AU7172391A

AU7172391A - An improved toxin for construction of immunotoxins

Info

Publication number: AU7172391A
Application number: AU71723/91A
Authority: AU
Inventors: David Fitzgerald; Ira H. Pastan
Original assignee: US Government
Current assignee: US Department of Commerce
Priority date: 1989-12-21
Filing date: 1990-12-21
Publication date: 1991-07-24
Anticipated expiration: 2010-12-21
Also published as: EP0506854A1; AU636453B2; CA2071946A1; JPH04506976A; EP0506854A4; WO1991009965A1

Description

AN IMPROVED TOXIN FOR CONSTRUCTION OF IMMUNOTOXINS

The parent application (06/911,227) teaches the production of reco binant proteins from modified Pseudomo- nas exotoxin (PE) gene fused with DNA sequences encoding a recognition protein for which a specific receptor exists on the cells. This was exemplified in the parent applica¬ tion with the construction and expression of an IL-2-PE fusion gene. The present application relates to the production of improved toxins which are useful in con¬ structing more effective immunotoxins. Particularly, the invention provides an altered PE molecule, designated herein as Lys-PE40, that can be easily conjugated to an antibody with effective cytotoxicity toward target cells.

BRIEF DESCRIPTION OF THE DRAWINGS Various objects, features and many of the atten¬ dant advantages of the invention will be better understood upon a reading of the following detailed description when considered in connection with the accompanying drawings wherein:

Figure 1 schematically illustrates the structure of plasmid pVC85L showing the presence of a T7 promoter, and OmpA signal sequence and domains II (translocation domain) and III (ADP ribosylation domain) of Pseudomonas exotoxi .

Figure 2A shows the results of SDS-PAGE analysis of LysPE40 pools at various stages of purification. 12.5% gels were stained with Coomassie blue. Lane 1, QMA concentrated culture medium proteins; Lane 2, Q Sepharose pool; Lane 3, Flow through material from Mono S; Lane 4, Mono S pool; Lane 5, TSK 250 pool. The positions of molecular weight standards are indicated. B: SDS-PAGE analysis of anti-TFR-LysPE40. Samples were applied on a 10% reducing polyacrylamide gel. Lane 1, αTFR-LysPE40; Lane 2, LysPE40; Lane 3, anti-TFR. Gels were stained with Coomassie blue.

Figure 3A demonstrates the inhibition of protein synthesis in A431 cells by anti-TFR-LysPE40. Immunotoxin was added to the cells in the absence (*) and presence (o) of excess anti-TFR (tp μg/ml) for 18-24 hrs at 37°C. B: Cytotoxic activity of anti-Tac-LysPE40 on HUT102 cells. Anti-Tac-LysPE40 was added at various concentrations to the indicated cell lines. For competition experiment 70 μg/ml anti-Tac was added before the addition of the immunotoxin. ³H leucine incorporation was measured as described in the text.

Figure 4 shows the blood levels of anti-TFR- LysPE40. BALB/C mice or nude mice with A431 tumors were injected I.P. with 100 μg or 50 μg of anti-TFR-LysPE40. Immunotoxin levels were measured in serum at different time periods. Results are average of two different experiments.

Figure 5 shows the effect of anti-TFR-LysPE40 on the growth of A 31 tumors in nude mice. Mice were inject¬ ed with 3 x 10⁶ A431 cells and treated with the immunotoxin as indicated. Mice were given four doses of 50 μg each on the indicated days: (#) days 2, 4, 6, 8; (A) days 9, 11, 13 and 15; (■) no treatment. B. Mice given four doses on days 5, 7, 9 and 11; (■) no treatment; (D) 5μg; (#); 20 μg; (A), 50 μg; (A), single dose of 150 μg on day 5.

Figure 6 shows the gross appearance of subcutane¬ ous A431 tumors in nude mice with and without treatment with HB21-PE40.

Nude mice were injected subcutaneously with 3 x 10⁶ A431 cells on day 0. Without further treatment, the tumors were apparent as small bumps under the skin on day 5 (A; arrows). By day 15, tumors were large, often erupting through the skin surface (B) . Mice treated with HB21-PE40 on days 2, 4, 6 and 8 usually showed no develop¬ ment of tumor, demonstrated here as the absence of gross tumor on day 26 (C) . When mice with large tumors were treated with HB21-PE40 (on days 9, 11, 13 and 15), the tumors often began to shrink, collapsing inward on their necrotic centers (D; arrows).

Figure 7 shows the histological appearance of typical treated and control A431 subcutaneous tumors. A431 tumors were removed at necropsy, fixed on formaldehyde and processed for routine paraffin embedding and sectioning, and staining with hematoxylin and eosin. A section from a tumor removed from a mouse at day 15 is shown in A-4. A similar section of a tumor removed from a mouse on day 19 that had been treated on days 9, 11, 13 and 15 with anti-TFR-LysPE40 is shown in B-B. The cross- section shown in A shows that the majority of the untreat¬ ed tumor contains viable tumor cells (VT) with only small areas of necrosis (arrow). In contrast, the tumor from a treated mouse (B) shows that a large percentage of the tumor is necrotic (NT), with only a small rim of viable tumor (VT) remaining (s=skin). (A', A") and (B'B") are higher magnification fields from the margins of tumors demonstrating that the untreated tumor is mostly composed of homogeneous viable tumors (VT), whereas the treated tumor shows a rim of viable cells of variable thickness lying adjacent to a connective tissue capsule (ct). The majority of the treated tumor shows large areas of central necrosis, and in some areas of the tumor margin all tumor cells are necrotic, whereas in other areas a viable tumor rim only a few cells thick remains (B", double arrow). (Mags: A,B = 5, bar = 1 mm; A', B' = x26, bar = 200 μm; A", B" = x260; bar = μm) . DETAILED DESCRIPTION OF THE INVENTION

The above and various other objects and advantages of the present invention are achieved by an improved Pseudomonas exotoxin (PE) of the type including a deletion in the receptor binding domain la of the native toxin, wherein the improvement comprises a recombinant PE mole¬ cule possessing at least one lysine residue in domain la of the PE molecule, which otherwise will be devoid of a lysine residue when having a deletion in the receptor binding domain la, said lysine residue providing an essential linkage for effective coupling of the recombi¬ nant PE to other molecules, such as antibodies and the like. When PE is chemically attached to antibodies or other targeting molecules, lysine residues are required for coupling PE to other molecules. Since all 12 lysine residues of domain I are lost when domain I is deleted from PE, one of the three lysine residues in the other part of the molecule (for instance, domain III), must be used to couple PE40 to an antibody or another targeting molecule. However, when one of these three lysine resi¬ dues are used, a conjugate with low activity is obtained (Kondo et al, J. Biol. Chem. 263:9470, 1988). In order to overcome this problem and to obtain a conjugate with high activity, a new PE molecule was created by deleting most of domain I (residues 6-252) but maintaining one of the 12 lysine residues originally present in domain I. This new molecule, in accordance with the present invention, is designated herein as LysPE40.

In order to demonstrate the effect of the new molecule on immunotoxin constructs, two novel immunotoxins were made, first with LysPE40 conjugated to antiTac antibody and second conjugated to an antibody specific for the human transferrin receptor (anti-TFR).

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned hereunder are incorporated herein by reference. Unless mentioned otherwise, the techniques employed herein are standard methodologies well known to one of ordinary skill in the art. The materials, methods and examples are only illus¬ trative and not limiting. The term "antibody" as used herein means a portion of an immunoglobulin molecule (see W.E. Paul, ed. , "Funda¬ mental Immunology," Raven Press, N.Y. , 1984, pp. 131-165) capable of binding to an antigen. According to this definition, the term "antibody" includes various forms of modified or altered antibodies, such as an intact immuno- globulin, an Fv fragment containing only the light and heavy chain variable regions, an Fab or (Fab) '₂ fragment containing the variable regions and parts of the constant regions, a single-chain antibody (Bird et al., 1988, Science 242, 424-426; Huston et al., 1988, Proc. Natl. Acad. Sci. USA 85, 5879-5883), and the like. The antibody may be of animal (especially mouse or rat) or human origin or may be chimeric (Morrison et al. , 1984, Proc. Nat. Acad. Sci. USA 81, 6851-6855) or humanized (Jones et al., 1986, Nature 321, 522-525, and published UK patent appli¬ cation #8707252). Methods of producing antibodies suit¬ able for use in the present invention are well known to those skilled in the art and can be found described in such publications as Harlow & Lane, Antibodies: A Labora¬ tory Manual, Cold Spring Harbor Laboratory, 1988. The genes encoding the antibody chains may be cloned in cDNA or in genomic form by any cloning procedure known to those skilled in the art. See for example Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, 1982.

The term "without significant cytotoxicity" as used herein means that the fusion protein of the present invention does not affect the normal functions of the untargeted cells to any appreciable degree or to any abnormal level.

The recombinant antibody-LysPE40 fusion protein may contain one polypeptide chain or two chains. The example disclosed herein relates to the one chain case. To produce two chains, no a ino acid linker would be inserted between the V_H and V_L sequences. Instead a termination codon would be inserted after the V_H sequence, and an initiation codon and ribosome binding sequence would be inserted before the V_L sequence. In another embodiment of the invention, the V_L and V_H sequences will be followed respectively by part or all of the light and heavy chain constant regions, e.g., the whole kappa light chain constant region and the C_H1 domain of the heavy chain constant region, with or without the heavy chain hinge domain. The V_L, V_H and PE40 genes may occur in any order on the plasmid, hence the PE40 gene may be attached to either the 5' or 3' end of either the light or heavy chain gene. Those skilled in the art will realize that additional modifications, deletions, insertions and the like may be made to the antibody and LysPE40 genes. Especially, deletions or changes may be made in LysPE40 or in the linker connecting the antibody gene to LysPE40, in order to increase cytotoxicity of the fusion protein toward target cells or to decrease cytotoxicity toward cells without antigen for the antibody. All such con¬ structions may be made by methods of genetic engineering well known to those skilled in the art (see, generally, Maniatis et al., supra) and may produce proteins that have differing properties of affinity, specificity, stability and toxicity that make them particularly suitable for various clinical or biological applications. MATERIALS AND METHODS

The following example is offered by way of illus¬ tration, not limitation.

Construction of a vector that encodes LvsPE40 and secretes it into the medium. Plasmid pVC4 (derived from pJH4 by treating pJH4 with Sphl and Tthllll and relegating the large fragment containing the PE gene) was joined to an OmpA signal sequence as described by Chaudhary et al., PNAS 85, 2929- 2943, 1988, to produce pVC45. Site directed mutagenesis is a convenient way to make deletions and it was used to create plasmid pJY85L which produces LysPE40 as shown in Figure 1. A Hindlll/Sall fragment of the PE gene in pVC45 was cloned into M13, mpl9 and uracil containing single stranded DNA prepared by the method of Kunkel (kunkel, T.A. , PNAS 82, 488-492, 1985). An oligonucleotide 36 nucleotides in length with the structure 5'CCAGGCTGCCGC- CCTTGAAAGCTTGGCGTAATCATG3' was synthesized which generated a large deletion in PE of amino acids 6 through 252 and retained a lysine residue between amino acids 5 and 253 to give a molecule with the sequence:

1 2 3 4 5 x 253 254 255 256 Ala-Glu-Glu-Ala-Phe-Lys-Gly-Gly-Ser-Leu A 176 bp Hindlll/Sall fragment was excised from the replicative form of the mutant DNA in Ml3 and ligated with a 3.3 kb Hindlll/Sall fragment of pVC45 to give pJY85L which encodes a protein with the following struc¬ ture: Met-Lys-Lys-Thr-Ala-Ile-Ala-Ile-Ala-Val-Ala-Leu-Ala-Gly- Phe

1 Ala-Thr-Val-Ala-Gln-Ala-Ala-Asn-Leu-Glu-Glu-Ala-Phe-Lys Gly-Gly-Ser .... This protein is processed at the ( 1 ) and the processed product secreted into the medium. When the plasmid was expressed in F_±. coli BL21 (λDE3) cells, LysPE40 was found in and purified from the medium with a yield of greater than 1 mg per liter. The sequence of amino acids at its amino terminus was found to be that predicted from the DNA sequence:

1 2 3 4 5 253 254 255 H₂N Ala-Asn-Leu-Ala-Glu-Glu-Ala-Phe-Lys-Gly-Gly-Ser (the numbers indicate the location of the amino acids in the native PE structure).

A deposit of plasmid pJY85L has been made at the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, Maryland 20852, U.S.A., on December 18, 1989 under the accession number 68189. The deposit shall be viably maintained, replacing it if it becomes non- viable, for the life of the patent, for a period of 30 years from the date of the deposit, or for 5 years from the last date of request for a sample of the deposit, whichever is longer, and made available to the public upon issuance of a patent from this application, without re¬ striction, in accordance with the provisions of the law. The Commissioner of Patents and Trademarks, upon request, shall have access to the deposit. Expression of LvsPE40

BL21 ( DE3) cells were transformed with plasmid pVC85L and grown in LB medium containing 100 μg/ml ampi- cillin at 37°C. At absorbance 0.6 (650 nm) , isopropyl-1- thio-β-D-galactopyranoside was added to a final concentra¬ tion of 1 mM. Cells were harvested 90 min later. The culture medium was used as the source of LysPE40 because most of the protein was secreted into the medium. Purification of LvsPE40 Clarified culture medium, 25 liters, containing

LysPE40 was diluted four-fold with chilled deionized water and applied on a 10 x 5.5 cm silica-based anion exchange column (QMA, Waters) at a flow rate of 100 ml/min. The column was washed with 0.05 M sodium phosphate buffer, pH7.0, and proteins were eluted with two liters of 0.25 M NaCl in the equilibration buffer. LysPE40 from the QMA column was concentrated further by using Amicon YM30 membranes to 150 ml, dialyzed for 12-16 hours against 0.02 M Tris-HCl, pH7.6, centrifuged at 10,000 x g for 20 minutes and applied on a 2.5 x 14 cm Q-Sepharose column equilibrated with 0.02 M Tris-HCl, pH 7.6. Proteins were eluted with a 500 ml linear gradient of 0-0.5 M NaCl; LysPE40-containing fractions were detected by SDS PAGE, pooled, diluted 10-fold with 0.02 M Mes, pH 5.5, and loaded onto an FPLC Mono S 16/10 column equilibrated with 0.02 M Mes, pH 5.5. LysPE40 bound to the column and was eluted by a 100 ml linear gradient of 0-0.5 M NaCl. It was further purified on TSK250 (22.5 x 600 mM) column (BioRad) using 0.2 M sodium phosphate buffer pH 7.0 containing 1 mM EDTA.

Construction of immunoconiuσates

LysPE40 (2.5 mg/ml) in 0.2 M sodium phosphate buffer pH 7.0 containing 1 mM EDTA was mixed with a 3-fold molar excess of SMCC and incubated at room temperature (about 22°-24°C) for 30 minutes. Protein was separated from the unreacted cross linker on a PD10 column. MoAb (HB21 or αTac) (5-10 mg/ml) was mixed with a 3-fold molar excess of 2-iminothiolane-HCl in 0.2 M sodium phosphate buffer pH 8.0 containing 1 mM EDTA and incubated at 37°C for 1 hr. The derivatized antibody was separated from the reactants on a PD10 column. To make immunotoxins, derivatized LysPE40 and derivatized antibody were mixed in 4:1 molar ratio and incubated at room temperature for 16- 20 hrs. Immunotoxin was then purified by successive chromatography on a mono Q and TSK 250 columns.

In order to determine the efficacy, two different immunotoxins were prepared and used. One is anti-TFR- LysPE40, which binds to human transferrin receptor (TFR), and the other is anti-Tac-LysPE40, which binds to 55 kD a subunit of human IL2 receptor. SDS-PAGE and immunoblottinσ

SDS-PAGE described by (Reference) . Protein synthesis inhibition assay

Activities of the conjugates were tested on A431, KB, HUT102, HT29, OVCAR2, 0VCAR3, OVCAR4, CEM and M0LT4 cells by measuring ³H-leucine incorporation (Kondo et al., J. Biol. Chem. 263, 9470, 1988). HUT102 cells were washed two times with RPM1640 and used immediately. Immunotoxins were diluted with 0.2% human serum albumin in PBS prior to addition to cells. Assay of blood levels of anti-TFR-LysPE40 in Mice

BALB/C mice or nude mice bearing A431 subcutaneous tumors were injected with 100 μg or 50 μg of immunotoxin I.P. Blood was drawn at different time points and the level of the IT was assayed by incubating serum with A431 cells and measuring its effect on protein synthesis. A standard curve was made using anti-TFR-LysPE40. Antitumor activity of anti-TFR-LysPE40 in nude mice bearing a human epidermoid carcinoma

A431 cells ( c x 10⁶) were injected subcutaneously on day 0 into nude mice: this injection produced detect¬ able tumors in all mice by day five. Treatment of mice was started either 2 days, 5 days or 9 days after tumor implantation. Each treatment group consisted of 4-6 animals. Tumors were measured using a caliper every fourth day and the volume of the tumor was calculated using the formula: tumor volume in mm³ = length x (width)² x 0.4. Tests with anti-Tac-LysPE40 were performed simi¬ larly.

As mentioned before, the amino end of PE40 was altered so that it contained a lysine residue and an OmpA signal sequence. (The OmpA signal sequence was added primarily to direct the export of LysPE40 to the growth medium. ) The structure of LysPE40 and the plasmid encod¬ ing LysPE40 which is under the control of a T7 promoter is shown in Figure 1. Similar to PE40, LysPE40 was also secreted in the culture medium in large amounts. The purity of the protein at each purification step is shown in Figure 2. Material from the TSK 250 column, which was used as the final step, was found to be homogeneous when analyzed by SDS PAGE (Fig. 2, lane 5) as well as by immunoblotting with an antibody to PE (data not shown) . Typically, 2 mg of pure LysPE40 was obtained from one liter of culture.

The N-terminal sequence of the purified protein (LysPE40) was found to be Ala-Asn-Leu-Ala-Glu-Ala-Phe-Lys- Gly-Gly-Ser-Leu. The purified protein had the exact sequence expected from the DNA sequence and processing occurred within the OmpA sequence (Figure 1). In con¬ trast, the N-terminal sequence of PE40 is Ala-Asn-Leu-Ala- Glu-Glu-Gly-Gly.

Construction of immunotoxins with LysPE40

LysPE40 was chemically coupled to two different monoclonal antibodies, HB21 which binds to the human transferrin receptor (anti-TFR) (Haynes et al, J. Immunol 127:347, 1981) and anti-Tac which binds to the 55 kDa subunit of human interleukin 2 receptor (Uchiyama et al, . Immuno. , 126:1393, 1981). After the conjugation, the immunotoxins (ITs) were purified on MonoQ and TSK 250 columns. Purified conjugates contain LysPE40 coupled to both the light and heavy chain and do not contain any free LysPE40 (Figure 3). For comparison, immunotoxins were also made with native PE. Activity of immunotoxins made with LysPE40

The activity of anti-TFR-LysPE40 was assayed on a variety of human cell lines and it inhibited protein synthesis in all the human cell lines studied (Table I). Anti-TFR-LysPE40 was most active on A431 cells with an ID₅₀ of 4.0 ng/ml. Specificity was demonstrated by showing that excess unconjugated antibody prevented the cytotoxic effect of anti-TFR-LysPE40 (Fig. 3A) . Ariti-TFR-LysPE40 was not cytotoxic to murine Swiss 3T3 cells even at 2 μg/ml (data not shown) .

The cytotoxic activity of anti-Tac-LysPE40 was determined on HUT102 cells, a human T cell leukemia line containing IL2 receptors. As shown in Figure 5, anti-Tac- LysPE40 inhibited protein synthesis in HUT102 cells with an ID₅₀ of 2.5 ng/ml and excess anti-Tac blocked this effect demonstrating the specificity of the immunotoxin (Fig. 3B). Anti-Tac-LysPE40 did not inhibit protein synthesis on IL2 receptor negative cells, even at 2000 ng/ml, further showing the specificity of the IT. Blood levels of anti-TFR-LysPE40 in mice

Balb/C mice were injected I.P. with a single dose of 100 μg of anti-TRF-LysPE40 and blood was drawn at different times after the injection to assay for immuno¬ toxin activity. As shown in Fig. 4, a peak blood level of 78 μg/ml was obtained 4 hrs after the injection and a level of 10 μg/ml was still present 24 hrs after the injection. A similar experiment was performed in arthymic mice bearing A431 tumors. After injecting 50 μg of anti- TFR-LysPE40, a blood level of 27 μg/ml was detected 4 hrs after injection and 8 μg/ml after 24 hrs (Fig. 4). Effect of anti-TFR-LvsPE40 on A431 tumors in mice

Anti-TFR-LysPE40 was assayed for its ability to inhibit the growth of A431 cells as subcutaneous xeno- grafts in nude mice. To produce tumors, 3 x 10⁶ A431 cells were injected subcutaneously on day 0. In the control group treated only with diluent, the tumors grew very rapidly and the animals were sacrificed on day 19 with very large tumors that were penetrating the skin (Fig. 5, 6). In a group that received anti-TFR-LysPE40 on days 2, 4, 6, 8, no tumors were evident on day 24 when the experiment was terminated (Fig. 5A and 6) . In another group of animals, treatment was delayed until the tumors were about 125 mm3 in volume and given on days 9, 11, 13 and 15. As soon as the treatment was initiated, the tumors stopped increasing in size (Figure 5A and 6) and then developed soft centers. Histological examination showed that almost all of the cells in the center of the tumor were nonviable (Figure 7). However, at the rim of the tumor many viable cells were observed.

To determine if the antitumor effect was dose related, treatment with various amounts of anti-TFR- LysPE40 was begun on day 5 when small tumors were evident (Figure 5B) . Even the 5 μg dose produced a delay in tumor growth but after the treatment was stopped on day 11, the tumors began to grow rapidly. As the dose was increased, (20 or 50 μg), some or all of the tumors became undetect- able by day 11, but with time began to reappear and grow. One group of animals received a single dose on day 5 of 150 μg, which is close to the ID₅₀. Two animals died, ^"but in the other three animals the tumor regressed and did not reappear. When antibody alone or an immunotoxin composed of an antibody that did not react with the tumor (MOPC- LysPE40) was administered at 50 μg doses, no antitumor response was observed.

In summary, the results indicate that LysPE40 can be efficiently coupled to antibodies yielding an immuno¬ toxin with high cytotoxic activity against cultured cell lines bearing the appropriate antigen, and no detectable cytotoxicity against cultured cells to which the antibody does not bind. Furthermore, an immunotoxin composed of an antibody to the human transferrin coupled to LysPE40 (anti-TFR-LysPE40) could be administered safely in large amounts to mice and caused regression of a rapidly growing human epidermoid carcinoma implanted subcutaneously.

When administered intraperitoneally in mice, anti- TFR-LysPE40 appeared rapidly in the blood. A dose of 50 μg gave a peak blood level 4 hrs post injection of about 30 μg/ml, and blood levels were still 8 μg/ml at 24 hrs (Fig. 3) indicating that this immunotoxin has a relatively long half-life. A single dose of 100 μg gave a peak blood level of 80 μg/ml. Since a 10 g mouse has a blood volume of about 1 ml, almost all the immunotoxin is found in the blood four hours after intraperitoneal administration.

In the treatment protocols described herein, the

.tumor cells were allowed to grow to form a detectable solid tumor before treatment was initiated. Under these conditions, a treatment consisting of four injections given over eight days caused obvious tumor regression

(Figs. 5-8). At the lower dose levels with small tumors, or even at the high dose level with large tumors, viable tumor cells remained. By continuing the treatment for longer periods, a larger antitumor effect could most likely be achieved. Nevertheless, the protocol caused marked regression of a solid tumor resistant to standard chemotherapy, thereby indicating that LysPE40 when at- tached to target-specific antibodies acts as a potent immunotoxin.

A therapeutic composition in accordance with the present invention comprises an effective amount of the LysPE40-coupled to a target-specific ligand to kill target cells, and a pharmaceutically acceptable carrier, the target cells being those that are desired to be selective¬ ly killed and carry a binding site to which said ligand specifically binds.

Of course, ligands other than antibodies, such as receptors, growth factors and molecules which selectively recognize target cells are coupled to the LysPE40 follow¬ ing the methodology similar to that described herein to obtain target-specific cytotoxic entities.

It is understood that the embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggest¬ ed to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims.

TABLE I ACTIVITY OF ANTI-TFR-LYSPE40 ON VARIOUS HUMAN CELL LINES CELLS IDsnafnσ/ml) anti-TFR-LvsPE40 LvsPE40

A431 4.0 >2000

KB 14.0 >2000

HT29 6.6 >2000 HUT102 21.0 >2000

CEM 22.5 >2000

OVCAR2 135.0 ND

OVCAR3 280.0 ND

OVCAR4 30.0 ND MOLT4 32.0 ND ^aID₅₀ is described as concentration of the immunotoxin needed for 50% inhibition of protein synthesis. N.D. - not done.

TABLE II INCIDENCE OF TUMOR IN NUDE MICE TREATED WITH

ANTI-TFR-LYSPE40

Athymic mice were injected subcutaneously with 3 x

10⁶ A431 cells. On days 5, 7, 9 and 11, the animals were injected I.P. with anti-TFR-LysPE40 at the indicated dose. Number of animals with tumors/total animals is shown on different days after tumor transplantation.

^*Single dose on day 5

Claims

WHAT IS CLAIMED IS:

1. An improved Pseudomonas exotoxin (PE) of the type including a deletion in the receptor binding domain la of the native toxin, wherein the improvement comprises a recombinant PE molecule possessing at least one lysine residue in domain la of the PE molecule which otherwise will be devoid of a lysine residue when having a deletion in the receptor binding domain la, said lysine residue providing an essential linkage for effective coupling of the recombinant PE to other molecules.

2. A cytotoxic molecule comprising the recombi¬ nant PE of claim 1 coupled to a target-specific ligand.

3. The cytotoxic molecule of claim 2 wherein said ligand is an antibody or a growth factor.

4. A composition comprising an effective amount of the cytotoxic molecule of claim 2 to kill target cells and a pharmaceutically acceptable carrier.

5. A method for achieving targeted cytotoxicity, comprising contacting cells targeted to be killed with cytotoxic amount of the composition of claim 3, said target cells being those having binding sites to which the target-specific ligand binds, but the composition being without detectable cytotoxity to cells which lack said binding sites.