WO1994004689A1 - Toxine recombinee a demi-vie prolongee - Google Patents

Toxine recombinee a demi-vie prolongee Download PDF

Info

Publication number
WO1994004689A1
WO1994004689A1 PCT/US1993/007672 US9307672W WO9404689A1 WO 1994004689 A1 WO1994004689 A1 WO 1994004689A1 US 9307672 W US9307672 W US 9307672W WO 9404689 A1 WO9404689 A1 WO 9404689A1
Authority
WO
WIPO (PCT)
Prior art keywords
domain
protein
recombinant protein
recombinant
life
Prior art date
Application number
PCT/US1993/007672
Other languages
English (en)
Inventor
Ira H. Pastan
Vijay K. Chaudhary
Janendra Batra
Original Assignee
The Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services filed Critical The Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services
Priority to AU50983/93A priority Critical patent/AU5098393A/en
Publication of WO1994004689A1 publication Critical patent/WO1994004689A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/21—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Pseudomonadaceae (F)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/70514—CD4
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/32—Fusion polypeptide fusions with soluble part of a cell surface receptor, "decoy receptors"
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/55—Fusion polypeptide containing a fusion with a toxin, e.g. diphteria toxin

Definitions

  • the present invention relates to the production and use of recombinant toxins modified to increase their half-life and potency during therapy. More particularly, this invention relates to the use of specific regions of the Fc portion of an immunoglobulin molecule to confer an increased half-life on single chain chimeric toxins.
  • antibodies and other cell targeting molecules can be used to kill cells bearing specific receptors or antigens (Pastan et al.. Cell 47:641 (1986) and Vitetta et al.. Science 238:1098 (1987)).
  • immunotoxins were made by coupling monoclonal antibodies to toxins by chemical methods to form protein di ers.
  • recombinant toxins have been made in E. coli in which growth factors like TGF ⁇ , IL2, IL4, IL6, IGF1, or CD4 are fused to recombinant forms of the Pseudomonas toxin. These chimeric toxins possess specific in vitro and in vivo cytotoxic activities (Pastan et al., Ann . Rev. Biochem. 61:331-354 (1992)).
  • CD4-PE40 is a recombinant toxin consisting of a portion of the CD4 molecule (amino acids 1-178) attached to PE40.
  • PE40 is a recombinant fragment of the Pseudomonas exotoxin that lacks the cell binding domain of PE (Chaudhary et al.. Nature 335:369 (1988)).
  • PE-40 contains the domains of PE that permit cell membrane translocation and inhibition of protein translation through the ADP ribosylation of elongation factor 2.
  • CD4-PE40 binds specifically to gpl20 on the surface of HIV infected cells and kills these cells by inhibiting protein synthesis. Thus, this molecule is a potential therapeutic for AIDS.
  • CD4-PE40 can eliminate HIV from infected cultures (Ashorn et al., Proc. Natl . Acad. Sci . USA 87:8889 (1990)).
  • CD4-PE40 is currently being evaluated as a therapeutic agent for the treatment of AIDS in clinical trials.
  • Recombinant toxins made in E. coli are much smaller in size than conventional immunotoxins. Thus, they more easily penetrate tumors and tissues as compared with immunotoxins formed from more than one polypeptide strand. The single chain and small size make these toxins more effective in cell delivery. However, chimeric toxins are rapidly cleared from the blood. The short half-life of recombinant chimeric toxins could be a consequence of their small size or their sensitivity to proteases. For example, an improved CD4-PE40 toxin that readily penetrates tissue and has an increased half-life would directly benefit AIDS patients.
  • Antibodies have been chemically conjugated to toxins to generate immunotoxins which have increased half-lives in serum as compared with unconjugated toxins and this increased half-life is attributed to the native antibody.
  • Pollock et al. (Eur. J. Immunol . 20:2021, 1990) reported that at least 30% of IgG remains in the circulation after 24-48 hrs and also that the subsequent decay rates of the IgG subclass is much slower than IgM or IgA subclasses.
  • IgGl, IgG2a and IgG3 all have similar half-lives while IgG2b has a shorter half-life.
  • CD4-immunoadhesins 2 ⁇ l and 4 ⁇ l constructed hybrid molecules, termed CD4-immunoadhesins 2 ⁇ l and 4 ⁇ l, that consist of the first two or all four immunoglobulin-like domains of CD4 fused to the constant regions of the human IgGl heavy chain.
  • Polyacrylamide gel analysis indicated that both immunoadhesins were disulfide linked dimers with structural similarities to immunoglobulin. Dimers tend to be expensive to make and are larger molecules which deter them from readily penetrating tissue. While the immunoadhesins functioned in the circulation to bind HIV, as a dimer, they had limited penetration into tissue.
  • This invention relates to single chain recombinant proteins, comprising the following domains: (a) a cytotoxic domain; (b) a ligand binding domain; and (c) a peptide linking domains (a) and (b) comprising an IgG constant region domain having the property of increasing the half-life of the protein in mammalian serum.
  • the IgG constant region domain is CH2 or a fragment thereof.
  • the cytotoxic domain is preferably Pseudomonas exotoxin A (PE) wherein domain la has been deleted from the PE.
  • An exemplary and particularly useful ligand binding domain is from CD4 receptor.
  • the invention also includes recombinant DNA molecules operably encoding the recombinant proteins and host cells expressing the proteins. Further included are methods for treating HIV infection in a human, comprising administering a therapeutically effective dose of the recombinant proteins. Pharmaceutical compositions comprising a therapeutically effective dose of the recombinant proteins in a pharmaceutically acceptable carrier are also contemplated.
  • Figure 1A is a schematic of expression vector pJB 403H encoding CD4-PE40 under the control of the bacteriophage T7 promoter.
  • the junction of CD4 and domain II of PE40 is given in the expanded sequence above the construct section.
  • the DNA sequence of the linker and the corresponding amino acids are abbreviated using the single letter code.
  • Figure IB relates plasmid nomenclature to the protein product produced by each of the constructs.
  • Each construct contains CD4 and PE40 together with various segments from the Fc portion of IgGl. The numbers in parentheses indicate those amino acids derived from each indicated domain.
  • Figure 2 provides the SDS-polyacrylamide gel electrophoretic pattern of the purified protein chimeras stained with Coomassie Blue. Molecular weight size markers (in daltons) are provided in the left margin.
  • Figure 3 graphically illustrates the difference between blood concentrations of CD4-CH2-PE40, CD-CH1CH2-PE40, CD4-CH3-PE40, CD4-CH2CH3-PE40, and CD4-PE40 over time. About 40 ⁇ g I 125 labeled protein was injected intravenously and amounts assayed at time points indicated.
  • Figure 4 contains three SDS polyacrylamide gels each containing CD4-PE40 and CD4-CH2-PE40 digested with various amounts of trypsin at pH 7.4 ( Figure 4A) and at pH 5.0 ( Figure 4B) .
  • Figure 4C represents equal amounts of both CD4-PE40 and CD4-CH2-PE40 mixed and incubated with indicated concentrations of trypsin. Proteins were run on 12.5% polyacrylamide gels and stained with Coomassie blue.
  • CD4 is a T-lymphocyte surface molecule and is the cell receptor for Human Immunodeficiency Virus (HIV) .
  • HIV Human Immunodeficiency Virus
  • CD4 specifically binds HIV envelope glycoprotein gpl20. Few of the CD4 based candidates neutralize HIV infectivity to cell surface CD4.
  • This chimeric molecule selectively inhibits protein synthesis in cells expressing the HIV envelope glycoprotein and is selectively toxic to cells expressing the HIV envelope glycoprotein gpl20 (Chaudhary et al.. Nature 335:369 (1988) incorporated by reference herein) .
  • CD4-PE40 is now in clinical trials.
  • CD4-PE40 toxin successfully kills HIV infected cells, it has a reduced half-life as compared with other circulating molecules such as immunoglobulins or recombinant di er molecules comprising CD4 and the immunoglobulin constant region.
  • a toxin with an increased half-life in the circulation or improved HIV-infected cell cytotoxicity would directly benefit HIV patients worldwide.
  • One preferred embodiment of the invention discloses the incorporation of fragments of immunoglobulin into the single chain recombinant chimeric protein CD4-PE40 to confer an increased half-life in vivo.
  • These fragments are broadly termed "domains".
  • a domain may be a designated region of a molecule such as the CH3 domain of an immunoglobulin, or domain can refer to fragments thereof. Since CD4-PE40 is typically given to patients intravenously, its circulatory half-life and rate of degradation plays an important role in its therapeutic efficacy. This invention dramatically improves the half-life of an important therapeutic.
  • the single chain recombinant proteins of the invention are produced by fusing through recombinant means, such as through the production of single chain antibodies in E. coli , a cytotoxic domain, a ligand binding domain and an IgG constant region domain peptide linking the first two domains.
  • a variety of cytotoxic molecules are suitable for use as the cytotoxic domain in the recombinant immunotoxins described here. Any toxin known to be useful as the toxic component of an immunotoxin may be used so long as it is a protein that may be recombinantly expressed.
  • cytotoxic domain Particularly useful as the cytotoxic domain are Pseudomonas exotoxin A; diphtheria toxin and ribosome inactivating toxins derived from plants and fungi, including ricin, sarcin, tricanthosin, saporin and others described in Genetically Engineered Toxins, ed. A. Frankel, Marcel Dekker, Inc. (1992) , incorporated by reference herein; and any recombinant derivatives of those. See generally, “Chimeric toxins,” Olsnes and Pihl, Pharmac. Ther. 25:355-381 (1982) and U.S. Patent Nos.
  • the cytotoxic domain from PE preferably comprises a PE molecule in which domain IA has been deleted, such as in PE-40.
  • the PE cytotoxic domain can be further modified using site-directed mutagenesis or other techniques known in the art, to alter the molecule for particular desired application. Means to alter the PE molecule in a manner that does not substantially affect the functional advantages provided by the recombinant proteins described here can also be used and such resulting molecules are intended to be covered herein. For maximum cytotoxic properties of a preferred PE domain, several modifications to the molecule may be used.
  • An appropriate carboxyl terminal sequence to the recombinant molecule is preferred to translocate the molecule into the cytosol of target cells.
  • Amino acid sequences which have been found to be effective include, REDLK (as in native PE) , REDL or KDEL, repeats of those, or other sequences that function to maintain or recycle proteins into the endoplasmic reticulum, referred to here as "endoplasmic retention sequences". See, for example, Chaudhary et al, Proc. Natl . Acad. Sci . USA
  • a "ligand binding domain” refers generally to all molecules capable of reacting with or otherwise specifically recognizing or binding to a receptor on a target cell. Examples of such binding domains include, but are not limited to antibodies, growth factors such as TGFof, IL2-r IL4, IL6, IGF1 or CD4, hormones and the like which specifically bind desired target cells.
  • Ligand binding domains from the CD4 receptor are preferred and are known and described in the art. See, e.g. Chaudhary et al., Nature, supra.; P.J. Maddon et al., Proc. Natl . Acad. Sci . USA, 86:9155-9157 (1987); Smith et al..
  • a binding domain including about 180 amino acids from the ⁇ -terminal end of CD4 is used.
  • the amino terminal end of an IgG molecule is characterized by sequence variability in both the heavy (V H ) and light (V L ) chain regions.
  • the rest of the molecule is relatively constant.
  • the constant portion of the light chain is termed the C L region and the constant portion of the heavy chain is further divided into three structurally discrete regions: CHI, CH2 and CH3.
  • the hinge region is a segment of heavy chain between the CHI and CH2 domains. See Roitt et al.. Immunology, Harper & Row Publishers, New York City, New York (1989) .
  • IgG constant region domains are useful in the invention and are preferably of human origin.
  • the regions may be chimeric (Morrison et al., Proc. Natl . Acad. Sci . USA 81:6851-6855 (1984)) or humanized (Jones et al.. Nature 321:522-525 (1986)).
  • the IgG constant region domains useful in the proteins here include all or any one of the constant regions, CHI, CH2 and CH3, any fragments thereof and any combination of these. Exemplary sequence listings for these regions are known and are found in Ellison et al., Nuc. Acid Des . , 10:4071-4079 (1982), incorporated by reference herein.
  • the IgG constant region domains incorporated into the recombinant proteins will be CH2, CH3, CH2-CH3, or CH1-CH2, most preferably CH2. Fragments of these domains may alternatively be used. Effective fragments will be those that have the property of increasing the half-life of the ligand binding domain in mammalian serum.
  • IgG constant region domain into the proteins disclosed here increases the half-life of the product in mammalian serum. An increase in the half-life may be demonstrated by using the method described in Example 3 below. Preferably the IgG constant region domain will increase the half-life of the protein in serum by about 200%, most preferably by about 1000%.
  • Recombinant or fusion proteins of the invention may be expressed in a variety of host cells, including E. coli , other bacterial hosts, yeast, and various higher eucaryotic cells such as the COS, CHO and HeLa cells lines and myeloma cell lines.
  • the recombinant protein gene will be operably linked to appropriate expression control sequences for each host.
  • E. coli this includes a promoter such as the T7, trp, or lambda promoters, a ribosome binding site and preferably a transcription termination signal.
  • the control sequences will include a promoter and preferably an enhancer derived from immunoglobulin genes.
  • the plasmids of the invention can be transferred into the chosen host cell by well-known methods such as calcium chloride transformation for E. coli and calcium phosphate treatment or electroporation for mammalian cells. Cells transformed by the plasmids can be selected by resistance to antibiotics conferred by genes contained on the plasmids, such as the amp, gpt, neo and hyg genes.
  • the recombinant fusion proteins can be purified according to standard procedures of the art, including ammonium sulfate precipitation, affinity columns, column chromatography, gel electrophoresis and the like (see, generally, R. Scopes, Protein Purification, Springer-Verlag, N.Y. (1982)). Substantially pure compositions of at least about 90 to 95% homogeneity are preferred, and 98 to 99% or more homogeneity are most preferred for pharmaceutical uses. Once purified, partially or to homogeneity as desired, the polypeptides may then be used therapeutically.
  • the recombinant fusion proteins and pharmaceutical compositions of this invention are particularly useful for parenteral administration such as intraperitoneal administration or intravenous administration.
  • compositions for administration will commonly comprise a solution of the fusion protein dissolved in a pharmaceutically acceptable carrier, preferably an aqueous carrier.
  • a pharmaceutically acceptable carrier preferably an aqueous carrier.
  • aqueous carriers can be used, e. g. , buffered saline and the like. These solutions are sterile and generally free of undesirable matter.
  • These compositions may be sterilized by conventional, well known sterilization techniques.
  • the compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents, toxicity adjusting agents and the like, for example, sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate and the like.
  • concentration of fusion protein in these formulations can vary widely, and will be selected primarily based on fluid volumes, viscosities, body weight and the like in accordance with the particular mode of administration selected and the patient's needs.
  • a typical pharmaceutical composition for intravenous administration would be about 0.5 to 10 mg per patient per day. Dosages from 0.2 up to about 30 mg per patient per day may be used. Actual methods for preparing parenterally administrable compositions will be known or apparent to those skilled in the art and are described in more detail in such publications as Remington 's Pharmaceutical Science, 15th ed. , Mack Publishing Company, Easton, Pennsylvania (1980) .
  • compositions containing the present fusion proteins or a cocktail thereof can be administered for therapeutic treatments.
  • compositions are administered to a patient suffering from a disease, such as AIDS or to those patients positive for HIV.
  • An amount adequate to accomplish this is an amount sufficient to cure or at least partially arrest the disease and its complications.
  • An amount adequate to accomplish this is defined as a "therapeutically effective dose.” Amounts effective for this use will depend upon the severity of the disease and the general state of the patient's health.
  • compositions may be administered depending on the dosage and frequency as required and tolerated by the patient.
  • the composition should provide a sufficient quantity of the proteins of this invention to effectively treat the patient.
  • Recombinant means that the subject product is the result of the manipulation of genes into new or non-native combinations.
  • a “vector” is a sequence of DNA, typically in plasmid or viral form, which is capable of replicating in a host.
  • a vector can be used to transport or manipulate DNA sequences.
  • An “expression vector” includes vectors which are capable of expressing DNA sequences contained therein, producing a protein product. The coding sequences are linked to other sequences capable of effecting their expression, such as promoters and enhancers.
  • the term "without significant cytotoxicity" means that the fusion protein of the present-invention does not affect the function of the untargeted cells to any appreciable degree or to any abnormal level.
  • Plasmid pJB 403H is a modification of pVC403 deposited with the American Type Culture-Collection, Rockville, Maryland which bears ATCC deposit No. 67739,
  • Plasmid pVC403 contains a fusion gene encoding the first 178 amino acids of mature CD4 and amino acids 1-3 and 253-613 of PE. The gene is under control of a T7 late promoter. Plasmid pJB 403H resulted from a modification of pVC403 such that there is a Hind III site at the junction of CD4 and PE40 which has been used for various insertions.
  • the primers were designed using the sequence published by Ellison et al. (Nucl . Acids Res. 10:4071 (1982) incorporated by reference herein) . Exemplary primers used in this study are provided below.
  • JKB-1 5'AGCCTCCACCAAGGGCCCATCGGTCTTCCC3' (SEQ. I.D. NO.1)
  • JKB-2 5'TCATTTACCCGGAGACAGGGAGAGGCTCTTCTG3' (SEQ. I.D. NO.2)
  • JKB-1 and JKB-2 (SEQ. I.D. NO. 2) were used to generate the full length IgG constant region fragments by polymerase chain reaction (PCR) using human IgGl cDNA as template. From this constant region, using the remaining primers the Fc immunoglobulin fragments CH2, CH3, CH1-CH2 and CH2-CH3 were generated that were then positioned between CD4 and PE40 as illustrated in Figure IB.
  • Example 1 provides specific methods used to generate plasmids pJB 403C2, pJB 403C3, pJB 403C12 and pJB 403C23. These plasmids are modified versions of pJB 403H ( Figure 1A) that incorporate the inserts provided in Figure IB.
  • CD4-PE40 The recombinant chimeric toxins produced from each of these plasmids are modified forms of CD4-PE40.
  • the parent toxin CD4-PE40 together with its modified forms are generally referred to herein as "CD4-PE40 and its derivatives". All of the chimeric proteins were expressed in E. coli strain BL21 ( ⁇ DE3) , which carries an inducible T7 RNA polymerase gene on a prophage. (Studier and Moffatt, J. Mol . Biol . 189:113-130 (1986)) . Expressed protein was present in bacterial cell inclusion bodies.
  • the inclusion bodies were dissolved in guanidine hydrochloride, and, after renaturation, the recombinant proteins were purified by successive ion exchange and size exclusion chromatography as described by Batra et al. , Mol . Cell . Biol . 11:2211 (1991), which is hereby incorporated by reference.
  • the generation of plasmids, the location of the expressed protein and the methods used to isolate and purify the recombinant protein are known in the art. Depending on the plasmid, the location of the expressed recombinant protein may vary. Thus these methods are exemplary and should not detract from the scope of this invention.
  • each of the purified toxins was assayed on ENV-15 cells from the Upjohn Company, Kalamazoo, MI, a transfected CHO cell line that expresses gpl60 on its surface, or on CV1 cells, also expressing the HIV envelope glycoprotein.
  • the HIV envelope glycoprotein was introduced into CV1 cells using a recombinant vaccinia virus as described in Example 2.
  • all five chimeric toxins were active and had similar cytotoxic activities (Table 2) .
  • the chimeric toxins had no activity on uninfected cells. The uninfected controls were not killed demonstrating the specificity of CD4-PE40 and its derivatives for HIV envelope glycoprotein 120.
  • CD4-PE40 CD4-CH2-PE40 CD4-CH3-PE40
  • CD4-CH1-CH2-PE40 CD4-CH2-CH3-PE40
  • CD4-PE40 The half-life of CD4-PE40 and its derivatives was determined by intravenously injecting labelled protein into rats.
  • CH3-PE40, and CD4-CH2-CH3-PE40 were expressed, purified and labelled with 125 I.
  • the labelled protein was injected intravenously into rats at a concentration of 20-50 ⁇ g/kg.
  • Serial plasma samples were collected and assayed for TCA precipitable 125 I.
  • Averaged counts were translated into protein concentrations and half-lives were determined using computer program RSTRIP (See Example 3) that employed a biexponential equation as described in Example 3. As shown in Table 3, the mean residence time in the circulation was highest for CD4-CH2- PE40 (115 min) whereas the lowest residence time was obtained from CD4-PE40 (47 min) .
  • CD4-PE40 The a and ⁇ half-lives of CD4-PE40 were 6.3 and 40 min respectively whereas those for CD4-CH2-PE40 were prolonged to 24 and 122 minutes (Table 3)
  • the mean residence time of CD4-CH3-PE40, CD4-CH2-CH3-PE40 and CD4-CH2-CH3-PE40 was found to be 78, 89 and 98 minutes respectively (Table 3) which was longer than CD4-PE40 and shorter than that for CD4-CH2-PE40.
  • the plasma clearance of CD4-CH2-PE40 and CD4-CH2-CH3-PE40 was 1.0 and 1.4 ml/min/kg, respectively, compared to CD4-PE40 at 1.9 ml/min/kg (Table 3) .
  • Plasma pharmacokinetics of 125 I-labeled CD4-PE40 and various derivatives in rats Plasma pharmacokinetics of 125 I-labeled CD4-PE40 and various derivatives in rats.
  • the N-terminal sequence of the 37 kD fragment was found to be Met-x-Glu-Pro-Leu-Gly-Glu-Glu- Glu- Tyr/Leu.
  • the N-terminal sequence of this fragment suggests that the cleavage site is at Arg 274 or Arg 276 in domain II of PE.
  • Figure 4 illustrates the susceptibility of CD4-PE40 and CD4-CH2-PE40 to increasing concentrations of trypsin.
  • Samples of CD4-PE40 and CD4-CH2-PE40 were digested with trypsin at pH 7.4 and pH 5.
  • pH 7 CD4-CH2-PE40 was significantly more resistant to trypsin degradation than CD4-PE40 ( Figure 4A) .
  • Similar size fragments were produced by trypsin digestion with both CD4-PE40 and CD4- CH2-PE40 indicating that the cleavage sites were the same in both molecules. It is known that the Pseudomonas toxin loses its secondary structure at pH 5.
  • the postulated cleavage site is within the cytotoxic domain of the CD4-PE40 toxins, it is likely that at neutral pH CH4-CH2-PE40 is folded such that the protease sensitive sites in the disulfide loop of the molecule are masked by the CH2 domain rendering the molecule resistant to digestion, while at the acidic pH, those sites are exposed and therefore the molecule is sensitive to trypsin.
  • any peptide domain that protects these sites from proteolysis at neutral pH would be useful, and is therefore contemplated within the scope of this invention.
  • cytotoxic domain could be subjected to site-directed mutagenesis, using techniques well known in the art, to replace the protease sensitive sites with other amino acids that would render the CD4-PE40 toxin and its derivatives resistant to proteolysis.
  • the overall size of the chimera could influence its circulatory half-life.
  • larger protein has reduced tissue permeability.
  • the half-life enhanced CD4-PE40 derivative, CD4-CH2-PE40 may be mutagenized and additional sequences may be added to increase size.
  • the reasons for selecting a particular half-life enhancing domain may therefore include, but are not limited to, the size of the polypeptide, the presence of proteolytic protecting domains, the ability to increase toxin potency and the permeability enhancing characteristics of the particular domain.
  • CD4-PE40 and CD4-CH2-PE40 were injected intraperitoneally into mice to assess their toxicity.
  • the LD 50 was determined after 96 hours for each protein at each dose.
  • the D 50 of a single dose of CD4-PE40 was 60 ⁇ g and for CD4-CH2-PE40 it was greater than 80 ⁇ g. When the difference in molecular weight of these two molecules is considered, the results indicate that the insertion of CH2 into CD4-PE40 does not make the molecule more toxic to mice. Results of these studies are provided in Table 5.
  • the values in parentheses are the amount of protein injected in pmoles.
  • the chimeric toxin CD4-PE40 and its derivatives can be further modified to alter one or more of the functional domains of this molecule.
  • the CD4 region, the half- life enhancing region, if one is included, and the cytotoxic domain can all be altered using site-directed mutagenesis or PEglylation or other methods known in the art to improve the function of this chimeric toxin.
  • the CD4 region can be subjected to site-directed mutagenesis to alter or improve the binding properties of this molecule to gpl20.
  • site- directed mutagenesis or substitution can be used to generate an improved cytotoxic domain.
  • the constant region of IgG was obtained from the human IgG x cDNA.
  • a human spleen cDNA library was purchased from Clontech, Palo Alto, CA and cDNA for constant region of IgGl was isolated using the polymerase chain reaction (PCR) .
  • the primers used to amplify human IgGl constant region cDNA were designed using the sequence published by Ellison et al., Nucleic Acids Res . 10:4071-4079 (1982) incorporated by reference herein, and are provided in Table 1.
  • a 30 cycle PCR was performed with denaturation at 94°C for 1 min., annealing at 55°C for 90 sec. and polymerization at 72°C for 2 min. with 10 sec. extension per cycle using a Perkin Elmer/Cetus thermocycler (Perkin-Elmer Cetus Instruments, Norwalk, CT) .
  • Primers JKB-1 (SEQ. I.D. NO. 1) and JKB-2 (SEQ. I.D. NO. 2) were first used to amplify IgGl constant region DNA using the spleen cDNA library as template. This amplified DNA was checked for size on an agarose gel using techniques well known in the art.
  • the amplified fragments were digested with Hindlll and ligated to Hind III digested pJB 403H ( Figure 1) .
  • the resulting ligation product contained segments of the constant region of IgGl located between CD4 and PE40.
  • a schematic of the constructs is provided in Figure IB.
  • pJB 403H was modified to include either the CH2 domain, the CH3 domain, or bot -the CH2 and CH3 domains.
  • Plasmids pJB 403C2, pJB 403C3 and pJB 403C23 were generated by these ligations and encoded CD4-CH2-PE40, CD4-CH3- PE40 and CD4-CH2-CH3-PE40 respectively.
  • pJB 403H was digested with Hindlll and BamHl.
  • the DNA was dephosphorylated and the 4.2 kb DNA fragment was gel purified.
  • the PCR amplified CHI domain was digested with Hindlll and SstI and a 330 bp fragment was gel purified.
  • Plasmid pJB 403C2 DNA was digested with SstI and BamHl and a 330 bp fragment containing the CH2 domain and part of domain II of PE were then gel purified. A three fragment ligation was performed with the 4.2 kb vector and the CHI and CH2 domains.
  • labeled protein was injected intravenously into rats and the amount of radioactivity was assayed in the TCA precipitable fraction over time.
  • the labeled toxin was prepared by incubating 100 mg of protein in PBS, 0.5% Tween 80 with 500 ⁇ Cu ⁇ a 125 I (Amersham, Arlington Heights, IL) in the presence of 10 ⁇ g iodogen (Pierce Chemical, Rockford, IL) , previously dried on the bottom of a plastic tube, for 10 min on ice.
  • 125 I-labeled protein was removed from unreacted iodide by passage over Sephadex G-25M (PD-10 column, Pharmacia, Piscataway, NJ) (Fraker et al., Biochem. Biophys Res . Commun . 80:849. (1978) which is hereby incorporated by reference) .
  • the iodination method used is known to be mild and results in little protein damage.
  • SDS-PAGE autoradiography revealed a single major labeled band corresponding to CD4-PE40.
  • mice Male Sprague-Dawley rats (Charles River, Portage, MI) , weighing approximately 250 g, were fitted with a chronic sampling cannula via the jugular vein. The rats were administered 125 I-labeled protein at a dose of 20-50 ⁇ g/kg. Serial blood samples were collected via cannula and the plasma was prepared for TCA precipitation. Plasma samples (100 ⁇ l) were diluted with 400 ⁇ l PBS and precipitated with an equal volume of cold 25% trichloroacetic acid (TCA) . Following centrifugation, the pellet was radioassayed in a gamma counter. Since 125 I is not physiologically incorporated into protein outside the thyroid, and since the TCA does not precipitate proteins less than 5000 MW, the TCA precipitable radioactivity represented intact drug.
  • TCA cold 25% trichloroacetic acid
  • Plasma CD4-PE40 concentration-vs.-time data was evaluated by an exponential curve fitting program, RSTRIP (Version 5, MicroMath Scientific Software, Salt Lake City, Utah) , which provided an estimate of A, B, a, and b by fitting concentration data (C) at time (t) to equation (1) where A and B are the calculated maximum concentrations (coefficients) for the functions described by the rate constants a and b.
  • concentration data C
  • Tl/2(a) and Tl/2(b) were obtained from equations (2) and (3) .
  • the area under the plasma concentration-time curve (AUC) , the area under the first moment curve (AUMC) , and the mean residence time (MRT) were determined by RSTRIP using equations (4) , (5) , and (6) .
  • the dose (D) was determined by the weight of the administered formulation.
  • AUC A/a+B/b (4)
  • CD4-PE40 and CD4-CH2-PE40 were tested for their resistance to increasing concentrations of trypsin.
  • 40 ⁇ g of CD4-PE40 or CD4-CH2-PE40 were incubated with 40, 200 or 500 ng of trypsin at 25° for 60 minutes in PBS at either pH 7.4 or pH 5.
  • An aliquot of the sample was then subjected to 12.5% reducing SDS-PAGE analysis ( Figure 4A and 4B) .
  • Figure 4A and 4B SDS-PAGE analysis
  • CD4-PE40 was completely degraded at 40 ng trypsin
  • CD4- CH2-PE40 was resistant to trypsin at up to 200 ng.
  • N- terminal amino acid analysis following electrophoresis, proteins were transferred onto PVDF membrane (Millipore) , appropriate bands were cut out and sequenced using techniques well known to those with skill in the art.
  • CD4-PE40 and CD4-CH2-PE40 were mixed and digested with different concentrations of trypsin.
  • Plasmin and thrombin were also used to compare the sensitivity of CD4-PE40 and CD4-CH2-PE40 to proteolytic cleavage. 10 ⁇ g of recombinant toxin was incubated at room temperature at pH 7.4 with different amounts of protease in a volume of 100 ⁇ l. The protein was incubated with thrombin for 1 hr and with plasmin for 3 hrs. At the end of the incubation, proteins were analyzed on 12.5% SDS-polyacrylamide gels and stained with Coomassie blue.
  • CD4-PE40 and CD4-CH2-PE40 were given intraperitoneally to mice to assess their toxicity in vivo.
  • CD4- PE40 or CD4-CH2-PE40 was injected i.p. into five groups of female Balb/c mice in doses ranging from 10-80 ⁇ g. Animals were observed for 72 hrs. for signs of toxicity and death. The LD50 in these experiments was the dose of toxin that killed 50% of the animals over the time indicated. In these studies, animals were observed for 96 hours.
  • Patients positive for HIV will be administered CD4- CH2-PE40 in buffered saline intravenously at a dose of 10 ⁇ g/kg of patient body weight per day for 10 consecutive days. Progress will be measured by detecting to see if the CD4 positive cell population increases and by determining if there is a decrease in the viral antigens in the blood.
  • This invention provides methods for increasing the half-life of single chain recombinant toxins in the circulation.
  • the invention identifies a particularly useful half-life enhancing CD4-PE40 derivative CD4-CH2-PE40.
  • methods are disclosed for further improving the half-life of the toxins using random and site-directed mutagenesis techniques. None of the derivatives tested altered the cytotoxic activity of the toxin as compared with the parent CD4-PE40 toxin. This work is the first example to prove that the CH2 fragment can be used to increase the half-life of a therapeutic recombinant single chain toxin.
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne la production et l'utilisation de toxines recombinées pour obtenir une prolongation de leur demi-vie et donc pour accroître leur puissance pendant une thérapie. Plus particulièrement, cette invention concerne l'utilisation de régions de la portion Fc d'une molécule d'immunoglobuline destinée à conférer une demi-vie prolongée aux toxines chimériques monocaténaires qui comportent un domaine pouvant se lier à un ligand et provenant par exemple d'un récepteur CD4, ainsi qu'un domaine cytotoxique, tel que celui provenant de l'exotoxine A de Pseudomonas.
PCT/US1993/007672 1992-08-14 1993-08-12 Toxine recombinee a demi-vie prolongee WO1994004689A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU50983/93A AU5098393A (en) 1992-08-14 1993-08-12 Recombinant toxin with increased half-life

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US93103392A 1992-08-14 1992-08-14
US07/931,033 1992-08-14

Publications (1)

Publication Number Publication Date
WO1994004689A1 true WO1994004689A1 (fr) 1994-03-03

Family

ID=25460122

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1993/007672 WO1994004689A1 (fr) 1992-08-14 1993-08-12 Toxine recombinee a demi-vie prolongee

Country Status (2)

Country Link
AU (1) AU5098393A (fr)
WO (1) WO1994004689A1 (fr)

Cited By (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996032478A1 (fr) * 1995-04-14 1996-10-17 Genentech, Inc. Polypeptides modifies a demi-vie accrue
WO1997022364A1 (fr) * 1995-12-18 1997-06-26 Yissum Research Development Company Of The Hebrew University Of Jerusalem PROTEINE fc$G(e)-EP POUR LE TRAITEMENT CIBLE DE REACTIONS ALLERGIQUES, PROCEDE POUR LA PREPARER ET COMPOSITIONS PHARMACEUTIQUES LA CONTENANT
WO1997034631A1 (fr) * 1996-03-18 1997-09-25 Board Of Regents, The University Of Texas System Domaines analogues a l'immunoglobuline a demi-vies prolongees
US5739277A (en) * 1995-04-14 1998-04-14 Genentech Inc. Altered polypeptides with increased half-life
US5747035A (en) * 1995-04-14 1998-05-05 Genentech, Inc. Polypeptides with increased half-life for use in treating disorders involving the LFA-1 receptor
WO1998040408A1 (fr) 1997-03-10 1998-09-17 Sunol Molecular Corporation Anticorps permettant d'inhiber la coagulation sanguine et procedes d'utilisation de ces derniers
US5869046A (en) * 1995-04-14 1999-02-09 Genentech, Inc. Altered polypeptides with increased half-life
WO2000009560A2 (fr) * 1998-08-17 2000-02-24 Abgenix, Inc. Production de molecules modifiees avec demi-vie serique prolongee
AU767725C (en) * 1998-10-23 2000-05-15 Amgen, Inc. Modified peptides as therapeutic agents
US6121022A (en) * 1995-04-14 2000-09-19 Genentech, Inc. Altered polypeptides with increased half-life
WO2001002440A1 (fr) * 1999-07-02 2001-01-11 Genentech, Inc. Peptides de fusion comprenant un domaine ligand peptide et un domaine de multimerisation
US6277375B1 (en) 1997-03-03 2001-08-21 Board Of Regents, The University Of Texas System Immunoglobulin-like domains with increased half-lives
WO2004100882A2 (fr) * 2003-05-06 2004-11-25 Syntonix Pharmaceuticals, Inc. Inhibition de medicament se liant a la serumalbumine
GB2424886A (en) * 2005-04-04 2006-10-11 Dxs Ltd Polynucleotide primers against epidermal growth factor receptor and method of detecting gene mutations
WO2008011157A2 (fr) 2006-07-20 2008-01-24 The General Hospital Corporation Procédés, compositions, et trousses permettant une activation sélective de protoxines par un ciblage combinatoire
US7442778B2 (en) 2004-09-24 2008-10-28 Amgen Inc. Modified Fc molecules
US7524937B2 (en) 1996-01-08 2009-04-28 Genentech, Inc. WSX receptor agonist antibodies
EP2322228A1 (fr) 2000-06-05 2011-05-18 Altor BioScience Corporation Protéines de fusion et conjugués de récepteurs de lymphocytes T et procédés d'utilisation de ceux-ci
EP2388266A2 (fr) 2007-05-11 2011-11-23 Altor BioScience Corporation Molécules de fusion et variantes de IL-15
US8932586B2 (en) 2011-09-06 2015-01-13 Intrexon Corporation Modified forms of Pseudomonas exotoxin A
US9114175B2 (en) 2005-08-12 2015-08-25 Amgen Inc. Modified Fc molecules
EP2918607A1 (fr) 2010-09-21 2015-09-16 Altor BioScience Corporation Molécules de fusion multimères solubles à base d'il-15, leurs procédés de préparation et d'utilisation
WO2015160928A2 (fr) 2014-04-15 2015-10-22 University Of Virginia Patent Foundation Récepteurs des lymphocytes t isolés et leurs procédés d'utilisation
WO2016004060A2 (fr) 2014-06-30 2016-01-07 Altor Bioscience Corporation Molécules à base de il-15 et leurs procédés d'utilisation
WO2018183821A1 (fr) 2017-03-31 2018-10-04 Altor Bioscience Corporation Alt-803 combiné à un anticorps anti-cd38 pour thérapies anticancéreuses
WO2019191100A1 (fr) 2018-03-26 2019-10-03 Altor Bioscience Llc Molécules d'association au récepteur du tgf-beta, il-15 et anti-pdl1
WO2020018715A1 (fr) 2018-07-17 2020-01-23 Massachusetts Institute Of Technology Protéines de fusion à base d'échafaudage d'immunoglobuline multimère soluble et leurs utilisations
US10865230B2 (en) 2016-05-27 2020-12-15 Altor Bioscience, Llc Construction and characterization of multimeric IL-15-based molecules with CD3 binding domains
US11053299B2 (en) 2010-09-21 2021-07-06 Immunity Bio, Inc. Superkine
US11129883B2 (en) 2017-03-06 2021-09-28 Altor BioScience, LLC. IL-15-based fusions to IL-12 and IL-18
US11161890B2 (en) 2017-08-28 2021-11-02 Altor Bioscience LLC. IL-15-based fusions to IL-7 and IL-21
US11318201B2 (en) 2016-10-21 2022-05-03 Altor BioScience, LLC. Multimeric IL-15-based molecules
US11820807B2 (en) 2015-06-12 2023-11-21 Ubi Pharma Inc Immunoglobulin fusion proteins and uses thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0314317A1 (fr) * 1987-10-02 1989-05-03 Genentech, Inc. Variantes d'adhésions, acide nucléique les codant ainsi que compositions les contenant
WO1990001035A1 (fr) * 1988-07-23 1990-02-08 The United States Of America, Represented By The Secretary, United States Department Of Commerce Agent cytotoxique pour le traitement d'infections virales specifiques
WO1991018099A1 (fr) * 1990-05-14 1991-11-28 The United States Of America, As Represented By The Secretary, U.S. Department Of Commerce Exotoxine recombinee de pseudomonas cytotoxique, specifique de cibles

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0314317A1 (fr) * 1987-10-02 1989-05-03 Genentech, Inc. Variantes d'adhésions, acide nucléique les codant ainsi que compositions les contenant
WO1990001035A1 (fr) * 1988-07-23 1990-02-08 The United States Of America, Represented By The Secretary, United States Department Of Commerce Agent cytotoxique pour le traitement d'infections virales specifiques
WO1991018099A1 (fr) * 1990-05-14 1991-11-28 The United States Of America, As Represented By The Secretary, U.S. Department Of Commerce Exotoxine recombinee de pseudomonas cytotoxique, specifique de cibles

Cited By (87)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU721155B2 (en) * 1995-04-14 2000-06-22 Genentech Inc. Altered polypeptides with increased half-life
WO1996032478A1 (fr) * 1995-04-14 1996-10-17 Genentech, Inc. Polypeptides modifies a demi-vie accrue
CN100390279C (zh) * 1995-04-14 2008-05-28 基因技术股份有限公司 具有更长半衰期的变异多肽
US5739277A (en) * 1995-04-14 1998-04-14 Genentech Inc. Altered polypeptides with increased half-life
US5747035A (en) * 1995-04-14 1998-05-05 Genentech, Inc. Polypeptides with increased half-life for use in treating disorders involving the LFA-1 receptor
US6998253B1 (en) 1995-04-14 2006-02-14 Genentech, Inc. Altered polypeptides with increased half-life
US5869046A (en) * 1995-04-14 1999-02-09 Genentech, Inc. Altered polypeptides with increased half-life
US6121022A (en) * 1995-04-14 2000-09-19 Genentech, Inc. Altered polypeptides with increased half-life
US6096871A (en) * 1995-04-14 2000-08-01 Genentech, Inc. Polypeptides altered to contain an epitope from the Fc region of an IgG molecule for increased half-life
US7704506B2 (en) 1995-12-18 2010-04-27 Yissum Research Development Company Of The Hebrew University Of Jerusalem Fcε-PE chimeric protein for targeted treatment of allergy responses a method for its production and pharmaceutical compositions containing the same
US6919079B1 (en) 1995-12-18 2005-07-19 Yissum Research Company Of The Hebrew University Of Jerusalem FcεPE chimeric protein for targeted treatment of allergy responses, a method for its production and pharmaceutical compositions containing the same
US7740853B2 (en) 1995-12-18 2010-06-22 Yissum Research Development Company Of The Hebrew University Of Jerusalem Fcepsilon-pe chimeric protein for targeted treatment of allergy responses a method for its production and pharmaceutical compositions containing the same
WO1997022364A1 (fr) * 1995-12-18 1997-06-26 Yissum Research Development Company Of The Hebrew University Of Jerusalem PROTEINE fc$G(e)-EP POUR LE TRAITEMENT CIBLE DE REACTIONS ALLERGIQUES, PROCEDE POUR LA PREPARER ET COMPOSITIONS PHARMACEUTIQUES LA CONTENANT
US7524937B2 (en) 1996-01-08 2009-04-28 Genentech, Inc. WSX receptor agonist antibodies
WO1997034631A1 (fr) * 1996-03-18 1997-09-25 Board Of Regents, The University Of Texas System Domaines analogues a l'immunoglobuline a demi-vies prolongees
US6277375B1 (en) 1997-03-03 2001-08-21 Board Of Regents, The University Of Texas System Immunoglobulin-like domains with increased half-lives
US6821505B2 (en) 1997-03-03 2004-11-23 Board Of Regents, The University Of Texas System Immunoglobin-like domains with increased half lives
WO1998040408A1 (fr) 1997-03-10 1998-09-17 Sunol Molecular Corporation Anticorps permettant d'inhiber la coagulation sanguine et procedes d'utilisation de ces derniers
WO2000009560A3 (fr) * 1998-08-17 2000-05-18 Abgenix Inc Production de molecules modifiees avec demi-vie serique prolongee
WO2000009560A2 (fr) * 1998-08-17 2000-02-24 Abgenix, Inc. Production de molecules modifiees avec demi-vie serique prolongee
AU767725B2 (en) * 1998-10-23 2003-11-20 Amgen, Inc. Modified peptides as therapeutic agents
AU767725C (en) * 1998-10-23 2000-05-15 Amgen, Inc. Modified peptides as therapeutic agents
WO2001002440A1 (fr) * 1999-07-02 2001-01-11 Genentech, Inc. Peptides de fusion comprenant un domaine ligand peptide et un domaine de multimerisation
EP2322228A1 (fr) 2000-06-05 2011-05-18 Altor BioScience Corporation Protéines de fusion et conjugués de récepteurs de lymphocytes T et procédés d'utilisation de ceux-ci
WO2004100882A2 (fr) * 2003-05-06 2004-11-25 Syntonix Pharmaceuticals, Inc. Inhibition de medicament se liant a la serumalbumine
WO2004100882A3 (fr) * 2003-05-06 2007-05-31 Syntonix Pharmaceuticals Inc Inhibition de medicament se liant a la serumalbumine
US7645861B2 (en) 2004-09-24 2010-01-12 Amgen Inc. Modified Fc molecules
US7655765B2 (en) 2004-09-24 2010-02-02 Amgen Inc. Modified Fc molecules
US7662931B2 (en) 2004-09-24 2010-02-16 Amgen Inc. Modified Fc molecules
US7442778B2 (en) 2004-09-24 2008-10-28 Amgen Inc. Modified Fc molecules
US7655764B2 (en) 2004-09-24 2010-02-02 Amgen Inc. Modified Fc molecules
GB2424886A (en) * 2005-04-04 2006-10-11 Dxs Ltd Polynucleotide primers against epidermal growth factor receptor and method of detecting gene mutations
US9029084B2 (en) 2005-04-04 2015-05-12 Qiagen Manchester Limited Polynucleotide primers
US9114175B2 (en) 2005-08-12 2015-08-25 Amgen Inc. Modified Fc molecules
US10188740B2 (en) 2005-08-12 2019-01-29 Amgen Inc. Modified Fc molecules
US11266744B2 (en) 2005-08-12 2022-03-08 Amgen Inc. Modified Fc molecules
WO2008011157A2 (fr) 2006-07-20 2008-01-24 The General Hospital Corporation Procédés, compositions, et trousses permettant une activation sélective de protoxines par un ciblage combinatoire
US11673932B2 (en) 2007-05-11 2023-06-13 Altor BioScience, LLC. Fusion molecules and IL-15 variants
US11498950B1 (en) 2007-05-11 2022-11-15 Altor Bioscience, Llc Fusion molecules and IL-15 variants
US11365231B2 (en) 2007-05-11 2022-06-21 Altor Bioscience, Llc Interleukin 15 (IL-15) variants
EP2769984A1 (fr) 2007-05-11 2014-08-27 Altor BioScience Corporation Molécules de fusion et variantes de IL-15
EP2388266A2 (fr) 2007-05-11 2011-11-23 Altor BioScience Corporation Molécules de fusion et variantes de IL-15
EP3305805A1 (fr) 2007-05-11 2018-04-11 Altor BioScience Corporation Molécules de fusion et variantes de il-15
US9328159B2 (en) 2010-09-21 2016-05-03 Altor Bioscience Corporation Multimeric IL-15 soluble fusion molecules and methods of using same
US10150805B2 (en) 2010-09-21 2018-12-11 Altor Bioscience, Llc Multimeric IL-15 soluble fusion molecules and methods of making and using same
US11845783B2 (en) 2010-09-21 2023-12-19 Altor BioScience, LLC. Multimeric IL-15 soluble fusion molecules and methods of making and using same
EP2918607A1 (fr) 2010-09-21 2015-09-16 Altor BioScience Corporation Molécules de fusion multimères solubles à base d'il-15, leurs procédés de préparation et d'utilisation
EP3327040A1 (fr) 2010-09-21 2018-05-30 Altor BioScience Corporation Molécules de fusion multimères solubles à base d'il-15, leurs procédés de préparation et d'utilisation
US11104716B2 (en) 2010-09-21 2021-08-31 Altor BioScience, LLC. Multimeric IL-15 soluble fusion molecules and methods of making and using same
EP3851459A1 (fr) 2010-09-21 2021-07-21 Altor BioScience Corporation Molécules de fusion multimères solubles à base d'il-15, leurs procédés de préparation et d'utilisation
US9428573B2 (en) 2010-09-21 2016-08-30 Altor Bioscience Corporation Multimeric IL-15 soluble fusion molecules and methods of making and using same
US9255141B2 (en) 2010-09-21 2016-02-09 Hing C. Wong Multimeric IL-15 soluble fusion molecules and methods of treating neoplasia and HIV using same
US10358478B2 (en) 2010-09-21 2019-07-23 Altor Bioscience Corporation Multimeric IL-15 soluble fusion molecules and methods of making and using same
US11053299B2 (en) 2010-09-21 2021-07-06 Immunity Bio, Inc. Superkine
EP4385570A2 (fr) 2010-09-21 2024-06-19 Altor BioScience, LLC Molécules de fusion multimères solubles à l'il-15 et leurs procédés de fabrication et d'utilisation
US11046747B2 (en) 2010-09-21 2021-06-29 Altor Bioscience Llc Multimeric IL-15 soluble fusion molecules and methods of making and using same
US10899821B2 (en) 2010-09-21 2021-01-26 Altor Bioscience Llc Method of treating neoplasia with a multimeric IL-15 soluble fusion molecule
US8932586B2 (en) 2011-09-06 2015-01-13 Intrexon Corporation Modified forms of Pseudomonas exotoxin A
US9677055B2 (en) 2011-09-06 2017-06-13 Interxon Corporation Modified forms of Pseudomonas exotoxin A
US9447387B2 (en) 2011-09-06 2016-09-20 Intrexon Corporation Modified forms of pseudomonas exotoxin A
US9371517B2 (en) 2011-09-06 2016-06-21 Intrexon Corporation Modified forms of Pseudomonas exotoxin A
WO2015160928A2 (fr) 2014-04-15 2015-10-22 University Of Virginia Patent Foundation Récepteurs des lymphocytes t isolés et leurs procédés d'utilisation
US11679144B2 (en) 2014-06-30 2023-06-20 Altor BioScience, LLC. IL-15-based molecules and methods of use thereof
US12097244B2 (en) 2014-06-30 2024-09-24 Altor BioScience, LLC. Methods of treating a neoplasia with IL-15-based molecules and CTLA-4 antibody
US11992516B2 (en) 2014-06-30 2024-05-28 Altor BioScience, LLC. Compositions comprising IL-15-based molecules and immune checkpoint inhibitor antibodies
US11173191B2 (en) 2014-06-30 2021-11-16 Altor BioScience, LLC. IL-15-based molecules and methods of use thereof
EP3912637A1 (fr) 2014-06-30 2021-11-24 Altor BioScience Corporation Molécules basées sur il-15 et leurs procédés d'utilisation
WO2016004060A2 (fr) 2014-06-30 2016-01-07 Altor Bioscience Corporation Molécules à base de il-15 et leurs procédés d'utilisation
US11925676B2 (en) 2014-06-30 2024-03-12 Altor BioScience, LLC. Method for treating neoplasia with an anti-CD38 antibody and an IL-15:IL-15R complex
EP3673915A1 (fr) 2014-06-30 2020-07-01 Altor BioScience Corporation Molécules basées sur il-15 et leurs procédés d'utilisation
US11471511B2 (en) 2014-06-30 2022-10-18 Altor Bioscience, Llc IL-15-based molecules and methods of use thereof
US11890323B2 (en) 2014-06-30 2024-02-06 Altor Bioscience, Llc Method of treating cancer with composition comprising IL-15-based molecules and BCG
US11820807B2 (en) 2015-06-12 2023-11-21 Ubi Pharma Inc Immunoglobulin fusion proteins and uses thereof
US10865230B2 (en) 2016-05-27 2020-12-15 Altor Bioscience, Llc Construction and characterization of multimeric IL-15-based molecules with CD3 binding domains
US11318201B2 (en) 2016-10-21 2022-05-03 Altor BioScience, LLC. Multimeric IL-15-based molecules
US11369679B2 (en) 2016-10-21 2022-06-28 Altor Bioscience, Llc Multimeric IL-15-based molecules
US11975059B2 (en) 2017-03-06 2024-05-07 Altor BioScience, LLC. IL-15-based fusions to IL-12 and IL-18
US11571470B2 (en) 2017-03-06 2023-02-07 Altor Bioscience Llc IL-15-based fusions to IL-12 and IL-18
US11872272B2 (en) 2017-03-06 2024-01-16 Altor Bioscience, Llc IL-15-based fusions to IL-12 and IL-18
US11129883B2 (en) 2017-03-06 2021-09-28 Altor BioScience, LLC. IL-15-based fusions to IL-12 and IL-18
US11612645B2 (en) 2017-03-06 2023-03-28 Altor Bioscience, Llc IL-15-based fusions to IL-12 and IL-18
WO2018183821A1 (fr) 2017-03-31 2018-10-04 Altor Bioscience Corporation Alt-803 combiné à un anticorps anti-cd38 pour thérapies anticancéreuses
US11161890B2 (en) 2017-08-28 2021-11-02 Altor Bioscience LLC. IL-15-based fusions to IL-7 and IL-21
US11965007B2 (en) 2017-08-28 2024-04-23 Altor BioScience, LLC. IL-15-based fusions to IL-7 and IL-21
US11168138B2 (en) 2018-03-26 2021-11-09 Altor Bioscience, Llc Anti-PDL1, IL-15 and TGF-beta receptor combination molecules
WO2019191100A1 (fr) 2018-03-26 2019-10-03 Altor Bioscience Llc Molécules d'association au récepteur du tgf-beta, il-15 et anti-pdl1
WO2020018715A1 (fr) 2018-07-17 2020-01-23 Massachusetts Institute Of Technology Protéines de fusion à base d'échafaudage d'immunoglobuline multimère soluble et leurs utilisations

Also Published As

Publication number Publication date
AU5098393A (en) 1994-03-15

Similar Documents

Publication Publication Date Title
WO1994004689A1 (fr) Toxine recombinee a demi-vie prolongee
CA2187283C (fr) Ligands et molecules chimeriques a permutation circulaire
US5608039A (en) Single chain B3 antibody fusion proteins and their uses
EP0975674B1 (fr) Immunotoxines, comprenant une proteine onc, dirigees contre des cellules malignes
JP3553933B2 (ja) 高められた活性を有する組換シュードモナス外毒素
EP0583794B1 (fr) Exotoxine récombinante de Pseudomonas: construction d'une immunotoxine active avec effets secondaires faibles
Batra et al. Single-chain immunotoxins directed at the human transferrin receptor containing Pseudomonas exotoxin A or diphtheria toxin: anti-TFR (Fv)-PE40 and DT388-anti-TFR (Fv)
AU660616B2 (en) Target-specific, cytotoxic, recombinant pseudomonas exotoxin
US5932448A (en) Bispecific antibody heterodimers
US5889157A (en) Humanized B3 antibody fragments, fusion proteins, and uses thereof
AU656352B2 (en) Recombinant immunotoxin composed of a single chain antibody reacting with the human transferrin receptor and diphtheria toxin
US5747654A (en) Recombinant disulfide-stabilized polypeptide fragments having binding specificity
EP0467536B1 (fr) Méthode de traitement des cellules cancéreuses de la vessie
Debinski et al. An immunotoxin with increased activity and homogeneity produced by reducing the number of lysine residues in recombinant Pseudomonas exotoxin
Siegall et al. Cytotoxicity of IL6-PE40 and derivatives on tumor cells expressing a range of interleukin 6 receptor levels.
AU7172391A (en) An improved toxin for construction of immunotoxins
Batra et al. Insertion of constant region domains of human IgG, into CD4-PE40 increases its plasma half-life
JPH07278200A (ja) ＰＥ４０Ａｂを含有するタンパク質抗ガン剤
NZ238583A (en) Targetted cytotoxic anticancer conjugates and

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA JP

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: CA