WO1992014847A2 - Detection du palillomavirus humain a haut risque et a risque faible par amplification enzymatique d'adn - Google Patents
Detection du palillomavirus humain a haut risque et a risque faible par amplification enzymatique d'adn Download PDFInfo
- Publication number
- WO1992014847A2 WO1992014847A2 PCT/NL1992/000031 NL9200031W WO9214847A2 WO 1992014847 A2 WO1992014847 A2 WO 1992014847A2 NL 9200031 W NL9200031 W NL 9200031W WO 9214847 A2 WO9214847 A2 WO 9214847A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- dna sequences
- dna
- amplifying
- hpv
- types
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/708—Specific hybridization probes for papilloma
Definitions
- the invention relates in general to clinical tests for HPV by enzymatic amplification of DNA and more specifically to a sensitive method and diagnostic kit for identification of high and low risk HPV types.
- Papillomaviruses have been linked to widespread, serious human diseases, especially carcinomas of the genital and oral mucosa. Identification and typing of HPV is clinically important since different types of HPV pose different risks to the affected individuals.
- a method for the identification of high risk human papillomavirus (HPV) types in a sample including the steps of hybridizing the sample with a consensus primer pair for amplifying DNA sequences of high risk HPV types, amplifying by an enzymatic reaction the DNA sequences which hybridize to the consensus primer pair and detecting amplified DNA sequences.
- HPV human papillomavirus
- a method for the identification of low risk human papillomavirus (HPV) types in a sample including the steps of hybridizing the sample with a consensus primer pair for amplifying DNA sequences of low risk HPV types, amplifying by an enzymatic reaction the DNA sequences which hybridize to the consensus primer pair and detecting amplified DNA sequences.
- HPV human papillomavirus
- HPV human papillomavirus
- HPV types and consensus primer pairs for amplifying DNA sequences of low risk HPV types, amplifying by an enzymatic reaction the
- a consensus primer pair including a first single stranded DNA oligonucleotide designated ORH1 SENSE comprising sense sequence 5'AAGGGAGTAACCGAAATCGGT 3' and a second single stranded oligonucleotide designated ORH1 ANTISENSE comprising antisense sequence 5'ATAATGTCTATATTCACTAATT 3'.
- another consensus primer pair includes a first single stranded oligonucleotide designated ORL1 SENSE comprising sense sequence 5' GGCTTTGGTGCTATGAATTTTGC 3' and a second single stranded oligonucleotide designated ORL1 ANTISENSE I comprising antisense sequence 5' GACGTGCGATTTCCACTACCC 3'.
- a further consensus primer pair includes a first single stranded oligonucleotide designated ORL1 SENSE comprising sense sequence 5' GGCTTTGGTGCTATGAATTTTGC 3' and a second single stranded oligonucleotide designated ORL1 ANTISENSE II comprising antisense sequence 5' CAACAGGTCATCAGGCACAGG 3'.
- a consensus primer pair includes a first single stranded DNA oligonucleotide consisting of sense sequence 5 'AAGGGAGTAACCGAAATCGGT 3' and a second single stranded oligonucleotide consisting of antisense sequence 5' ATAATGTCTATATTCACTAATT 3'.
- another consensus primer pair includes a first single stranded oligonucleotide consisting of sense sequence 5 'GGCTTTGGTGCTATGAATTTTGC 3' and a second single stranded oligonucleotide consisting of antisense sequence 5'GACGTGCGATTTCCACTACCC 3'.
- a further consensus primer pair includes a first single stranded oligonucleotide consisting of sense sequence 5'CAACAGGTCATCAGGCACAGG 3' and a second single stranded oligonucleotide consisting of antisense sequence 5'CAACAGGTCATCAGGCACAGG 3'.
- At least one oligonucleotide of a consensus primer pair includes a terminus which is biotinylated.
- At least one oligonucleotide of a consensus primer pairs is biotinylated at the 5' end.
- At least one oligonucleotide of a consensus primer pair includes a polycytidylic acid tail.
- the polycytidylic acid tail includes 10 to 40 monomers of dCMP.
- the polycytidylic acid tail of the at least one oligonucleotide of a consensus primer pair is at a 5 ' end .
- polycytidylic acid tail of the at least one oligonucleotide of a consensus primer pair is sulfonated.
- amplification by an enzymatic reaction is preformed by
- the amplified DNA sequences include sulfonated polycytidylic acid tails and wherein the amplified DNA sequences are detected by an immunological-enzymatic reaction with the sulfonated polycytidylic tails.
- amplified DNA sequences include a biotinylated termini and wherein the amplified DNA sequences are detected by an enzymatic reaction with the biotinylated terminui.
- amplified DNA sequences are identified by procedures which include gel electrophoresis.
- amplified sequences are identified by procedures which include hybridization with sulfonated DNA probes.
- a method for increasing the efficiency of a process for enzymatic amplification of a DNA sequence comprising the steps of, hybridizing a pair of oligonucleotide primers with a DNA sequence to be amplified wherein at least one of the oligonucleotides includes a polycytidylic acid tail including 10 to 40 monomers of dCMP, and amplifying by an enzymatic reaction the DNA sequence to be amplified.
- a method for increasing the efficiency of a test for detection of high risk human papillomavirus (HPV) types in a sample including the steps of, hybridizing a sample with a consensus primer pair of oligonucleotides for amplifying DNA sequences of high risk HPV types, wherein at least one of the oligonucleotides includes a polycytidylic acid tail including 10 to 40 monomers of dCMP, amplifying by an enzymatic reaction the DNA sequences of which hybridize to the high risk HPV types, and detecting amplified DNA sequences.
- HPV human papillomavirus
- a method for increasing the efficiency of a test for detection of low risk human papillomavirus (HPV) types in a sample including the steps of, hybridizing a sample with a consensus primer pair of oligonucleotides for amplifying DNA sequences of low risk HPV types, wherein at least one of the oligonucleotides includes a polycytidylic acid tail including 1C to 40 monomers of dCMP, amplifying by an enzymatic reaction the DNA sequences of which hybridize to the low risk HPV types, and detecting amplified DNA sequences.
- HPV human papillomavirus
- a method for increasing the sensitivity of a test for detection of a DNA sequence by enzymatic amplification of DNA comprising the steps of hybridizing a pair of oligonucleotide primers with a DNA sequence to be amplified wherein at least one of the oligonucleotides includes a polycytidylic acid tail including 10 to 40 monomers of dCMP, and amplifying by an enzymatic reaction the DNA sequence to be amplified.
- a method for increasing the sensitivity of a test for detection of high risk human papillomavirus (HPV) types in a sample including the steps of, hybridizing a sample with a consensus primer pair of oligonucleotides for amplifying DNA sequences of high risk HPV types, wherein at least one of the oligonucleotides includes a polycytidylic acid tail including 10 to 40 monomers of dCMP, amplifying by an enzymatic reaction the DNA sequences of which hybridize to the high risk HPV types, and detecting amplified DNA sequences.
- HPV human papillomavirus
- a method for increasing the sensitivity of a test for detection of low risk human papillomavirus (HPV) types in a sample including the steps of, hybridizing a sample with a consensus primer pair of oligonucleotides for amplifying DNA sequences of low risk HPV types, wherein at least one of the oligonucleotides includes a polycytidylic acid tail including 10 to 40 monomers of dCMP, amplifying by an enzymatic reaction the DNA sequences of which hybridize to the low risk HPV types, and detecting amplified DNA sequences.
- HPV human papillomavirus
- a method for separation of amplified DNA sequences from unextended DNA oligonucleotide primers following enzymatic amplification of the DNA sequences comprising the steps of, adsorbing both the amplified DNA sequences and the unextended DNA oligonucleotide primers on a substrate, and removing the amplified DNA sequences from the substrate.
- a method for separation of amplified DNA sequences from unextended DNA oligonucleotide primers in a reaction mixture following enzymatic amplification of the DNA sequences comprising the steps of, adsorbing both the amplified DNA sequences and the unextended DNA oligonucleotide primers on a substrate by mixing the reaction mixture with glass beads and a high concentration of chotrophic salt, washing the substrate with ethanol, removing the amplified DNA sequences from the glass beads by mixing the adsorbed glass beads with a low concentration of buffered salt solution, and decanting the supernatant.
- a diagnostic kit for the detection of high risk human papillomavirus (HPV) types comprising, single stranded sequences designated ORH1 SENSE and ORH1 ANTISENSE, and a suitable buffer solution.
- HPV human papillomavirus
- the diagnostic kit further comprises , immobilized specific high risk HPV DNA probes , apparatus for labeling DNA by sulfonation. a monoclonal antibody (mAb) recognizing the labeled DNA, and a marker apparatus for directly recognizing the mAb.
- mAb monoclonal antibody
- the marker apparatus indirectly recognizes the mAb.
- a diagnostic kit for the detection of low risk human papillomavirus (HPV) types comprising, single stranded sequences designated ORL1 SENSE.
- the diagnostic kit further comprises, immobilized specific low risk HPV DNA probes, apparatus for labeling DNA by sulfonation, a monoclonal antibody (mAb) recognizing the labeled DNA, and a marker apparatus for directly recognizing the mAb.
- mAb monoclonal antibody
- the marker apparatus indirectly recognizes the mAb.
- a further diagnostic kit for the detection of high risk human papillomavirus (HPV) types comprising, single stranded sequences designated ORH1 SENSE and ORH1 ANTISENSE wherein at least one of the sequences includes a sulfonated polycytidylic acid tail, and a suitable buffer solution.
- HPV human papillomavirus
- the further diagnostic kit additionally comprises, a monoclonal antibody (mAb) recognizing the labeled DNA, and a marker apparatus for directly recognizing the mAb.
- mAb monoclonal antibody
- the marker apparatus of the further diagnostic kit indirectly recognizes the mAb.
- a further diagnostic kit for the detection of low risk human papillomavirus (HPV) types comprising, single stranded sequences designated ORL1 SENSE, ORL1 ANTISENSE I and ORL1 ANTISENSE II wherein at least one of the sequences includes a sulfonated polycytidylic acid tail, and a suitable buffer solution.
- HPV human papillomavirus
- the further diagnostic kit additionally comprises, a monoclonal antibody (mAb) recognizing the labeled DNA, and a marker apparatus for directly recognizing the mAb.
- mAb monoclonal antibody
- the marker apparatus of the further diagnostic kit indirectly recognizes the mAb.
- a diagnostic kit for the simultaneous detection of high and low risk human papillomavirus (HPV) types comprising, at least one pair of single stranded DNA oligonucleotides which hybridize to high risk HPV types wherein at least one of the sequences includes a sulfonated polycytidylic acid tail, and at least one pair of single stranded DNA oligonucleotides which hybridize to low risk HPV types wherein at least one of the sequences includes a biotinylated tail, and a suitable buffer solution.
- HPV human papillomavirus
- a diagnostic kit further comprising a monoclonal antibody (mAb) recognizing the sulfonated polycytidylic acid tail, a first marker means for directly recognizing the mAb, and a second marker means for directly recognizing the biotinylated tail.
- mAb monoclonal antibody
- a diagnostic kit wherein the first marker means indirectly recognizes the mAb, and the second marker means indirectly recognizes the biotinylated tail.
- Fig. 1 is an illustration of gel electrophoresis analysis of PCR products amplified using high risk HPV consensus primers to amplify: HPV 6B (lane 1); HPV 11 (lane 2); HPV 16 (lane 3); HPV 18 (lane 43); KPV 33 (lane 5): human placental DNA (lane 6); CaSki cells (lane 7); HeLa cells (lane 8); SiHa cells (lane 9) and marker DNA "lane M);
- Fig. 2 A is an il lus trati on of gel elec trophoresis analys is of PCR products amplified using low risk HPV consensus primers to amplify: HPV 6B (lane 1); positive clinical samples lanes 3, 5, and 6; HPV 11 (lane 4); and marker DNA (lanes M) and high risk KPV consensus primers to amplify HPV 16 (lane 2);
- Fig. 2B is, an illustration of gel electrophoresis analysis of PCR products amplified using low risk HPV consensus primers to amplify negative clinical samples (lanes 1 - 11);
- Fig. 3 is an illustration of a gel electrophoresis analysis of PCR products amplified from HPV 16 using C-tailed or non-tailed primers in which 1 ng of HPV 16 was amplified in 35 PCR cycles using: non-tailed primers (lane 1); C-tailed primers (lane 2); and sulfonated C-tailed primers (lanes 3 arid 4); and
- Fig. 4 is an illustration of a comparison between EtBr staining of gels and immunoenzymatic visualization of electroblots in which an EtBr-stained 8% acrylamide slab gel with a ten fold dilution series of approximately 10 ng of PCR- amplified DNA is shown in (a) where both C-tailed primers used in the PCR were sulfonated and in (b) where only one of the C-tailed primers were sulfonated and where the PCR products were subsequently electroblotted onto a Nylon membrane in a 10 fold dilution series and visualized by the Chemiprobe system and in which (c) is an electroblot of the gel shown in a and (d) is an electroblot of the gel shown in b.
- HPV 11 Based on the known sequences of HPV 6B, HPV 11, HPV 16, HPV 18 and HPV 333. a computerized program was executed to aid in the choice of two sets of primers (5' and 3' primers per set ⁇ . The first set was selected to amplify specific DNA sequences of HPV 16. HPV 18, HPV 33, and other sequences of high risk HPV types.
- the second set was selected to be specific for DNA sequences of HPV 6B and 11 and other sequences which are classified as low risk HPV types .
- the C- tailed primer's sequences are the same as the nor. C-tailed sequences except for the addition of 13 cytidine groups at the 5' end. All the primers were synthesized on a DNA synthesizer (Applied Biosystems 380A) using the methoxytritylphosphoramidite method.
- 0.5 mg ml of unpurified C-tailed primer was sulfonated according to the instructions of the Chemiprobe kit (Orgenics, Yavne, Israel). 100 ⁇ l of each primer was mixed with an equal volume of solution A (sodium bisulfite) and a half a volume of solution B (methoxyamine) and incubated at 42oC for two hours The sulfonated oligonucleotide was then desalted by centrifuging 100ul through a 2 ml bed of a Sephadex G-50 spin column.
- solution A sodium bisulfite
- solution B methoxyamine
- the enzymatic amplification employed a PCR protocol.
- the reaction mixtures of 100ul contained 0.25mM of deoxynucleoside triphosphates (dNTP), 1.5mM MgCl 2 , 10mM tris-HCl (pH 8-3), 50 mM KCl, 0.1 g l gelatin and 2.5 units of Taq polymerase (USB Cleveland, Ohio USA) with either 0.2 to 1 ⁇ g of DNA extracted from cervical biopsies or cell culture or 0.5ng of plasmid containing recombinant HPV DNA.
- the mixture was overlaid with 1000 ul of mineral oil.
- PCR amplification of DNA was performed using a programmable water bath (Grant, Cambridge, UK) operating at 20 or 35 cycles under the following conditions: 1) a 10 minute denaturation at 94°C for 30 seconds; 2) an annealing step at 45oC for 30 seconds; and 3) an extension step at 72oC for 30 seconds.
- a programmable water bath Grant, Cambridge, UK
- the gel was denatured by overlaying the gel for 30 minutes with 0.2 M NaOH and 1.5 M NaCl, followed by renaturation for 30 minutes in TAE prior to electroblotting.
- PCR products initiated from a non sulfonated primer were first hybridized to a sulfonated plasmid probe.
- the membrane was baked for 1 hr. at 80oC and kept at room temperature until needed.
- ORH1 SENSE and ORH1 ANTISENSE Two sets of consensus primers were selected, a first set. designated ORH1 SENSE and ORH1 ANTISENSE (see Table 1 for the sequences), for high risk HPV types and a second set, designated ORL1 SENSE and ORL1 ANTISENSE I and ORL1 ANTISENSE II (see Table 1 for the sequences), for low risk HPV types.
- the ORH1 set of primers consists of two oligonucleotides, 21 and 22 bases in length and 350 bases apart, located in the E6 ORF of the HPV genome.
- the ORL1 set of primers consists of three primers from E6 ORF, one leftward primer of 23 bases and two type-specific rightward primers of 21 bases each for HPV 6B and HPV 11 (see Table 1). The latter primers are located 244 and 218 bases, respectively, downstream of the consensus primer of HPV 6B and HPV 11.
- Plasmids containing genomes of HPV 16, 18 and 33 and purified DNA from cervical carcinoma tissue culture can be amplified by using ORH1 primers either with or without a C- tail. As shown in Fig 1. (lanes 1 and 2), no amplification was observed with plasmids containing HPV 6B or 11 genome or with human placenta when ORH1 primers were used.
- the efficiency of amplification is increased (i.e. the number of PCR cycles needed to detect a PCR product is reduced, when C-tailed primers rather than non tailed primers are used (see Fig. 37.
- Amplification was further enhanced by shortening the PCR cycle to a 12 second annealing step at 45°C, an 18 second extension step at 72° C and an 18 second denaturing step at 94oC (see Fig. 3, lanes 1 and 2).
- primers of 30 bases in length allow the intermediate annealing step to be omitted, with only the temperatures 72oC and 94oC comprising the PCR cycle. (data not shown).
- the enhanced efficiency resulting from the use of C-tailed primers is also accompanied by an increased sensitivity of the test.
- This enhanced sensitivity is illustrated in Fig. 4 using a sulfonated C-tailed primer.
- EtBr staining of sulfonated C-tailed PCR products in a 10 fold dilution series revealed clearly visible bands only in the first dilution (about 10ng of DNA).
- electroblots visualized by the Chemiprobe tm system showed a 100 fold increase in sensitivity, detecting approximately 100 pg of DNA (Fig 4 b and d).
- the inventors believe that the enhanced efficiency mav be attributed to the increased T m of annealing between the C- tailed primer and the newly synthesized PCR product with the complementary poly dG sequence.
- the presence of a poly dG ends is expected to accelerate the limiting annealing reaction with complementary fragments having unlabeled poly dC ends.
- the HybriComb tm kit contains: 1.
- the HybriComb. which is a comb shaped card with a plurality of teeth in which each tooth has at least one spot sensitized with unlabeled DNA.
- the developing plate which is divided into sections, each section having wells containing liquid reagents for use in a test procedure and adapted to receive the teeth of the HybriComb, and 3. The reagents for the test.
- the Hybricomb kit employs a mode of reverse hybridization whereby the sample to be tested is labeled directly by chemical modification.
- the labeled DNA sample is hybridized with an unlabeled specific DNA probe which is immobilized on the teeth of the HybriComb card.
- Hybrids a re detected by an immunological-enzymatic procedure, whereby a chromogenic substrate of alkaline phosphatase precipitates, resulting in the appearance of a colored spot at the site of hybridization.
- the oligonucleotide ORH1 SENSE is immobilized on the teeth of the HybriComb.
- the sample containing high risk HPV DNA is amplified and sulfonated by the procedure described in Example 1.
- the amplified and sulfonated sample DNA is introduced into the wells of the first section of the developing plate together with the hybridization mixture of Example 1.
- the teeth of the HybriComb, on which the oligonucleotide ORH1 SENSE is immobilized. is introduced into the wells of the first section and incubated for 15 hours at 39oC.
- HybriComb After hybridization, to prevent non-specific attachment of unhybridized labeled DNA, the HybriComb is rinsed in water and incubated in the wells of the second section for 45 minutes at 27°C together with a blocking solution containing 350 mg/ml skimmed milk powder, 37 mg/ml bovine serum albumin, 0.05 (w/v) saponin, 3-5 mg/ml sodium heparin (Prolabo) in TEN buffer (50mM Tris-HCl, ImM EDTA).
- a blocking solution containing 350 mg/ml skimmed milk powder, 37 mg/ml bovine serum albumin, 0.05 (w/v) saponin, 3-5 mg/ml sodium heparin (Prolabo) in TEN buffer (50mM Tris-HCl, ImM EDTA).
- the hybridized DNA is visualized by next incubating the HybriComb for 1 hour at 27oC in the wells of section 3 together with the blocking solution mentioned above containing a 1 250 dilution of a biotinylated mouse mAb specific for sulfonated cytosine.
- the HybriComb is incubated for 3'0 minutes at 27oC in the fourth section in the presence of Streptavidin conjugated to alkaline phosphatase.
- the HybriComb is then washed by incubation in the fifth section and transferred to the sixth section containing the chromogenic substrate for alkaline phosphatse. After an incubation of 30 minutes a colored spot appears on the teeth of the card where the DNA has been hybridized.
- the first set of consensus primers is for amplification of high risk HPV types and is designated ORH1 SENSE and ORH1 ANTISENSE.
- the second set of consensus primers is for amplification of low risk HPV types and is designated ORL1 SENSE and ORL1 ANTISENSE I and ORL1 ANTISENSE II.
- the first set of primers (for amplification of high risk HFV) is synthesized with 13 cytidine groups at the 5' end but only the ORH1 SENSE primer is sulfonated as explained in more detail in Example 1.
- the second set of primers (for amplification of low risk HPV) is chemically biotinylated at the 5' end using the protocol of Corey, Levenson and Chu-an Chang ( Nonisotopically Labeled Probes and Primers. In PCR Protocols a Guide to Methods and Applications. Michael A. Innis et al. Eds., pp 99 - 193. Academic Press).
- Plasmid DNA from HPV 16, 18. and 33 and purified DNA from cervical carcinoma tissue cultures (SiHa, CaSi, and HeLa) is amplified using a Grant programable water bath (Grant, Cambridge, UK).
- the conditions for PCR are as follows: 1) a 10 minute denaturation at 94°C, a 30 second annealing step at 45o C. a 30 second extension step at 72° C, and a 7 minute extension step at 72o C.
- the exces. primers are separated from the amplified DNA sequences by the following procedures: After amplification the reaction mixture is mixed with 5 ⁇ l of acid cleaned glass beads and 3 volumes of 5M Guanidine thiocyate and 0.2M NaEDTA. The beads are then washed with 70o. cold ethanol and the amplified DNA is then recovered by the addition of 100 ⁇ l of Tris EDTA (10mM Tris/1mM EDTA), heating the sample to 55o C for 5 minutes and decanting the supernatant.
- Tris EDTA 10mM Tris/1mM EDTA
- the supernatant from the above procedure containing the amplified DNA is then applied to a dot blot apparatus using the following procedure: Nylon membranes are cut to 9 ⁇ 13 cm and soaked in 10 ⁇ SSC for 1 - 2 hours. Aliquots of 100 ⁇ l of the supernatant are loaded onto a dot blot apparatus. ( Bio Dot tm , Bio Rad. Richmond, CA). The membrane was air dried and then floated onto 95o. ethanol. After further drying the membrane is rinsed twice in 2 ⁇ SSC for 15 minutes each time.
- the membrane After air drying the membrane is baked for 2 hours at 80o C.
- the visualization of the amplified DNA is accomplished by immunochemical staining sequences.
- the membrane is incubated for 30 minutes in PBS + 3 % BSA and then for 1 hr. in Strepavidine. After washing with PBS 0.05o. + Tween 80, the membrane is incubated with a mixture of equal aliquots of biotinylated horseradish peroxidase (HPR) complex (Enzo, Palo Alto, CA, USA), 1:250 and monoclonal mouse antisulfonated DNA (ChemiProbe kit, Orgenics Ltd., Israel) in PBS + 3o.BSA. The preparation is then washed with PBS Tween an d incubated with goat anti mouse conjugated to alkaline phosphatase (1:50 in PBS + 1o. BSA) for 30 minutes.
- HPR horseradish peroxidase
- the presence of sulfonated DNA marking the high risk HPV DNA sequences will be indicated by red dots.
- the presence of biotinylated DNA marking the presence of low risk HPV DNA sequences will be indicated by black dots.
- the absence of a color response will indicate absence of both high risk and low risk KPV DNA sequences.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Virology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Procédé d'identification de types de papillomavirus humain (HPV) à haut risque et à risque faible dans un échantillon, comprenant les étapes consistant à hybrider l'échantillon avec une paire d'amorces de consensus, afin d'amplifier des séquences d'ADN de types de HPV à haut risque et à faible risque, à amplifier par réaction enzymatique les séquences d'ADN s'hybridant avec la paire d'amorces de consensus, et à détecter des séquences d'ADN amplifiées. L'invention concerne également un procédé permettant d'augmenter l'efficacité et la sensibilité de l'amplification d'ADN enzymatique au moyen d'amorces au bout desquelles est fixé un acide polycytidylique sulfoné.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
IL97226 | 1991-02-13 | ||
IL97226A IL97226A0 (en) | 1991-02-13 | 1991-02-13 | Detection of high and low risk human papillomavirus by enzymatic amplification of dna |
Publications (2)
Publication Number | Publication Date |
---|---|
WO1992014847A2 true WO1992014847A2 (fr) | 1992-09-03 |
WO1992014847A3 WO1992014847A3 (fr) | 1993-01-21 |
Family
ID=11062099
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/NL1992/000031 WO1992014847A2 (fr) | 1991-02-13 | 1992-02-12 | Detection du palillomavirus humain a haut risque et a risque faible par amplification enzymatique d'adn |
Country Status (2)
Country | Link |
---|---|
IL (1) | IL97226A0 (fr) |
WO (1) | WO1992014847A2 (fr) |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1994026934A2 (fr) * | 1993-05-06 | 1994-11-24 | Baxter Diagnostics Inc. | Methode de detection du papillomavirus chez l'homme |
WO1996002836A1 (fr) * | 1994-07-18 | 1996-02-01 | Pharmacia Biotech Ab | Systeme de traitement automatique pour liaisons biospecifiques en phase solide, et techniques de sequençage d'adn |
EP0774518A2 (fr) | 1995-11-15 | 1997-05-21 | Gen-Probe Incorporated | Sondes d'acides nucléiques complémentaires aux acides nucléiques du virus du Papillome humain, procédés associés et trousse d'essais |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1988006634A1 (fr) * | 1987-02-26 | 1988-09-07 | The University Of Sydney | Procede de detection de papillomavirus humains carcinogenes |
WO1990001065A1 (fr) * | 1988-07-26 | 1990-02-08 | Genelabs Incorporated | Techniques d'amplification d'adn et d'arn |
WO1990002821A1 (fr) * | 1988-09-09 | 1990-03-22 | Cetus Corporation | Detection du virus du papillome humain par la reaction en chaine de polymerase |
EP0402132B1 (fr) * | 1989-06-08 | 1994-12-21 | Takara Shuzo Co. Ltd. | Procédé pour la détection du virus du papillome humain |
-
1991
- 1991-02-13 IL IL97226A patent/IL97226A0/xx unknown
-
1992
- 1992-02-12 WO PCT/NL1992/000031 patent/WO1992014847A2/fr unknown
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1988006634A1 (fr) * | 1987-02-26 | 1988-09-07 | The University Of Sydney | Procede de detection de papillomavirus humains carcinogenes |
WO1990001065A1 (fr) * | 1988-07-26 | 1990-02-08 | Genelabs Incorporated | Techniques d'amplification d'adn et d'arn |
WO1990002821A1 (fr) * | 1988-09-09 | 1990-03-22 | Cetus Corporation | Detection du virus du papillome humain par la reaction en chaine de polymerase |
EP0402132B1 (fr) * | 1989-06-08 | 1994-12-21 | Takara Shuzo Co. Ltd. | Procédé pour la détection du virus du papillome humain |
Non-Patent Citations (6)
Title |
---|
Ann. Biol. Clin., vol. 47, 1989, Paris, FR; I. Nur et al.: "Chemiprobe TM, a nonradioactive system for labeling nucleic acid - Principles and applications", pages 91,92, see the whole article * |
Gene, vol. 103, 1991, Elsevier Science Publ. B.V., Amsterdam, NL; T. Paper et al.: "Use of sulfonated primers to detect and type papillomavirus in cell cultures and cervical biopsies", pages 155-161, see the whole article * |
Gene, vol. 108, 1991, Elsevier Science Publ. B.V., Amsterdam, NL; Yuka Uchimura et al.: "Nonradioactive labeling with chemically modified cytosine tails by the polymerase chain reaction", pages 103-108, see the whole article * |
Journal of Medical Virology, vol. 27, February 1989, Alan R. Liss, Inc. P.B. Dallas et al.: "Polymerase chain reaction for fast, nonradioactive detection of high- and low-risk Papillomavirus Types in routine cervical specimens and in biopsies" pages 105-111, see abstract * |
Journal of Medical Virology, vol. 27, no. 4, April 1989, Alan R. Liss, Inc., W. Melchers et al.: "Increased detection rate of human Papillomavirus in cervical scrapes by the polymerase chain reaction as compared to modified FISH and southern-blot analysis", pages 329-335, see page 330 * |
Nucleic Acids Research, Symposium Series, no. 20, 1988, IRL Press Ltd, Oxford (GB), Akio Yamane et al.: "Rapid detection of specific gene sequences", pages 91,92 * |
Cited By (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1994026934A2 (fr) * | 1993-05-06 | 1994-11-24 | Baxter Diagnostics Inc. | Methode de detection du papillomavirus chez l'homme |
WO1994026934A3 (fr) * | 1993-05-06 | 1995-01-26 | Baxter Diagnostics Inc | Methode de detection du papillomavirus chez l'homme |
WO1996002836A1 (fr) * | 1994-07-18 | 1996-02-01 | Pharmacia Biotech Ab | Systeme de traitement automatique pour liaisons biospecifiques en phase solide, et techniques de sequençage d'adn |
US5882595A (en) * | 1994-07-18 | 1999-03-16 | Pharmacia Biotech Ab | Automatic processing system for use in solid phase biospecific binding and DNA sequencing techniques |
EP0774518A2 (fr) | 1995-11-15 | 1997-05-21 | Gen-Probe Incorporated | Sondes d'acides nucléiques complémentaires aux acides nucléiques du virus du Papillome humain, procédés associés et trousse d'essais |
US6583278B1 (en) | 1995-11-15 | 2003-06-24 | Gen-Probe Incorporated | Nucleic acid probes complementary to human papilloma virus nucleic acid |
US7355034B2 (en) | 1995-11-15 | 2008-04-08 | Gen-Probe Incorporated | Oligonucleotides for use in determining the presence of human papilloma virus in a test sample |
US7470512B2 (en) | 1995-11-15 | 2008-12-30 | Gen-Probe Incorporated | Oligonucleotides for use in determining the presence of human papilloma virus in a test sample |
Also Published As
Publication number | Publication date |
---|---|
IL97226A0 (en) | 1992-05-25 |
WO1992014847A3 (fr) | 1993-01-21 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU647411B2 (en) | Enhanced nucleic acid amplification process | |
JP2846018B2 (ja) | 核酸配列の増幅および検出 | |
CA1339262C (fr) | Detection du papillomavirus humain par la reaction en chaine de la polymerase | |
CA2005589C (fr) | Systeme de replication de sequences auto-entretenu | |
US6303293B1 (en) | Oligonucleotide reverse transcription primers for efficient detection of HIV-1 and HIV-2 and methods of use thereof | |
RU2441918C2 (ru) | In vitro диагностический набор для идентификации папилломавируса человека в клинических образцах | |
EP0374665A2 (fr) | Essai des séquences utilisant des gènes amplifiés | |
US7105318B2 (en) | Specific and sensitive nucleic acid detection method | |
Ilina et al. | Matrix-assisted laser desorption ionization-time of flight (mass spectrometry) for hepatitis C virus genotyping | |
WO2007084567A2 (fr) | Detection et discrimination de virus d’hepatite c, virus de l’immunodeficience humaine de type-1 et virus d’hepatite b | |
EP0687737A1 (fr) | Détection du virus herpes simplex, treponema pallidum et haemophilus ducreyi | |
EP1082466A1 (fr) | Procede, reactif et kit servant a determiner le genotype de papillomavirus humains | |
JPH04500610A (ja) | 核酸の増幅技術の改良 | |
EP0326395A2 (fr) | Méthode de détection et d'identification de certaines séquences virales | |
EP2013366B1 (fr) | Séquençage du codon L10 du gène gag du VIH | |
WO1997032036A1 (fr) | Amorces et sondes pour l'amplification, la detection et le typage de mycoplasma pneumoniae | |
WO1997032036A9 (fr) | Amorces et sondes pour l'amplification, la detection et le typage de mycoplasma pneumoniae | |
WO1992014847A2 (fr) | Detection du palillomavirus humain a haut risque et a risque faible par amplification enzymatique d'adn | |
Lahijani et al. | Quantitation of host cell DNA contaminate in pharmaceutical-grade plasmid DNA using competitive polymerase chain reaction and enzyme-linked immunosorbent assay | |
US7235387B2 (en) | Method for mutation detection in HIV-1 using pol sequencing | |
KR20070106110A (ko) | B형 간염바이러스, c형 간염 바이러스,인간면역결핍바이러스의 동시진단 분석방법 | |
de Souza Kindermann et al. | Performance of the tetra-primer PCR technique compared to PCR-RFLP in the search for rs12979860 (C/T) and rs8099917 (T/G) single nucleotide polymorphisms (SNPs) in the IFNL4 gene | |
JP3940446B2 (ja) | C型肝炎ウイルスのジェノタイプの判別方法 | |
Yamakawa et al. | Improved detection of rotavirus RNA in dot-blot hybridization assay by chromatographic extraction and acid denaturation of double-stranded RNA | |
CN118109650A (zh) | 一种基于RPA-CRISPR/Cas12a检测A型塞内卡病毒核酸可视化检测试剂盒 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): JP |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): AT BE CH DE DK ES FR GB GR IT LU MC NL SE |
|
AK | Designated states |
Kind code of ref document: A3 Designated state(s): JP |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): AT BE CH DE DK ES FR GB GR IT LU MC NL SE |