WO1993000445A1 - Detection moleculaire de deletions de genes - Google Patents

Detection moleculaire de deletions de genes Download PDF

Info

Publication number
WO1993000445A1
WO1993000445A1 PCT/US1992/004764 US9204764W WO9300445A1 WO 1993000445 A1 WO1993000445 A1 WO 1993000445A1 US 9204764 W US9204764 W US 9204764W WO 9300445 A1 WO9300445 A1 WO 9300445A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
fragments
homologous regions
deletion
fusion
Prior art date
Application number
PCT/US1992/004764
Other languages
English (en)
Inventor
John A. Phillips, Iii
Cindy L. Vnencak-Jones
Original Assignee
Vanderbilt University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Vanderbilt University filed Critical Vanderbilt University
Publication of WO1993000445A1 publication Critical patent/WO1993000445A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
    • C12Q1/683—Hybridisation assays for detection of mutation or polymorphism involving restriction enzymes, e.g. restriction fragment length polymorphism [RFLP]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6853—Nucleic acid amplification reactions using modified primers or templates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • This invention relates to a method of detecting gene deletions and primers used with the method. More specifically, the present invention can be used for the detection of growth hormone gene deletions, such information being used to identify families at risk for recurrence of growth hormone deficiency as well as providing more accurate estimates of the risk for affected individuals to develop immune intolerance to treatment with exogenous growth hormone.
  • the Saiki et al patent further relates to a method for detecting polymorphic restriction sites and nucleic acid sequences. Each method utilizes probes, nucleic acid being hybridized to the probe.
  • the Saiki et al patent utilizes subsequent digestion with restriction enzymes that cleave those oligomers that have hybridized the nucleic acid and reform the restriction site. The resulting cut and uncut labeled oligomers are separated and detected based on the type of probe label.
  • the previously mentioned patents relate to amplification of nucleic acid sequences but do not at all relate to situations where the nucleic acid may be in the form of fusion fragments.
  • the present invention provides a process for detecting gene deletions in the form of fusion fragments and primers which can be used in the process.
  • the present invention relates to the detection of gene deletions in specific forms of genomic DNA not addressed by the prior art. For example, the deletion of a structural enzyme for the systemic manufacture of growth hormone results in a fusion fragment which can be detected pursuant to the present invention.
  • Human growth hormone deficiency has a prevalence of between 1 in 4,000 and 1 in 15,000 and 5% to 30% of the cases are estimated to be familial (1,2).
  • the molecular basis of one Mendelian form, isolated growth hormone deficiency type 1A (IGHD1A) results from the deletion of the structural gene for growth hormone (GH1) (3) .
  • IGHD1A isolated growth hormone deficiency type 1A
  • GH1 structural gene for growth hormone
  • the polymerase chain reaction amplification technique provides an alternative to Southern blotting for the identification of a growing number of genetic disorders.
  • applicant has developed a rapid method utilizing a modified polymerase chain reaction amplification technique followed by restriction enzyme digestion and visualization of the DNA fragments that enables identification of carriers (hetrozygotes and homozygotes) for the GH1 gene deletions as well as noncarriers. It is important to detect homozygotes for the GH1 gene deletions because such patients having never systemically produced growth hormone are immune reactive to growth hormone replacement therapy. These patients produce antibody to the growth hormone given clinically and do not react to such therapy. It is important to detect heterozygotes because the mating of two heterozygotes have a 25% chance of producing a homozygous offspring.
  • the GH1 gene deletion is in the form of a particular structural type of genomic DNA.
  • the GH1 gene and its immediate flanking sequences from normal individuals are contained within three EcoRI derived fragments of 4.7, 2.6, and 4.9 kb which are referred to as Rl-3, respectively (7) .
  • Rl and R3 are homologous regions of DNA that contain either a Bgll and Haell site (Rl) or two Smal sites (R3) . Unequal recombination between these two homologous regions yield fusion fragments that contain a single Smal site and cause 6.7 kb deletions of genomic DNA that contain GH1(8).
  • Amplification of such fusion fragments and the use of such amplification to detect a gene deletion are not addressed by the prior art. Further, digestion of these fusion fragments utilizing specific enzymes to which the sites are susceptible to determine heterozygotes, homozygotes, and noncarriers is also not addressed by the prior art.
  • the present invention provides a method for detecting gene deletions in the form of the above discussed fusion fragments, heterozygotes or carriers of the deletions, and noncarriers.
  • a method of detecting gene deletions including the steps of obtaining a genomic DNA sample possibly including a gene deletion, the gene having two ends normally flanked by two homologous regions having substantially identical portions, the gene deletion being in the form of a fusion fragment of the two homologous regions.
  • the genomic DNA is amplified using a set of primers capable of amplifying both the fusion fragment and the two homologous regions having the gene in-between.
  • the amplified fusion fragments are characterized alone indicating a homozygous deletion, a combination of fusion fragments and the two homologous regions having the gene in-between indicating a heterozygous deletion, or the two homologous regions and the gene alone indicating a homozygous nondeletion.
  • the present invention further provides a primer set for detecting gene deletions in a genomic DNA sample possibly including a gene deletion, the gene having two ends normally flanked by two homologous regions having substantially identical portions, the gene deletion being in the form of a fusion fragment of the two homologous regions.
  • the primer set includes means for amplifying both the fusion fragment and the two homologous regions having the gene in-between.
  • Figure 1 is a photomicrograph of ethidium bromide staining patterns of DNA fragments obtained by PCR amplification following subjection to digestion with Smal and polyacrylamide gel electrophoreses: lane 1-control, lanes 2 and 3 known GH1 gene deletion heterozygote and homozygote, respectively, lanes 4 and 5 parents of subjects 1-2 (Table 1) , and lanes 6 through 12 subjects 1-7 (Table 1) , squares representing males and circles females;
  • Figure 2 is a schematic representation of the three EcoRI derived fragments that flank (Rl and R3) or contain (R2) the GH1 gene (top) , the location of the 1900 and 1921 bp genomic fragments that are obtained by PCR amplification using the indicated oligonucleotide primers being shown in the middle (noting the first three 5' bases of both oligonucleotides being added to facilitate
  • Figure 3 shows three different sizes of deletions which encompass the human growth hormone gene of humans detected by Southern blot analysis of DNA from individuals with familial isolated growth hormone deficiency type 1A as well as the characteristic fusion fragments that are associated with each.
  • the numbers on the right indicate th size of fragments obtained after digestion with various restriction enzymes, as set forth above regarding Figure 2;
  • Figure 3 is a schematic representation of the 3 EcoRI-derived fragments that flank (Rl and R3) or contain (R2) the GH-1 gene.
  • the sizs and relative loctions of 6.7, 7.0 and 7.6 kb deletions are shown by solid, open and stippled bars.
  • oligonucleotide primers indicated by small horizontal arrows
  • the sizes and restriction patterns of resulting PCR amplification products obtained from control and deletion DNAs are shown on the right;
  • Figure 4 is a photomicrograph of ethidium bromide-staining patters of DNA fragments obtained by PCR amplification of genomic DNAs and polyacrylamide gel electrophoresis. Lanes 1, 2 and 4 GH-1 deletion homozygotes, lanes 3 and 5 GH-1 deletion heterozygotes, lanes 6 and 7 controls lane 8 blank and lane 9 molecular weight marker;
  • Figure 5 is a photomicrograph of ethidium bromide-staining patters of DNA fragments obtained by PCR amplification of genomic DNA using the ANF primers and polyacrylamie gel electrophoresis. Lanes 1 and 22 contain molecular weight markers. Patterns obtained from 5 controls are shown in lanes 2-6, 7-11, 12-16 and 17-21 following digestion with Mspl. Ddel. Haelll or Rsal. respectively; and Figure 6 shows aliquots of PCR products following amplification of the human prion gene were subjected to polyacrylamide gel electrophoresis and visualized after staining wit ethidium bromide. Lanes 1 through 6 represent amplified products from members of the probands's family at risk for developing Creutzfeldt-Jakob disease. Lane 7 is the proband and lane 8 is a normal control.
  • the method includes the steps of obtaining a genomic DNA sample possibly including a gene deletion, the gene having two ends normally flanked by two homologous regions having substantially identical portions, the gene deletion being in the form of a fusion fragment of the two homologous regions.
  • the genomic DNA is amplified using a set of primers capable of amplifying both the fusion fragment and the two homologous regions having the gene in-between.
  • Amplified fusion fragments are characterized alone indicating a homozygous deletion, a combination of fusion fragments and the two homologous regions and the gene in-between indicating a heterozygote deletion or the two homologous regions and the gene alone indicating a homozygous nondeletion or noncarrier.
  • Primers are provided which are capable of amplifying either the fusion fragments or the two homologous regions having the gene in-between thereby being capable of detecting either the homozygote, the carrier heterozygote, or the noncarrier homozygote nondeletion.
  • this method provides detection of gene deletions wherein the gene deletion is in the form of fusion fragments.
  • the fusion fragments are derived from the gene that is otherwise deleted having the two homologous regions on each side thereof.
  • the two homologous regions have substantially identical portions which can fuse as a result of the gene deletion.
  • the genomic DNA sample would normally be obtained from a patient desirous of a genetic analysis assessing the risk of carrying a gene deletion of the type which produces fusion fragments of the flanking genetic material.
  • An example of such a deletion is the deletion of the GH1 gene of the R2 region of EcoRI.
  • the GH1 gene is contained in the R2 region and is immediately flanked by Rl and R3.
  • Rl and R3 are homologous regions of DNA that are believed to be of evalutionarily related.
  • the two homologous regions have areas of substantially similar nucleotide sequence. Where a deletion occurs of the R2 region, there is unequal recombination between these two homologous regions yielding the fusion fragments that contain a single Smal site and cause the 6.7 kb deletions of genomic DNA that contain the GH1 region, as shown in Figures 2 and 3.
  • the amplification of the genomic DNA is performed using the polymerase chain amplification method as described by Saiki et al with modifications (6) .
  • a particular set of primers are used which are capable of amplifying both the fusion fragment and the two homologous regions having the gene in-between.
  • the set of primers are complementary to the substantially identical portions of the two homologous regions. This enables the primers to amplify either the fusion fragments or the two homologous regions having the gene in-between. That is, the set of primers are capable of cloning regions Rl and R3 in the fusion fragment form or having the R2 region therebetween.
  • each primer sequence of the primer set includes a nucleotide triplet at each 5' end thereof to facilitate cloning of the polymerase chain reacting amplification products. That is, the ends of the amplified products contain sequences that enable them being inserted into plasmid or phasge vectors to facilitate propagation, DNA sequencing or expression vector analysis.
  • primer sequence (a) shown in Figure 2 includes a triplet 5'GGA3* flanking the 5* end thereof.
  • Primer sequence (b) shown in Figure 2 includes the triplet 3-AAG5 1 flanking the 5' end thereof.
  • oligonucleotide primers can be constructed for the detection of other deletions wherein the deletion results in a fusion fragment of homologous flanking nucleotide segments.
  • the commonality of these primers is their complementary structure to the substantially identical portions of the two flanking homologous regions.
  • At least one the homologous regions of the DNA sample contains a site susceptible to cleavage by a particular enzyme.
  • the characterizing step of the present invention would be further defined as enzymatically digesting the amplified genomic DNA with a particular enzyme, and producing digestion fragments from the fusion fragments having lengths different from the digestion fragments of the two homologous regions having the gene therebetween.
  • the samples would then be identified as including deletions based on observing the different size digestion fragments. Identification can be performed by electophoretically separating the produced fragments and visually observing the separated fragments.
  • the GH1 gene is from the R2 region cleaved by EcoRl. Digestion with EcoRl also produces the two homologous flanking regions Rl and R3.
  • the R3 region includes two Smal sites. It is known that the unequal recombination between the two homologous regions yield fusion fragments that contain a single Smal site and cause the 6.7 kb deletions of genomic DNA that contain GHl (8) , as shown in Figures 2 and 3.
  • digestion with the restriction enzyme Smal of the fusion fragments having the single Smal site produces fragments of different lengths than digestion of the two homologous regions having the otherwise deleted gene in-between, this segment having two Smal sites and the 6.7 kb genomic DNA that contains GHl.
  • a 1918 bp fusion fragment is amplified from a homozygote for GHl deletion
  • 1900 and 1921 bp fragments are amplified from a nondeletion control
  • a combination of the 1918 bp and 1900 bp and 1921 bp fragment is amplified from a heterozygote.
  • Digestion produces 1900, 761, 712, and 448 bp digestion fragments from the control, a 1470 and 448 bp digestion fragments from the homozygote, and the combination of the 1900, 761, 712, and 448 bp with the 1470 and 448 bp digestion fragments from the heterozygote.
  • Electrophoreses of the different samples results in different patterns based on the combinations of the different length fragments.
  • the nondeletion homozygote control, the homozygote deletion carrier and the heterozygote carrier of the deletion on a single DNA strand can be identified.
  • EXPERIMENTAL EVIDENCE Experiment 1 Seven subjects with severe growth retardation due to isolated GH deficiency (IGHD) were studied. Diagnostic criteria included severe growth retardation with height greater than -5 SD, decreased growth rate, retarded bone age, normal karyotype and T4 and peak GH levels less than 7 ng/ml after various provocative stimuli (see Table 1) .
  • DNA Isolation High molecular weight nuclear DNA was isolated from peripheral leukocytes of subjects, selected relatives and controls as previously described (5) . The concentration of each sample was determined by measuring the optical density of the purified DNA at 260 n . DNA Amplification and Restriction Endonuclease Analysis
  • DNA amplifications were performed using the polymerase chain reaction (PCR) amplification method as described by Saiki et al with modifications (6) .
  • Reaction mixtures had a total volume of 100 ul and contained 100 to 200 ng of high molecular weight genomic DNA, 1 uM of each synthetic oligonucleotide primer (see Figure 2) , 200 uM each of dATP, dGTP, dCTP and TTP, 50 mM KC1, 10 mM Tris (pH 8.0), 1.5 mM MgC12, 0.01% gelatin and 2.5 units of Taq polymerase.
  • the samples were overlaid with mineral oil to prevent condensation and placed in a Perkin Elmer Cetus thermocycler.
  • Template DNA was denatured at 94*C for 6 minutes and subjected to 30 amplification cycles. Each cycle consisted of a 30 second DNA denaturation period at 94-C, 30 second DNA annealing period at 60 ⁇ C and a 2 minute DNA extension period at 72 ⁇ C. Following the 30 cycle amplification process, a 10 minute extension period at 72 C was performed.
  • each reaction mixture was digested with the restriction endonuclease Smal according to the specification of the supplier.
  • the buffer contained 20mM KC1, 6mM Tris-HCl (pH 8.0), 6mM MgC12, 6mM beta-mercaptoethanol, 100 ug/ml bovine serum albumin and 12 units of enzyme.
  • the reaction was allowed to proceed at room temperature for 2-1/2 hours.
  • the Smal digested PCR products were visualized following electrophoresis on a 5% polyacrylamide gel.
  • PCR amplification of the fusion fragments using the oligonucleotide primers of the present invention yielded 1918 bp fragments. These differed from the PCR derived fragments obtained from the DNA controls which were 1900 and 1921 bp in length, corresponding to Rl and R3 sequences, respectively. Following digestion with Smal, the 1900 bp fragments (Rl sequences) were not cleaved, as these fragments do not include restriction sites susceptible to the enzyme as shown in Figure 2. The 1921 bp fragments including the R3 sequences were cleaved to yield three fragments of 761, 712 and 448 bp corresponding to the three segments separated by the two Smal sites.
  • PCR derived DNA fragments from a known carrier (heterozygote) of the GHl gene deletion yield a distinctive pattern following digestion with Smal, as shown in lane 2 in Figure 1.
  • the normal fragments (1900, 761, 712, and 448 bp) derived from the Rl and R3 sequences on their normal chromosome are seen as the 1470 and 448 bp fragments derived from the fusion of Rl and R3 that is associated with GHl deletion.
  • genotypes of subjects 3-7 are GHl/GHl homozygotes while those of subjects 1 and 2 are deletion/deletion homozygotes while that of both their parents is GHl/deletion (heterozygous carriers) , consistent with the above analysis (Table 1) .
  • Table 1 The above results were confirmed by
  • the present method for detecting GHl deletions provides an easier and more rapid alternative to Southern blot analysis.
  • Application of this method could provide prenatal diagnosis of at risk pregnancies such as future children of the parents of subjects 1 and 2 (see Table 1 and Figure 1) using DNA from amniotic fluid or chorionic villus cells.
  • this method could facilitate studies to determine the true incidence of IGHD1A among children with severe growth hormone deficiency of early onset. Detection of such cases would, in turn, identify families at risk for recurrence as well as provide more accurate estimates of the risk for affected individuals to develop immune intolerance to exogenous growth hormone.
  • Genomic DNA was isolated as previously described from individuals with GHl gene deletions of 6.7, 7.0 and 7.6 kb in size.
  • DNAs were PCR amplified in 100 ⁇ l reactions containing mixtures of 400 ⁇ g of genomic DNA, 1 ⁇ M of each oligonucleotide primer used in experiment 1,200 ⁇ M each of dATP, dGTP, dCTP and TTP, 50 m KCl, 10 mM Tris (pH 8.0), 1.5 mM MgCl 2 , 0.001% gelatin and 2.5 units of TaqI polymerase.
  • the reactions were placed in a thermocycler (Perkin Elmer Cetus, Norwalk, Conn.), denatured at 90°C for six minutes, then subjected to 30 amplification cycles. Each cycle consisted of a thirty second DNA extension period at 72°C. After the 30 cycles the samples were allowed to anneal for 10 minutes at 72°C, then cooled to 0°C.
  • Rl and R3 were selected that correspond to nucleotides 1337-1363 (Rl GTGTCTTGCCCCTCTCCTCCCCAAGCC 3') AND 9410-9386 (R3, 5 1 GAGAGACTACTCAGGGAGAGCCTCC 3').
  • Reaction mixtures had a total volume of 100 ⁇ l and contained 400 Ng of genomic DNA, 0.3 ⁇ M of each synthetic oligonucleotide primer (see previous paragraph) , 200 ⁇ M each of dATP, dGTP, dCTP and TTP, 50 mM KCl, 10 mM Tris (pH 8.0), 1.5mM MgCl 2 , 0.001% gelatin and 2.5 units of Taq polymerase.
  • the samples were overlayered with mineral oil and placed in a Perkin Elmer Cetus thermocycler.
  • PCR products of - 1350 bp are obtained from chromosomes bearing GHl gene deletions but no are formed from normal chromosomes (see Figure 4) .
  • No product results from non-deleted chromosomes because the Rl primer anneals only to Rl and the R3 primer only t6o R 3 the normal distance between these (-9.4 kb) on non-deleted chromosomes prevents the formation of PCR products. Since the 1350 bp fragments are only synthesized in the case of a GHl gene deletion only gel electrophoresis is needed after PCR amplification and restriction enzyme digestion is no longer required.
  • the human prion gene has been mapped to 20pl2-pter and encodes a protein, whose function has not yet been defined. Th structure of the gene is unusual in that it has a single open reading frame approximately 808 base pairs (bp) in length. Interestingly, a 24 base pair sequence is tandemly repeated 5 times within this region (Kretzschmar et al (1986) DNA 5:315-324). By virtue of their repetitive nature, these sequences may participate in unequal homologous recombination that results in the loss of gain of a repetitive unit or part thereof. Using the polymerase chain reaction (PCR) and oligonucleotide primers and amplification conditions originally described by Hsiao, et al.
  • PCR polymerase chain reaction
  • the human prion gene may successfully be amplified. Following polyacrylamide gel electrophoresis the products may be analyzed for a deletion (see Figure 6) .
  • the 860 bp fragments represent the expected gene product using the primers and conditions originally described by Hsiao et al. (1989) Nature 338:342-345.
  • the 835 bp fragments represent products from an altered allel containing a 24 bp deletion (see Figure B- Kretzschmar et al. (1986) DNA 5:315-324).
  • the heteroduplex fragments represent the annealing of PCR amplified fragments derived from the normal and altered allel (Bosque, P.J., Vnencak-Jones, C.L., Johnson, M.D. and McLean, J.J. (1991) in preparation for submission to Neurology) .
  • the ligonucleotide primers required for this amplification are: 5 1 AAGGATCCCTCAAGCTGGAAAAAGA 3' AND 5' AAGAA TTCTCTGACATTCTCCTCTTCA 3' .
  • the amplification conditions included an initial denaturation at 94°C for six minutes, followed by 35 cycles of 9 °C for ninety seconds, 50°C for ninety seconds and 72°C for three minutes. Extension of the amplified segments were completed at 72°C for ten minutes. Results:
  • FCJD Familial Creutzfeld-Jakob disease
  • the proband also may be identical to that of the proband.
  • the proband also had a G to A substitution at nucleotide 581 corresponding to a CpG dinucleotide that results in an Asp to Asn substitution at codon 178.
  • the data indicate that a prion allele with a partial deletion occurs in a proband and segregates with FCJD in his kindred but may also occur in controls.
  • the role, of this additional nucleotide substitution in the prion allele in causing FCJD is under ongoing investigation.
  • Genomic DNA was isolated, as previously described from individuals with familial orthostatic intolerance and controls. DNAs were PCR amplified in 100 ⁇ l reactions containing mixtures of 200 ⁇ g of genomic DNA, 0.5 ⁇ M of synthetic oligonucleotide primers 167-191 5' CACGGCGGTGAGATAACCAAGGAC 3 « and 2552-2526 5•CCAACGCAGGCATTTGTCTTCTGTCC 3 1 (see prion gene sequence) , 200 ⁇ M of each dNTP, 50 mM KCl, 10 mM (Tris pH ⁇ .O), 1.5 mM MgCl 2 , 0.001% gelatin and 2.5 units of TagI polymerase.
  • the reactions were placed in a thermal cycler, denatured at 94°C for six minutes, then subjected to 30 amplification cycles. Each cycle consisted of a sixty second DNA denaturation period at 94°C, as a 120 second annealing period at 56°C and a 120 second DNA extension period at 72°C. After the 30 cycles the samples were allowed to anneal for ten minutes at 72°C, then cooled to 0°C. Following PCR amplification, 25 ⁇ l of each reaction mixture were digested with the restriction endonucleases Mspl. jDdel, Haelll or Rsal using conditions specified by the commercial suppliers. The resulting DNA fragments were then subjected to electrophoresis in 5% polyacrylamide gels and visualized by ethidium bromide staining (see Figure 5) .
  • Atrial natriuretic factor is a small peptide hormone synthesized by atrial cardiomyocytes. Infusion of ANF in man causes decreased arterial pressure due to decreased cardiac output and vascular resistance and decreased intravascular volume. Individuals with familial orthostatic intolerance (FOI) development hypotension and dizziness on standing and may have mitral valve proplapse. Interestingly, individuals in certain FOI kindreds have paradoxical increases in ANF levels on standing suggesting possible abnormalities in ANF or in its clearance receptor.
  • An intragenic ANF PCRFLP was identified to map ANF and study its linkage relationship to FOI. Hhal digestion of a 2.552 kb PCR fragment containing the entire ANF gene detected a RFLP whose major allel was 0.81.
  • the data 1) confirm the assignment of the ANF locus to lp36 and identify multiple linked markers, and 2) raise the possibility that derangements of ANF may contribute to FOI.
  • Haelll or Rsal (see Figure 5) is best explained by the presence of a small deletion in one ANF allel. Such a deletion could only occur by unequal recombination between Alu related sequences that occur in 3* end of the ANF gene. Such inter Alu recombinations could truncate the size of one Alu repeat thereby yielding slightly smaller sizes when PCR products contianing ANF are digested with multiple restriction endonucleases (see Figure 5) .
  • the invention has been described in an illustrative manner, and it is to be understood that the terminology which has been used is intended to be in the nature of words of description rather than of limitation.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Un procédé de détection de délétions de gènes comprend les étapes consistant à obtenir un échantillon d'ADN génomique comprenant éventuellement une délétion de gène, le gène comportant deux extrémités normalement bordées par deux régions homologues ayant des parties identiques, la délétion de gène se présentant sous la forme d'un fragment de fusion des deux régions homologues. On amplifie l'ADN génomique au moyen d'un ensemble d'amorce capable d'amplifier à la fois le fragment de fusion et les deux régions homologues normales entre lesquelles se trouve le gène. Les fragments de fusion amplifiés sont caractérisés seuls, indiquant une délétion homozygote, une combinaison de fragments de fusion ainsi que les deux régions homologues entre lesquelles se trouve le gène indiquant une délétion hétérozygote, ou les deux régions homologues ainsi que le gène seul indiquant une non délétion homozygote. L'invention concerne également de nouvelles amorces utilisées dans le procédé de l'invention.
PCT/US1992/004764 1991-06-20 1992-06-04 Detection moleculaire de deletions de genes WO1993000445A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US71800691A 1991-06-20 1991-06-20
US718,006 1991-06-20

Publications (1)

Publication Number Publication Date
WO1993000445A1 true WO1993000445A1 (fr) 1993-01-07

Family

ID=24884441

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1992/004764 WO1993000445A1 (fr) 1991-06-20 1992-06-04 Detection moleculaire de deletions de genes

Country Status (1)

Country Link
WO (1) WO1993000445A1 (fr)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998039478A1 (fr) * 1997-03-03 1998-09-11 Exact Laboratories, Inc. Examen de sequences genomiques contigues
US5839716A (en) * 1996-03-15 1998-11-24 Vrm France Device for transferring liquid under simple or accelerated gravity by means of a valve
WO2001085993A2 (fr) * 2000-05-12 2001-11-15 University Of Wales College Of Medicine Procede de detection de variations d'hormones de croissance chez des etres humains, variations et utilisations associees
EP1156123A1 (fr) * 2000-05-12 2001-11-21 University of Wales College of Medicine Méthode pour détecter une variation dans le GH1 comme indicateur pour un dysfonctionnement d' hormone de croissance
WO2003042408A2 (fr) * 2001-11-12 2003-05-22 University Of Wales College Of Medicine Methode de detection des variations de l'hormone de croissance chez les etres humains, ces variations et leurs utilisations

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES USA, Vol. 85, issued August 1988, VNENCAK-JONES et al., "Molecular Basis of Human Growth Hormone Gene Deletions", pages 5615-5619. *
THE JOURNAL OF BIOLOGICAL CHEMISTRY, Vol. 266, No. 13, issued 05 May 1991, S-H. YOON et al., "Molecular Defect of Truncated Beta-Spectrin Associated with Hereditary Elliptocytosis", pages 8490-8494. *

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5839716A (en) * 1996-03-15 1998-11-24 Vrm France Device for transferring liquid under simple or accelerated gravity by means of a valve
AU745862B2 (en) * 1997-03-03 2002-04-11 Esoterix Genetic Laboratories, Llc Contiguous genomic sequence scanning
WO1998039478A1 (fr) * 1997-03-03 1998-09-11 Exact Laboratories, Inc. Examen de sequences genomiques contigues
AU745862C (en) * 1997-03-03 2003-06-05 Esoterix Genetic Laboratories, Llc Contiguous genomic sequence scanning
EP1340820A2 (fr) * 2000-05-12 2003-09-03 University of Wales College of Medicine Méthode pour détecter une variation dans le GH1 comme indicateur pour un dysfonctionnement d'hormone de croissance
WO2001085993A3 (fr) * 2000-05-12 2002-05-10 Univ Wales Medicine Procede de detection de variations d'hormones de croissance chez des etres humains, variations et utilisations associees
EP1156123A1 (fr) * 2000-05-12 2001-11-21 University of Wales College of Medicine Méthode pour détecter une variation dans le GH1 comme indicateur pour un dysfonctionnement d' hormone de croissance
EP1340821A2 (fr) * 2000-05-12 2003-09-03 University of Wales College of Medicine Méthode pour détecter une variation dans le GH1 comme indicateur pour un dysfonctionnement d'hormone de croissance
WO2001085993A2 (fr) * 2000-05-12 2001-11-15 University Of Wales College Of Medicine Procede de detection de variations d'hormones de croissance chez des etres humains, variations et utilisations associees
EP1342795A2 (fr) * 2000-05-12 2003-09-10 University of Wales College of Medicine Méthode pour détecter une variation dans le GH1 comme indicateur pour un dysfonctionnement d' hormone de croissance
EP1340820A3 (fr) * 2000-05-12 2004-05-12 University of Wales College of Medicine Méthode pour détecter une variation dans le GH1 comme indicateur pour un dysfonctionnement d'hormone de croissance
EP1340821A3 (fr) * 2000-05-12 2004-05-19 University of Wales College of Medicine Méthode pour détecter une variation dans le GH1 comme indicateur pour un dysfonctionnement d'hormone de croissance
EP1342795A3 (fr) * 2000-05-12 2004-05-19 University of Wales College of Medicine Méthode pour détecter une variation dans le GH1 comme indicateur pour un dysfonctionnement d' hormone de croissance
WO2003042408A2 (fr) * 2001-11-12 2003-05-22 University Of Wales College Of Medicine Methode de detection des variations de l'hormone de croissance chez les etres humains, ces variations et leurs utilisations
WO2003042408A3 (fr) * 2001-11-12 2004-02-12 Univ Wales Medicine Methode de detection des variations de l'hormone de croissance chez les etres humains, ces variations et leurs utilisations

Similar Documents

Publication Publication Date Title
Myers et al. Detection of single base substitutions by ribonuclease cleavage at mismatches in RNA: DNA duplexes
Myers et al. Detection of single base substitutions in total genomic DNA
US8143000B2 (en) Mutation within the connexin 26 gene responsible for prelingual non-syndromic deafness and method of detection
US5741645A (en) Gene sequence for spinocerebellar ataxia type 1 and method for diagnosis
Eggerding et al. Fluorescence‐based oligonucleotide ligation assay for analysis of cystic fibrosis transmembrane conductance regulator gene mutations
EP0398955B1 (fr) Diagnostic du retinoblastome
US6197500B1 (en) DNA sequences related to fragile X syndrome
US5306616A (en) Molecular diagnosis of autosomal dominant charcot-marie-tooth disease
EP0584145B1 (fr) Procede de diagnostic in vitro d'anomalies chromosomales susceptibles d'etre en rapport avec la maladie de charcot-marie-tooth type 1a
CA2024769A1 (fr) Methode de diagnostic
US5550020A (en) Method, reagents and kit for diagnosis and targeted screening for retinoblastoma
EP0570371B1 (fr) Procede de cartographie genomique par identification directe d'haplotypes par l'analyse de sequences d'introns
WO1993000445A1 (fr) Detection moleculaire de deletions de genes
JPH05211897A (ja) ヌクレオチド配列
CA2455607C (fr) Temoins multiples pour analyses genetiques moleculaires
EP1705255B1 (fr) Méthode de diagnostic et kit pour déterminer le génotype des groupes sanguins Kell
Schwarz DNA diagnosis of cystic fibrosis
EP1641937B1 (fr) Mutations dans le gene slc40a1 associees a l'homeostasie du fer alteree
FAN et al. Identification of a mutation hotspot in exon 8 of Wilson disease gene by cycle sequencing
US5273878A (en) Nucleic acid probes that reveal hypervariable restriction fragment length polymorphisms within the ABR gene
EP1601784B1 (fr) Temoins multiples pour analyses genetiques moleculaires
US7384735B1 (en) Retinoblastoma nucleic acids
US20050095590A1 (en) Brain expressed cap-2 gene and protein associated with bipolar disorder
US7223842B1 (en) Detection of proteins whose absence is associated with a neoplasm
Owen et al. Applications to the study and treatment of Applications to the study and t'reatment of respiratory disease: methodsin molecular biology

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): CA JP

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IT LU MC NL SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
NENP Non-entry into the national phase

Ref country code: CA

122 Ep: pct application non-entry in european phase