WO1993024515A1 - Recepteur de neuropeptide y et de peptide yy humains du type y1 et oligonucleotides antisens complementaires de ce recepteur ayant pour effet d'inhiber la vasoconstriction - Google Patents

Recepteur de neuropeptide y et de peptide yy humains du type y1 et oligonucleotides antisens complementaires de ce recepteur ayant pour effet d'inhiber la vasoconstriction Download PDF

Info

Publication number
WO1993024515A1
WO1993024515A1 PCT/US1993/005039 US9305039W WO9324515A1 WO 1993024515 A1 WO1993024515 A1 WO 1993024515A1 US 9305039 W US9305039 W US 9305039W WO 9324515 A1 WO9324515 A1 WO 9324515A1
Authority
WO
WIPO (PCT)
Prior art keywords
leu
phe
asn
val
ser
Prior art date
Application number
PCT/US1993/005039
Other languages
English (en)
Inventor
Claes Wahlestedt
Original Assignee
Cornell Research Foundation, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cornell Research Foundation, Inc. filed Critical Cornell Research Foundation, Inc.
Publication of WO1993024515A1 publication Critical patent/WO1993024515A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/72—Receptors; Cell surface antigens; Cell surface determinants for hormones
    • C07K14/723—G protein coupled receptor, e.g. TSHR-thyrotropin-receptor, LH/hCG receptor, FSH receptor

Definitions

  • Neuropeptide Y (NPY) and peptide YY (PYY) are structurally related peptides that primarily function as neurotransmitter and gastrointestinal hormone, respectively.
  • Previous functional and binding data have indicated the existence of at least three distinct receptor types, Y1, Y2, and Y3, for NPY and/or PYY in mammals.
  • Y1, Y2, and Y3 for NPY and/or PYY in mammals.
  • Y1 cDNA clone I.Y1-5, isolated from a fetal brain library.
  • the human Y-1 receptor consists of 384 amino acids and has seven putative transmembrane (TM) domains like other members of the G-protein- coupled superfamily of receptors.
  • the Y-1 receptor In the region spanning the TM domains, the Y-1 receptor displays 29% sequence identity to human tachykinin receptors, but it only shows 21 % and 23% homology with proposed bovine (LCR1) and Drosophila (PR4) NPY-receptor clones, respectively.
  • Northern blot analysis of a human neuroblastoma cell line, SK-N-MC, previously used by many investigators as a model system for studies on the Y-1 receptor revealed a single 3.5 kb mRNA species.
  • Reverse transcriptase analysis indicated expression also in human cultured vascular smooth muscle cells, supporting the view that the Y1 -receptor is associated with NPY/PYY-evoked vasoconstriction.
  • hY1 -5 When expressed in COS1 cells, hY1 -5 conferred specific 1 2 5
  • Neuropeptide Y is a tyrosine-rich 36-amino acid peptide with a carboxyterminal amide which displays a remarkable degree of structural conservation in evolution. It is one of the most abundant and widely distributed neuropeptides within the central nervous system and belongs to a peptide family that also includes peptide YY (PYY) and pancreatic polypeptide (PP). Mammalian NPY and PYY show 70% sequence identity while PP is 50% homologous to NPY and PYY. NPY is widely distributed in the brain, notably in "limbic" regions, and the peripheral nervous system, and is often co-localized with norepinephrine, e.g.
  • NPY/PYY In the brain many effects, including stimulation of appetite, anixiolysis/sedation and modulation of pituitary hormone release, have been attributed to NPY/PYY.
  • NPY In the brain many peripheral actions of NPY, it has been suggested to be involved in a large number of neuroendocrine functions, stress responses, circadian rhythms, central autonomic functions, eating and drinking behavior, and sexual and motor behavior; most attention has been given to its vasoconstrictor effects.
  • NPY is related to various neurological and psychiatric illnesses such as Huntington's Chorea, Alzheimer's disease, and major depressive illness.
  • functional studies and receptor characterizations have been difficult to perform.
  • NPY/PYY receptors are heterogeneous [see Ann. NY Acad. Sci. 611 :7 (1990); Regul. Pept.12:317 (1986); and Life Sci. 50: PL7 (1992)] and the nomenclature "Y1-, Y2- and Y3-receptor type "was introduced to encompass this heterologous nature.
  • the Y1 -receptor binds NPY and PYY with similar affinity, as well as the synthetic analog [Pro 34 ]NPY and analogs thereof, but C-terminal fragments of NPY and PYY have been shown to bind poorly.
  • the present invention pursued the isolation of receptor DNA clones using several strategies. These strategies led to the cloning of a putative human Y1 -receptor cDNA clone.
  • This clone, hY1-5 appears to be a human homolog of a previously published rat "orphan" receptor, FC5 [see FEBS Lett. 271 :81 (1990)].
  • the latter rat clone had appeared relevant to the present invention because its expression pattern, as studied by in situ hybridization, was reminiscent of that of the Y1 -receptor protein, as shown by receptor autoradiography. Thus, a polymerase chain reaction (PCR) product was generated corresponding to the rat "orphan” receptor.
  • PCR polymerase chain reaction
  • one aspect of the present disclosure is to present functional evidence identifying one such clone as a human NPY/PYY receptor of the Y1-type.
  • another aspect of the present invention is to describe an 18- base antisense oligodeoxynucleotide sequence that corresponds to a coding region near the human Y1 -receptor amino-terminus.
  • Still a further aspect of the present disclosure is to describe the inhibitory effect of treatment with neuropeptide Y-Y1 receptor antisense oligodeoxynucleotide on the contractile response to NPY of human arteries and veins.
  • Example VI depicts only a single antisense sequence, hY1-AS, this sequence is to be considered as merely a specific example of a class of antisense sequences which have similar capabilities of affecting the NPY-evoked contractile response of blood vessels as described herein).
  • Figure 1 is a side-by-side comparison of Northern and Southern hybridizations
  • Figure 2 depicts ligand competition for 1 25 I-PYY binding in hY1 - 5 (Y1 -receptor) transfected COS1 cell membranes;
  • Figure 3 depicts the contractile effect of NPY on human subcutaneous arteries; and Figure 4 depicts the contractiel effect of NPY on human veins.
  • Figure 1 depicts the Northern blot of human neuroblastoma cell lines probed with a human Y1 fragment, each lane containing 15 ⁇ g of total RNA.
  • Figure 1 also depicts the Southern blot of human genomic DNA under conditions of high stringency, with each lane containing 10 ⁇ g of genomic DNA.
  • Human Fetal Brain cDNA Library The lambda ZAPII cDNA library (Stratagene) was made from mRNA of a human female fetal (17-18 week gestation) brain, using both oligo (dT) and random-sequence primers.
  • the filters were submerged in denaturing solution (1.5 M NaCI and 0.5 M NaOH) for 2 min and in neutralizing solution (1.5 M NaCI, 0.5 M Tris-HCI, ph 8.0) for 5 minutes, and then rinsed in 2X SSC (0.3 M NaCI, 0.03 M sodium citrate, ph 7.0).
  • the filters were dried on Whatman 3MM paper and DNA was fixed to the filters by either using a UV Stratalinker 1800 (Stratagene) or baking at 80°C for
  • a 500-bp PCR product, corresponding to part of the coding region (547-1047) of the rat orphan receptor was used to screen the human fetal brain cDNA library.
  • This probe was generated using the following PCR conditions: 5 min at 95°C for 1 cycle, then 1 min at 93°C, 1 min at 45°C and 2 min at 72°C for 35 cycles, with the fetal brain cDNA library as template, and a 23-mer forward primer (TTCCAAAATGTATCACTTGCGGC, positions 547-569) and a 25-mer reverse primer (TAGTCTCGTAGTCCGTCCGTCTCGAG, positions 1023- 1047). Both primers were synthesized on a Biosearch Cyclone DNA Synthesizer.
  • the PCR reaction contained 50 mM KCI, 10 mM Tris-HCI (pH 9.0), 0.1% Triton X-100, 2.5 mM MgC_2, 1.6 mM dNTPs (US Biochemical), 50 pmol of forward and reverse primers, and 1 unit Taq DNA Polymerase in a 100 ⁇ l reaction volume. 4. Probe Labeling:
  • the human fetal brain probe was labeled using a random primed DNA labeling kit (Boehringer Mannheim Biochemical), following the manufacturer's instructions. Approximately 25 ng of the human fetal brain PCR product was heat denatured (10 minutes at 95°C), and the following components were added: dATP, dGTP, dTTP mixture (all 0.5 mmol/l in Tris buffer); reaction mixture (10X buffer with random hexamer primers); 50 ⁇ Ci [alpha- 32 P] dCTP, 3000 Ci/mmol; and 1 unit Klenow enzyme. This mixture was incubated for 30 minutes at 37°C, and heated at 65°C for 10 minutes to stop the reaction.
  • the probe was then purified by Sephadex G-50 Sin Columns to remove non-incorporated deoxyribonucleotide triphosphates.
  • the Pharmacia Oiigolabelling Kit was also used to label the human fetal brain probe. 5. Hybridization Conditions:
  • the filters were prehybridized for 2 hours at 42°C in 25% formamide, 1 M NaCI, 10% dextran sulfate, 5X Denhardt's solution and 1 % SDS.
  • the hybridization was carried out in the same solution with the addition of the 32 P-labeled human fetal brain probe (300 ⁇ l volume, 200-300 cps/ ⁇ l) at 42°C for 16 hours.
  • the filters were then washed twice for 5 minutes at room temperature in 2X SSC, 0.2% SDS and twice at 42°C for 30 minutes in 2X SSC, 0.5% SDS.
  • the nylon membranes were exposed to XAR-5 (Kodak) film at -70°C for 24-72 hours. 6.
  • the positive plaques were removed from the plates and placed in SM buffer ((0.1 M NaCI, 0.01 M MgS04 , 50 mM Tris-HCI (pH 7.5), and 0.01% gelatin)). These plaques were diluted and titered with XL1 cells to yield about 10 plaques for the first set and 100 plaques for the second set on 100 mm agar plates. As before, the plates were incubated at 37°C overnight and transferred to nylon membranes as previously described. The same prehybridization/hybridization conditions in the initial screening were also used for the secondary screening. Positive clones were chosen for the tertiary screening, which was carried out essentially as described for the secondary screen.
  • Phagemids were rescued from the lambda vector and transfected into XL1 Blue bacteria according to the Stratagene protocol.
  • the Bluescript vector was purified from colonies using Promega Magic Miniprep system. The minipreps were performed according to the manufacturer's protocol. Overnight cultures were pelleted by centrifugation, and the pellets were resuspended in Cell Resuspension Solution (50 mM Tris-HCI, pH 7.5, 10 mM EDTA, 100 ⁇ l/ml RNase A). Cell lysis solution (0.2 M NaOH, 1 mM EDTA) was added to the resuspended cells, and then the cells were neutralized in a solution of 2.55 M KOAc, pH 4.8.
  • Cell Resuspension Solution 50 mM Tris-HCI, pH 7.5, 10 mM EDTA, 100 ⁇ l/ml RNase A.
  • Cell lysis solution 0.2 M NaOH, 1 mM EDTA
  • the double-stranded Bluescript plasmid obtained from the miniprep procedure was alkali denatured (incubation at 37° C for 30 min. in 0.2 M NaOH, 0.2 mM EDTA), neutralized in 0.4 volume 5 M NH4AC and precipitated with 4 volume 100% ethanol at -70° C for 5 min., after which it was spun in a microcentrifuge and the pellet was washed with 70% ethanol.
  • the sequencing was performed using The Sequenase Version 2.0 Sequencing kit (US Biochemical) and the sequencing reactions were carried out according to the manufacturer's instructions.
  • the 5X labeling Mix (7.5 urn each of dGTP, dCTP, dTTP) was diluted with water, and the Sequenase was diluted in the enzyme dilution buffer (10 mM Tris-HCI, pH 7.5, 5 mM DTT and 0.5 mg/ml BSA).
  • the enzyme dilution buffer 10 mM Tris-HCI, pH 7.5, 5 mM DTT and 0.5 mg/ml BSA.
  • 0.1 M DTT diluted labeling mix, 5 ⁇ Ci [ 35 S]-dATP (Amersham, >1000 Ci/mmol) and diluted sequenase were added to the annealing mixture and incubated at room temperature for 5 min.
  • the labeling reaction was added to each of the termination mixtures, and incubated for 5 min at 37° C.
  • stop solution (95% formamide, 20 mM EDTA, 0.05% bromphenol blue and 0.05% xylene cyanol) was added to each reaction.
  • the sequencing reactions were also carried out with the Pharmacia T7 sequencing kit using their sequencing protocol, which is similar to the procedure described above. 3. Automated Fluorescence Based Solid Phase Sequencing:
  • Sequencing of the HY1-5 and HY1 -7 clones were performed by using the manual dideoxy chain termination reaction using T7 DNA- polymerase and 5s-ATP (described above) and by using a Taq- polymerase based dideoxy chain termination reaction with dye-labeled 2',3'-dideoxynucleoside triphosphates, where the sequencing reaction is separated on an automated DNA sequencing apparatus (Applied Biosystems 373A Sequencing System) that automatically collects sequence data and makes it possible to export sequences to a databank, where further analysis of the sequence can take place.
  • Automatencing System Automatencing System
  • oligonucleotides Two oligonucleotides (primers), JS1 (5'- GCGCGGATAACAATTTCACACA-3') and JS2 (5'- GCAGCACTGACCCTTTTGGGACCG-3') were constructed. They correspond to the sequences juxtaposed to the linker of the PUC plasmid and its derivatives, making it possible to do PCR amplification of a DNA cloned in the plasmid's linker.
  • a second set of the JS-primers called JS1 B and JS2B, were modified by coupling biotin to the primer's 5'-end. Biotin is a protein that strongly binds a 66 kDa protein called Streptavidin.
  • a PCR-reaction where one primer is biotinylated and the other is not generates a product that can be bound to a solid phase in our case the Dynalbeads M-280 (ny Dynal, Norway) complexes between superparamagnetic polystyrene beads chemically bound to Streptavidin.
  • the biotinylated product is bound to streptavidin the product can be denatured and the non-bound DNA can be washed away, resulting in single stranded DNA bound to the magnetic beads.
  • the standard PCR insert amplification protocol is:
  • each primer either JS1-JS2b or JS1 B-JS2, depending on each strand that shall be sequenced
  • the dye primers, M13, M13rev, T3 and T7 and Taq-sequencing kit were purchased from ABI. Sequencing reactions were performed according to the manufacturer's protocol. A. Diluting the enzyme
  • PCR cycle Place the tubes in a thermal cycler preheated to 95°C.
  • a modified PCR cycle was used which included 1 minute at 94°C, 1 min at 55° C, and 1 min at 72° C for 25 cycles followed by a soak file at 4° C. These PCR conditions appeared to be as efficient as the conditions recommended by the manufacturer.
  • the apparatus is based on a four-dye, one lane, scanned laser technology.
  • Conventional 6% polyacrylamide gels are used ((57 g acrylamide, 3 g bis-acrylamide, 450 g urea and 100 ml 10 x TEB)/liter).
  • the settings on the machine to perform a 14 hour long run are based on the manufacturer's recommendations: 2500 V, 40 mAMP, 30 W, 40°C.
  • the sequencing reactions were incubated at 75° C for 2 min before they were run on 6% acrylamide gels (57 g acrylamide, 3 g bis- acrylamide, 480 g urea/liter in 1X TBE buffer).
  • the gels were 0.4 mm thick and 30 cm x 38 cm in size.
  • the gel was dried (1 hr at 80° C) with a gel dryer, and exposed to XAR-5 film for 18-72 hrs.
  • Enzyme digestion of rescued plasmids revealed several overlapping sibling clones, of which suitable clones, i.e. the longest (hY1-5) and those containing overlapping coding regions, were selected for sequencing analysis.
  • mRNA from several neuroblastoma cell lines were purified by standard guanidinium isothiocyanate/oligo (dT)-cellulose methods. Briefly, cultured cells were homogenized in guanidinium thiocyanate homigenization buffer (4 M guanidinium thiocyanate, 0.1 M Tris-HCI, pH 7.5, 1% beta-mercaptoethanol, 0.5% sodium lauryl sarcosinate) and the resulting lysate was centrifuged (5000 x g, 20 min).
  • guanidinium thiocyanate homigenization buffer (4 M guanidinium thiocyanate, 0.1 M Tris-HCI, pH 7.5, 1% beta-mercaptoethanol, 0.5% sodium lauryl sarcosinate
  • 0.1 vol 3M sodium acetate (pH 5.2) and 0.5 vol cold 100% ethanol were added and incubated on ice for 2 hrs.
  • the nucleic acid was pelleted by centrifugation (as above), and the pellet was resuspended in a second guanidinium thiocyanate buffer (4 M guanidinium thiocyanate, 0.1 M sodium acetate, pH 7.0, 1 mM DTT, 20 mM EDTA, pH 8.0).
  • the nucleic acid was precipitated in 0.5 vol cold 100% ethanol and incubated at -20° C for 2 hrs.
  • the nucleic acid was pelleted as before, and precipitated twice more.
  • RNA was dissolved in water.
  • 20 mM EDTA pH 8.0
  • 1 volume chloroform: 1-butanol (4:1) This was recentrifuged as before and extraction with phenol/chloroform/isoamyl alcohol was repeated.
  • 3 volumes of 4 M sodium acetate (pH 7.0) was added to the last aqueous phase, incubated at -20° C for 2 hrs before centrifugation, after which two more rounds of ethanol precipitation were carried out and the RNA was dissolved in water.
  • RNA was heated at 65° C for 5 min before addition of loading buffer (20 mM Tris-HCI, pH 7.6, 0.5 M NaCI, 1 mM EDTA, pH 8.0, 0.1% sodium lauryl sarcosinate), which was then applied onto oligo (dT)-cellulose columns. The columns were washed with the loading buffer and the poly (A) RNA was eluted with the elution buffer (10 mM Tris-HCI, pH 7.6, 1 mM EDTA, pH 8.0, 0.05
  • mRNA (few ⁇ g) was run on formaldehyde-containing agarose gels and transferred to nylon filters by capillary elution and RNA was crosslinked to the nylon membranes using a UV Stratalinker 1800 (Stratagne). 3. Hybridization Conditions:
  • the probe a 1.4 kb Xhol-EcoRI fragment of hY1-5, was labeled with 32 P as described earlier in Example I.
  • the prehybridization conditions were carried out as described for cDNA screening, except that 2X SSC was used instead of 1 M NaCI.
  • the filters were washed using the previously outlined conditions (for cDNA screening), with the exception that the final two washes were done at 65° C in 0.2 X SSC and 0.1% SDS. The filters were exposed to film as described earlier. 4.
  • Southern Hybridization The human leucocyte genomic DNA was prepared (by standard procedure) and digested with restriction enzymes. This DNA was then run on a 1% agarose gel and the DNA was transferred to filters as described before.
  • the probe, hybridization and washes were also as described for the Northern hybridization.
  • the Northern hybridization showed that the hY1-5 fragment hybridized to a single 3.5 kb transcript in SK-N-MC, which was known to express Y1 receptors, whereas the probe failed to identify Y1 transcripts in several other neuroblastoma cell lines.
  • the Southern hybridization results suggests that the genome contains a single Y1 receptor gene. In order to confirm that the cDNA clones were the human
  • Y1 receptor specific primers synthesized for sequencing the clones, were used in RT-PCR.
  • the mRNA was prepared from SK-N-MC cells using the Fast Track mRNA Isolation Kit (Invitrogen), following their instructions. In brief, cells were washed in PBS, pelleted by centrifugation, resuspended and lysed in lysis buffer (kit), and subsequently homogenized in a Dounce homogenizer. The lysate was passed through a 21 gauge needle several times, incubated at 45° C for 2 hrs, and added to pre-equilibrated oligo (dT) cellulose and incubated for another hour at room temperature with shaking. The oligo (dT) cellulose-bound mRNA was pelleted by centrifugation and resuspended in binding buffer
  • Cytoplasmic RNA was prepared from human cultured circumflex coronary artery smooth muscle cells. As before, cells were washed in PBS, centrifuged, and resuspended in lysis buffer (50 mM Tris-HCI, pH 8.0, 100 mM NaCI, 5 mM MgCl2, 0.5% NP-40; also added RNase inhibitor). After incubating on ice for 5 min, the lysate was centrifuged, and the supernatant was collected. Proteinase K (100 ⁇ g in 100 mM Tris, pH 7.5, 12.5 mM EDTA, 0.15 M NaCI, 1% SDS) was added to the supernatant, and incubated for 15 min at 37° C.
  • lysis buffer 50 mM Tris-HCI, pH 8.0, 100 mM NaCI, 5 mM MgCl2, 0.5% NP-40; also added RNase inhibitor. After incubating on ice for 5 min, the lysate was centrifuge
  • RNA was extracted with 2 sets of phenol/chloroform/isoamyl alcohol extractions and precipitated with 1 volume isopropanol.
  • the cytoplasmic RNA was pelleted by centrifugation and redissolved in water.
  • the reverse transcription reaction was performed using the cDNA Cycle kit (Invitrogen). Approximately 1 ⁇ g of SK-N-MC mRNA (or 5 ⁇ g of circumflex coronary artery smooth muscle cell total RNA) was used in each reaction, which consisted of 10 mM MeHgOH, 0.1 M beta- mercaptoethanol, 0.2 ⁇ g of oligo dT primer, RNase inhibitor, 5X buffer, 1 mM dNTPs and 5 units reverse transcriptase. For the total RNA sample, the primer was first incubated at 65° C for 2 min before the addition of the other reagents.
  • the samples were incubated at 42° C for one hour, followed by another incubation at 95° C for 3 min, after which another 5 units of reverse transcriptase was added and the cDNA synthesis was repeated.
  • the resulting cDNA was used directly for PCR analysis.
  • the four primers synthesized for the sequencing reaction were also used for the PCR reaction.
  • the same PCR reagents were used as described in the probe preparation section (Example I; 50 pmol of forward and reverse primers), however, the cycling conditions were slightly different: 5 min at 95° C for 1 cycle, then 1 min at 93° C, 2 min at 55° C and 2 min at 72° C for 35 cycles.
  • the resulting PCR products were run on 1.5% agarose gels along with molecular weight markers to estimate their sizes.
  • the cDNA of the human NPY Y1 receptor was transfected into COS 1 cells. This was done in order to establish the functional identity of our clone. Following the transfection procedure described below, the cells were studied with respect to: (i) radioreceptor binding using 1 5 l-peptide YY (PYY); (ii) cyclic AMP accumulation by use of radioimmunoassay kit (Advanced Magnetics); and (iii) 45 Ca 2 influx into the cells from the extracellular space. The two latter so-called second messenger responses were elicited by stimulation of the cells with NPY. In all three types of assay, cells not transfected with the Y1 receptor cDNA were used as controls to verify that these COS 1 cells do not normally possess Y1 receptors.
  • DM EM Dulbecco's Modified Eagle Media
  • COES 1 cells passages 6 to 17, were maintained in T75 flask in DMEM supplemented with 10% fetal calf serum (GIBCO-BRL) at 37° C and 95% humidity under 5% CO2 avoiding confluency until used. 2. The day before transfections were performed, cells were trypsinized and washed with 25 ml of DMEM containing 10% NuSerum (Collaborative Research; Catalogue #5000) to completely remove trypsin. After trituration, cells were subcultured to the density of 220,000 cells per 35 mm plate in 2 ml DMEM with 10% NuSerum. Allow approximately 20 hours for cells to attach to plates under the same culture-incubator condition described above.
  • DMEM fetal calf serum
  • the purified plasmid (cDNA of human NPY Y1 receptor in PCDM8 vector (Invitrogen) was precipitated with ethanol and dissolved in sterile 20 mM HEPES buffer (pH 7.4) containing 150 mM NaCI to the final concentration of 0.1 mg/ml.
  • the final concentration of DEAE-dextran should be 500 ⁇ g/ml after mixed with media for transfections. Leave the mixture at room temperature until the media for the transfection is prepared (10 minutes). At this concentration of plasmid, normally no precipitation was formed, however, if any precipitate was visible, the volume of buffer was increased to 100 ⁇ l.
  • the cells grown in 145 mm plates were washed three times, harvested and suspended in 50 mM ice-cold Tris-HCI buffer (pH 7.4) with 5 mM EDTA and 1 mM ⁇ -mercaptoethanol and then homogenized using Polytron (Brinkman; setting 6) for 10 sec.
  • the homogenate was centrifuged at 1 ,000 x g for 10 min using a swinging bucket rotor.
  • the supernatant was then subjected to ultracentrif ugation at 100,000 x g for 30 min.
  • the resulting pellet was resuspended by Polytron homogenizer in fresh binding buffer (137 mM NaCI, 5.4 mM KCL, 0.44 mM KH2PO4, 1.26 mM CaCl2, 0.81 mM MgS ⁇ 4, 20 mM HEPES, 0.3% bovine serum albumin and 0.01 % bacitracin; pH 7.4) and membranes from 2 X 10 6 cells were used per assay tube in a final volume of 0.4 ml. Samples were then incubated with 125 l-peptide YY (( 125 I-PYY (New England Nuclear); 2200 Ci/mmol; 22°C; 100 min)). In displacement-type experiments, 0.1 nM radioligand was used.
  • Cyclic AMP accumulation determination Sixty hours after transfection (35 mm wells) cells were equilibrated in the HEPES-based buffer described above for one hour. Phosphodiesterase inhibitor, methylisobutylxanthine (500 ⁇ M) was present throughout the cAMP experiments. Ten minutes after addition of 100 nM NPY, the cells were challenged with 5 ⁇ M forskolin. Fifteen minutes later, the reaction was terminated by adding 1 ml of ethanol to the 1 ml of incubation mixture. The cells were harvested from each well into individual tubes, the wells were washed with another 1 ml of ethanol, and the washings were combined. The cells were then sonicated and left on ice for 10 minutes.
  • Precipitated proteins were separated by centrifugation, the precipitates were washed once with 1 ml of ethanol, and the supematants were combined. The final ethanol extract was evaporated under vacuum and the residue dissolved in assay buffer supplied with the cyclic AMP radioimmunoassay kit. Assay for cyclic AMP was carried out using the non-acetylated protocol, precisely as described by the kit manufacturer.
  • the structural gene for the Y-1 receptor consists of the sequence between nucleotide 197 and 1534.
  • the deduced amino acid sequence of the human Y1 -receptor taken from this cDNA sequence is:
  • the predicted Y1 -receptor sequence shows 93% identity to that deduced from the rat FC5 clone, which is proposed to correspond to a rat Y1 -receptor.
  • the predicted Y1 -receptor sequence shows 93% identity to that deduced from the rat FC5 clone, which is proposed to correspond to a rat Y1 -receptor.
  • seven occur in the N-terminal extracellular part and nine occur in transmembrane region
  • TM 4 and the following extracellular loop.
  • the human Y1 -sequence has two additional amino acids as compared to its rat counterpart, one in the N-terminal extension and one near the C-terminus. It is notable that the sequence DRY (Asp-Arg-Tyr), which follows TM3 in most receptors belonging to the G-protein-coupled receptor superfamily, reads ERH (Glu-Arg-His) in the Y1 sequences of both human and rat. Most other positions which are highly conserved in the receptor superfamily are also conserved in the predicted Y1 -sequences.
  • the peptides according to the present invention can be synthesized by any suitable method, such as by exclusively solid-phase techniques, by partial solid-phase techniques, by fragment condensation or by classical solution addition.
  • Synthetic Y1 -receptor according the to the present invention may also be entirely or partially synthesized by recently developed recombinant DNA techniques, which may likely be used for large-scale production.
  • Synthesis by use of recombinant DNA techniques should be understood to include the suitable employment of a structural gene coding for all or an appropriate section of the Y1 -receptor to transform a microorganism, using an expression vector including an appropriate promoter and operator together with the structural gene, and causing the transformed microorganism to express the peptide or such a synthetic peptide fragment.
  • a structural gene coding for all or an appropriate section of the Y1 -receptor to transform a microorganism, using an expression vector including an appropriate promoter and operator together with the structural gene, and causing the transformed microorganism to express the peptide or such a synthetic peptide fragment.
  • an expression vector including an appropriate promoter and operator together with the structural gene and causing the transformed microorganism to express the peptide or such a synthetic peptide fragment.
  • a non-human animal may also be used to produce the peptide by gene-farming using such a structural gene or cDNA in the microinjection of embryos.
  • the peptides are not prepared using recombinant DNA technology, they are preferably prepared using solid phase synthesis, such as that described by Merrifield [see J. Am. Chem. Soc. 85:2149 (1964), although other equivalent chemical syntheses known in the art can also be used as previously described.
  • Y1 -receptor mRNA The presence of Y1 -receptor mRNA in various human cultured cells was investigated by (1) Northern hybridizations using human Y1- probe (Fig. 1) and (2) by RT-PCR using specific human Y1 -primers (data not shown). Both methods showed the human neuroblastoma cell line, SK-N-MC to express Y1 -receptors (Fig. 1); this particular cell line has been viewed as a model system for studies on Y1 -receptors. The size of the single hybridizing transcript in SK-N-MC is approx. 3.5 kb.
  • the insert of hY1-5 was transferred to the mammalian expression vector, pCDM ⁇ , and used to transfect COS1 cells.
  • Such transfected DCs were used for studies on (1) radioligand, i.e. 125
  • radioligand i.e. 125
  • second messenger i.e. Ca 2+ and cAMP
  • Radioligand binding assays in membranes prepared from the hY1- 5 transfected cells indicate that the clone encodes a protein with the pharmacological characteristics typical of a Y1 -receptor type.
  • the pharmacological profile of ligands competing for 1 25 I-PYY binding to the expressed clone illustrated in Fig.
  • NPY13-36 > NPY18-36 was determined (Fig.2); similar rank orders of potency have been observed in various vascular smooth muscle cells [see Br. J. Pharmacol. 105:45 (1992)] and SK-N-MC [see Life Sci. 50 PL7- PI12 (1992)].
  • Human NPY was equipotent with porcine NPY (not shown).
  • Two second messenger responses frequently associated with Y1 - receptors are influx of Ca 2+ , which is not necessarily associated with activation of phosphoinositidase C, and inhibition of cAMP accumulation.
  • the portion of the sequence spanning the TM regions of hY1-5 shows only 21% and 23% identity with proposed bovine and Drosophila NPY receptors, respectively; the Y1 -sequence appears more closely related to tachykinin receptors (29% sequence identity) [see Ann. NY Acad Sci. 632:53 (1991)], and it is similar to the human somatostatin type 1 receptor (23% identity) [see Proc. Natl. Acad. Sci. USA 89:251 (1992)] as to the bovine and Drosophila NPY receptors.
  • the present invention has described the cloning and identification of the human Y1-type NPY/PYY receptor. This receptor is thought to be instrumental for the ability of NPY/PYY to induce vasoconstriction as well as several behavioral effects.
  • NPY Neuropeptide Y
  • Y1 -receptor The receptor sub-type cloned according to the present invention is termed "Y1 -receptor", and is widely believed to mediate some of the most important functions of NPY:
  • Vascular smooth muscle contraction - NPY is released from nerves surrounding blood vessels and is one of the most potent known pressor agents, thus increasing blood pressure in man; elevated levels of NPY have been observed in hypertensive patients; (2) Sedation/anxiolysis - NPY is as powerful as a benzodiazepine, e.g.
  • Valium in inducing anticonflict behaviors in animals; in psychiatric patients suffering from major depression, the brain levels of NPY are reduced, and anxiety symptoms in these patients are inversely related to NPY levels; and (3) Food intake - NPY has frequently been argued to be the most powerful stimulator of food intake and obesity ever studied in mammals; dysregulation of NPY systems have been suggested to exist in patients with eating disorders, i.e. anorexia nervosa/bulimia.
  • the human Y1 -receptor according to the present invention has a potential pharmaceutical target; at present, no therapeutically useful drugs are known to interact with the Y1- receptor.
  • oligonucleotides necessary to study the inhibition of the contractile effect of neuropeptide Y on human blood vessels were synthesized on a Biosearch Cyclone DNA Synthesizer following the manufacturer's instructions.
  • Three oligonucleotides were prepared: (1 ) an antisense 18-base oligonucleotide (designated as hY1-AS) corresponding to the human Y1 receptor amino-terminus . (2) a corresponding sense oligonucleotide sequence (designated as hY1-S), and (3) a 3-base mismatched antisense oligonucleotide (designated as hY1-MM).
  • sequences of these three oligonucleotides were: hY1 -S 5' - CAACATTATT TTCCCAGG - 3' hY1 -AS 5' - CCTGGGAAAA TAATGTTG - 3' hY1-MM 5' - CCTGAGATAA TAAGGTTG - 3'
  • oligonucleotides were iyophilized and redissolved in water. These oligonucleotides were then run on a 15% acrylamide gel to verify their sizes.
  • Subcutaneous arteries and veins from patients operated upon for non-vascular diseases were dissected in the beginning of the operation from the abdominal region and cut into cylindrical segments 2-3 mm long. These segments were incubated in Dulbecco's Modified Essential Medium (Sigma) supplemented with streptomycin (10,000 mg/ml), penicillin (10,000 U/ml) with or without the test oligonucleotides at 1 ⁇ M. Each incubation was conducted for 48 hours at 37° C in humidified 5% carbon dioxide and 95% air.
  • the cylindrical segments were then mounted on two metal prongs, one of which was connected to a force displacement transducer (model FT03C) attached to a Grass Polygraph for continuous recording of the isometric tension, and the other to a displacement device.
  • the mounted specimens were immersed in temperature controlled (37° C) tissue bathes containing a buffer of the following composition (mM): NaCI 119, NaHC ⁇ 3 15, KCI 4.6, MgCI 1.2, NaH2P ⁇ 4 1.2, CaCl2 1.5, and glucose 11.
  • the solution was continuously gassed with 5% carbon dioxide in oxygen giving a pH of 7.4.
  • a tension of 4 mN was applied to the vessel segments and they were allowed to stabilize at this level of tension for 1.5 hours.
  • each vessel segment was examined by exposure to a potassium-rich (60 mM) buffer solution. After another 45 minutes rest period, the following known agonists were added to the vessels in cumulative doses: neuropeptide Y (Auspep, Australia), neuropeptide Y13-I 6 (Bissendorf Biochemicals), pro 34 neuropeptide, noradrenaline (Sigma).
  • NPY, PYY and Pro34NPY had similar contractile effects while NPY13-36 had no contractile effect upon the vessels tested, thus clearly indicating that the contractions seen were mediated by a Y1 -receptor.
  • the maximum contraction (% of potassium-induced contraction) was significantly reduced by antisense oligoncleotide treatment as shown in the above table.
  • potency is expressed as -log concentration of agonist inducing half maximum concentration, and no significant differences were seen in the potency values between the groups (artery and vein). All values represent the mean ⁇ SEM for 8 to 10 vessel segments, except for the mismatch value which represents 3 segments.
  • the asterisk ( * ) represents a p ⁇ 0.01 between the sense and antisense data according to the paired Wilcoxon signed rank test.
  • the contractile responses to NPY were markedly reduced. This is believed to be due to reduced numbers of NPY-Y1 receptors. This finding, in turn, indicates that the contractile effect of NPY on human resistance vessels that are likely to be active in the regulation of vascular tone and blood pressure, is mediated primarily by the cloned Y1 receptor.
  • the selectivity of the antisense oligodeoxynucleotide molecule seems to be very high since treatment with the mismatched analogue, hY1-MM, with 3 out of 18 nucleotides mismatched, was without effect on NPY-evoked vasoconstriction.
  • the antisense oligonucleotide did not affect responses of the vessels to noradrenaline or high K + depolarization.
  • the antisense oligonucleotides described herein or deemed to be equivalents hereof, may be used in diagnostics, therapeutics and as research reagents and kits.
  • the use of the antisense oligonucleotide compounds may represent a suitable research tool for vascular pharmacology by which the functional characteristics of a number of cloned receptors may be examined.
  • the antisense oligonucleotides according to the present invention is to be administered to an animal, especially a human, in which it is medically desired to specifically attenuate NPY-evoked vasoconstriction.
  • Administration of the antisense oligonucleotides according to the present invention may be by any acceptable means, however, it is most preferred that the administration take place intravenously into a blood vessel, either artery or vein, so as to deliver the oligonucleotide directly to the site of NPY receptors.
  • Use of recognized pharmacologically acceptable carriers may also be preferred as carriers, diluents, buffers and other functional classes well within the purview of those skilled in the formulation arts.
  • the exact dosages of antisense oligonucleotides provided to a mammal to attenuate the NPY- evoked response in the mammal's blood vessels may vary across a broad range, however, such dosages should be limited to that range which is sufficient to bring about the desired degree of attenuation based upon the method of administration, the urgency by which such attenuation is desired, the weight of the mammal, and the amount of the oligonucleotide in the total bolus of medication administered.
  • MOLECULE TYPE cDNA
  • SEQUENCE DESCRIPTION SEQ ID NO:1 :

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Toxicology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Endocrinology (AREA)
  • Peptides Or Proteins (AREA)

Abstract

La présente invention est destinée au clonage, à l'identification et aux utilisations du récepteur de neuropeptide Y et de peptide YY humains de type Y-1. Le clone d'ADN isolé est exprimé dans des cellules COS1 pour un essai par compétition de liaison de ligands. L'invention porte également sur un nouveau principe de développement d'un inhibiteur des réactions contractiles du neuropeptide Y dans les vaisseaux du corps humain par utilisation d'un oligodésoxynucléotide antisens complémentaire du récepteur humain Y-1Y1 de l'ARNm.
PCT/US1993/005039 1992-05-29 1993-05-27 Recepteur de neuropeptide y et de peptide yy humains du type y1 et oligonucleotides antisens complementaires de ce recepteur ayant pour effet d'inhiber la vasoconstriction WO1993024515A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US891,453 1986-07-30
US89145392A 1992-05-29 1992-05-29

Publications (1)

Publication Number Publication Date
WO1993024515A1 true WO1993024515A1 (fr) 1993-12-09

Family

ID=25398219

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1993/005039 WO1993024515A1 (fr) 1992-05-29 1993-05-27 Recepteur de neuropeptide y et de peptide yy humains du type y1 et oligonucleotides antisens complementaires de ce recepteur ayant pour effet d'inhiber la vasoconstriction

Country Status (1)

Country Link
WO (1) WO1993024515A1 (fr)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996023809A1 (fr) * 1995-02-03 1996-08-08 Merck & Co., Inc. Recepteur du neuropeptide y
EP0746332A1 (fr) * 1993-12-28 1996-12-11 Synaptic Pharmaceutical Corporation Adn codant un recepteur (y4) de neuropeptide y/peptide yy/polypeptide pancreatique et utilisation de celui-ci
EP0791009A1 (fr) * 1994-11-07 1997-08-27 Merck & Co., Inc. Recepteurs neuropeptidiques y modifies
US5912227A (en) * 1995-01-27 1999-06-15 North Carolina State University Method of enhancing nutrient uptake
US5916869A (en) * 1997-06-13 1999-06-29 North Carolina State University Method of treating birds in ovo
US5919901A (en) * 1996-04-08 1999-07-06 Bayer Corporation Neuropeptide Y receptor Y5 and nucleic acid sequences
US5965392A (en) * 1996-04-08 1999-10-12 Bayer Corporation Neuropeptide Y receptor Y5 and nucleic acid sequences
US5968819A (en) * 1994-12-02 1999-10-19 Synaptic Pharmaceutical Corporation DNA encoding a hypothalamic atypical neuropeptide Y/peptide YY receptor (Y5)
US5989920A (en) * 1994-12-02 1999-11-23 Synaptic Pharmaceutical Corporation Methods of modifying feeding behavior compounds useful in such methods and DNA encoding a hypothalmic atypical neuropeptide Y/peptide YY receptor Y5
US6713265B1 (en) 1997-06-04 2004-03-30 Synaptic Pharmaceutical Corporation Methods of modifying feeding behavior, compounds useful in such methods, and DNA encoding a hypothalamic atypical neuropeptide Y/peptide YY receptor (Y5)
WO2004066966A2 (fr) 2003-01-17 2004-08-12 Societe De Conseils De Recherches Et D'applications Scientifiques S.A.S. Analogues du peptide yy

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
ANNALS OF THE NEW YORK ACADEMY OF SCIENCES, Volume 611, issued 01 December 1990, C. WAHLESTEDT et al., "Central and Peripheral Significance of Neuropeptide Y and its Related Peptides", pages 7-26. *
EUROPEAN JOURNAL OF PHARMACOLOGY, Volume 204, issued 1991, H.N. DOODS et al., "Different Neuropeptide Y Receptor Subtypes in Rat and Rabbit Vas Deferens", pages 101-103. *
MOLECULAR PHARMACOLOG, Volume 40, issued 1991, J. RIMLAND et al., "Sequence and Expression of a Neuropeptide Y Receptor cDNA", pages 869-875. *
THE JOURNAL OF BIOLOGICAL CHEMISTRY, Volume 267, No. 1, issued 05 January 1992, X. LI et al., "Cloning, Functional Expression, and Developmental Regulation of a Neuropeptide Y Receptor from Drosophila Melanogaster", pages 9-12. *

Cited By (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5958709A (en) * 1993-12-28 1999-09-28 Synaptic Pharmaceutical Corporation Processes for identifying compounds that bind to the human Y4 receptor
EP0746332A1 (fr) * 1993-12-28 1996-12-11 Synaptic Pharmaceutical Corporation Adn codant un recepteur (y4) de neuropeptide y/peptide yy/polypeptide pancreatique et utilisation de celui-ci
EP0746332A4 (fr) * 1993-12-28 1997-02-26 Synaptic Pharma Corp Adn codant un recepteur (y4) de neuropeptide y/peptide yy/polypeptide pancreatique et utilisation de celui-ci
US6913892B1 (en) 1993-12-28 2005-07-05 H. Lundbeck A/S Method of obtaining compositions comprising Y4 specific compounds
US5976814A (en) * 1993-12-28 1999-11-02 Synaptic Pharmaceutical Corporation DNA encoding a human neuropeptide Y/peptide YY/pancreatic polypeptide receptor (Y4) and uses thereof
EP0791009A1 (fr) * 1994-11-07 1997-08-27 Merck & Co., Inc. Recepteurs neuropeptidiques y modifies
EP0791009A4 (fr) * 1994-11-07 2003-03-05 Merck & Co Inc Recepteurs neuropeptidiques y modifies
US6645774B1 (en) 1994-12-02 2003-11-11 Synaptic Pharmaceutical Corporation Methods of modifying feeding behavior using compounds with afinity for the human hypothalamic atypical neuropeptide Y/peptide YY receptor (Y5)
US5989920A (en) * 1994-12-02 1999-11-23 Synaptic Pharmaceutical Corporation Methods of modifying feeding behavior compounds useful in such methods and DNA encoding a hypothalmic atypical neuropeptide Y/peptide YY receptor Y5
US6818445B2 (en) 1994-12-02 2004-11-16 Synaptic Pharmaceutical Corporation Methods of modifying feeding behavior, compounds useful in such methods, and DNA encoding a hypothalamic atypical neuropeptide Y/peptide YY receptor (Y5)
US6316203B1 (en) 1994-12-02 2001-11-13 Synaptic Pharmaceutical Corporation Methods of screening and preparing a composition using DNA encoding a hypothalamic atypical neuropeptide Y/peptide YY receptor (Y5)
US5968819A (en) * 1994-12-02 1999-10-19 Synaptic Pharmaceutical Corporation DNA encoding a hypothalamic atypical neuropeptide Y/peptide YY receptor (Y5)
US5912227A (en) * 1995-01-27 1999-06-15 North Carolina State University Method of enhancing nutrient uptake
US5939263A (en) * 1995-02-03 1999-08-17 Merck & Co., Ltd. Neuropeptide Y receptor
WO1996023809A1 (fr) * 1995-02-03 1996-08-08 Merck & Co., Inc. Recepteur du neuropeptide y
US5621079A (en) * 1995-02-03 1997-04-15 Merck & Co., Inc. Neuropeptide Y receptor
US6207799B1 (en) 1996-04-08 2001-03-27 Bayer Corporation Neuropeptide Y receptor Y5 and nucleic acid sequences
US5965392A (en) * 1996-04-08 1999-10-12 Bayer Corporation Neuropeptide Y receptor Y5 and nucleic acid sequences
US6368824B1 (en) 1996-04-08 2002-04-09 Bayer Corporation Neuropeptide Y receptor Y5 and nucleic acid sequences
US5919901A (en) * 1996-04-08 1999-07-06 Bayer Corporation Neuropeptide Y receptor Y5 and nucleic acid sequences
US6713265B1 (en) 1997-06-04 2004-03-30 Synaptic Pharmaceutical Corporation Methods of modifying feeding behavior, compounds useful in such methods, and DNA encoding a hypothalamic atypical neuropeptide Y/peptide YY receptor (Y5)
US5916869A (en) * 1997-06-13 1999-06-29 North Carolina State University Method of treating birds in ovo
WO2004066966A2 (fr) 2003-01-17 2004-08-12 Societe De Conseils De Recherches Et D'applications Scientifiques S.A.S. Analogues du peptide yy
US7811989B2 (en) 2003-01-17 2010-10-12 Ipsen Pharma S.A.S. Peptide YY analogs
EP2277527A2 (fr) 2003-01-17 2011-01-26 Ipsen Pharma Analogues du peptide YY

Similar Documents

Publication Publication Date Title
Kolakowski Jr et al. Molecular characterization and expression of cloned human galanin receptors GALR2 and GALR3
Duvoisin et al. The functional diversity of the neuronal nicotinic acetylcholine receptors is increased by a novel subunit: β4
CA2156272C (fr) Adn codant un recepteur (y4) de neuropeptide y/peptide yy/polypeptide pancreatique et utilisation de celui-ci
Hoek et al. A new Ig‐superfamily member, molluscan defence molecule (MDM) from Lymnaea stagnalis, is down‐regulated during parasitosis
WO1993014201A1 (fr) Adn codant un recepteur humain 5-ht1f et utilisations de cet adn
JP2002514055A (ja) ガラニンｇａｌｒ３受容体をコードするｄｎａおよびその使用
WO1993024515A1 (fr) Recepteur de neuropeptide y et de peptide yy humains du type y1 et oligonucleotides antisens complementaires de ce recepteur ayant pour effet d'inhiber la vasoconstriction
JP2001508293A (ja) マウスガラニンレセプターｇａｌｒ２及び該レセプターをコードするヌクレオチド
EP1297003A2 (fr) Lignee cellulaire recombinee exprimant gpcrx11 en tant que recepteur fonctionnel valide par l'angiopeptine et utile dans le criblage d'agonistes et antagonistes
EP0463064B1 (fr) Compositions de recepteurs d'acetylcholine nicotinique neuronaux contenant la sous-unite beta4
JP2001525178A (ja) ヒト１１ｃｂスプライス変異体に対するアゴニストおよびアンタゴニストの探索方法
WO1995023858A1 (fr) Nouveau gene de canal potassique declenche par tension
AU6445394A (en) Cloned human alphaic adrenergic receptor
KR19990064263A (ko) 뉴로펩티드 y-y5 수용체
US6143880A (en) Pig myogenin gene and method to identify polymorphisms related to muscle growth
US6551821B1 (en) Brain cyclic nucleotide gated ion channel and uses thereof
AU782848B2 (en) DNA encoding SNORF62 and SNORF72 receptors
US5449606A (en) DNA encoding neuronal nicotinic acetylcholine receptor compositions containing the beta 4 subunit
US6146835A (en) Human kappa opioid receptor, nucleic acids and uses thereof
WO1997031015A1 (fr) Recepteurs de l'obesite du rat et nucleotides codant ces recepteurs
CA2379462A1 (fr) Nouveau recepteur couple a la proteine g humaine
US5770432A (en) Obesity associated genes
WO1996003416A1 (fr) Acides nucleiques codant des recepteurs pour des peptides analogues a bombesine
US6281346B1 (en) Rat ob-receptors and nucleotides encoding them
AU667510C (en) DNA encoding a human 5-HT-1F receptor and uses thereof

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): JP US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase