WO1993004701A1 - Apport cible de polynucleotides ou d'oligonucleotides a des cellules - Google Patents

Apport cible de polynucleotides ou d'oligonucleotides a des cellules Download PDF

Info

Publication number
WO1993004701A1
WO1993004701A1 PCT/US1992/007339 US9207339W WO9304701A1 WO 1993004701 A1 WO1993004701 A1 WO 1993004701A1 US 9207339 W US9207339 W US 9207339W WO 9304701 A1 WO9304701 A1 WO 9304701A1
Authority
WO
WIPO (PCT)
Prior art keywords
cell
molecular complex
oligonucleotide
antisense
binding agent
Prior art date
Application number
PCT/US1992/007339
Other languages
English (en)
Inventor
George Y. Wu
Catherine H. Wu
Original Assignee
University Of Connecticut
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University Of Connecticut filed Critical University Of Connecticut
Priority to EP92920863A priority Critical patent/EP0666923A1/fr
Priority to AU26780/92A priority patent/AU681997B2/en
Priority to KR1019940700741A priority patent/KR100252547B1/ko
Priority to JP5505335A priority patent/JPH07500820A/ja
Publication of WO1993004701A1 publication Critical patent/WO1993004701A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/645—Polycationic or polyanionic oligopeptides, polypeptides or polyamino acids, e.g. polylysine, polyarginine, polyglutamic acid or peptide TAT
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/351—Conjugate
    • C12N2310/3513—Protein; Peptide

Definitions

  • Antisense oligonucleotides hold great promise as means of specifically inhibiting unwanted gene expression in cells. Improvements in the delivery of oligonucleotides to cells will enhance effectiveness. Naked antisense oligonucleotides can be taken up by cells non-specifically and at low efficiency. Some methods have been explored to increase uptake. Lemaitre et al. covalently coupled an oligonucleotide to polylysine and demonstrated inhibition of viral gene expression at several fold lower than DNA concentrations compared to mixtures of polylysine and antisense DNA (Lemaitre, M. et. al. Proc. Natl. Acad. Sci. USA 84:648-652). Although specific antiviral effects were shown, specific delivery was not demonstrated.
  • This invention pertains to a soluble, targetable molecular complex for targeting poly- or oligonucleo ⁇ tides to a specific cell to inhibit the expression of a gene or genes.
  • the molecular complex comprises a single-stranded poly- or oligonucleotide which hybridizes to an RNA transcript of the gene, complexed to a carrier which is a conjugate of a cell-specific binding agent and a poly- or oligonucleotide-binding agent.
  • the complex is administered in a pharmaceutically acceptable solution in an amount sufficient to hybridize to and inhibit the function of the RNA transcript.
  • the poly- or oligonucleotide can be DNA or RNA.
  • an antisense oligodeoxy- nucleotide can be used which hybridizes to and inhibits the function of an RNA.
  • the targeted RNA is typically a messenger RNA.
  • the oligonucleotide can also be an RNA which has catalytic activity (a ribozyme) .
  • the target for antisense or ribozyme- mediated inhibition can be a gene or genes of cellular origin (e.g., a cellular oncogene) or of noncellular origin (e.g., a viral oncogene or the genes of an infecting pathogen such as a virus) .
  • the cell-specific binding agent is specific for a cellular surface structure, typically a receptor, which mediates internalization of bound ligands by endocytosis, such as the asialoglycoprotein receptor of hepatocytes.
  • the cell-specific binding agent can be a natural or synthetic ligand (for example, a protein, polypeptide, glycoprotein, carbohydrate, etc.) or it can be an antibody, or an analogue thereof, which specifically binds a cellular surface structure which then mediates internalization of the bound complex.
  • the poly- or oligonucleotide-binding component of the conjugate is a compound such as a polycation which stably complexes the single-stranded poly- or oligonucleotide under " extracellular conditions and releases it under intracellular conditions so that it can function within the cell.
  • the complex of the gene and the carrier can be used in vitro or in vivo to selectively deliver poly- or oligonucleotides to target cells.
  • the complex is stable and soluble in physiological fluids. It can be administered in vivo where it is selectively taken up by the target cell via the surface-structure- mediated endocytotic pathway.
  • the incorporated poly- or oligonucleotide hybridizes with its complementary RNA, thereby inhibiting function of the RNA and expression of the target gene or genes.
  • Figure 1 shows the uptake of complexed antisense DNA by HepG2 and SK Hepl cells.
  • Figure 2 shows the effect of complexed antisense DNA on hepatitis B virus surface antigen concentration in culture medium.
  • FIG. 3 shows Southern blots of DNA extracted from medium and cells after 24 hrs of exposure to antisense DNA.
  • a soluble, targetable molecular complex is used to selectively deliver a single-stranded poly- or oligonucleotide to a target cell or tissue in vivo to specifically inhibit gene expression.
  • the molecular complex comprises the oligonucleotide to be delivered complexed to a carrier made up of a binding agent specific for the target cell and a DNA-binding agent. The complex is selectively taken up by the target cell and the oligonucleotide hybridizes to the RNA transcript which inhibits expression of the targeted gene(s) .
  • the poly- or oligonucleotide is a single- stranded molecule which hybridizes to a specific RNA under intracellular conditions.
  • the degree of complementarity required for appropriately specific hybridization to the target RNA sequence under intra ⁇ cellular conditions can be determined empirically.
  • the oligonucleotide is an antisense oligodeoxynucleotide.
  • the antisense oligodeoxynucleotide can be a normal oligodeoxy ⁇ nucleotide or an analogue of an oligodeoxynucleotide (e.g., phosphorothioate oligonucleotides., in which one of the phosphate oxygens is replaced by a sulfur atom) sufficiently stable to reach the target in effective concentrations. See e.g., Stein, CA. and Cohen, J.S. (1988) Cancer Research 48:2659-2668.
  • Antisense oligodeoxynucleotides can be prepared by standard synthetic procedures. The antisense oligonucleotides can be designed to operate by different mechanisms of gene inhibition.
  • these mechanisms involve the hybridization of the oligonucleotide to a specific RNA sequence, typically a messenger RNA.
  • the targeted sequence can be located in the coding region of the RNA or it can be a signal sequence required for processing or translation of the RNA.
  • the targeted sequence can be a sequence normally found in an organism or a sequence found in a pathogenic organism but not in its host.
  • the oligonucleotide may form a triple helix DNA structure, inhibiting transcription of the mRNA sequence.
  • the oligonucleotide can be an RNA molecule which has catalytic activity, i.e., a ribozyme.
  • Ribozymes are advantageous because they specifically cleave and, thus, destroy the targeted RNA sequence. Ribozymes are described in U.S. Patent No. 4,987,071.
  • the carrier component of the complex is a conjugate of a cell-specific binding agent and an oligonucleotide-binding agent.
  • the cell- specific binding agent specifically binds a cellular surface structure which mediates its internalization by, for example, the process of endocytosis.
  • the surface structure can be a protein, polypeptide, carbohydrate, lipid or combination thereof. It is typically a surface receptor which mediates endo ⁇ cytosis of a ligand.
  • the binding agent can be a natural or synthetic ligand which binds the receptor.
  • the ligand can be a protein, polypeptide, carbohydrate, lipid or a combination thereof which has functional groups that are exposed sufficiently to be recognized by the cell surface structure.
  • the binding agent can also be an antibody, or an analogue of an antibody such as a single chain antibody, which binds the cell surface structure.
  • Ligands useful in forming the carrier will vary according to the particular cell to be targeted.
  • glycoproteins having exposed terminal carbohydrate groups such as asialoglyco- protein (galactose-terminal) can be used, although other ligands such as polypeptide hormones may also be employed.
  • asialoglycoproteins include asialoorosomucoid, asialofetuin and desialylated vesicular stomatitis virus.
  • Such ligands can be formed by chemical or enzymatic desialylation of glycoproteins that possess terminal sialic acid and penultimate galactose residues.
  • asialoglycoprotein ligands can be formed by coupling galactose terminal carbohydrates such as lactose or arabinogalactan to non-galactose bearing proteins by reductive lactosamination.
  • galactose terminal carbohydrates such as lactose or arabinogalactan
  • non-galactose bearing proteins by reductive lactosamination.
  • other types of ligands can be used, such as mannose for macrophages (lymphoma), mannose-6-phosphate glycoproteins for fibroblasts (fibrosarcoma) , intrinsic factor-vitamin B12 for enterocytes and insulin for fat cells.
  • the cell-specific binding agent can be a receptor or receptor-like molecule, such as an antibody which binds a ligand (e.g., antigen) on the cell surface.
  • Such antibodies can be produced by standard procedures.
  • the poly- or oligonucleotide-binding agent complexes the oligonucleotide to be delivered. Complexation with the oligonucleotide must be sufficiently stable in vivo to prevent significant uncoupling of the oligonucleotide extracellularly prior to internalization by the target cell. However, the complex is cleavable under appropriate conditions within the cell so that the oligonucleo ⁇ tide is released in functional, hybridizable form.
  • the complex can be labile in the acidic and enzyme rich environment of lysosomes.
  • a non ⁇ covalent bond based on electrostatic attraction between the binding agent and the oligonucleotide provides extracellular stability and is releasable under intracellular conditions.
  • Preferred poly- or oligonucleotide-binding agents are polycations that bind the negatively charged nucleic acid strands. These positively charged materials can bind noncovalently with the poly- or oligonucleotide to form a soluble, targetable molecular complex which is stable extracellularly but which releases the poly- or oligonucleotide as a functional (e.g., hybridizable) molecule intracellularly.
  • Suitable polycations are polylysine, polyarginine, polyornithine, basic proteins such as histones, avidin, protamines and the like.
  • a preferred polycation is polylysine (e.g., ranging from 3,800 to 60,000 daltons) .
  • noncovalent bonds that can be used to releasably link the poly- or oligonucleotide include hydrogen bonding, hydrophobic bonding, electrostatic bonding alone or in combination such as, anti-poly- or oligonucleotide antibodies bound to poly- or oligonucleotide, and streptavidin or avidin binding to poly- or oligonucleotide containing biotinylated nucleotides.
  • the carrier can be formed by chemically linking the cell-specific binding agent and the oligonucleo ⁇ tide-binding agent.
  • the linkage is typically covalent.
  • a preferred linkage is a peptide bond. This can be formed with a water soluble carbodiimide as described by Jung, G. et al. (1981) Biochem. Biophys. Res. Cornmun. 101:599-606.
  • An alternative linkage is a disulfide bond.
  • the linkage reaction can be optimized for the particular cell-specific binding agent and oligonucleotide-binding agent used to form the carrier. Reaction conditions can be designed to maximize linkage formation but to minimize the formation of aggregates of the carrier components.
  • the optimal ratio of cell-specific binding agent to poly- or oligonucleotide-binding agent can be determined empirically. When polycations are used, the molar ratio of the components will vary with the size of the polycation and the size of the poly- or oligonucleotide.
  • the ratio can range from 2:1 to 1:2 by weight (asialoorosomucoid:oligonucleotide) can be used.
  • Uncoupled components and aggregates can be separated from the carrier by molecular sieve or ion exchange chromatography.
  • the conjugate is purified on a high pressure liquid cation exchange column (AquaporeTM cation-exchange, Rainin) with stepwise elution with 0.1 M sodium acetate, pH 5.0, 2.5, 2.25 and 2.0.
  • the poly- or oligonucleo ⁇ tide and carrier are mixed and incubated under conditions conducive to complexation.
  • the poly- or oligonucleotide and carrier can be mixed at the appropriate ratio in 2 M NaCl and the solution can be diluted to 0.15 M and filtered to provide an administrable composition.
  • the molecular complex can contain more than one copy of the nucleic acid strand.
  • the amount of poly- or oligonucleotide should not exceed that required to maintain solubility of the resulting complex.
  • the preferred weight or molar ratio of carrier to poly- or oligonucleotide for the construct employed can be determined by routine experimentation,
  • the molecular complex of this invention can be administered parenterally. Preferably, it is injected intravenously.
  • the complex is administered in solution in a physiologically acceptable vehicle.
  • the molecular complex of this invention can be used to target delivery of a wide range of poly- and oligonucleotide for specific hybridization usually to an RNA target.
  • the target can also be DNA by triplex formation.
  • the oligonucleotide can be directed against translation of a gene or genes of cellular origin (e.g., a cellular oncogene) or of noncellular origin (e.g., a viral oncogene or the genes of an infecting pathogen such as a virus or a parasite such as malaria, trypanosome, lysteria or mycoplasma) .
  • the antisense can be directed against transcription of target genes.
  • the method of this invention can be used to treat hepatitis infection.
  • the complex can be used to deliver an antisense oligo ⁇ deoxynucleotide specifically to liver cells to block production of hepatitis virus.
  • One strategy is to take advantage of the fact that, because of its compact nature, the human hepatitis B virus has only one polyadenylation signal (nucleotides 1903-1923) . The signal is common to all hepatitis B viral-derived mRNA and is different from the mammalian signal. As a result, antisense oligodeoxynucleotides comple ⁇ mentary to this region can block viral protein synthesis.
  • the antisense strand is complexed to a carrier comprising a ligand for the hepatic asialoglycoprotein receptor and a polycationic protein such as polylysine to provide a soluble molecular complex targetable to the liver.
  • the method of this invention can be used to alter the expression of a gene of cellular origin.
  • This method may be useful in the treatment of diseases characterized by abnormal biosynthesis, especially overexpression, of normal or abnormal cellular proteins.
  • a targetable, soluble DNA carrier was prepared by coupling asialoorosomucoid to poly L-lysine
  • a 21-mer oligodeoxynucleotide, complementary to a portion of the human hepatitis B virus (ayw subtype) (Hirschman, S.Z. et al. (1980) Proc. Natl. Acad. Sci. USA
  • nucleotides 1903-1923 See SEQUENCE ID NO. 1 - TTTATAAGGGTCGATGTCCAT) of the viral genome, was synthesized with phosphorothioate linkages on an automated nucleotide synthesizer (Applied Biosystems) (Matsukura, M. et al. (1987) Proc. Natl. Acad. Sci. USA 84:7705-7710). As a control, a random 21-mer sequence was prepared in an identical fashion. The purity of oligonucleotides was determined by electrophoresis through 15% polyacrylamide gels stained with ethidium bromide.
  • Antisense DNA was titrated with conjugate to form a soluble complex using an agarose gel retardation system as described previously (Wu, G.Y. and Wu, CH. (1987) J. Biol. Chem. 262:4429-4432) and a conjugate to DNA ratio of 1.6:1 by weight (asialoorosomucoid: DNA) was selected.
  • antisense DNA was end-labeled with 32 P (Sambrook, J. et al. (1989) Molecular Cloning - A Laboratory Manual, Cold Spring Harbor Laboratory, 2nd ed., vol. 2, pg. 11.31). DNA alone, or in the form of a complex was added to medium of HepG2 and SK Hepl cells to make 50 ⁇ M solutions with respect to added antisense DNA. Uptake was determined as described previously for asialoglycoproteins (Schwartz, A.L. et al. (1981) J. Biol. Chem. 256:8878-8881).
  • HepG2 2.2.15 cells were seeded six days pre-confluence and incubated at 37°C in medium containing antisense DNA alone, complexed antisense DNA, complexed random DNA, or medium alone. All media containing added DNA were initially 50 ⁇ M with respect to DNA. At daily intervals, 50 ⁇ l of medium was sampled and assayed for hepatitis B surface antigen by an ELISA (Abbott) method as described by the manufacturer, modified for quantitation using serially diluted standard surface antigen (CalBiochem) which produced a linear response within the range of antigen levels found in the samples. Cell number was determined by microscopic counting cells stained with trypan blue. All points were determined in triplicate and the results of four experiments are shown as means ⁇ SEM expressed as ⁇ g/ml/10 6 cells. Effect of Antisense DNA on Protein Secretion
  • HepG2 2.2.15 cells were incubated with 50 ⁇ M complexed DNA as described in Figure 2 except that 10 ⁇ Ci [ 35 S]-methionine (Amersham), specific activity 1000 Ci/mmole, was added to label newly synthesized proteins. After 24 hrs, medium was moved, cells washed with phosphate buffered saline and lysed with 1% sodium dodecyl sulfate which was subsequently removed with triton X-100. Both media and cell lysates were treated with a specific rabbit anti- surface antigen antibody (DAKO) and precipitated with protein-A sepharose (Sigma) . Precipitates were scintillation counted and each point assayed in triplicate. Total cell protein was determined by colorimetric assay (Bio-Rad) . The results of three experiments are shown as means ⁇ SEM expressed as cpm/mg cell protein.
  • HBV DNA was identified by Southern blot using an EcoRI-Bglll fragment of the HBV genome (nucleotide 0 to 1982) as a probe labeled with 32 P and exposed to x-ray film as described previously (Sambrook, J. et al. (1989) Molecular Cloning - A
  • FIG. 1 shows uptake of complexed antisense DNA by HepG2 and SK Hepl cells.
  • a targetable, soluble DNA carrier was prepared by coupling asialooroso ⁇ mucoid to poly L-lysine using a water soluble carbodiimide as described previously (Wu, G.Y.
  • Figure 2 shows the effect of complexed antisense DNA on hepatitis B virus surface antigen concentration in culture medium.
  • HepG2 2.2.15 cells were incubated at 37°C in medium containing antisense DNA alone, complexed antisense DNA, complexed random DNA, or medium alone. All media containing added DNA were initially 50 ⁇ M with respect to DNA.
  • medium was sampled and assayed for the presence of hepatitis B surface antigen by an ELISA (Abbott) method as described by the manufacturer, modified as described in Materials and Methods.
  • Cell number was determined by microscopically counting cells stained with trypan blue. All points were determined in triplicate and the results of four experiments are shown as means £ SEM expressed as ⁇ g/ml/10 6 cells.
  • Figure 2 shows that in untreated control cells, hepatitis B viral surface antigen steadily increased in concentration in their media, rising from 1 ⁇ g/ml/10 6 cells on the first day to 5.5 ⁇ g/ml/10 6 cells by the seventh day. Exposure of cells to antisense DNA alone had no significant effect until the 3rd day at which time surface antigen concen ⁇ tration was 30% lower than untreated controls. Nevertheless, surface antigen concentrations in the presence of antisense DNA alone continued to rise steadily throughout the 7 days of exposure. However, treatment with complexed antisense DNA resulted in an 80% inhibition after the 1st day and 95% inhibition by the 7th day compared to untreated controls. There was no significant increase in surface antigen concentration after the first 24 hrs. Complexed random DNA of the same size had no effect on antigen concentrations at any time point under identical conditions.
  • FIG. 3 shows Southern blots of DNA extracted from medium and cells after 24 hrs exposure to antisense DNA. Cells were incubated as described for Figure 2 with 50 ⁇ M antisense DNA alone, or in the form of complexes as described for Figure 2. After 24 hrs, medium was removed and DNA, extracted from the medium (Sells, M.A. et al. (1987) Proc. Natl. Acad. Sci. USA M 1005-1009) and from the cell layer (Hirt, B.J. (1967) Mol. Biol. 26:365-371).
  • Total cell protein was determined by colorimetric assay (Bio-Rad) .
  • DNA extracted from equal volumes of medium and from approximately equal numbers of cells were applied on an agarose gel, HBV DNA was identified by Southern blot using an EcoRI-Bglll fragment of the HBV genome as a probe labeled with 32 P and exposed to x-ray film (Sambrook, J. et al. (1989) Molecular Cloning - A
  • Figure 3 lanes 1 and 5 show that untreated cells produced bands at positions expected for relaxed circular and single-stranded linear viral replicative DNA forms. Other minor bands are present, at 2.3 kb for example, as described previously for this cell line (Sells, M.A. et al. (1987) Proc. Natl. Acad. Sci. USA rl005-1009) .
  • Lanes 2 and 6 show that treatment of cells with complexed antisense DNA decreased the amount of all viral DNA forms in the medium by approximately 80% compared to untreated cells (lanes 1 and 5).
  • Complexed random DNA lanes 3 and 7, had no detectable effect on the levels of HBV DNA under identical conditions.
  • Agrawal et al. administered infectious virus (HIV) together with antisense oligonucleotides in a non-targeted manner to cell media (Agrawal, S. et al. (1989) Proc. Natl.
  • hepatitis B virus in vivo, persistent production of hepatitis B virus is usually due to the presence of unintegrated viral DNA (Shafritz, D. et al. (1981) N. Eng. J. Med. 305:1067-1073). Integration of the viral genome into that of the host is usually associated with a cessation of production of complete viral particles (Ganem, D. (1982) Rev. Infect. Pis. 4:1026). Whether targeted antisense delivery can be effective in the presence of an infection generated by unintegrated viral DNA remains to be seen.
  • asialoglycoprotein uptake in hepatitis virus-infected HepG2 cells was found to be not substantially different from non-infected HepG2 cells (data not shown) , indicating that infection by the virus did not alter the receptor activity in these cells.
  • targeted delivery of antisense oligonucleotides may be generally applicable to naturally infected hepatocytes, that are otherwise normal, via asialoglycoprotein receptors. It should be noted that the oligonucleotides used in this current work were linked together by phosphorothioate bonds. These linkages are less susceptible to nuclease degradation than normal phosphodiester bonds.
  • Confluent 35mm dishes of 3T3-AsGR were treated with ⁇ l(I) antisense DNA alone (1.3 ⁇ M or 2.7 ⁇ M) or varying concentrations of antisense DNA complex (1.3 ⁇ M, 1.7 ⁇ M, or 2.7 ⁇ M antisense) for 12-16 hours (overnight) at 37°C in DMEM and 10% FBS.
  • the medium was removed and replaced with labeling medium containing 5 ⁇ Ci/ml of [ 3 H]-proline, 50 ⁇ g/ml
  • L-ascorbate L-ascorbate and varying concentrations of antisense DNA or complexes. Cells were incubated for 4 hours at 37°C in the labeling medium. Newly synthesized procollagens and other proteins were determined by bacterial collagenase digestion (Peterkofsky, B. and Diegelmann, Biochemistry 05 10.:988-994 (1971)) .
  • the labeling medium was removed and set aside.
  • Buffer containing protease inhibitors (.5 M Tris, pH 7.4, .4 mM NEM, .2 mM PMSF, 2.5 ⁇ i EDTA) was added to 0 the cell layer and the cell layer was removed and pooled with the supernatant. The entire mixture was homogenized using a Dounce homogenizer and ice cold TCA was added to a final concentration of 15%.
  • TCA precipitable proteins were digested with bacterial 5 collagenase (Form III, Advanced Biofactures, Lynbrook, NY) at 37°C for 2 hours followed by precipitation with TCA-tannic acid.
  • the collagenase-sensitive radioactivity in the supernatant was separated by centrifugation to measure newly synthesized 0 procollagen production.
  • the collagenase-resistant precipitated radioactivity was used to calculate non-collagenous protein production. All assays were normalized to equal numbers of cells.
  • Antisense DNA was titrated with conjugate to form a soluble complex using an agarose gel retardation system as described previously (Wu, G.Y. and Wu, CH. (1987) J. Biol. Chem. 262:4429-4432) and a conjugate to DNA ratio of 2:1 by weight (asialoorosomucoid-pplylysine (AsOR-PL) : DNA) was selected.
  • cells were incubated with [ 125 I]-AsOR at 37°C and at regular time intervals (0.5, 1, 2, or 4 hours), dishes were chilled to 4°C, washed three times with cold 10 mM EDTA-phosphate buffered saline and the cell layers solubilized with 0.1 NaOH and gamma counted.
  • RNA samples 60 ⁇ g were heat denatured in 50% formamide, 2x formaldehyde running buffer, 7% formaldehyde at 55°C for 15 minutes (Sambrook, J., et al. Molecular Cloning 7.43, (1989)). Samples were run on formaldehyde gels (1% agarose, 2.2 M formaldehyde) for 4 hours at 100 mvolts on ice. Molecular weight and control RNAs were stained in 0.1 ammonium acetate and 0.5 ⁇ g/ml ethidium bromide and photographed with a fluorescent ruler.
  • RNA was transferred onto a nitrocellulose filter under vacuum for one hour and cross-linked to the filter by exposure to ultraviolet irradiation using a Stratalinker. Conditions for prehybridization and hybridization were the same as in the slot blot studies.
  • the 3T3-ASGR cells do not normally possess asialoglycoprotein receptors, they were transfected with the asialoglycoprotein receptor genes and were found to have a Kg of 1.5 x 10 -9 M, a binding saturation with [ 125 I]-AsOR at 1.8 ⁇ g/ml, and an uptake rate of [ 12 5 ⁇ ]-AsOR of 1.8 pmole/million cells/hr.
  • the number of asialoglycoprotein receptors per cell was 250,000.
  • the 3T3-AsGR cells displayed a linear uptake of ⁇ l(I) antisense DNA-AsOR-PL complex up to 4 hours at a rate of 18.2 pmole of DNA/million cells/hr. In contrast, the rate of uptake of labeled ⁇ l(I) antisense DNA alone was 0.15 pmole DNA/million cells/hr. Uptake of AsOR in a 300x excess by weight competed with the uptake of ⁇ l(I) antisense DNA complex. Effect of ⁇ l(I) antisense DNA complex on collagen synthesis ⁇ l(I) antisense DNA complexes inhibited collagen production by 3T3-AsGR cells. This inhibition was specific for collagen production and was dependent on the concentration of ⁇ l(I) antisense DNA in the complex. This result is set forth in the following table.

Abstract

L'invention décrit des complexes moléculaires servant à cibler des oligonucléotides, tels que des oligonucléotides non codants ou des ribozymes, vers une cellule spécifique, de façon à bloquer l'expression d'un ou plusieurs gènes dans la cellule. Le poly- ou oligonucléotide mono-brin est mis en complexe avec un conjugué constitué par un agent de fixation spécifique à une cellule et par un agent de fixation du poly- ou oligonucléotide. L'agent de fixation spécifique à une cellule est spécifique pour une structure supérficielle cellulaire provoquant l'internalisation du complexe. Un exemple est représenté par le récepteur d'asialoglycoprotéine d'hépatocytes. L'agent de fixation du poly- ou oligodéoxynucléotide est un composé, tel qu'une protéine polycationique formant un complexe stable pour l'oligonucléotide dans des conditions extracellulaires et le libérant dans des conditions intracellulaires, de façon à s'hybridiser avec l'ARN cible. Le complexe moléculaire est stable et soluble dans des fluides physiologiques et peut s'utiliser pour introduire sélectivement des oligonucléotides non codants, des ribozymes ou d'autres oligonucléotides mono-brins dans une cellule, afin d'inhiber l'expression d'un gène à l'intérieur de ladite cellule. L'oligonucléotide peut être dirigé contre des gènes cellulaires (par exemple, des oncogènes cellulaires) ou des gènes d'origine non cellulaire (par exemple, des oncogènes viraux, des gènes d'un pathogène provoquant une infection).
PCT/US1992/007339 1991-09-05 1992-09-04 Apport cible de polynucleotides ou d'oligonucleotides a des cellules WO1993004701A1 (fr)

Priority Applications (4)

Application Number Priority Date Filing Date Title
EP92920863A EP0666923A1 (fr) 1991-09-05 1992-09-04 Apport cible de polynucleotides ou d'oligonucleotides a des cellules
AU26780/92A AU681997B2 (en) 1991-09-05 1992-09-04 Targeted delivery of poly- or oligonucleotides to cells
KR1019940700741A KR100252547B1 (ko) 1991-09-05 1992-09-04 폴리-또는 올리고누클레오티드의 세포로의 표적화된 전달
JP5505335A JPH07500820A (ja) 1991-09-05 1992-09-04 ポリヌクレオチド又はオリゴヌクレオチドの細胞への標的を定めた送達

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US75508391A 1991-09-05 1991-09-05
US07/755,083 1991-09-05
US78811991A 1991-11-04 1991-11-04
US07/788,119 1991-11-04
US86400392A 1992-04-03 1992-04-03
US07/864,003 1992-04-03

Publications (1)

Publication Number Publication Date
WO1993004701A1 true WO1993004701A1 (fr) 1993-03-18

Family

ID=27419474

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1992/007339 WO1993004701A1 (fr) 1991-09-05 1992-09-04 Apport cible de polynucleotides ou d'oligonucleotides a des cellules

Country Status (6)

Country Link
EP (1) EP0666923A1 (fr)
JP (1) JPH07500820A (fr)
KR (1) KR100252547B1 (fr)
AU (1) AU681997B2 (fr)
CA (1) CA2116107A1 (fr)
WO (1) WO1993004701A1 (fr)

Cited By (94)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993024640A2 (fr) * 1992-06-04 1993-12-09 The Regents Of The University Of California PROCEDES ET COMPOSITIONS UTILISES DANS UNE THERAPIE GENIQUE $i(IN VIVO)
WO1994013325A2 (fr) * 1992-12-15 1994-06-23 Microprobe Corporation Sequences de liaison peptidiques pour l'amelioration de l'apport d'oligonucleotides
WO1994023050A1 (fr) * 1993-04-05 1994-10-13 University Of Connecticut Apport cible de genes codant des polyribonucleotides antisens
WO1994023751A1 (fr) * 1993-04-14 1994-10-27 Boehringer Mannheim Gmbh Peptides de tranfert d'acides nucleiques et leur utilisation pour injecter des acides nucleiques dans des cellules eucaryotes
WO1995006129A2 (fr) * 1993-08-20 1995-03-02 Therexsys Limited Processus de transfection
WO1995019433A2 (fr) * 1994-01-12 1995-07-20 Targetech, Inc. Polynucleotides et oligonucleotides anti-hepatite b
WO1995022618A1 (fr) * 1994-02-22 1995-08-24 Dana-Farber Cancer Institute Systeme de liberation d'acide nucleique, son procede de synthese et ses utilisations
EP0674705A1 (fr) * 1992-11-09 1995-10-04 Thomas Jefferson University Oligonucleotides antisens utilises pour inhiber l'expression de genes de collagene ayant subis une mutation et de type sauvage
EP0681482A1 (fr) * 1993-01-22 1995-11-15 University Research Corporation Localisation d'agents therapeutiques
WO1995031566A1 (fr) * 1994-05-13 1995-11-23 Chiron Viagene, Inc. Compositions et procedes de ciblage de vecteurs d'apport de genes
FR2721612A1 (fr) * 1994-06-23 1995-12-29 Idm Nouveaux dérivés d'oligosides, leur procédé de préparation et leurs applications.
US5521291A (en) * 1991-09-30 1996-05-28 Boehringer Ingelheim International, Gmbh Conjugates for introducing nucleic acid into higher eucaryotic cells
WO1996021036A2 (fr) * 1994-12-30 1996-07-11 Chiron Viagene, Inc. Agents de concentration d'acide nucleique ayant une immunogenicite reduite
US5547932A (en) * 1991-09-30 1996-08-20 Boehringer Ingelheim International Gmbh Composition for introducing nucleic acid complexes into higher eucaryotic cells
US5623049A (en) * 1993-09-13 1997-04-22 Bayer Aktiengesellschaft Nucleic acid-binding oligomers possessing N-branching for therapy and diagnostics
EP0821001A1 (fr) * 1995-03-31 1998-01-28 Drug Delivery System Institute, Ltd. Derives d'amidite et derives d'oligonucleotides
US5728399A (en) * 1994-06-29 1998-03-17 University Of Conn. Use of a bacterial component to enhance targeted delivery of polynucleotides to cells
US5756353A (en) * 1991-12-17 1998-05-26 The Regents Of The University Of California Expression of cloned genes in the lung by aerosol-and liposome-based delivery
US5849893A (en) * 1993-09-13 1998-12-15 Bayer Aktiengesellschaft Nucleic acid-binding oligomers possessing C-branching for therapy and diagnostics
WO1998056938A1 (fr) * 1997-06-13 1998-12-17 Baylor College Of Medicine Lipoproteines utilisees comme vecteurs d'acide nucleique
US5858784A (en) * 1991-12-17 1999-01-12 The Regents Of The University Of California Expression of cloned genes in the lung by aerosol- and liposome-based delivery
US5889169A (en) * 1991-05-16 1999-03-30 Cold Spring Harbor Laboratory Cell cycle regulatory protein p16 gene
WO1999016883A2 (fr) 1997-10-01 1999-04-08 Dana-Farber Cancer Institute Stabilisation des glycoproteines trimeres d'enveloppe au moyen de liaisons bisulfure introduites dans un ectodomaine de la glycoproteine gp41
US5922859A (en) * 1992-02-01 1999-07-13 Boehringer Ingelheim International Gmbh Complexes containing nucleic acid which can be taken-up by endocytosis into higher eukaryotic cells
WO1999041273A2 (fr) * 1998-02-11 1999-08-19 Perkin-Elmer Corporation Conjugues d'anp et d'adn et procedes de preparation desdits conjugues
US5955571A (en) * 1994-08-08 1999-09-21 Bayer Aktiengesellschaft Nucleic acid-binding oligomers for therapy and diagnosis
US5962316A (en) * 1992-10-16 1999-10-05 Cold Spring Harbor Laboratory Cell-cycle regulatory proteins, and uses related thereto
US5981273A (en) * 1991-09-30 1999-11-09 Boehringer Ingelheim Int'l. Gmbh Composition comprising an endosomolytic agent for introducing nucleic acid complexes into higher eucaryotic cells
US6043030A (en) * 1992-12-17 2000-03-28 Cold Spring Harbor Laboratory Cell-cycle regulatory proteins, and uses related thereto
WO2000036131A1 (fr) * 1998-12-16 2000-06-22 november Aktiengesellschaft Gesellschaft für Molekulare Medizin Particule d'acide nucleique synthetique
US6162641A (en) * 1997-06-06 2000-12-19 The Regents Of The University Of Michigan Neuregulin response element and uses therefor
EP1083232A1 (fr) * 1999-09-09 2001-03-14 Jung, Günther, Prof. Dr. Transfert de mARN á l'aide de composés polycationiques
US6210892B1 (en) * 1998-10-07 2001-04-03 Isis Pharmaceuticals, Inc. Alteration of cellular behavior by antisense modulation of mRNA processing
US6211334B1 (en) 1992-10-16 2001-04-03 Cold Spring Harbor Cell-cycle regulatory proteins, and uses related thereto
US6271360B1 (en) 1999-08-27 2001-08-07 Valigen (Us), Inc. Single-stranded oligodeoxynucleotide mutational vectors
WO2001072765A1 (fr) * 2000-03-28 2001-10-04 Isis Pharmaceuticals, Inc. Modification de comportement cellulaire par modulation antisens de la maturation d'arn messager
US6306993B1 (en) 1997-05-21 2001-10-23 The Board Of Trustees Of The Leland Stanford, Jr. University Method and composition for enhancing transport across biological membranes
WO2001089579A2 (fr) * 2000-05-19 2001-11-29 Regents Of The University Of Minnesota Composition pour l'introduction de composes dans des cellules
US6331390B1 (en) 1992-12-17 2001-12-18 Cold Spring Harbor Laboratory Cell-cycle regulatory proteins, and uses related thereto
US6335436B1 (en) 1995-02-10 2002-01-01 Hybridon, Inc. Oligonucleotides active against drug-resistant bacteria
WO2002079447A2 (fr) 2001-03-30 2002-10-10 Avigenics, Inc. Promoteur de lysozymes aviaires
US6524613B1 (en) 1997-04-30 2003-02-25 Regents Of The University Of Minnesota Hepatocellular chimeraplasty
US6593292B1 (en) 1999-08-24 2003-07-15 Cellgate, Inc. Compositions and methods for enhancing drug delivery across and into epithelial tissues
US6627615B1 (en) 1991-12-17 2003-09-30 The Regents Of The University Of California Methods and compositions for in vivo gene therapy
US6669951B2 (en) 1999-08-24 2003-12-30 Cellgate, Inc. Compositions and methods for enhancing drug delivery across and into epithelial tissues
WO2004056308A2 (fr) 2002-11-26 2004-07-08 Protein Design Labs, Inc. Anticorps chimeriques et humanises diriges contre l'integrine $g(a)5$g(b)1 modulant l'angiogenese
US6806084B1 (en) 1992-06-04 2004-10-19 The Regents Of The University Of California Methods for compositions for in vivo gene delivery
US6875588B2 (en) 2001-11-30 2005-04-05 Avigenics, Inc. Ovomucoid promoter and methods of use
WO2005058937A2 (fr) 2003-12-12 2005-06-30 Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Epitope de lymphocyte t cytotoxique humain et son epitope agoniste issus du nombre non variable de sequences repetees en tandem de muc-1
US6984729B1 (en) * 1995-06-06 2006-01-10 Hybridon, Inc. Oligonucleotides specific for hepatitis B virus
WO2006043811A1 (fr) * 2004-10-21 2006-04-27 Synvolux Ip B.V. Vehicule destine au transport d’une molecule selectionnee vers une cellule
WO2006081331A2 (fr) 2005-01-25 2006-08-03 Prolexys Pharmaceuticals, Inc. Erastine et proteines de liaison d'erastine, et utilisations de celles-ci
US7135562B2 (en) 2002-03-14 2006-11-14 University Of Cincinnati Avian iFABP gene expression controlling region
US7148203B2 (en) 1997-03-11 2006-12-12 Regents Of The University Of Minnesota Nucleic acid transfer vector for the introduction of nucleic acid into the DNA of a cell
US7160682B2 (en) 1998-11-13 2007-01-09 Regents Of The University Of Minnesota Nucleic acid transfer vector for the introduction of nucleic acid into the DNA of a cell
US7176300B2 (en) 2001-03-30 2007-02-13 Avigenics, Inc. Avian lysozyme promoter
US7229961B2 (en) 1999-08-24 2007-06-12 Cellgate, Inc. Compositions and methods for enhancing drug delivery across and into ocular tissues
US7294507B2 (en) 2001-11-30 2007-11-13 Avigenics, Inc. Ovomucoid promoters and methods of use
US7335761B2 (en) 2001-11-30 2008-02-26 Avigenics, Inc. Avian gene expression controlling regions
US7541512B2 (en) 2001-03-30 2009-06-02 Synageva Biopharma Corp. Avians containing a lysozyme promoter transgene
US7550561B1 (en) 1991-05-16 2009-06-23 Cold Spring Harbor Laboratory p16INK4 polypeptides
US7550650B2 (en) 2001-09-18 2009-06-23 Synageva Biopharma Corp. Production of a transgenic avian by cytoplasmic injection
US7691632B2 (en) 1993-11-18 2010-04-06 Cold Spring Harbor Laboratory Kit for detecting the level of cyclin-dependent kinase inhibitor P16 gene expression
WO2010096388A2 (fr) 2009-02-18 2010-08-26 Carnegie Mellon University Colorants dendrimères désactivés pour détection de brillant
WO2010128407A2 (fr) 2009-05-05 2010-11-11 Novimmune S.A. Anticorps anti-il-17f et leurs méthodes d'utilisation
WO2011091272A1 (fr) 2010-01-21 2011-07-28 Dana-Farber Cancer Institute, Inc. Plate-forme de criblage génétique spécifique du contexte pour assister la découverte de gènes et la validation de cibles
WO2011150079A1 (fr) 2010-05-25 2011-12-01 Carnegie Mellon University Sondes ciblées de physiologie cellulaire
US8227432B2 (en) 2002-04-22 2012-07-24 Regents Of The University Of Minnesota Transposon system and methods of use
EP2629094A1 (fr) 2007-01-24 2013-08-21 Carnegie Mellon University Biocapteurs optiques
WO2013149111A2 (fr) 2012-03-29 2013-10-03 Novimmune S.A. Anticorps anti-tlr4 et utilisations de ceux-ci
WO2013166500A1 (fr) 2012-05-04 2013-11-07 Dana-Farber Cancer Institute, Inc. Anticorps anti-ccr4 monoclonaux humanisés maturés par affinité et leurs procédés d'utilisation
WO2014055897A2 (fr) 2012-10-04 2014-04-10 Dana-Farber Cancer Institute, Inc. Anticorps monoclonaux humains anti pd-l1 et procédés d'utilisation
WO2014087248A2 (fr) 2012-12-03 2014-06-12 Novimmune S.A. Anticorps anti-cd47 et leurs procédés d'utilisation
US8921050B2 (en) 2006-03-17 2014-12-30 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Methods of diagnosing renal cell carcinoma
WO2015143194A2 (fr) 2014-03-19 2015-09-24 Dana-Farber Cancer Institute, Inc. Restriction immunogénétique sur l'élicitation des anticorps
WO2015164865A1 (fr) 2014-04-25 2015-10-29 Dana-Farber Cancer Institute, Inc. Anticorps neutralisant le coronavirus du syndrome respiratoire du moyen-orient et procédés d'utilisation de ceux-ci
WO2015195917A1 (fr) 2014-06-18 2015-12-23 Mersana Therapeutics, Inc. Anticorps monoclonaux dirigés contre l'épitope her2 et procédés d'utilisation de ceux-ci
WO2016054638A1 (fr) 2014-10-03 2016-04-07 Dana-Farber Cancer Institute, Inc. Anticorps dirigés contre le récepteur du facteur de nécrose tumorale induit par glucocorticoïdes (gitr) et leurs procédés d'utilisation
WO2016057488A1 (fr) 2014-10-06 2016-04-14 Dana-Farber Cancer Institute, Inc. Anticorps humanisés anti-récepteur de la chimiokine cc4 (ccr4) et leurs procédés d'utilisation
WO2016081423A1 (fr) 2014-11-18 2016-05-26 Janssen Pharmaceutica Nv Anticorps anti-cd47, procédés et utilisations
EP3026432A2 (fr) 2010-12-27 2016-06-01 Brown University Procédé de prévision de la réponse du patient au traitement avec biglycan
US9597346B2 (en) 2010-01-15 2017-03-21 Cornell University Methods for reducing protein levels in a cell
WO2017136676A1 (fr) 2016-02-05 2017-08-10 Nanoview Diagnostics Inc. Détection d'exosomes ayant des marqueurs de surface
WO2017160754A1 (fr) 2016-03-15 2017-09-21 Mersana Therapeutics,Inc. Conjugués anticorps-médicament ciblant napi2b et leurs procédés d'utilisation
EP3252068A2 (fr) 2009-10-12 2017-12-06 Larry J. Smith Procédés et compositions permettant de moduler l'expression génique à l'aide de médicaments à base d'oligonucléotides administrés in vivo ou in vitro
WO2018018039A2 (fr) 2016-07-22 2018-01-25 Dana-Farber Cancer Institute, Inc. Anticorps dirigés contre le récepteur du facteur de nécrose tumorale induit par glucocorticoïdes (gitr) et leurs procédés d'utilisation
WO2018045379A1 (fr) 2016-09-02 2018-03-08 Dana-Farber Cancer Institute, Inc. Composition et méthodes de traitement des déreglements des lymphocytes b
WO2018049261A1 (fr) 2016-09-09 2018-03-15 Icellhealth Consulting Llc Virus oncolytique exprimant des modulateurs du point de contrôle immunitaire
WO2018048939A1 (fr) 2016-09-06 2018-03-15 Dana-Farber Cancer Institute, Inc. Procédés de traitement ou de prévention d'une infection par le virus zika
EP3327039A1 (fr) 2010-06-02 2018-05-30 Dana Farber Cancer Institute, Inc. Anticorps monoclonaux humanisés et méthodes d'utilisation
EP3333187A1 (fr) 2007-12-06 2018-06-13 Dana-Farber Cancer Institute, Inc. Anticorps dirigés contre le virus de la grippe et leurs procédés d'utilisation
EP3511344A1 (fr) 2004-12-10 2019-07-17 NovImmune S.A. Anticorps neutralisants et leurs procédés d'utilisation
WO2019175658A1 (fr) 2018-03-14 2019-09-19 Novimmune Sa Anticorps anti-cd3 epsilon et leurs procédés d'utilisation
US10434177B2 (en) 2014-11-17 2019-10-08 Carnegie Mellon University Activatable two-component photosensitizers

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
Journal of Biological Chemistry, Volume 264, No. 29, issued 15 October 1989, WU et al., "Targeting Genes: Delivery and Persistent Expression of a Foreign Gene Driven by Mammalian Regulatory Elements in Vivo", pages 16985-16987, see entire article. *
Proceedings of the National Academy of Sciences, Volume 77, No. 9, issued September 1980, HIRSCHMAN et al., "Expression of Cloned Hepatitis B Virus DNA in Human Cell Cultures", pages 5507-5511, see entire article. *
Proceedings of the National Academy of Sciences, Volume 84, issued February 1987, LEMAITRE et al., "Specific Antiviral Activity of a Poly (L-Lysine)-Conjugated Oligodeoxyribonucleotide Sequence Complementary to Vesicular Stomatitis Virus N Protein mRNA Initiation Site", pages 648-652, see entire article. *
Proceedings of the National Academy of Sciences, Volume 87, issued May 1990, WAGNER et al., "Transferrin-Polycation Conjugates as Carriers for DNA Uptake Into Cells", pages 3410-3414, see entire article. *
See also references of EP0666923A4 *

Cited By (148)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7550561B1 (en) 1991-05-16 2009-06-23 Cold Spring Harbor Laboratory p16INK4 polypeptides
US5889169A (en) * 1991-05-16 1999-03-30 Cold Spring Harbor Laboratory Cell cycle regulatory protein p16 gene
US6022735A (en) * 1991-09-30 2000-02-08 Boehringer Ingelheim International Gmbh Composition for introducing nucleic acid complexes into higher eucaryotic cells
US6274322B1 (en) 1991-09-30 2001-08-14 Boehringer Ingelheim International Gmbh Composition for introducing nucleic acid complexes into higher eucaryotic cells
US5547932A (en) * 1991-09-30 1996-08-20 Boehringer Ingelheim International Gmbh Composition for introducing nucleic acid complexes into higher eucaryotic cells
US5981273A (en) * 1991-09-30 1999-11-09 Boehringer Ingelheim Int'l. Gmbh Composition comprising an endosomolytic agent for introducing nucleic acid complexes into higher eucaryotic cells
US5521291A (en) * 1991-09-30 1996-05-28 Boehringer Ingelheim International, Gmbh Conjugates for introducing nucleic acid into higher eucaryotic cells
US5858784A (en) * 1991-12-17 1999-01-12 The Regents Of The University Of California Expression of cloned genes in the lung by aerosol- and liposome-based delivery
US6627615B1 (en) 1991-12-17 2003-09-30 The Regents Of The University Of California Methods and compositions for in vivo gene therapy
US5756353A (en) * 1991-12-17 1998-05-26 The Regents Of The University Of California Expression of cloned genes in the lung by aerosol-and liposome-based delivery
US6468798B1 (en) 1991-12-17 2002-10-22 The Regents Of The University Of California Expression of cloned genes in the lung by aerosol and liposome-based delivery
US5922859A (en) * 1992-02-01 1999-07-13 Boehringer Ingelheim International Gmbh Complexes containing nucleic acid which can be taken-up by endocytosis into higher eukaryotic cells
US6806084B1 (en) 1992-06-04 2004-10-19 The Regents Of The University Of California Methods for compositions for in vivo gene delivery
WO1993025673A1 (fr) * 1992-06-04 1993-12-23 The Regents Of The University Of California Therapie genique in vivo a l'aide d'une sequence significative sans intron
WO1993024640A2 (fr) * 1992-06-04 1993-12-09 The Regents Of The University Of California PROCEDES ET COMPOSITIONS UTILISES DANS UNE THERAPIE GENIQUE $i(IN VIVO)
WO1993024640A3 (fr) * 1992-06-04 1994-04-28 Univ California PROCEDES ET COMPOSITIONS UTILISES DANS UNE THERAPIE GENIQUE $i(IN VIVO)
US5827703A (en) * 1992-06-04 1998-10-27 The Regents Of The University Of California Methods and composition for in vivo gene therapy
US6211334B1 (en) 1992-10-16 2001-04-03 Cold Spring Harbor Cell-cycle regulatory proteins, and uses related thereto
US5962316A (en) * 1992-10-16 1999-10-05 Cold Spring Harbor Laboratory Cell-cycle regulatory proteins, and uses related thereto
US5968821A (en) * 1992-10-16 1999-10-19 Cold Spring Harbor Laboratories, Inc. Cell-cycle regulatory proteins, and uses related thereto
US7425617B2 (en) 1992-10-16 2008-09-16 Cold Spring Harbor Laboratory Antibodies to the cell cycle regulatory protein p16
US6486131B2 (en) 1992-10-16 2002-11-26 Cold Spring Harbor Laboratory Cell-cycle regulatory proteins, and uses related thereto
EP0674705A4 (fr) * 1992-11-09 1997-11-26 Univ Jefferson Oligonucleotides antisens utilises pour inhiber l'expression de genes de collagene ayant subis une mutation et de type sauvage.
EP0674705A1 (fr) * 1992-11-09 1995-10-04 Thomas Jefferson University Oligonucleotides antisens utilises pour inhiber l'expression de genes de collagene ayant subis une mutation et de type sauvage
WO1994013325A3 (fr) * 1992-12-15 1994-10-13 Microprobe Corp Sequences de liaison peptidiques pour l'amelioration de l'apport d'oligonucleotides
US5574142A (en) * 1992-12-15 1996-11-12 Microprobe Corporation Peptide linkers for improved oligonucleotide delivery
WO1994013325A2 (fr) * 1992-12-15 1994-06-23 Microprobe Corporation Sequences de liaison peptidiques pour l'amelioration de l'apport d'oligonucleotides
US6043030A (en) * 1992-12-17 2000-03-28 Cold Spring Harbor Laboratory Cell-cycle regulatory proteins, and uses related thereto
US6331390B1 (en) 1992-12-17 2001-12-18 Cold Spring Harbor Laboratory Cell-cycle regulatory proteins, and uses related thereto
EP0681482A4 (fr) * 1993-01-22 1998-07-01 Univ Research Corp Localisation d'agents therapeutiques.
EP0681482A1 (fr) * 1993-01-22 1995-11-15 University Research Corporation Localisation d'agents therapeutiques
WO1994023050A1 (fr) * 1993-04-05 1994-10-13 University Of Connecticut Apport cible de genes codant des polyribonucleotides antisens
AU686614B2 (en) * 1993-04-05 1998-02-12 Targetech, Inc Targeted delivery of genes encoding antisense polyribonucleotides
WO1994023751A1 (fr) * 1993-04-14 1994-10-27 Boehringer Mannheim Gmbh Peptides de tranfert d'acides nucleiques et leur utilisation pour injecter des acides nucleiques dans des cellules eucaryotes
WO1995006129A2 (fr) * 1993-08-20 1995-03-02 Therexsys Limited Processus de transfection
WO1995006129A3 (fr) * 1993-08-20 1995-06-15 Therexsys Ltd Processus de transfection
US5766902A (en) * 1993-08-20 1998-06-16 Therexsys Limited Transfection process
US5849893A (en) * 1993-09-13 1998-12-15 Bayer Aktiengesellschaft Nucleic acid-binding oligomers possessing C-branching for therapy and diagnostics
US5623049A (en) * 1993-09-13 1997-04-22 Bayer Aktiengesellschaft Nucleic acid-binding oligomers possessing N-branching for therapy and diagnostics
US7691632B2 (en) 1993-11-18 2010-04-06 Cold Spring Harbor Laboratory Kit for detecting the level of cyclin-dependent kinase inhibitor P16 gene expression
WO1995019433A2 (fr) * 1994-01-12 1995-07-20 Targetech, Inc. Polynucleotides et oligonucleotides anti-hepatite b
AU704562C (en) * 1994-01-12 2007-08-23 Targetech, Incorporated, A Wholly Owned Subsidiary Of The Immune Response Corporation Anti-hepatitis B poly- and oligonucleotides
AU704562B2 (en) * 1994-01-12 1999-04-29 Targetech, Incorporated, A Wholly Owned Subsidiary Of The Immune Response Corporation Anti-hepatitis B poly- and oligonucleotides
WO1995019433A3 (fr) * 1994-01-12 1995-10-19 Targetech Inc Polynucleotides et oligonucleotides anti-hepatite b
US7186697B2 (en) 1994-02-22 2007-03-06 Dana-Farber Cancer Institute Nucleic acid delivery system, methods of synthesis and use thereof
WO1995022618A1 (fr) * 1994-02-22 1995-08-24 Dana-Farber Cancer Institute Systeme de liberation d'acide nucleique, son procede de synthese et ses utilisations
WO1995031566A1 (fr) * 1994-05-13 1995-11-23 Chiron Viagene, Inc. Compositions et procedes de ciblage de vecteurs d'apport de genes
WO1996000229A1 (fr) * 1994-06-23 1996-01-04 I.D.M. Immuno-Designed Molecules Nouveaux derives d'oligosides, leur procede de preparation et leurs applications
FR2721612A1 (fr) * 1994-06-23 1995-12-29 Idm Nouveaux dérivés d'oligosides, leur procédé de préparation et leurs applications.
US6251858B1 (en) 1994-06-23 2001-06-26 I.D.M. Immuno-Designed Molecules Derivatives of oligosides, their process of preparation and their applications
US5728399A (en) * 1994-06-29 1998-03-17 University Of Conn. Use of a bacterial component to enhance targeted delivery of polynucleotides to cells
US5955571A (en) * 1994-08-08 1999-09-21 Bayer Aktiengesellschaft Nucleic acid-binding oligomers for therapy and diagnosis
WO1996021036A3 (fr) * 1994-12-30 1996-09-06 Viagene Inc Agents de concentration d'acide nucleique ayant une immunogenicite reduite
WO1996021036A2 (fr) * 1994-12-30 1996-07-11 Chiron Viagene, Inc. Agents de concentration d'acide nucleique ayant une immunogenicite reduite
US6335436B1 (en) 1995-02-10 2002-01-01 Hybridon, Inc. Oligonucleotides active against drug-resistant bacteria
EP0821001A1 (fr) * 1995-03-31 1998-01-28 Drug Delivery System Institute, Ltd. Derives d'amidite et derives d'oligonucleotides
EP0821001A4 (fr) * 1995-03-31 2002-07-17 Drug Delivery System Inst Ltd Derives d'amidite et derives d'oligonucleotides
US6984729B1 (en) * 1995-06-06 2006-01-10 Hybridon, Inc. Oligonucleotides specific for hepatitis B virus
US7148203B2 (en) 1997-03-11 2006-12-12 Regents Of The University Of Minnesota Nucleic acid transfer vector for the introduction of nucleic acid into the DNA of a cell
US6524613B1 (en) 1997-04-30 2003-02-25 Regents Of The University Of Minnesota Hepatocellular chimeraplasty
US6306993B1 (en) 1997-05-21 2001-10-23 The Board Of Trustees Of The Leland Stanford, Jr. University Method and composition for enhancing transport across biological membranes
US6495663B1 (en) 1997-05-21 2002-12-17 The Board Of Trustees Of The Leland Stanford Junior University Method and composition for enhancing transport across biological membranes
US6162641A (en) * 1997-06-06 2000-12-19 The Regents Of The University Of Michigan Neuregulin response element and uses therefor
US6635623B1 (en) 1997-06-13 2003-10-21 Baylor College Of Medicine Lipoproteins as nucleic acid vectors
WO1998056938A1 (fr) * 1997-06-13 1998-12-17 Baylor College Of Medicine Lipoproteines utilisees comme vecteurs d'acide nucleique
WO1999016883A2 (fr) 1997-10-01 1999-04-08 Dana-Farber Cancer Institute Stabilisation des glycoproteines trimeres d'enveloppe au moyen de liaisons bisulfure introduites dans un ectodomaine de la glycoproteine gp41
US6197513B1 (en) 1998-02-11 2001-03-06 Pe Corporation PNA and DNA conjugates and methods for preparation thereof
WO1999041273A2 (fr) * 1998-02-11 1999-08-19 Perkin-Elmer Corporation Conjugues d'anp et d'adn et procedes de preparation desdits conjugues
WO1999041273A3 (fr) * 1998-02-11 1999-09-23 Perkin Elmer Corp Conjugues d'anp et d'adn et procedes de preparation desdits conjugues
US6210892B1 (en) * 1998-10-07 2001-04-03 Isis Pharmaceuticals, Inc. Alteration of cellular behavior by antisense modulation of mRNA processing
US7160682B2 (en) 1998-11-13 2007-01-09 Regents Of The University Of Minnesota Nucleic acid transfer vector for the introduction of nucleic acid into the DNA of a cell
DE19858005B4 (de) * 1998-12-16 2007-02-08 november Aktiengesellschaft, Gesellschaft für Molekulare Medizin Synthetisches Nucleinsäure-Partikel
WO2000036131A1 (fr) * 1998-12-16 2000-06-22 november Aktiengesellschaft Gesellschaft für Molekulare Medizin Particule d'acide nucleique synthetique
US8729010B2 (en) 1999-08-24 2014-05-20 Kai Pharmaceuticals, Inc. Compositions and methods for enhancing drug delivery across and into ocular tissues
US6759387B2 (en) 1999-08-24 2004-07-06 Cellgate, Inc. Compositions and methods for enhancing drug delivery across and into epithelial tissues
US7229961B2 (en) 1999-08-24 2007-06-12 Cellgate, Inc. Compositions and methods for enhancing drug delivery across and into ocular tissues
US8623833B2 (en) 1999-08-24 2014-01-07 Kai Pharmaceuticals, Inc. Compositions and methods for enhancing drug delivery across and into epithelial tissues
US6669951B2 (en) 1999-08-24 2003-12-30 Cellgate, Inc. Compositions and methods for enhancing drug delivery across and into epithelial tissues
US8278264B2 (en) 1999-08-24 2012-10-02 Kai Pharmaceuticals, Inc. Compositions and methods for enhancing drug delivery across and into ocular tissues
US6593292B1 (en) 1999-08-24 2003-07-15 Cellgate, Inc. Compositions and methods for enhancing drug delivery across and into epithelial tissues
US7060500B2 (en) 1999-08-27 2006-06-13 Metz Richard A Single-stranded oligodeoxynucleotide mutational vectors
US6479292B1 (en) 1999-08-27 2002-11-12 Valigen (Us), Inc. Genetic alteration in plants using single-stranded oligodeoxynucleotide vectors
EP2324856A1 (fr) 1999-08-27 2011-05-25 Valigen (US), Inc. Vecteurs mutationnels d'oligodeoxynucleotides à brin simple
EP2266627A1 (fr) 1999-08-27 2010-12-29 Valigen (US), Inc. Vecteurs mutationnels à oligonucléotides à brin simple.
US6271360B1 (en) 1999-08-27 2001-08-07 Valigen (Us), Inc. Single-stranded oligodeoxynucleotide mutational vectors
EP1083232A1 (fr) * 1999-09-09 2001-03-14 Jung, Günther, Prof. Dr. Transfert de mARN á l'aide de composés polycationiques
WO2001072765A1 (fr) * 2000-03-28 2001-10-04 Isis Pharmaceuticals, Inc. Modification de comportement cellulaire par modulation antisens de la maturation d'arn messager
WO2001089579A2 (fr) * 2000-05-19 2001-11-29 Regents Of The University Of Minnesota Composition pour l'introduction de composes dans des cellules
WO2001089579A3 (fr) * 2000-05-19 2002-08-29 Univ Minnesota Composition pour l'introduction de composes dans des cellules
US7199279B2 (en) 2001-03-30 2007-04-03 Avigenics, Inc. Recombinant promoters in avian cells
WO2002079447A2 (fr) 2001-03-30 2002-10-10 Avigenics, Inc. Promoteur de lysozymes aviaires
US7176300B2 (en) 2001-03-30 2007-02-13 Avigenics, Inc. Avian lysozyme promoter
US7541512B2 (en) 2001-03-30 2009-06-02 Synageva Biopharma Corp. Avians containing a lysozyme promoter transgene
US7550650B2 (en) 2001-09-18 2009-06-23 Synageva Biopharma Corp. Production of a transgenic avian by cytoplasmic injection
US6875588B2 (en) 2001-11-30 2005-04-05 Avigenics, Inc. Ovomucoid promoter and methods of use
US7375258B2 (en) 2001-11-30 2008-05-20 Avigenics, Inc. Transgenic avians with an ovomucoid gene expression control region linked to a nucleotide sequence encoding a heterologous polypeptide
US7335761B2 (en) 2001-11-30 2008-02-26 Avigenics, Inc. Avian gene expression controlling regions
US7294507B2 (en) 2001-11-30 2007-11-13 Avigenics, Inc. Ovomucoid promoters and methods of use
US7812215B2 (en) 2001-11-30 2010-10-12 Synageva Biopharma Corp. Methods and protein production using ovomucoid promoters
US7507873B2 (en) 2001-11-30 2009-03-24 Avigenics, Inc. Transgenic avians containing recombinant ovomucoid promoters
US7135562B2 (en) 2002-03-14 2006-11-14 University Of Cincinnati Avian iFABP gene expression controlling region
US8227432B2 (en) 2002-04-22 2012-07-24 Regents Of The University Of Minnesota Transposon system and methods of use
EP2351583A1 (fr) 2002-11-26 2011-08-03 Facet Biotech Corporation Anticorps chimériques et humanisés pour intégrine alpha5 béta1 permettant de moduler l'angiogénèse
WO2004056308A2 (fr) 2002-11-26 2004-07-08 Protein Design Labs, Inc. Anticorps chimeriques et humanises diriges contre l'integrine $g(a)5$g(b)1 modulant l'angiogenese
WO2005058937A2 (fr) 2003-12-12 2005-06-30 Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Epitope de lymphocyte t cytotoxique humain et son epitope agoniste issus du nombre non variable de sequences repetees en tandem de muc-1
WO2006043811A1 (fr) * 2004-10-21 2006-04-27 Synvolux Ip B.V. Vehicule destine au transport d’une molecule selectionnee vers une cellule
EP3511344A1 (fr) 2004-12-10 2019-07-17 NovImmune S.A. Anticorps neutralisants et leurs procédés d'utilisation
WO2006081331A2 (fr) 2005-01-25 2006-08-03 Prolexys Pharmaceuticals, Inc. Erastine et proteines de liaison d'erastine, et utilisations de celles-ci
US10214726B2 (en) 2006-03-17 2019-02-26 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Compositions and methods for prevention or treatment of neoplastic disease in a mammalian subject
US9856453B2 (en) 2006-03-17 2018-01-02 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Compositions and methods for prevention or treatment of neoplastic disease in a mammalian subject
US10557118B2 (en) 2006-03-17 2020-02-11 The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Compositions and methods for prevention or treatment of neoplastic disease in a mammalian subject
US8921050B2 (en) 2006-03-17 2014-12-30 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Methods of diagnosing renal cell carcinoma
EP2629094A1 (fr) 2007-01-24 2013-08-21 Carnegie Mellon University Biocapteurs optiques
EP3333187A1 (fr) 2007-12-06 2018-06-13 Dana-Farber Cancer Institute, Inc. Anticorps dirigés contre le virus de la grippe et leurs procédés d'utilisation
EP3524619A1 (fr) 2007-12-06 2019-08-14 Dana-Farber Cancer Institute, Inc. Anticorps dirigés contre le virus de la grippe et leurs procédés d'utilisation
WO2010096388A2 (fr) 2009-02-18 2010-08-26 Carnegie Mellon University Colorants dendrimères désactivés pour détection de brillant
US9249306B2 (en) 2009-02-18 2016-02-02 Carnegie Mellon University Quenched dendrimeric dyes for florescence detection
WO2010128407A2 (fr) 2009-05-05 2010-11-11 Novimmune S.A. Anticorps anti-il-17f et leurs méthodes d'utilisation
EP4089169A1 (fr) 2009-10-12 2022-11-16 Larry J. Smith Procédés et compositions permettant de moduler l'expression génique à l'aide de médicaments à base d'oligonucléotides administrés in vivo ou in vitro
EP3252068A2 (fr) 2009-10-12 2017-12-06 Larry J. Smith Procédés et compositions permettant de moduler l'expression génique à l'aide de médicaments à base d'oligonucléotides administrés in vivo ou in vitro
US9597346B2 (en) 2010-01-15 2017-03-21 Cornell University Methods for reducing protein levels in a cell
WO2011091272A1 (fr) 2010-01-21 2011-07-28 Dana-Farber Cancer Institute, Inc. Plate-forme de criblage génétique spécifique du contexte pour assister la découverte de gènes et la validation de cibles
WO2011150079A1 (fr) 2010-05-25 2011-12-01 Carnegie Mellon University Sondes ciblées de physiologie cellulaire
US9995679B2 (en) 2010-05-25 2018-06-12 Carnegie Mellon University Targeted probes of cellular physiology
EP3327039A1 (fr) 2010-06-02 2018-05-30 Dana Farber Cancer Institute, Inc. Anticorps monoclonaux humanisés et méthodes d'utilisation
EP3026432A2 (fr) 2010-12-27 2016-06-01 Brown University Procédé de prévision de la réponse du patient au traitement avec biglycan
WO2013149111A2 (fr) 2012-03-29 2013-10-03 Novimmune S.A. Anticorps anti-tlr4 et utilisations de ceux-ci
EP3511343A1 (fr) 2012-05-04 2019-07-17 Dana Farber Cancer Institute, Inc. Anticorps anti-ccr4 monoclonaux humanisés maturés par affinité et leurs procédés d'utilisation
WO2013166500A1 (fr) 2012-05-04 2013-11-07 Dana-Farber Cancer Institute, Inc. Anticorps anti-ccr4 monoclonaux humanisés maturés par affinité et leurs procédés d'utilisation
WO2014055897A2 (fr) 2012-10-04 2014-04-10 Dana-Farber Cancer Institute, Inc. Anticorps monoclonaux humains anti pd-l1 et procédés d'utilisation
WO2014087248A2 (fr) 2012-12-03 2014-06-12 Novimmune S.A. Anticorps anti-cd47 et leurs procédés d'utilisation
WO2015143194A2 (fr) 2014-03-19 2015-09-24 Dana-Farber Cancer Institute, Inc. Restriction immunogénétique sur l'élicitation des anticorps
WO2015164865A1 (fr) 2014-04-25 2015-10-29 Dana-Farber Cancer Institute, Inc. Anticorps neutralisant le coronavirus du syndrome respiratoire du moyen-orient et procédés d'utilisation de ceux-ci
WO2015195917A1 (fr) 2014-06-18 2015-12-23 Mersana Therapeutics, Inc. Anticorps monoclonaux dirigés contre l'épitope her2 et procédés d'utilisation de ceux-ci
WO2016054638A1 (fr) 2014-10-03 2016-04-07 Dana-Farber Cancer Institute, Inc. Anticorps dirigés contre le récepteur du facteur de nécrose tumorale induit par glucocorticoïdes (gitr) et leurs procédés d'utilisation
WO2016057488A1 (fr) 2014-10-06 2016-04-14 Dana-Farber Cancer Institute, Inc. Anticorps humanisés anti-récepteur de la chimiokine cc4 (ccr4) et leurs procédés d'utilisation
EP3699196A1 (fr) 2014-10-06 2020-08-26 Dana Farber Cancer Institute, Inc. Anticorps humanisés dirigés contre récepteur 4 des chimiokines cc (ccr4) et leurs procédés d'utilisation
US10434177B2 (en) 2014-11-17 2019-10-08 Carnegie Mellon University Activatable two-component photosensitizers
US10946098B2 (en) 2014-11-17 2021-03-16 Carnegie Mellon University Activatable two-component photosensitizers
WO2016081423A1 (fr) 2014-11-18 2016-05-26 Janssen Pharmaceutica Nv Anticorps anti-cd47, procédés et utilisations
WO2017136676A1 (fr) 2016-02-05 2017-08-10 Nanoview Diagnostics Inc. Détection d'exosomes ayant des marqueurs de surface
WO2017160754A1 (fr) 2016-03-15 2017-09-21 Mersana Therapeutics,Inc. Conjugués anticorps-médicament ciblant napi2b et leurs procédés d'utilisation
WO2018018039A2 (fr) 2016-07-22 2018-01-25 Dana-Farber Cancer Institute, Inc. Anticorps dirigés contre le récepteur du facteur de nécrose tumorale induit par glucocorticoïdes (gitr) et leurs procédés d'utilisation
WO2018045379A1 (fr) 2016-09-02 2018-03-08 Dana-Farber Cancer Institute, Inc. Composition et méthodes de traitement des déreglements des lymphocytes b
WO2018048939A1 (fr) 2016-09-06 2018-03-15 Dana-Farber Cancer Institute, Inc. Procédés de traitement ou de prévention d'une infection par le virus zika
WO2018049248A1 (fr) 2016-09-09 2018-03-15 Icellhealth Consulting Llc Virus oncolytique équipé de molécules d'engagement bispécifiques
WO2018049261A1 (fr) 2016-09-09 2018-03-15 Icellhealth Consulting Llc Virus oncolytique exprimant des modulateurs du point de contrôle immunitaire
WO2019175658A1 (fr) 2018-03-14 2019-09-19 Novimmune Sa Anticorps anti-cd3 epsilon et leurs procédés d'utilisation

Also Published As

Publication number Publication date
CA2116107A1 (fr) 1993-03-18
EP0666923A4 (fr) 1995-01-20
JPH07500820A (ja) 1995-01-26
EP0666923A1 (fr) 1995-08-16
KR100252547B1 (ko) 2000-09-01
AU2678092A (en) 1993-04-05
AU681997B2 (en) 1997-09-18

Similar Documents

Publication Publication Date Title
US6030954A (en) Targeted delivery of poly- or oligonucleotides to cells
AU681997B2 (en) Targeted delivery of poly- or oligonucleotides to cells
EP0894129B1 (fr) Sequence guides externes courtes
Wu et al. Specific inhibition of hepatitis B viral gene expression in vitro by targeted antisense oligonucleotides.
CA2210353C (fr) Sequences guides externes stabilisees
Kumasaka et al. Role of the intercellular adhesion molecule-1 (ICAM-1) in endotoxin-induced pneumonia evaluated using ICAM-1 antisense oligonucleotides, anti-ICAM-1 monoclonal antibodies, and ICAM-1 mutant mice.
AU704562C (en) Anti-hepatitis B poly- and oligonucleotides
AU2006261732B2 (en) RNAi modulation of HIF-1 and theraputic uses thereof
CN107849567A (zh) 一种siRNA、含有该siRNA的药物组合物和缀合物及它们的应用
US5843770A (en) Antisense constructs directed against viral post-transcriptional regulatory sequences
JP2018511307A (ja) Ｔｍｐｒｓｓ６発現を調節するための化合物及び方法
CA2164288A1 (fr) Methode pour traiter le sarcome de kaposi a l'aide d'oligonucleotides antisens
CA2205075C (fr) Reactif et methode d'inhibition de l'expression de n-ras
CN103333890A (zh) 治疗乙型病毒性肝炎的rna干扰制剂
WO2003008628A2 (fr) Conjugues a peptides d'acide nucleique enzymatique
US20020102694A1 (en) Nucleozymes with endonuclease activity
AU686614B2 (en) Targeted delivery of genes encoding antisense polyribonucleotides
EP4273245A1 (fr) Acide nucléique, composition et conjugué d'arnsi contenant un acide nucléique, procédé de préparation et utilisation associés
WO2023116607A1 (fr) Acide nucléique, composition et conjugué contenant un acide nucléique, procédé de préparation et utilisation associés
CA2191192A1 (fr) Utilisation de phosphorothioate oligonucleotidique pour la depletion du complement et la reduction de la pression sanguine
JP3150609B2 (ja) 癌治療用アンチセンスオリゴヌクレオチド
WO2005007854A2 (fr) Compositions polycationiques destinees a l'administration cellulaire de polynucleotides

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AT AU BB BG BR CA CH CS DE DK ES FI GB HU JP KP KR LK LU MG MN MW NL NO PL RO RU SD SE

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL SE BF BJ CF CG CI CM GA GN ML MR SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2116107

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 1992920863

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 1992920863

Country of ref document: EP

WWR Wipo information: refused in national office

Ref document number: 1992920863

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1992920863

Country of ref document: EP