vitro to rid bone marrow of CD44H+ malignant cells.
  • the present invention relates to methods of inhibiting CD44-hyluronan (HA) interaction and to compounds suitable for use in such a method.
  • CD44 ligation of HA is involved in a variety of pathologic clinical situations.
  • CD44 expression is upregulated on ras transformed tumor cells (Thomas et al, J. Cell. Biol. 118:971 (1992) ; Turley et al, J. Cell. Biol. 112:1041 (1991)), and HA ligation of tumor CD44 molecules is essential for tumor cell migration (Turley et al, J. Cell. Biol. 112:1041 (1991)) .
  • CD44 synthetic peptides eg, 3,4,5, 8 or 9
  • mimetopes of an anti-CD44 antibody Fab binding site for example, 5F12 (see Example 7 below)
  • DNA, RNA or peptide mimetopes can be used as inhibitors of CD44-HA interactions.
  • CD44 monoclonal antibodies for example, 5F12
  • 5F12 can be used to select ligands, for example, from random RNA, DNA or peptide libraries, that bind to the Fab region of the 5F12 mab with a high affinity and that mimic the HA binding site on CD44H (reviewed in Szostak, TIBS 17:89 (1992) and Tsai et al, J. Immunol. 150:1137 (1993)) .
  • ligands for example, from random RNA, DNA or peptide libraries
  • bind to the Fab region of the 5F12 mab with a high affinity and that mimic the HA binding site on CD44H (reviewed in Szostak, TIBS 17:89 (1992) and Tsai et al, J. Immunol. 150:1137 (1993)) .
  • such antibody-selected mimetopes for example, RNA, DNA or synthetic peptide
  • these mimetopes can be used to treat or prevent tumor cell metastasis of a variety of malignant cell types and to treat inflammatory diseases characterized by upregulation of CD44.
  • CD44 monoclonal antibodies for example, 5F12
  • 5F12 can be used in screening protocols to select, from a range of test compounds, those that can be used as inhibitors of the binding of HA to CD44.
  • a test compound can be contacted with a CD44 antibody such as 5F12 and the ability of the antibody to bind the test compound determined.
  • Test compounds for which the antibody has a high affinity can be expected to be useful as inhibitors of CD44-HA binding.
  • kits comprising container means disposed within which are antibodies to CD44, or peptides thereof, and ancillary agents (buffers, etc.) necessary for determining the metastatic potential of hematopoietic cell types.
  • Synovial Tissue and Synovial Fluid Synovial tissue was obtained as discarded tissue from the Duke University Department of Pathology at the time of joint surgery.
  • Synovial fluid was obtained as discarded fluid from the Duke University Clinical Immunology Laboratory at the time of arthrocentesis.
  • the degree of reactivity of CD44 and anti-fibronectin antibodies was graded 1+ to 4+ with 1+ signifying reactivity with ⁇ .25% of synovial tissue reactive, 2+ >25% and ⁇ 50% of synovial tissue area reactive, 3+ >50% and ⁇ . 75% of synovial tissue area reactive, and 4+ >75% of synovial tissue area reactive.
  • CD44 A1G3 and A3D8
  • FN-15 rat anti-mouse kappa chain
  • Synovial tissue was thawed, homogenized with a Dounce homogenizer in 0.6-1.0 ml extraction buffer (10 mM Tris pH 8.0, 150 M NaCl, 1% Triton X-100, 20 ⁇ g/ml soybean trypsin inhibitor, 1 mM iodoacetamide, and 1 mM PMSF) , and centrifuged, (15000 rpm x 1 minute) .
  • the protein content of supernatants (tissue extracts) was determined using a copper/bicinchoninic acid assay (McCachren et al. (1990) J. Clin. Immunol. 10:19-27) (BCA Protein Assay, Pierce, Rockford, IL) .
  • Tissue extracts were analyzed by SDS-PAGE on 7% or 10% mini-gels (Mini-Protean II, Biorad Laboratories, Richmond, CA) , followed by Western blot analysis using alkaline phosphatase-conjugated goat anti- mouse immunoglobulin along with the color development substrates BCIP (5-bromo-4-chloro-3 indolyl phosphate) and NBT (nitro blue tetrazolium) as developing reagents.
  • BCIP color development substrate
  • NBT nitro blue tetrazolium
  • CD44 in RA and OA fluids were expressed as a ratio using the equation
  • CD44 ratio CD44 in RA or OA Tissue .
  • CD44 in Trauma Tissue Analysis of Synovial Fluid for CD44 Protein Synovial fluid specimens were centrifuged, aliquoted, and stored at -80°C until processed. CD44 protein was immunoprecipitated from aliquots of synovial fluid which were precleared by incubation with P3-
  • Sepharose (control) beads then precipitated with either A3D8-Sepharose or P3-Sepharose.
  • Immunoprecipitates were removed from the beads by boiling in 0.06 M Tris pH 6.8, 10% glycerol, 2% SDS and analyzed by SDS-PAGE and Western blot analysis using alkaline phosphatase conjugated 187.1 rat anti-mouse immunoglobulin.
  • the amount of CD44 in trauma synovial fluid was given the value of 1 and the level of CD44 in RA and OA fluids were expressed as a ratio using the equation,
  • CD44 ratio CD44 in RA or OA Fluid
  • CD44 in Trauma Fluid Band densities of CD44 in gels were determined as for tissue above.
  • CD44 A3D8 and control YgGl (P3X63/Ag8) antibodies were conjugated "to CNBr-activated Sepharose CL-4B (Pharmacia, Piscataway, NJ) (3.0 mg IgG/ml gel).
  • HuT 78 T Cell (CD44+) lysate was solubilized from 5 x 10 9 cells in 50 ml buffer (300 mM NaCl, 10 mM Na 2 HP0 4 pH 7.4, 0.2% NaN 3 w/v 0.5% NP-40 v/v), 0.01% Tween 80 w/v, 0.2 mM phenylmethylsulfonyl fluoride, and 0.1 mM tosyl L-lysine chloromethyl ketone) (0°C x 30 min) , centrifuged (4°C 3000 x g x 15 min, 23420 x g x 30 min) filtered, precleared x 2 over a P3-Sepharose column, and allowed to bind overnight (4°C) to A3D8-Sepharose.
  • 50 ml buffer 300 mM NaCl, 10 mM Na 2 HP0 4 pH 7.4, 0.2% NaN 3 w/v 0.5% NP-40 v/v
  • CD44 Liposomes Liposomes were prepared by the method of Mimms et al. ((1981) Biochemistry 20:833-840), using 1 ⁇ M purified CD44 or control glycophorin protein, 1 nM L- ⁇ -dioleoyl lecthin (Avanti Polar Lipids, Birmingham, AL) , and 240 nM OG. Liposomes were analyzed for content of the appropriate protein using a novel labelling technique and flow cytometry. Liposomes were incubated with 5- (N-octadecanoyl) aminofluorescein (Molecular Probes, Eugene, OR) in PBS x 10 min at room temperature.
  • 5- (N-octadecanoyl) aminofluorescein Molecular Probes, Eugene, OR
  • Fluoresceinated liposomes were then reacted with 4.5 mm magnetic beads (Dynabeads M-450 Goat anti-Mouse IgG, Dynal Inc., Great Neck, NY) coated with CD44 (A3D8) or anti-glycophorin (E3,E4,E5) mAbs. After 45 minutes (4°C), with continuous end-over-end rotation, beads were washed x3 in PBS using a magnet to immobilize the beads during PBS changes. Fluoresceinated liposome-bead conjugates were then analyzed by flow cytometry.
  • PBMC from healthy donors were stimulated with optimal mitogenic concentration of CD2 mabs 35.1 and 9-1 as described (Denning et al. ) . Where indicated, CD44 or control glycophorin liposomes (final protein range used was 28-140 nM) were added to these cultures 20 min prior to addition of CD2 mabs. In some experiments PBMC were pretreated with 0.1% bromelain to remove cell membrane CD44 (Telen et al. (1983) J. Clin. Invest. 71:1878-1886, Hale (1989) Immunol. 143:3944-3948).
  • Figures 1A-F In RA, infiltrating lymphocytes and macrophages, as well as synovial lining cells, vessels and fibroblasts were brightly CD44+ ( Figures 1G,H,I) . In RA with pannus formation, both CD44 and fibronectin were widely expressed throughout synovial tissues ( Figures 1K,J,L) . RA tissues studied had a mean inflammation score of 13.1 ⁇ 2.0 versus 6.6 ⁇ 1.3 in OA tissues. The degree of CD44 mAb reactivity in indirect IF assay was graded (CD44 index, see Methods) on a 1-4 scale with 1 the least CD44 present and 4 the most.
  • CD44 index in RA was 3.6+.2 versus 1.8 ⁇ .2 in OA (p ⁇ .001) (Table 4).
  • CD44 upregulation in synovial tissues in RA was due to two separate mechanisms:1) increase in expression of CD44 on synovial tissue cell types (synovial lining cells, vessels, fibroblasts) , and 2) influx of CD44+ infiltrating immune cells (CD44+ T and B lymphocytes, macrophages) .
  • the diagnosis of RA was made using ACR criteria.
  • Trauma (n 6) 9.2 ⁇ 4.2# 2.0+0.4 2.4 ⁇ 0.6
  • FIG. 229) RA synovium (nos. 7,154, and 86) and in a representative OA synovium (no. 198) is shown in Figure 2A.
  • Figure 2B shows the relative amounts of CD44 in each synovial tissue as determined by the actual value obtained by laser densitometry of the same Western blot gel.
  • RA tissue contained 3 fold more CD44 per gram of wet tissue than did OA tissue, 11 fold more than trauma synovium, and demonstrated that the amount of synovial tissue CD44 correlated with the degree of inflammation present (Table 5) .
  • the mean WBC was 1250 ⁇ 577 cells/mm 3 and the mean level of CD44 was .94 ⁇ 2 [ie, was .94x the level of CD44 found in trauma synovial fluid no. 11] .
  • the mean cell count was elevated (11,279 ⁇ 2107) (p ⁇ .025 compared to OA) and the mean CD44 level was near double that of trauma and OA synovial fluid (1.91+.4) (p ⁇ .001) (Table 6) .
  • Figure 3 shows examples of CD44 in RA versus OA and trauma synovial fluids.
  • RA synovial fluid contained an average of 2 fold more soluble CD44 than OA or trauma synovial fluid, and the mean RA synovial cell count was higher than for OA (Table 6) .
  • RA synovial fluids When RA synovial fluids were grouped according to cell count, RA synovial fluids with low cell counts ( ⁇ 7000 cells/mn 3 ) had 3.3x (2.84 ⁇ 0.3 mean +SEM relative CD44 level) more CD44 than did RA synovial fluids with higher cell counts (> 8500 cells/mm 3 ) (.85 ⁇ .35 mean ⁇ SEM relative CD44 level) . Thus, higher levels of soluble CD44 were present in RA synovial fluids with lower cell counts, and synovial fluid CD44 decreased to sub-normal levels in the more inflammatory RA synovial fluids.
  • Data are arbitrary units relative to CD44 level found in trauma synovial fluid no. 11 (cell count 450, relative CD44 protein level taken as 1.0) .
  • the types of medications taken by RA patients with WBC >8500 did not differ from medications taken by RA patients with WBC ⁇ 7000.
  • RA Patient 17 also had calcium pyrophosphate crystals present in join fluid.
  • CD44 was affinity-purified from T cell membranes, incorporated into liposomes, and incubated with peripheral blood ononuclear cells (PBMC) prior to stimulation with CD2 antibodies (a potent stimulus of T cell activation) (Denning et al., Stamenkovic et al. (1989) Cell 56:1057- 1062) .
  • PBMC peripheral blood ononuclear cells
  • CD2 mAb+CD44 liposomes CD2 mAb+control liposomes
  • CD2 mAb+CD liposomes CD2 mAb+control liposomes
  • the CD44-6A and the CD44-19A peptides can inhibit T cell activation and antisera against these peptides can also inhibit T cell activation.
  • Table 8 shows that addition of 1 mg/ml of either CD44-6A or CD44-19A peptide to anti-CD3 monoclonal antibodies triggered peripheral blood mononuclear cell in vitro cultures and resulted in inhibition of T cell activation.
  • Table 9 demonstrates that the rabbit polyclonal antisera against either the 6A or the 19A peptides also inhibited the in vitro T cell proliferative response to anti-CD3 monoclonal antibodies.
  • Synthetic peptides were prepared by F-Moc or T-Boc chemistry, purified using HPLC, and resuspended in RPMI media prior to addition to 4 day in vitro cultures. Following 4 days in culture, 3H- thymidine was added, and following an incubation of 4 hours, the cultures were harvested using an automated multiwell harvester using standard techniques.
  • the conjugated peptide was injected subcutaneously in multiple sites in rabbits, initially in complete Freund's adjuvant, and boosted in incomplete Freund's adjuvant as described in Ware et al . , J. Immunol. (1989) 143:3632-3640.
  • 5F12 IgG Human CD44 mab 5F12, A1G3 and A3D8 have been described previously (Liao et al, J. Immunol, in press (1993)).
  • 5F12 IgG was purified from serum- free supernatant of 5F12 hybridoma cell line by Affi-gel Protein A MAPS II column (Bio-Rad, Richmond, California) .
  • 5F12 Fab and Fab fragments were prepared by digestion of 5F12 whole IgG with pepsin or papain, and purified by protein A column.
  • Fluorocein isothocyanate (FITC) labeled 5F12 IgG was prepared as described previously
  • P3x63 paraprotein (P3) IgG was purified from serum-free supernatant of the P3x63Ag8.652 myeloma cell line, and used as a negative control in mab binding assays.
  • CD44H transfected Jurkat T cell lines have been previously described (Liao et al, J. Immunol. December 1, 1993) . Cells were treated with
  • CD44-Rg expression plasmid produces hybrid CD44-Rg molecules comprised of the full extracellular domain of CD44H and the human IgG hinge, CH2 and CH3 regions of IgG ⁇ heavy chain (gift from Brian Seed, Boston, Massachusetts) (Miyake et al, J. Exp. Med. 172:69 (1990)) .
  • CD44-Rg plasmid was transfected into cos cells and the CD44-Rg fusion protein was prepared from the supernatants of the transfected cos cells and purified by Protein A chromatography as described (Miyake et al, J. Exp. Med. 172:69 (1990)) .
  • the NH2 ⁇ terminal amino acid sequence of CD44-Rg was determined by automated amino acid sequencing (Applied Biosystems, Inc. Model 470A) . SDS-PAGE and Western blotting:
  • Jurkat T cells were washed twice with ice-cold PBS and lysed in 10 mM Tris-Cl, pH 7.4, 0.5% NP40, 150 mM NaCl, 25 mM EDTA, 10 ⁇ g/ml aprotinin, 1 mM phenylmethysulfonyl fluoride, and 20 mM iodacetemide) .
  • Cell lysates (approximately 1 X 10 6 cells/lane) and the purified CD44-Rg (100 ng/lane) were resolved by 7.5% SDS-PAGE under non-reducing conditions. The resulting gel was electrophoretically blotted onto a nitrocellulose filter.
  • the filter was blocked in 10% nonfat milk, reacted with CD44 mabs or control mab and then incubated with goat anti-mouse IgG-alkline phosphotase conjugate (Promega, Madison, Wisconsin) and followed by incubation with substrate for visualization.
  • Total cellular RNA was isolated from Cos cells by guanidium isothiocyanate lysis and centrifugation through cesium chloride. Total cellular RNA (5 ⁇ g) was transcribed using reverse transcriptase (Pharmacia LKB Biotechnology) with a down stream primer (GGATCTAGATTACACCCCAATCTTC)
  • CD44 monoclonal antibodies to bind to various forms of CD44 molecules:
  • Monoclonal antibodies 5F12, A1G3 and A3D8 were tested for their ability to bind to recombinant soluble CD44-Rg fusion protein produced by CD44 Rg-transfected African Green monkey cos cells (Liao et al, J. Immunol, in press (1993)) .
  • CD44-Rg cDNA Seed et al deleted the first 20 amino acids at the N-terminus of CD44 and substituted 5 amino acids of the leader sequence of CD5 in order to optimize expression of the CD44-Rg fusion molecule (Liao et al, J. Immunol, in press (1993)) .
  • A1G3, A3D8 and 5F12 to bind to endogenous African Green monkey kidney cell CD44 expressed on cos cells, to bind to baboon CD44 expressed on 26 CB-1 cells, or to bind to human CD44H transfected Jurkat cells was determined by indirect immunofluorescence and flow cytometry.
  • Figure 14 shows that only 5F12 reacted well with cos cells and 26 CB-1 cells, while all 3 mabs reacted well with human CD44H in Jurkat T cells.
  • Table 11 shows the N-terminal seqeunce of endogenous cos cell Africal Green Monkey CD44, human CD44 and the CD44-Rg fusion protein.
  • the N-terminal amino acids of CD44 are predicted to begin at the sequence MDKFWW (SEQ ID NO:23) and the RLRVP (SEQ ID NO:24) sequence is derived from the CD5 molecule (Liao et al, J. Immunol, in press (1993)) .
  • the N-terminal aa sequences of African Green monkey CD44 and human CD44H were deduced from the corresponding cDNAs as described.
  • the N-terminal amino acid sequence of CD44-Rg were determined by the N-terminal amino acid sequencing of CD44-Rg as
  • CD44-Rg is a fusion protein of the extracellular domain of CD44 (minus
  • CD44-3, CD44-4, CD44-4, CD44-5 and CD44-8 peptides, Table 1 are involved in HA binding, and therefore will, in and of themselves, be of use as therapeutic agents to block HA binding to CD44H or
  • CD44E He et al (J. Cell. Biol. 119:1711) and Liao et al (J. Immunol. December 1,, 1993) have both shown that CD44H and CD44E can bind HA.
  • Asp Ser Pro Trp lie Thr Asp Ser Thr Asp Arg lie Phe Ala Thr Arg
  • Lys Ala Leu Ser lie Gly Phe Glu Thr Cys Arg Tyr 20 25
  • MOLECULE TYPE peptide
  • xi SEQUENCE DESCRIPTION: SEQ ID NO:23 MDKFWW

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Toxicology (AREA)
  • Cell Biology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

L'invention concerne, de manière générale, un procédé permettant de traiter une inflammation ou d'inhiber des métastases de cellules cancéreuses. Plus particulièrement, elle concerne un procédé qui permet de réprimer l'activation des lymphocytes T, d'inhiber l'adhérence cellulaire due à la médiation de CD44 et la libération d'IL1 de monocytes due à la médiation de CD44, de traiter une inflammation et de transporter un médicament vers un site d'inflammation.
PCT/US1993/010412 1992-10-30 1993-10-29 Molecule d'adherence WO1994009811A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU55435/94A AU5543594A (en) 1992-10-30 1993-10-29 An adhesion molecule

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US97333992A 1992-10-30 1992-10-30
US973,339 1992-10-30

Publications (1)

Publication Number Publication Date
WO1994009811A1 true WO1994009811A1 (fr) 1994-05-11

Family

ID=25520779

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1993/010412 WO1994009811A1 (fr) 1992-10-30 1993-10-29 Molecule d'adherence

Country Status (2)

Country Link
AU (1) AU5543594A (fr)
WO (1) WO1994009811A1 (fr)

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998039034A2 (fr) * 1997-03-04 1998-09-11 Boehringer Ingelheim International Gmbh Utilisation de preparations contenant des anticorps anti-cd44 pour traiter certaines tumeurs et supprimer les reactions immunitaires
US5942417A (en) * 1996-07-15 1999-08-24 Human Genome Sciences, Inc. CD44-like protein and nucleic acids
US6001356A (en) * 1995-09-29 1999-12-14 Rush-Presbyterian-St. Luke's Medical Center Method of inhibiting tissue destruction in autoimmune disease using anti-CD44 antibodies
WO2000075312A1 (fr) * 1999-06-08 2000-12-14 Yissum Research And Development Company Of The Hebrew University Of Jerusalem Variante d'epissage de cd44 associee a la polyarthrite rhumatoide
WO2003018044A1 (fr) * 2001-08-24 2003-03-06 Stroemblad Staffan Nouveau medicament
EP1532984A1 (fr) * 2003-11-19 2005-05-25 Institut National De La Sante Et De La Recherche Medicale (Inserm) Utilisation d'anticorps anti-CD44 pour l'éradication des cellules souches de la leucémie myéloide aigue
EP1689781A2 (fr) * 2003-11-07 2006-08-16 Brigham And Women's Hospital, Inc. Anticorps de clycoformes de cd44 et utilisations de ceux-ci
EP2102238A2 (fr) * 2006-12-21 2009-09-23 Medarex Inc. Anticorps anti-cd44
WO2010058396A1 (fr) 2008-11-19 2010-05-27 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Anticorps anti-cd44vra et procédés diagnostiques et thérapeutiques l'utilisant
EP2403518A2 (fr) * 2009-03-06 2012-01-11 Angstrom Pharmaceuticals, Inc. Compositions et procédés de modulation de la migration cellulaire
WO2015028172A1 (fr) 2013-08-29 2015-03-05 Holy Stone Biotech Co., Ltd. Composé de glycosaminoglycane, son procédé de préparation et son utilisation
US10611819B2 (en) 2014-07-15 2020-04-07 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Isolated polypeptides of CD44 and uses thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5002873A (en) * 1989-03-17 1991-03-26 Fred Hutchinson Cancer Research Center DNA sequence encoding a lymphocyte adhesion receptor for high endothelium

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5002873A (en) * 1989-03-17 1991-03-26 Fred Hutchinson Cancer Research Center DNA sequence encoding a lymphocyte adhesion receptor for high endothelium

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
EXPERIMENTAL CELL RESEARCH, Volume 187, Number 2, issued April 1990, J. LESLEY et al., "Binding of Hyaluronic Acid to Lymphoid Cell Lines is Inhibited by Monoclonal Antibodies Against Pgp-1", pages 224-233. *
JOURNAL OF EXPERIMENTAL MEDICINE, Volume 171, issued February 1990, K. MIYAKE et al., "Monoclonal Antibodies to Pgp-1/CD44 Block Lympho-Hemopoiesis in Long-Term Bone Marrow Cultures", pages 477-488. *
JOURNAL OF EXPERIMENTAL MEDICINE, Volume 172, issued July 1990, K. MIYAKE et al., "Hyaluronate can Function as a Cell Adhesion Molecule and CD44 Participates in Hyaluronate Recognition", pages 69-75. *
SPRINGER SEMINARS IN IMMUNOPATHOLOGY, Volume 11, issued 1989, B.F. HAYNES et al., "The Role of Leukocyte Adhesion Molecules in Cellular Interactions: Implications for the Pathogenesis of Inflammatory Synovitis", pages 163-185. *
THE EMBO JOURNAL, Volume 10, Number 2, issued February 1991, I. STAMENKOVIC et al., "The Hematopoietic and Epithelial Forms of Cd44 are Distinct Polypeptides with Different Adhesion Potentials for Hyaluronate-Bearing Cells", pages 343-348. *
THE JOURNAL OF IMMUNOLOGY, Volume 142, Number 6, issued 15 March 1989, L.J. PICKER et al., "Monoclonal Antibodies Against CD44[In(Lu)-Related p80], and Pgp-1 Antigens in Man Recognize the Hermes Class of Lymphocyte Homing Receptors", pages 2046-2051. *
THE JOURNAL OF IMMUNOLOGY, Volume 143, Number 12, issued 15 December 1989, L.P. HALE et al., "CD44 Antibody Against In(Lu)-Related p80, Lymphocyte-Homing Receptor Molecule Inhibits the Binding of Human Erythrocytes to T Cells", pages 3944-3948. *
THE JOURNAL OF IMMUNOLOGY, Volume 144, Number 1, issued 01 January 1990, S.M. DENNING et al., "Antibodies Against the CD44 p80, Lymphocyte Homing Receptor Molecule Augment Human Peripheral Blood T Cell Activation", pages 7-15. *

Cited By (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6001356A (en) * 1995-09-29 1999-12-14 Rush-Presbyterian-St. Luke's Medical Center Method of inhibiting tissue destruction in autoimmune disease using anti-CD44 antibodies
US5942417A (en) * 1996-07-15 1999-08-24 Human Genome Sciences, Inc. CD44-like protein and nucleic acids
WO1998039034A3 (fr) * 1997-03-04 1998-12-17 Boehringer Ingelheim Int Utilisation de preparations contenant des anticorps anti-cd44 pour traiter certaines tumeurs et supprimer les reactions immunitaires
WO1998039034A2 (fr) * 1997-03-04 1998-09-11 Boehringer Ingelheim International Gmbh Utilisation de preparations contenant des anticorps anti-cd44 pour traiter certaines tumeurs et supprimer les reactions immunitaires
WO2000075312A1 (fr) * 1999-06-08 2000-12-14 Yissum Research And Development Company Of The Hebrew University Of Jerusalem Variante d'epissage de cd44 associee a la polyarthrite rhumatoide
WO2003018044A1 (fr) * 2001-08-24 2003-03-06 Stroemblad Staffan Nouveau medicament
EP1689781A2 (fr) * 2003-11-07 2006-08-16 Brigham And Women's Hospital, Inc. Anticorps de clycoformes de cd44 et utilisations de ceux-ci
EP1689781A4 (fr) * 2003-11-07 2007-06-13 Brigham & Womens Hospital Anticorps de clycoformes de cd44 et utilisations de ceux-ci
JP2007513610A (ja) * 2003-11-19 2007-05-31 アンスティテュ ナシオナル ドゥ ラ サーント エ ドゥ ラ ルシェルシュ メディカル キメラ抗ｃｄ４４抗体およびそれらの使用
EP2275444A1 (fr) * 2003-11-19 2011-01-19 Institut National de la Santé et de la Recherche Médicale (INSERM) Anticorps anti-CD44 chimériques et leur utilisation pour traiter la leucémie myéloide aigue
WO2005049082A2 (fr) * 2003-11-19 2005-06-02 Institut National de la Santé et de la Recherche Médicale Anticorps anti cd44 chimeriques et applications
EP1532984A1 (fr) * 2003-11-19 2005-05-25 Institut National De La Sante Et De La Recherche Medicale (Inserm) Utilisation d'anticorps anti-CD44 pour l'éradication des cellules souches de la leucémie myéloide aigue
WO2005049082A3 (fr) * 2003-11-19 2005-11-10 Inst Nat Sante Rech Med Anticorps anti cd44 chimeriques et applications
EP2102238A2 (fr) * 2006-12-21 2009-09-23 Medarex Inc. Anticorps anti-cd44
EP2102238A4 (fr) * 2006-12-21 2010-09-01 Bristol Myers Squibb Co Anticorps anti-cd44
WO2010058396A1 (fr) 2008-11-19 2010-05-27 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Anticorps anti-cd44vra et procédés diagnostiques et thérapeutiques l'utilisant
EP2403518A2 (fr) * 2009-03-06 2012-01-11 Angstrom Pharmaceuticals, Inc. Compositions et procédés de modulation de la migration cellulaire
EP2403518A4 (fr) * 2009-03-06 2013-01-23 Angstrom Pharmaceuticals Inc Compositions et procédés de modulation de la migration cellulaire
WO2015028172A1 (fr) 2013-08-29 2015-03-05 Holy Stone Biotech Co., Ltd. Composé de glycosaminoglycane, son procédé de préparation et son utilisation
US11229665B2 (en) 2013-08-29 2022-01-25 Holy Stone Healthcare Co., Ltd. Compound of glycosaminoglycan and its fabrication method as well as application
US10611819B2 (en) 2014-07-15 2020-04-07 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Isolated polypeptides of CD44 and uses thereof
US11560417B2 (en) 2014-07-15 2023-01-24 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Isolated polypeptides of CD44 and uses thereof

Also Published As

Publication number Publication date
AU5543594A (en) 1994-05-24

Similar Documents

Publication Publication Date Title
Pulido et al. Comparative biochemical and tissue distribution study of four distinct CD45 antigen specificities.
Fox et al. Normal human tissues, in addition to some tumors, express multiple different CD44 isoforms
US5644033A (en) Monoclonal antibodies that define a unique antigen of human B cell antigen receptor complex and methods of using same for diagnosis and treatment
Davies et al. CD59, an LY-6-like protein expressed in human lymphoid cells, regulates the action of the complement membrane attack complex on homologous cells.
Alessio et al. CD38 molecule: structural and biochemical analysis on human T lymphocytes, thymocytes, and plasma cells.
Jaspars et al. Tissue distribution of the human CD97 EGF‐TM7 receptor
US5227471A (en) Monoclonal antibody PD41 that binds to a prostate mucin antigen that is expressed in human prostatic carcinoma
Nakamura et al. Human T cell activation. IV. T cell activation and proliferation via the early activation antigen EA 1.
Samulowitz et al. Human endomucin: distribution pattern, expression on high endothelial venules, and decoration with the MECA-79 epitope
CA2181062A1 (fr) Diagnostic de cancers metastasiques a l'aide du gene mts-1
WO1994009811A1 (fr) Molecule d'adherence
GOULDING et al. Evidence for specific annexin I-binding proteins on human monocytes
Cook et al. Mouse monoclonal antibodies to the human C3b receptor
PL171920B1 (pl) Sposób wytwarzania nowego, hamujacego PDGF-R polipeptydy immunoglobulinowego PL
US6432405B1 (en) Method of inhibiting HIV infection with CD44 and anti-CD44 antibodies
Wagner et al. Regulation of the tyrosine kinase-dependent adhesion pathway in human lymphocytes through CD45.
US5863540A (en) Adhesion molecule
EP0697880B1 (fr) Inhibition de l'adhesion des leucocytes
US5942404A (en) Cell surface protein expressed on human cortical thymocyte and their use
Altevogt et al. Association of CD2 and T200 (CD45) in mouse T lymphocytes
AU1048495A (en) Cd6 ligand
US6328968B1 (en) Methods and means for modifying complement activation
Cruz et al. Functional analysis of a recombinant glycoprotein Ib alpha polypeptide which inhibits von Willebrand factor binding to the platelet glycoprotein Ib-IX complex and to collagen.
US7700316B2 (en) CD109 nucleic acid molecules, polypeptides and methods of use
Russell et al. p126 (CDw101), a costimulatory molecule preferentially expressed on mucosal T lymphocytes.

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA JP

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: CA