WO1991015587A1

WO1991015587A1 - Self-polymerising expression system based on modified potyvirus coat proteins

Info

Publication number: WO1991015587A1
Application number: PCT/AU1991/000128
Authority: WO
Inventors: Mittur Nanjappa Jagadish; Colin Wesley Ward; Dharma Deo Shukla
Original assignee: Commonwealth Scientific And Industrial Research Organisation
Priority date: 1990-04-06
Filing date: 1991-04-05
Publication date: 1991-10-17
Also published as: JPH05506145A; EP0527767A1; EP0527767A4

Abstract

Potyvirus coat proteins and nucleic acid sequences encoding the same are described, wherein the N-terminal and/or C-terminal domain is replaced or partly replaced with foreign polypeptides which may encode antigens of disease causing organisms, or useful polypeptide products. Potyvirus coat proteins assemble or polymerise into antigenic high molecular weight structures or aggregates. Accordingly, the potyvirus coat proteins or high molecular aggregates thereof may be used as vaccines in human and animals.

Description

SELF-POLYMERISING EXPRESSION SYSTEM BASED ON MODIFIED POTYVIRUS COAT PROTEINS

This invention relates to polypeptides and is particularly concerned with potyvirus coat proteins in which naturally occurring araino acid sequences are replaced with foreign polypeptides; polymers or aggregates thereof, and vaccines containing them. The invention also relates to gene sequences encoding mutant potyvirus coat protein, vectors containing them and host cells containing such vectors.

Genetically engineered sub-unit vaccines are safe, reliable and less expensive than conventional live or attenuated vaccines. In any type of vaccine, the ultimate structure of the presented molecule is critical for eliciting an effective host immune response. A virus like particle containing multiple copies of the host protective immunogenic proteins or even just the immunσdominant epitopes could be far more effective in triggering the host immune response than the same presented in a soluble form. In addition to protection from infectious agents, immunological techniques are now being applied to enable normal endocrine functions to be manipulated for improved fertility control and production performance. Hormones and small polypeptide molecules are frequently poor immunogens and a polymeric virus-like carrier protein presenting multiple copies of the small molecules on their own or in combination with relevant lymphokines could lead to enhanced immune responses to these molecules. Previously, carrier molecules such as the capsid protein of hepatitis B virus (1-5), polio virus (6), Ty elements (7), coat protein of tobacco mosaic virus (8), or pilin (9) and flagellin (10) of prokaryotes which all have the capacity to assemble into high molecular weight polymerized structures have been used to present immunodominant epitopes as vaccines. However, with all these systems there have been constraints on the available sites for addition and the size of the foreign sequences that can be added without disrupting the self- assembly properties of the carrier molecule. Further, the intrinsic structure of the assembled icosohedral virus like particle (HBV, Polio, TY) might sometimes prevent proper surface exposure of the critical immunodominant epitope that is necessary for an easy access to the host immune system.

Potyviruses, the largest of the 34 plant virus groups, consisting of 175 members, are long, flexuous, rod shaped particles (Fig. 1). Each virus particle consists of approximately 2000 copies of the single species of coat protein encapsidating a lOkb long, positive sense, single stranded RNA genome.

An immuno-structural analysis of six potyviruses treated mildly with trypsin revealed that the N and C terminal regions of the coat protein are exposed on the surface of the virus particles (11).

In-vitro studies have shown that potato virus Y, the type member of the potyvirus family, can be dissociated into coat protein-monomers, in the presence of high salt concentration or with low pH (below 6.0) or high pH

(above 9.0). They can then be reassociated by adjusting the salt concentration and pH into long flexuous rods of the correct size, in the presence or absence of the viral genome (12,13)- It is believed that 7-8 coat preotein monomers form a ring-like structure and that several of these rings assemble to form full length virus like particles or stacked ring particles respectively in the presence or absence of RNA.

Further, a comparative study of several potyviruses has shown that the coat protein (263 - 330 amino acid residues) consists of a variable N terminal region and a highly conserved core and C terminal regions (11,14). The N terminal region varies significantly in its length (30 - 177 amino acid residues) and sequence while there is striking sequence homology (65%) and similarity in length of the core (216 - 218 amino acid residues) and C terminal (18 - 20 amino acid residues) regions of the coat protein (14).

This invention is based on the finding that the N and/or C terminal regions of the coat protein protein of potyvirus may be replaced with foreign polypeptides, without effecting the innate ability of the coat protein monomer to assemble or polymerize into high molecular weight polymerized structures or aggregates.

According to one aspect of the present invention, there is provided a potyvirus coat protein whose N- terminal and/or C-terminal domain is replaced or partly replaced with a foreign polypeptide.

In another aspect this invention relates to a polymer or high molecular weight aggregate of potyvirus coat proteins whose N-terminal and/or C-terminal regions are replaced or partly replaced with foreign polypeptides.

The entire N or C-terminal domains of the coat protein may be replaced with foreign protein polypeptides. These may be referred to as mutant coat proteins. Alternatively, selected portions thereof may be replaced with foreign polypeptide sequences. The replaced foreign polypeptide sequences may contain the same number of amino acids as the deleted N or C-terminal sequence, or may be larger or smaller. For example, in respect of a potyvirus coat protein having an N-terminal domain of 177 amino acids, the whole 177 amino acid domain may be deleted and replaced with a foreign polypeptide sequence or sequences of up to 177 or more amino acids. Preferably, amino acid replacement occurs within the variable N-terminal region of potyviruses (as previously mentioned, various potyvirus strains have N- terminal domains of 30-177 amino acids). Foreign polypeptide sequences which comprise the N- and/or C- terminal domains of the coat protein may comprise all or part of one or more bacterial, viral or parasitic antigens, parts thereof or repeats thereof or various combinations thereof. The nature of the foreign polypeptide sequence is in no way limiting on this invention. They may also comprise all or part of peptide hormones, growth factors, cytokines or lymphokines for the induction of i munological regulation of normal endocrine function, or, in combination with other proteins, peptides, polypeptides or infectious agent antigens, for the induction of enhanced immune responses. Similarly, the number of amino acids comprising the foreign polypeptide sequence is unimportant, as long as the mutant coat protein retains the ability to polymerise or aggregate into high moleculαx weight forms. The term "polypeptide" is used herein in its broadest sense, and refers to a peptide having up to say 50 amino acids, and a polypeptide or protein having from 50 to 1 x 10^ or more amino acids. Obviously, the difference between a peptide and a polypeptide is an arbitrary one based solely on amino acid number.

Polymerised or high molecular weight forms of mutated coat proteins are formed by admixture of mutant coat monomers under conditions suitable for assembly of high molecular weight aggregates, such as 10-lOOmM NaP04, pH 7.2 and 100 mM NaCl at 4°C.

As is previously mentioned herein, the coat protein is characterised by 3 regions or domains, namely an N- terminus, a core, and C-terminus. The core domains of the various potyvirus strains show considerable sequence homology (65%) and similar length (216 - 218 amino acids). As embraced by this invention, coat protein core domains correspond to one of the known core domains of potyviruses or mutants thereof produced by the deletion, insertion or substitution of one or more amino acids, with the proviso that such mutant core domains are capable of assembling into polymeric or high molecular weight aggregates in like manner to natural (non mutated) potyvirus domains.

In accordance with a further aspect of this invention, there is provided a vaccine, which comprises a potyvirus coat protein or polymer or high molecular weight aggregate thereof, wherein the N-terminal and/or C-terminal domain of the coat protein is/are replaced or partly replaced with one or more bacterial, viral or parasite antigens, parts thereof, repeats thereof and/or combinations thereof, in association with a pharmaceutically, veterinarially or agriculturally acceptable carriers. Pharmaceutical and veterinary carriers may be the same or different and may include saline, glucose, buffers, water, and other carriers or combinations thereof known in the art, and described, for example, in Remington's Pharmaceutical Sciences 16 ed., 1980, ach Publishing Co., edited by Osol et al., which is hereby incorporated by reference. Agriculturally acceptable carriers may comprise water, silica and other materials or combinations thereof as are well known in the art.

This invention also extends to a nucleic acid sequence encoding the potyvirus coat protein, characterised in that the nucleotide sequence encoding the N and/or C-domains thereof are replaced either wholly or in part by one or more nucleotide sequences encoding one or more foreign polypeptides, parts thereof or repeats thereof. The nucleotide sequence may be comprised of DNA or RNA and may be single or double- stranded. Foreign polypeptides may correspond to antigens of viruses, bacteria and/or parasites, as previously defined; to hormones, growth factors, cytokines or lymphokines or to other proteins against which immune responses are to be generated.

The DNA sequence may include at its 5' end, or upstream of the sequence encoding the coat protein a leader sequence to facilitate secretion of the coat protein from a bacterial or other host cell and a promoter to direct transcription of downstream sequences on incubation with RNA polymerase. The term "promoter" is used herein in its broadest sense and refers to any DNA sequence capable of binding RNA polymerase and thereafter causing transcription of DNA sequences downstream thereof. By way of example only, suitable promoters which may be used in this invention include any bacterial, eukaryotic, or viral promoters, or promoters of parasite origin. The sole criteria of such promoters is as previously stated, that they be capable of effecting transcription of downstream sequences ligated thereto. This invention also extends to a vector containing nucleic acid sequences encoding the coat protein ot potyvirus, which is characterised by the nucleotide sequence encoding the N and/or C-domains thereof being replaced either wholly or in part by one or more nucleic acid sequences encoding one or more foreign polypeptides, parts thereof or repeats thereof. Said vectors may be in the form of DNA, or RNA and may be single or double- stranded. The vector may be a covalently closed circle, such as a plasmid or in the form of linear or non- circular DNA or RNA. Vectors falling within the scope of this invention would generally include a selectable marker, one or more promoters, and one or more restriction endonuclease cleavage sites to facilitate the insertion of desired nucleotide sequences- The term "selectable marker" is used herein in its broadest sense and refers to any chemical or biochemical marker carried by or encoded for on the vector. Suitable - 7 - detectable markers include resistance to antibiotics or chemicals or enzymes capable of causing a detectable reaction when provided with a suitable substrate. Examples include resistance to ampicillin, streptomycin, penicillin, tetracycline, kanamycin and the like, and β- galactosidase, alkaline phosphatase or urease, amongst others.

The aforementioned vectors may function as expression vectors in appropriate host cells, such that mutant coat-proteins, as described herein, are excreted from the host cell into the surrounding culture medium or are incorporated within the host cell itself and are liberated on lysis thereof. Accordingly, in a further aspect of this invention, there is provided a host cell which includes therein an expression vector which encodes a coat-protein of potyvirus characterised in that the N and/or C-terminal domains of the coat protein are replaced wholly or in part with one or more foreign polypeptides as hereinbefore described. Suitable host cells include bacteria, such as E. coli. Bacillus or Pseudomonas_ yeasts such as S. cerevisiae, Kluyueromvces lactis. Pichia, and the like and/or higher eukaryotic cells such as fungal, plant or mammalian cells. The precise nature or type of an expression vector or a host cell themselves is not critical to this invention, and any desired host cell may be employed in which appropriate expression vectors encoding mutant coat proteins as hereinbefore defined are capable of replication. Suitable host cells can be readily determined according to methods well known in the art, and suitable vectors constructed for replication in desired host cells.

The present invention will now be described, by way of illustration only, with reference to the following non-limiting Figures and Examples. FIGURE LEGENDS:

FIGURE 1 shows an electron micrograph of wild type JGMV particles (a); JGMV particles treated with trypsin (b); and reconstituted JGMV particles (c) following treatment with lysyl endopeptidase, dissociation in the presence of formic acid and dialysis against water followed by buffer containing 10 mM NaP04 pH7.2 plus 100 mM NaCl; Bar = 0.05 μm

FIGURE 2 illustrates the nucleotide sequence of JGMV coat protein ( within square brackets ) plus C-terminal region of the distal Nib gene (15). The recognition sequences for Bglll and Seal restriction enzymes that appear at 5' and 3' ends respectively, are underlined. The arrows indicate trypsin cleavage sites. FIGURE 3 illustrates the site specific changes made at the N-terminal region of the coat protein: 3a depicts the N, core and C terminal regions of the coat protein as well as the C terminal region of the Nib gene. QS represents the proteolytic cleavage site of the polyprotein. Trypsin (KK DKD and ER HT) and lysyl endopeptidase (KK DKD) sites that border N, core and C terminal regions are shown. * represents translational stop codon. 3b-c show the sites of introduction of BamHI and EcoRI sites, respectively. Figure 3d shows part of the N terminal region of the coat protein cloned into

BamHI-Smal sites of pTTQ19 vector (MCS: multiple cloning sites). The likely translation initiation codons (M) are shown. CP—> indicates the start of the coat protein encoding region. FIGURE 4a illustrates the E. coli expression vector pTTQ19:CP with relevant restriction enzyme sites; ptac, synthetic tac promoter; CP, coat protein; rrnB112, E. coli rrnB operon transcription terminator; LacI*?, Lac represson gene; LacZ, β-galactosidase alpha fragment gene; Ori, Origin of replication; AMP, Ampcillin resistance gene.

FIGURE 4b depcits the yeast expression vector pAAH5:CP with relevant restriction enzyme sites. P, ADCl promoter; CP, coat protein; T, ADCl terminator; Ori, bacterial origin of replication; AMP, ampicillin resistance gene, LEU2, S. cerevisiae leucine 2 gene; 2 μ, yeast origin of replication.

FIGURE 5 shows immunoblot analysis of CP expressed in E. coli (a) and S. cerevisiae (b) probed with the polyclonal antiserum JG:Core AS raised against purified, denatured, truncated CP cores of trypsin-treated JGMV particles. The bands were visualized by horse radish peroxidase reaction. (a). Lanes: 1,2, freeze dried CP purified from JGMV; 3, E. coli DH1; 4, DHl/pTTQ19; 5,6, DHl/pTTQ19:CP; 7, size standards; 8,9, purified JGMV samples stored at 4°C. Lanes 2,6 and 9 contain extracts treated with lysyl endopeptidase. Filled and open arrows indicate the full length CP and the CP without its N terminus, respectively, (b) . Lanes: 1, freeze dried CP; 2,6, size standards; 3, JHRYl-5D/ρAAH5; 4,5, JHRY1- 5D/ρAAH5:CP; 7,8, JGMV stored at 4°C. Lanes 5 and 7 contain samples treated with lysyl endopeptidase.

FIGURE 6 shows sedimentation in sucrose density gradients of CP material from S. cerevisiae JHRY1- 5D/pAAH5:CP. (a)(b). Aliquots from every third fraction were analysed by immunoblotting. Fractions indicated by the line between the vertical arrows from the first sucrose gradient (a) were pooled and centrifuged in a second gradient (b). Fractions indicated by the line between the arrows were pooled from the second gradient and dialysed. Lanes: 1, JGMV; 2, size standards. The last lane in gel (b) contains a sample aliquot of the pellet formed by centrifuging the pooled samples from the first gradient at 55,000 rpm for 1 h. (c) . Coomassie blue stained gel, and (d) immunoblot of several representative fractions obtained during purification. Lanes: 1, JGMV particle protein; 2,10, size standards; 3, total extract; 4, supernatant fraction after centrifugation at 3000 rpm; 5, as in right lane of figure 3b; 6, pooled fraction from the second gradient; 7,8, pellet fraction and supernatant fraction, respectively, following centrifugation of pooled fractions at 100,000 rpm from the second gradient; , total extracts from JHRYl-5D/pAAH5. Open arrows indicate the full length CP band.

FIGURE 7 shows electron micrographs of PVLPs from E. coli (a,b and e) and S. cerevisiae (c). JGMV particles purified from plants are shown in panel d. PVLPs from E__ coli and PVLPs [reassembled following formic acid (60%) denaturation of JGMV followed by dialysis against 10 mM phosphate buffer pH7.2 containing lOOmM NaCl at 4°C] decorated with JG:AS are shown in panels e and f, respectively. In panels b-f bar = 0.05 μm. FIGURE 8 depicts E. coli expression vector pGEX3:CoPc with relevant restriction enzyme sites. tacP, synthetic tac promoter; sj26, glutathione-s-transferase (GST) Schistosoma laponicum; I, multiple cloning sites and factor Xa cleavage site; CoPc, core and the C- terminal regions of the coat protein. The remaining abbreviations are as described before.

FIGURE 9 shows SDS-PAGE (a) and western blot (b) analyses of the sj26(GST)-CoPc expressed in E. coli DHl. The nitrocellulose blot was probed with antisera (JG:Core.As). M , molecular weight markers; V, JGMV;

3s⁵'¹⁰, 5 and 10 μl of purified GST-CoPc obtained from 10,000 rpm supernatant fraction of sonicated E. coli extracts; 3p²'⁵'¹⁰, 2, 5 and 10 μl of purified GST-CoPc obtained from 10,000 rpm pellet fraction; 3T, total protein extracts from DHl/ pGEX3:CoPc; XT, total protein extracts from DHl/pGEX3.

FIGURE 10 shows electron micrographs of rod shaped potyvirus like particles (PVLPs) resulting from self- assembly of GST-CoPc fusion protein expressed in E. coli; Bar = 0.05 μ.

FIGURE 11 depicts the expression vector pGEX3:L:CoPc with relevant restriction enzyme sites. L, represents an 18 amino acid length linker (hinge) sequence; CoPc, core and the C terminal regions of the coat protein, I, multiple cloning and factor Xa cleavage sites. Remaining abbreviations are as described before. FIGURE 12a shows SDS-PAGE and western blot analyses of GST-L-CoPc expressed in E. coli probed with antisera JG: Core As and antisera against GST (GST.As). The corresponding coo assie gel is also shown. Lanes: Jg, JGMV; MW, molecular weight markers; 3^D, DHl/pGEX3:CoPc- protein purified from 10,000 rpm pellet fraction of sonicated E. coli extracts; 3^s, DHl/pGEX3:CoPc - protein purfied from 10,000 rpm supernatant; 50*°, DHl/ pGEX3:L:CoPc - protein purfied from 10,000 rpm pellet; 50^s, DHl/pGEX3:L-CoPc - protein purfied from 10,000 rpm supernatant; GST, a sample of GST purified from E. coli. FIGURE 13 shows electron micrographs of particles resulting from self-assembly of GST-L-CoPc expressed in E. coli. Examples of particles obtained from self- assembly of GST-CoPc and full length coat protein expressed in E. coli are also shown ; Bar « 0.05 μm.

EXAMPLE 1:

Polymerization of coat protein monomers without its N and C termini into potyvirus-like particles: Previously, peptide analysis of samples of JGMV (Johnson Grass Mosaic Virus, a member of the potyvirus group) particles treated mildly with lysyl endopeptidase or trypsin has shown that lysyl endopeptidase cleaved after the 68th aminoacid residue to delete the N terminus (68 aa), and trypsin cleaved after the 68th amino acid and 268th amino acid residues to remove the N (68 aa) as well as the C termini (18 aa) respectively (11). The remaining portion of the particle is 218 aminoacid in length and is referred to as the core portion of the coat protein. In their morphology, the enzyme treated particles appeared to be similar to the untreated JGMV particles under the electron microscope (Fig 1 a & b) suggesting that N and C termini may not be required for virus morphological stability.

To determine whether the core portion of the coat protein alone is sufficient to polymerize to potyvirus- like particles(PVLPs), wild type JGMV particles treated mildly with lysyl endopeptidase or trypsin were disassembled by incubating in the presence of formic acid (60% v/v). The dissociated protein was then dialyzed against water followed by a buffer containing 10 mM NaP04 pH 7.2 and 100 mM NaCl at 4^βC for 54 h. Electron microscope analysis showed that the truncated protein had reassembled to form potyvirus-like particles (Fig. lc). The particles were long, flexuous with a stacked ring structure, characteristic of potyvirus assembled without its genome (12, 13).

EXAMPLE 2:

Cloning, expression and polymerization of full length JGMV coat protein in E. coli: A synthetic cDNA fragment encoding the full length coat protein and C terminal part of the distal nucleai inclusion protein (Nib) has been previously cloned and sequenced (15, Figs. 2, 3a). A Bglll - Seal fragment encoding this sequence was cloned into a multipurpose E^_ coli vector pT3T718U (Pharmacia) to give pT3T718U:BglII- Scal. For many potyviruses it has been determined, by amino acid sequence analysis of the purified coat protein, that the proteolytic processing of the polyprotein occurs between QS, QG or QA residues to separate coat protein from Nib. To express a clone containing only the coat protein sequences, the amino acid Q(CAG) was changed to M(ATG) by oligonucleotide mutagenesis. The 43^mer primer ( 5' GAAGATGTGGTGGATCCAG AAAATATGGCAGGCATTGAGGATG 3' ) was designed to introduce a BamHI restriction endonuclease cleavage site at the positions -8 to -13 and at the same time base A at -3 position for efficient translation initiation in yeast (Fig. 3b). Oligonucleotide mutagenesis was carried out using single stranded DNA of pT3T718U:BglII-ScaI isolated from the RZ1032 (dut~ ung^") strain of E. coli according to the procedure recommended by Bio-Rad. The base changes were confirmed by restriction enzyme and DNA sequence analysis. This construct was named SCMBl-1. The BamHI-Ball fragment encoding full length coat protein was isolated from SCMBl-1, filled in by polIK and cloned into polIK filled-in BamHI-Smal site of pTTQ19 (Amersham) to generate pTTQ19:CP (Fig. 3d, 4). pTTQ19 contains an IPTG inducible tac promoter. In pTTQ19:CP, there would be an addition of 16 aminoacids at the N terminus with 12 generated from the multiple cloning sites present upstream of the BamHI-Smal sites used for cloning the coat protein gene and 4 from the C- terminal region of the Nib gene (Fig. 3 a & d).

In order to establish a cell-free assembly system for potyvirus coat protein, expression vector pTTQ19:CP was transformed into E. coli DHl according to the standard procedures (16). Overnight cultures of E. coli DHl/pTTQ19:CP grown in LB+ampicillin at 37^βC were diluted 1:50 in fresh medium, grown for 1 h, induced by adding 500 μM (final concentration) of IPTG and further incubating at 37°C for 90 - 120 min. One ml cultures (approx. OD^O- 0.52) were pelleted and resuspended in 100 μl of loading buffer (60 mM Tris-HCL pH 7.5, 2% SDS, 10% glycerol, 5% β-mercaptoethanol, 0.001% Bromophenol blue), boiled for 3 min and 10 - 20 μl used in SDS-PAGE analysis (17) . The separated proteins were electrophoretically transferred to nitrocellulose membranes. The membranes were processed according to the standard immunoblotting procedures (18) and probed with rabbit polyclonal antisera raised against purified core portion of JGMV coat protein (JG:Core AS). The bands were visualised by horse radish peroxidase (Silenus) or alkaline phosphotase (Promega) reactions. Pre-stained protein molecular weight markers from BRL (range 14,000 - 200, 000 ) were used.

SDS-PAGE and Western blot analysis of protein extracts from E. coli DHl/pTTQ19:CP showed (Fig. 5a) that CP is synthesized in E. coli. There are two predominant bands that reacted with the antiserum JG:Core.As. The larger of the two is slightly bigger than the native CP (34 kDa), probably because of the additional 16 amino acids at the N terminus (Fig. 3d). Also, there are many coat protein specific bands smaller in size, presumably generated by partial degradation of the full length coat protein as seen in plant propogated virus preparations (11). The smaller proteins could have also been generated by internal initiation or premature termination of translation during gene expression. Coat protein specific bands were not detected in lanes containing protein extracts from E. coli DHl or E. coli DHl containing the expression vector pTTQ19 without the coat protein encoding region (Figure 5a).

To test whether or not the expressed coat protein in E. coli had folded to form correct monomers or even assembled into potyvirus-like particles in a way to resist cleavage of the core portion of the coat protein, the protein extracts were subjected to lysyl endopeptidase treatment. Aliquots of 100 μls of spheroplasts from E. coli (see below) were incubated at room temperature for 30 mins with or without 2-3 μg of lysyl endopeptidase ( Wako Chemicals, Dallas, Texas). Purified JGMV particles in sterile water and purified coat protein that had been previously denatured in formic acid, dialysed and freeze dried were used as controls.

Enzyme treated samples were centrifuged at 100,000g for 8 min at 4°C in Beckman TL-100 ultracentrifuge using TLA 100-2 rotor. The pellet was resuspended in the loading buffer and analysed by SDS-PAGE and western blotting methods. The results indicate that a portion of the coat protein is resistant to the enzyme cleavage (Fig. 5a, lanes 5 & 6). The size of this band is 26 kDa and is the same as the purified JGMV particle treated with the enzyme ( Fig. 5a, lanes 7 & 8). This indicates that coat protein expressed in E. coli has assumed a structure similar to that in JGMV particles. It is also possible that even the coat protein monomers and rings are folded in such a way that the N- terminal region is surface exposed and readily accessible to proteolytic attack similar to the wild type particles. Purified JGMV without the enzyme contains a band of 34 kDa (Fig. 5a, lane 8) that corresponds to the length of the full length coat protein, plus bands of bigger size that may correspond to the multimeric forms of the coat protein, and bands of smaller size (26 kDa or smaller) that may correspond to the coat protein resulting from the partial breakdown of virus particles upon storage at 4°C. On the other hand, JGMV particles treated with the enzyme (Fig. 5a, lane 7) contain a predominant band of size 26 kDa, small amounts of uncleaved or partially cleaved multimeric forms of the coat protein and a small amount of coat protein below 26 kDa resulting from excess cleavage by the enzyme.

The protein extracts from E. coli were partially purified to enrich for fractions containing coat protein. Cells from 100 mis of induced cultures were resuspended in 4 ml of Mix 1 (20% sucrose, 100 mM Tris-HCL pH 8.0, 10 mM EDTA), 80 μl of 5 mg/ml lysozyme was added, incubated 5-10 min at room temperature followed by 15 min on ice. The spheroplasts were resuspended in one ml sterile water and used for Sepharose S-1000 column chromatography. Alternatively, the spheroplasts were resuspended in 0.4 ml of Mix II (100 mM Tris-HCL pH8, 20% sucrose, 10 mM

², 1 μg/ml DNase and Rnase each) and further diluted with water to a final volume of two ml before column sepration. The column was monitored by absorbance at 280 nm. The peak fractions were collected, spun down at 50K rpm for 80 min and analysed by SDS-PAGE and western blotting techniques. For electron microscope analysis, aliquots of virus samples or extracts from E. coli were mounted on Formvar carbon-coated grids. The grids were washed with 30 drops of phosphate buffer and 60 drops of deionized water. The grids were negatively stained with 1% uranyl acetate (pH 4) and examined under a Joel electron microscope. Electron microscope examination of the pooled fraction containing coat protein indicated the presence of many potyvirus-like particles. The particles were long and flexuous, of heterogeneous length, but all of 11 nm width (Fig. 7 a,b). The particles had the stacked-ring structure characteristic of potyvirus coat protein monomers assembled without RNA (12). Immune electron microscopy, where virus particles are trapped on antisera coated grids, was applied to crude extracts from E. coli DHl/pTTQ19:CP. This procedure also indicated the presence of potyvirus like particles similar to those observed from purified fractions. No such structures were found in protein extracts from strains containing the expression vector pTTQ19 without the coat protein encoding region. Finally in antiserum decoration tests, particles derived from E. coli were heavily decorated with the antiserum JG:AS (an antiserum raised against purified JGMV particles) similar to the particles derived from the reassembly of dissociated JGMV coat protein monomers (Figure 7, e,f)

EXAMPLE 3:

Cloning, constitutive expression and polymerization of full length JGMV coat protein in the budding yeast S. cerevisiae:

The BamHI-Ball fragment (Figs. 3a,b) encoding full length coat protein was isolated from the previously described plasmid SCMBl-1, filled in by polIK and cloned into the polIK filled Hindlll site of pAAH5 to generate pAAH5:CP (Fig. 4b). The expression vector pAAH5 is an E. coli/veast shuttle plasmid containing constitutively expressed ADCl promoter and ADCl terminator (20). The expression vector pAAH5:CP was transfromed into S. cerevisiae JHYRl-5Dα, leu2-3, 112, his4-519, ura3-52, trpl, pep4-3. Yeast cells were grown at 30°C in YEPD or minimal medium with or without appropriate amino acids/nucleotides for selection and maintenance of plasmids. The procedures described by Ito et al., (21) were used for yeast transformation.

For analysis of yeast expressed coat protein, 10- 100 mis of early to mid logarithmic phase (OD⁶⁰⁰=0.2 - 1.5) cells grown in yeast selective medium (minimal medium containing histidine, uracil and tryptophan) were pelleted, washed in 1.2 M sorbitol, reusupended in 1-10 mis of solution I (0.9 M sorbitol, 0.1 M EDTA pH8.0, 14 mM β-r rcaptoethanol and 100 μg/ml zymolyase 100T), and incubated at 37°C for 30-45 mins to generate spheroplasts. The spheroplasts were washed in solution I without zymolyase and lysed by resuspending in 0.1-1 ml sterile water or in lysis loading buffer (2% SDS, 1.5 mM PMSF, 100 u/ml trasylol, 10% β-mercaptoethanol, 15% glycerol and 0.05% bromophenol blue). Aliquots were used for SDS-PAGE analysis. In yeast, most of the coat protein synthesized seemed to have undergone specific cleavage to give rise to a band of approximate size 30 kDa (Fig. 5b, lane 4). Neverthless, a band of 34 kDa, accounting for the full length coat protein can be seen. The specific cleavage appears to occur during extraction of the proteins using zymolyase treated spheroplasts and was prevented when proteins were extracted by homogenising cells with glass beads (see below). However, there are many coat protein specific bands of smaller size, presumably generated by further partial degradation of the full length coat protein. The treatment of yeast extracts with lysyl endopeptidase suggested that the coat protein molecules expressed in yeast were partially resistant to the enzymatic cleavage ( Fig. 5b, lanes 4 & 5), and thus like in E. coli. had assumed a structure either of a correctly folded monomeric form or even of a potyvirus like form.

For isolation of potyvirus-like particles from yeast, an overnight culture of JHYRl-5D/pAAH5:CP was diluted into one litre of yeast selective medium and further grown at 30°C for 18 hours to a OD⁶⁰⁰=1.2. Cells were washed once in lx PBS (phosphate buffered saline, pH 7.3, Oxoid), resuspended in 3 ml of lx PBS, added 6 gms of glass beads (0.45-0.50 mm) and 60 μl of 0.2 M PMSF (Phenylmethylsulfonyl fluoride). The cells were disrupted in a cell distrupter (Braun). The cell extracts were centrifuged at 3000 rpm for 5 min; the supernatant was transferred to a fresh tube; the pellet was further extracted with another 3 mis of lx PBS, centrifuged and the two supernatant fractions were pooled with an additional 10 μls of 0.2 M PMSF. The extracts were subjected to 10-40% sucrose density gradient centrifugation essentially according to the methods described by Adams et al., (22) and Muller et al., (23). Fractions were collected from the top and analysed by Western blotting methods (Fig. 6 a,b). Fractions containing large amounts of intact coat protein were pooled and subjected to a second sucrose density gradient centrifugation. After two sucrose gradient centrifugations, partially pure fractions containing coat protein were obtained (Fig. 6 c,d). The fractions containing coat protein were pooled and dialyzed against 10 mM phosphate buffer pH 7.2 containing 100 mM NaCl at 4^βC for 48 h or analysed directly by ultra- centrifugation. 100-500 μl aliquots were centrifuged at 100,000g for 8 min at 4°C in Beckman TL-100 ultracentrifuge using TLA 100-2 rotor. The pellet was resuspended in the loading buffer or IXPBS or TEN buffer (10 mM Tris pH 7.5, 2 mM EDTA, 100 mM NaCl) for electron microscope analysis. EM analysis revealed potyvirus-like particles (Fig. 7c) of structure similar to the E. coli produced particles described above. Also, similar to the particles derived from E. coli, the particles derived from yeast could be trapped on antisera coated grids in immune electron microscopy studies and could be decorated with JG:AS in antiserum decoration tests.

EXAMPLE 4:

Construction of pGEX3:CoPc, expression and polymerization of GST-CoPc in E. coli:

Construction of JGMV coat protein with a foreign sequence in place of its native dispensable N terminal region, to test if the fusion coat protein can still retain the ability to polymerize into potyvirus-like particles, was carried out as follows. The foreign sequence used here is GST (glutathione-s-transferase), a 26 kDa host-protective antigen from Schistosoma iaponicu . GST has been shown to provide protection against schistosomiasis (24, 25). In an oligonucleotide mutagenesis experiment, using a 39^mer primer 5' CGGGTGGAACGAATTCTACAATG ACAAAGAAGGATAAGG 3*, a translation initation ATG and an EcoRI restriction enzyme cleavage site were introduced in pτ3T718U:BglII-ScaI at 9 and 21 base regions upstream of the N terminal- trypsin/lysyl endopeptidase cleavage site (KK DKD) respectively (Fig. 3 a & c). The resulting construct was named SCMEA7-1. pGEX3:CoPc (CoPc refers to core portion plus the C terminal region of coat protein) was generated by cloning the EcoRI fragment from SCMEA7-1, into the unique EcoRI site of pGEX3 (Amrad). This fragment contains all of the core region (218 aa) of coat protein plus 7 amino acids from the N terminus, 18 amino acids from the C terminus and a short stretch of 3' untranslated region. The construct pGEX3:CoPc (Fig. 8) consists of JGMV-CP with its N-terminal 61 aa replaced by GST but separated from it by multiple cloning sites and factor Xa cleavage site (24 bp).

SDS-PAGE and Western blot analyses of protein extracts from E. coli DHl/pGEX3:CoPC showed a very high level expression of the GST-CoP fusion protein. It is of approximately 54 kDa in size and could be readily visualized by coo assie gel staining (Fig. 9a). In Western blot analysis, the fusion protein reacted with the antiserum JG:Cσre As as well as antiserum (GST.As) raised against purified GST. GST-CoPC fusion protein was purified using reduced glutathione agarose adsorption (24). Unlike GST by itself, a very high percentage of the GST-CoPc was found in the 10,000 rpm pellet fraction of sonicated E. coli extracts suggesting that GST is in a physical form different from that of GST by itself.

The GST-CoPc fusion protein (purified using reduced glutathione agarose adsorption) is immunogenic as evidenced by efficient antiserum production in New Zealand white rabbits.

Electron microscope analysis indicated that many of the hybrid GST-CoPc monomers had assembled to form stacked-rings resulting in potyvirus-like particles (Fig. 10). However, the particles were fewer in number, shorter (200nm) in length, and wider (22nm) than the native particles or the particles generated by expression of full length coat protein in E. coli and yeast. In the background there were aggregates which could be rings unable to readily stack under the conditions employed.

EXAMPLE 5:

Construction of pGEX3:L:CoPc, expression and polymerization of GST-L-CoPc in E. coli:

A linker (26) of neutral amino acids at the junction of GST and CoPC may provide a hinge like structure that is flexible to improve the ability of the foreign protein

(in this case GST) to fold and adopt its correct native conformation as well as to minimise the likelihood of the foreign protein (GST) from interfering with the folding and assembly of the truncated CP into potyvirus-like particles. pGEX3:L:CoPc (Fig. 11) was constructed as follows: two complimentary oligomers of 51 bases length (5' AAT, TCC,GGA,GGC,GGT,GGC,TCA,GGC,GGT,GGA,GGC,TCG,GGT,GGC, GGC , GGT,TCT, 3') encoding aa (SGGGG)³, each with EcoRI sticky ends, were synthesized; the oligomers were purified and annealed by mixing in equimolar amounts and incubating in a 85°C water bath followed by gradual cooling to room temperature; the 51bp fragment was then cloned into the EcoRI site of pGEX3: CoPc partially cut with EcoRI. A clone (pGEX3:L:CoPc) containing the 51 bp insertion at the EcoRI site between GST and CoPc was selected by Southern hybridization followed by screening of the positive clones by SDS-PAGE analysis. The GST-L-CoPc fusion band, approximately 2 kDa bigger than GST-CoPc accounting for the additional 17 amino acids of the linker (hinge), reacted with both JG:Core.As and GST.As antisera (Fig. 12). Protein extracts from E. coli DHl/pGEX3:L:CoPc were subjected to glutathione agarose purification. Electron microscope examination of the fractions indicated the presence of a few potyvirus-like particles which were shorter (400nm) wider (22nm) than the wild type particles ( Fig. 13) but were generally slightly bigger than the particles resulting from GST- CoPc fusion protein.

EXAMPLE 6:

Production and expression of coat proteins containing HIV epitopes and yeast copper metallothionein:

The V3 loop from gpl20 of HIV-1 was inserted into the N-terminal domain of the polyvirus coat protein. The fusion protein was expressed in yeast and E. coli.

Similarly, the copper metallothionein protein from yeast was inserted into the N-terminal domain of the potyvirus coat protein, and expressed in yeast. REFERENCES:

1. Valenzuela, P., Coit, D., Medina-Selby, M.A., Kuo, C.H., Van Nest, G. , Burke, R.L., Bull, P., Urdea, M.S. and Graves, P.V. Antigen engineering in yeast: Synthesis and assembly of hybrid hepatitis B surface antigen-herpes simplex lgD particles. Bio/Technology 3 (1985) 323-326. 2. Rutgers, T., Cabezou, T., Harford, N., Vanderbruge, D.,Descurieux, M., Van Opstal, 0., Van Wijnedaele, F., Hauser, P., Voet, P. and De Wilde, M. Expression of different forms of hepatitis B yirusenvelope proteins in yeast. In Zukerman, A.J. (Ed) Viral Hepatitis and Liver Disease. Liss New York, (1988a) 304-308.

3. Rutgers, T., Gordon, D., Gathoye, A.M., Hollingdale, M., Hockmeyer, W., Rosenberg, M. and De Wilde, M. Hepatitis B surface antigen as carrier matrix for the repetitive epitope of the circumsporozite protein of Plasmodium falciparaum. Bio/Technology 6 (1988b) 1065-1070. 4. Delpeyroux, F. , Chenciner, N., Lim, A., Malpiece, Y., Blondel, B,m Crainic, R., Van der Werf, S. and Streeck, R.E. A poliovirus neutralization epitope expressed on hybrid hepatitis B surface antigen particles. Science 233 (1986) 472-475.

5. Clarke, B.E., Newton, S.E., Caroll, A.R., Francis, M.J., Appelyard, G., Syred, A.D., Highfield, P.E., Rowlands, D.J. and Brown, F. Improved immunogenicity of a peptide epitope after fusion to hepatitis B core protein, Nature 330 (1987) 381-384.

6. Evans, D.J., McKeating, J., Meredith, J.M., Burke, K.L., Katrak, K. , John, A., Ferguson, M. , Minor, P.D., Weiss, R.A. and Almond, J.W. An engineered poliovirus chimaera elicits broadly reactive HIV-1 neutralizing antibodies. Nature, 339 (1989) 385- 388.

7. Adams, S.E., Dawson, K. , Gull, K., Kingsman, S.M. and Kingsman, A.J. The expression of hybrid HiV-TY virus-like particles in yeast. Nature 329 (1987) 68-71

8. Hayes, J.R., Cunningham, J., Seefried, A.V., Lennick, M. , Garvin, R.T. and Shen, S.H.

Development of a genetically engineered candidate poliovaccine employing the self-assembly properties of the tobacco mosaic virus coat protein. Bio/Technology 4 (1986) 637-641. 9. Jennings, P.A., Bills, M.M., Irving, D.O. and Mattick, J.S. Fimbriae of Bacteriodes nodosous: Protein engineering of the structural subunit for the productions of exogenous peptide. Protein Engineering, 2 (1989) 365- 369.

10. Wu, J.Y., Newton, S., Judd, A., Stocker, B. and Robinson, W.S. Expression of immunogenic epitopes of hepatitis B surface antigen with hybrid flagellin proteins by a vaccine strain of Salmonella. Proc. Natl. Acad. Sci. (USA) 86 (1989) 4726-4730.

11. Shukla, D.D., Strike, P.M., Tracy, S.L., Gough, K.H. and Ward, C.W. The N and C termini of the coat proteins of potyviruses are surface located and the N terminus contains the major virus specific epitopes. J. Gen. Virol. 69, (1988) 1497-1508.

12. McDonald, J.G. and Bancroft, J.B. Assembly studies on Potato Virus Y and its coat protein. J. Gen.

Virol. 35 (1977) 251-263.

13. McDonald, J.G., Beveridge, T.J. and Bancroft, J.B. Self-assembly of protein from a flexuous virus. Virology 69 (1976) 327-331.

14. Shukla, D.D. and Ward, C.W. Structure of portyviruses coat proteins and its applications in the taxonomy of the potyvirus group. Adv. in Virus Res. 36, (1989) 273-314.

15. Gough, K.H., Azad, A.A., Hanna, P.J. and Shukla, D.D. Nucleotide sequence of the capsid and nuclear inclusion protein genes from the Johnson Grass strain of Sugar-cane Virus RNA. J. Gen. Virol (1987) 68, 297-304.

16. Maniatis, T., Fritsch, E.F. and Sambrook, J. Molecular cloning. A Laboratory manual. (1982) Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

17. Laemmli, U.K. Cleavage of structural proteins during assembly of the head of the bacteriophage T4. Nature 227 (1970) 680-685.

18. Harlow, E. and Lane, D. Antibodies A Laboratory Manual (1988) Cold Spring Harbor Laboratory, NY. 19. Shukla, D.D., Tribbick. G. . Mason, T.J., Hewish,

D.R., Geysen, H.M. and Ward, C.W. Localization of virus-specific and group specific epitopes of plant potyviruses by sytematic immunochemical analysis of overlapping peptide fragments. Proc. Natl. Acad. Sci. (USA) 86 (1989) 8192-8196. 20. Ammerer, F. Gene expression in yeast with the ADCl promoter. Methods in Enzymol. 101 (1983) 192-201.

21. Ito, H., Fukuda, Y. , Murata, K. and Kimura, A. Transformations of intact yeast cells treated with alkali cations. J. Bacteriol. 152 (1983) 163-168.

22. Adams, S.E., Mellor, J., Gull, K. , Sim, R.B., Tuite, M.F., Kingsman, S.M. and Kingsman, A.J. The functions and relationships of Ty-VLP proteins in yeast reflect those of mammalian retroviral proteins. Cell (1987) 49, 111-119.

23. Muller, F. , Druhl, K.H., Frieidel, K., Kowallik, K.V. and Ciriacy, M. Processing of TY1 proteins and formation of TY1 virus-like particles in Saccharo vces cerevisiae. Molec. Gen. Gent. 207 (1987) 421-429. 24. Smith, D.B. and Johnson, K.S. Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione-S- transferase. Gene 67 (1988) 31-40. 25. Smith, D.B., Davern, K.M. , Board, P.G., Tu, W.U.,

Garcia, E.G. and Mitchell, G.F. Mr. 26,000 antigen of Schistosoma iaponicum recognisded by resistant WEHI 129/J mice is a parasite glutathione-s- transferase. Proc. Natl. Acad. Sci. (USA) 83 (1986) 8703-8707.

26. Chaudhary, V.K. , Queen, C, Junghans, R.B.,

Waldmann, T.A., Fitzerald, D.J. and Pastan, I. A recombinant immunotoxin consisting of two antibody variable domains fused to Pseudomonas exotoxin. Nature (1989) 339, 394-397.

Claims

1. A potyvirus coat protein wherein the N-terminal and/or C-terminal domain is replaced or partly replaced with one or more foreign polypeptides.

2. A potyvirus coat protein according to claim 1 wherein said foreign polypeptides comprise all or part of one or more bacterial, viral or parasitic antigens.

3. A potyvirus coat protein according to claim 1 wherein said one or more foreign polypeptides are selected from the hormones, growth factors, cytokines or lymphokines.

4. A potyvirus coat protein according to claim 1 wherein the N-terminal domain is replaced with a foreign polypeptide sequence having up to 177 amino acids.

5. A polymer or a high molecular weight aggregate of potyvirus coat proteins according to any one of claims 1 to 4.

6. A vaccine which comprises a potyvirus coat protein or polymer or high molecular aggregate thereof, wherein the N-terminal and/or C-terminal domain of the coat protein is replaced or partly replaced with one or more bacterial, viral or parasitic antigens or parts thereof, in association with a pharmaceutically, veterinarially, or agriculturally acceptable carrier.

7. A nucleic acid sequence encoding a potyvirus coat protein, characterised in that the nucleotide sequence encoding the N-terminal and/or C-terminal domains thereof is replaced either wholly or in part by one or more nucleotide sequences encoding one or more foreign polypeptides or parts thereof.

8. A nucleic acid sequence according to claim 7 wherein said one or more nucleotide sequences encode all or part of one or more bacterial, viral or parasitic antigens.

9. A nucleic acid sequence according to claim 7 wherein said one or more nucleotide sequences encode all or part of one or more hormones, growth factors, cytokines or lymphokines.

10. A nucleic acid sequence according to claim 7 wherein a leader sequence is located upstream of the sequence encoding the coat protein to facilitate secretion of said coat protein from a host cell.

11. A nucleic acid sequence according to claim 7 which includes a transcriptional promoter capable of driving transcription of potyvirus coat protein mRNA.

12. A vector containing a nucleic acid sequence encoding the coat protein of potyvirus, characterised in that the nucleotide sequence encoding the N-terminal and/or C- terminal domains of the coat protein is replaced either wholly or in part by one or more nucleic acid sequences encoding one or more foreign polypeptides or parts thereof.

13. A vector according to claim 12 wherein said one or more foreign polypeptides encode all the part of one or more bacterial, viral or parasitic antigens.

14. A vector according to claim 12 wherein said one or more foreign polypeptides encode all or part of one or more hormones, growth factors, cytokines or lymphokines.

15. A vector according to any one of claims 12 to 14 wherein said vector is in the form of DNA, or RNA, and is either single or double stranded.

16. A vector according to claim 12 which is a plasmid.

17. A vector according to any one of claims 12 to 16 which includes a detectable marker.

18. A vector according to claim 17 wherein said detectable marker is a gene which confers resistance to one or more antibiotics.

19. A vector according to claim 17 wherein said selector marker encodes a detectable polypeptide.

20. A host cell which contains a potyvirus coat protein or polymer thereof according to any one of claims 1 to 5.

21. A host cell which contains a nucleic acid sequence according to any one of claims 7 to 11.

22 A host cell which contains a vector according to any one of claims 12 to 19.

23. A host cell according to claim 21 wherein said nucleic acid sequence is integrated into the genome of the host cell or is carried on an extra-chromosomal element.