JPH05506145A - Self-polymerization expression system based on modified potyvirus coat protein - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] 23. The nucleic acid sequence is integrated into the genome of the host cell or is attached to an extrachromosomal element. 22. A host cell according to claim 21, wherein the host cell is carried.

Specification A self-polymerizing expression system based on a modified potyvirus coat protein. With respect to polypeptides, more specifically, if the naturally occurring amino acid sequence is a foreign polypeptide, potyvirus coat protein, its polymer or its aggregate, and vaccines containing them. The present invention further provides mutant potyviruses. A gene sequence encoding the protein coat protein, a vector containing the same, and a vector containing the same. Relating to host cells containing vectors.

Genetically engineered subunit vaccines are safe, reliable, and It is also cheaper than normal live or attenuated vaccines. Any type of vaccine Even in cases where the final structure of the molecule presented is critical to its effectiveness in eliciting a host immune response. It is essential. Multiple copies of host protective immunogenic proteins or immune-preferred epitopes only Virus-like particles containing It would be effective. In addition to protecting against infectious agents, immunological techniques now provide protection against reproductive health. In order to perform operations that improve force control and production behavior to normal secret functions. Applied. Hormones and small polypeptide molecules are known to be poor immunogens. The immune response to these molecules is often due to the multiplexing of these small molecules. Copies presented on their own or in combination with associated lymphokines It appears that this can be augmented by polymerized virus-like carrier proteins.

Traditionally, hepatitis B virus ( 1-5), poliovirus (6), Ty element (7), tobacco mosaic virus coat protein (8) or prokaryotic villin (9) and flagellin (10). Vaccines in which a carrier molecule, such as a cabundo protein, presents an immune-preferred epitope was used as. However, without destroying the self-organizing nature of the carrier molecules, The available sites related to the addition and size of foreign sequences that can be added are as follows. All systems are subject to constraints. In addition, icosahedral virus-like particles (HB Organized unique structures in V, polio, and TY) are resistant to triggering of the host's immune system. Preventing proper surface exposure of important immune-preferred epitopes that are essential for There are times when

Pottyviruses are the largest of the 34 plant virus groups and consist of 175 viruses. (potyviruses) are long, curved, rod-shaped particles (Figure 1). each Viral particles are approximately 2000 pieces, each containing one terminal strand with a length of 1Qkb + a polar RNA genome. It is composed of the coat protein of a single species of P. pea.

Immunostructural analysis of six potyviruses gently treated with trypunine. exposed the N- and C-terminal regions of the coat protein to the surface of the virus particle. (11).

In vitro tests have shown that high salt concentrations or low p) ((below 6,0) or high pH (9, Potato Y virus, a type member of the genus Potyvirus, It has been shown that the protein can be dissociated into coat protein monomers. These are then , in the presence or absence of the viral genome by adjusting the salt concentration and pH. They can reassemble into long curved rods of the correct size (12.13). This is 7 -8m coat protein monomers form ring-like structures, and these rings Some of them are fully-length virus-like particles in the presence or absence of RNA, respectively. or stacked ring particles ).

Furthermore, in some comparative studies of potyviruses, the envelope protein (263-3 30 amino acid residues) with various N-terminal regions and highly conserved core and C-terminal regions. It was shown that it is composed of two regions (11, 14). The length of the N-terminal region is 30-177 amino acid residues), and its sequence also varies, but on the other hand , the core (216-218 amino acid residues) and C-terminal region (18 -20 amino acid residues 1&) are similar in length and have significant sequence homology (65% ) (14).

The present invention is characterized in that coat protein monomers are organized or polymerized into high molecular weight polymers. -affecting the intrinsic organizing ability or polymerization ability of the monomer to form an aggregated structure or aggregates. Proteins N and/or C of the coat protein of potyvirus give This is based on the knowledge that the terminal region can be replaced with a foreign polypeptide. It is.

In one aspect, the present invention provides that the N-terminal and/or C-terminal domain Botyvirus coat proteins substituted or partially substituted with peptides are also provided. It is.

Another aspect of the present invention is that the N-terminal and/or C-terminal regions are foreign polypeptides. Polymer of potyvirus coat protein substituted or partially substituted with Or it provides a high molecular weight aggregate.

The entire N- or C-terminal domain of the coat protein contains a foreign protein polypeptide. can be replaced with These can be called mutant coat proteins. Ru. Alternatively, selected portions thereof may be replaced with foreign polypeptide sequences. . The substituted foreign polypeptide sequence contains the same number of amino acids as the deleted N- or C-terminal sequence. Can contain amino acids, or contain more or less amino acids be able to. For example, potyvirus with an N-terminal domain of 177 amino acids In the Japanese coat protein, the entire 177 amino acid domain was deleted; a foreign polypeptide sequence or sequence group of amino acids of or greater than Can be replaced. Preferably within the variable N-terminal region of the potyvirus. (As mentioned above, various potyvirus strains It has an N-terminal domain of 77 amino acids). N- and/or coat protein or a foreign polypeptide sequence containing a C-terminal domain may contain one or more Bacterial, viral or parasitic antigens, parts or repeats thereof, or species thereof It can contain all or part of a combination of each. foreign polypeptide sequence The main body of the invention is not limited to this invention. These are also normal endocrine mechanisms. Peptide hormones, growth factors, and cytokines to induce immunological regulation of or may contain all or some of the lymphokines, or may stimulate the immune response. to increase other protein, peptide, polypeptide or infectious agent antigens. can contain. Similarly, the number of amino acids contained in a foreign polypeptide sequence The resulting mutant coat protein is polymerized or aggregated into a high molecular weight form. unimportant as long as the ability to become The term "polypeptide" In the specification, it is used in its broadest sense, e.g., having up to 50 amino acids. and polypeptides having from 50 to 1 x 106 or more amino acids. means a peptide or protein. The difference between peptides and polypeptides is It is clear that it is arbitrary based only on the number of amino acids.

The polymerized or high molecular weight form of the mutated coat protein can lead to high molecular weight aggregation. Under conditions suitable for organization into a body, e.g. 10-100 iM NaPO4, Mix mutant coat monomers at pH 7°2 and 100mM NaC at 44°C. It is formed by

As previously mentioned, the coat protein has three regions or domains: the N-terminus, the core and C-terminus. The core domain of various potyvirus strains is have considerable sequence homology (65%) and similar length (216-218 amino acids). are doing. The core domain of the coat protein embodied by the present invention is virus, or by one or more amino acid substitutions, insertions or deletions. One known core domain of the potyvirus mutants generated is A mutant core domain like the natural (non-mutated) potyvirus domain corresponds to a core domain, which can be polymerized or organized into high molecular weight aggregates in the same way as are doing.

Another object of the present invention is to provide potyvirus coat proteins or polymers or polymers thereof. Molecular weight aggregates comprising the N-terminal and/or C-terminal domains of the coat protein. one or more bacterial, viral or parasitic antigens, parts thereof, or repeats thereof; Items that have been replaced or partially replaced with returned items and/or combinations thereof. together with a pharmaceutically, veterinarily or agriculturally acceptable carrier. It provides: The pharmaceutical and veterinary carriers may be the same or different (e.g., saline). Water, glucose, buffers, water, and other carriers or combinations thereof known to those skilled in the art. These include, for example, Remingto, edited by Osol et al. n's Pharmaceutical 5 Sciences 16th edition, 19 80. Matsushi Publishing Co., these are cited by Included herein. Agronomically acceptable carriers include water, silica and those skilled in the art. may contain other materials or combinations thereof that are well known in the art.

The present invention also relates to a nucleic acid sequence encoding a potyvirus coat protein, which one or more nucleotide sequences encoding the N and/or C-domains of one or more foreign polypeptides encoding a foreign polypeptide, a portion thereof, or a repeat thereof. characterized in that all or part of it is replaced by the above nucleotide sequence. Concerning nucleic acid sequences. This nucleotide sequence is DNA or RNA, and one It may be either a strand or a double strand. The foreign polypeptide is a virus as defined above, bacterial and/or parasitic antigens, hormones, growth factors, cytokines or lymphocytic or other proteins that elicit an immune response.

The DNA sequence is such that the coat protein can be secreted from bacteria or other host cells. including a leader sequence at the 5' end of or upstream of the coat protein encoding sequence. transcription of downstream sequences by incubation with RNA polymerase. A driving promoter can be included. The term "promoter" is used herein as In its broadest sense, it binds to RNA polymerase and then It refers to any DNA sequence that can be transcribed. Main departure Promoters that are suitable for specific use include bacterial, eukaryotic, or viral promoters. promoters, or promoters of parasitic origin, but these are just examples. This is an indication. The only criteria for such promoters is the linked This means that downstream sequences can be transcribed.

The invention further comprises a nucleic acid sequence encoding a potyvirus coat protein. a vector encoding the N- and/or C-domain sequence that encodes one or more polypeptides, portions thereof, or repeats thereof. be replaced in whole or in part by one or more nucleic acid sequences encoding Provided is a vector characterized by the following. This vector can be either DNA or RNA. It may be in any form, either single-stranded or double-stranded. The vector of the present invention is covalently linked. a closed circle, e.g. a plasmid, or a linear or non-circular DNA or R It can take the form of NA. Vectors encompassed by the present invention include a selection marker, for inserting one or more promoters and desired nucleotide sequences; generally contain one or more restriction endonuclease cleavage sites. That would be the point.

The term "selectable marker" is used herein in its broadest sense; any chemical or biochemical marker carried or encoded on the vector. Taste. Suitable detectable markers include resistance to antibiotics or There are enzymes or chemicals that can cause a detection reaction when provided with a substance.

This includes, for example, ampicillin, streptomycin, penicillin, tetracycline, Resistance to clin, kanamycin, etc., and β-galactosidase, alkaline Examples include phosphatase and urease.

The above vectors can function as expression vectors in suitable host cells. Therefore, as described herein, the mutant coat protein is removed from the host cell. It is excreted into the surrounding culture medium or taken up into the host cell itself and is involved in its cell lysis. more liberated. Therefore, a further object of the present invention is to or the C-terminal domain is mediated by one or more foreign polypeptides as described above. Botivirus coat protein characterized in that all or part of The purpose of the present invention is to provide a host cell containing an expression vector encoding a protein. Ru.

Suitable host cells include E. coli, Basill Bacteria such as S. us) or Pseudomonas, S. cerevisiae S. cerevisiae, K. luyueromyces Ia yeast such as ctis%P1chia, and/or fungal, plant or mammalian cells Examples include higher eukaryotic cells such as. expression vector or host cell itself The exact nature or type is not important to the invention (the above mutant coat protein Any desired host cell capable of replicating a suitable expression vector encoding the quality can be used. can be used. Suitable host cells are readily determined by methods well known to those skilled in the art. and a suitable vector is constructed for replication in the desired host cell.

The present invention will be further explained with reference to drawings and examples, which are merely examples. This is an illustration and is not intended as a limitation of the invention.

Drawing description Figure 1 shows lysyl endopeptidase (lysyl endopeptidase). e), dissociation in the presence of formic acid and dialysis against water, then 10 m M NaPO, pH 7°2 + permeability to buffer containing 100mM NaCl (a) wild-type JGMV particles, (b) trypsin-treated JG after analysis. Shows electron micrographs of MV particles and (c) reconstructed JGMV particles. . Bar = 0. It is 05 μm.

Figure 2 shows the C-terminal region of the distal NIb gene (15) as well as the JGMV envelope region. The protein nucleotide sequence (in square brackets) is shown. It at the 5゛ and 3゛ ends The recognition sequences of BgllI and 5caI restriction enzymes are underlined. . Arrows indicate trypsin cleavage sites.

Figure 3 shows site-specific changes made in the N-terminal region of the coat protein. . Figure 3a shows the N, core and C-terminal regions of the coat protein and the C-terminus of the Nib gene. Indicates the area. QS indicates the proteolytic cleavage site of the polyprotein. N1 co Trypsin (KK, DKD and ERHT) and Ri The silendopeptidase (KKDKD) site is shown. * is the translation stop code The N-terminal region of the coat protein (MCS: multiple cloning protein) is shown. area). A portion (M) that appears to be a translation initiation codon is also shown. cp-> is the envelope data Indicates the beginning of the quality coding area.

Figure 4a shows the E. coli expression vector pTTQ19:CP with the relevant control Shown with restriction enzyme site. ptac is a synthetic tac promoter, CP is an external rrnB 112 is the E. coli rrnB operon transcriptional protein. LacIq is the Lac represson gene (represson). gene), LacZ contains the β-galacto/dase α-fragment gene, and Ori contains the complex gene. AMP represents the origin of production, and AMP represents the ampicillin resistance gene, respectively.

Figure 4b shows the yeast expression vector pAAH5:CP with relevant restriction enzyme sites. Both are shown. P is ADCI promoter, CP is coat protein, T is AD Cl terminator-1Ori is a small origin of replication, AMP is an ampicillin resistance gene , LEU2 is S, S. cerevisiae leucine 2 gene, 2μ is yeast replication origin, and each represents.

Figure 5 shows the purified truncate of trypsin-treated JGMV particles. d) Polyclonal antiserum JG raised against CP core: (a) E. coli and (b) S. cerevisiae used as a tube. Immunoplot analysis of CP expressed in The band is horseradish peruo Visualized by oxidase reaction.

(a) Lanes 1 and 2 are freeze-dried cp purified from JGMV, lane 3 is E and c oliDHI, lane 4 is DHI/pTTQ19, lane 5.6 is DHI/pT TQ19: CP, lane 7 is size standard, lane 8.9 is purified stored at 4°C JGMV samples are shown, respectively. Lanes 2.6 and 9 are lysyl endopep. Contains extract treated with tidase. Solid lines and white arrows indicate complete The full-length CP and its N-terminus are deleted (CP is shown).

(b) Lane 1 is lyophilized CP Rune 2.6 is the size standard, Lane 3 is JHR YI-5D/pAAH5, lane 4.5 is JHRYl-5D/pAAH5:CP Rune 7.8 shows JGMV stored at 4°C. Lane 5 and 7 contain samples treated with lysyl endopeptidase.

Figure 6 shows CP material derived from S. Cerevishi 7JHRYI-5D/pAAH5:CP. Figure 2 shows the sedimentation separation of samples on a sucrose density gradient.

’ (a) (b) Analyze samples for each third fraction by immunoplotting did. Vertical I Plot both segments (a) of the initial sucrose gradient indicated by the horizontal lines between the straight arrows. and centrifuged on the second gradient (b). the second indicated by the horizontal line between the arrows; Gradient fractions were pooled and dialyzed. Lane 1 is JGMV, lane 2 is size standard It shows. The last lane in gel (b) is the pooled sample from the first gradient. Sample part of pellet produced by centrifuging for 1 hour at 05,0OOrp Contains minutes. (c)) is a cross-section of some representative fractions obtained during purification. - Massie blue stained gel, and (d) its immunoplot. Lane 1 is J GMV particle protein 2, L10 is the size standard, lane 3 is the total extract , lane 4 is the supernatant fraction after centrifugation at 3000 rpm, lane 5 is the supernatant fraction of Fig. 3b. Similar to the right lane, lane 6 is the pooled fraction from the second gradient, lane 7. 8, the pooled fractions derived from the second gradient were centrifuged at 100.0 OOrp. The pellet fraction and supernatant fraction after the treatment, lane 9 is from JHRYI-5D/pAAH5. The total extracts of each species are shown, respectively. Open arrow indicates full length CP band .

Figure 7 shows the results from E. coli (aSb and e) and S. cerevisiae (c). An electron micrograph of PVLP is shown. JGMV particles purified from plants are shown in panel d. It shows. E. coli-derived PVLP and [JGMV modified by G'# (60%) and then 10mM phosphate buffer containing 100M NaCl pH 7.2. Decorated with JG:AS of PVLP, which was reconstituted after dialysis (4°C) against The results are shown in panels e and f, respectively. In panels b-f, bar=0.0 It is 5 μm.

Figure 8 shows the E. coli expression vector pGEX3:CoPc with the relevant control It is shown together with the restriction enzyme site. tac P is the synthetic tac promoter, 5 j26 is glutathione-s-transferase (GST) Schist osom japonicum, ■ indicates multiple cloning site and factor Xa opening. C0PC indicates the core and C-terminal regions of the coat protein, respectively. There is. The remaining abbreviations have the same meanings as above.

Figure 9 shows sj26(GST)-CoP expressed in E. coli DHl. Analysis results of 5DS-P AGGE (a) and Western plot (b) of c It shows results. The obtained nitrocellulose plot was analyzed with antiserum (JG: core, probed by As).

MW, molecular weight marker; V-J GMV; 355. +o, sonication E, Purified GST-CoPc obtained from the 10.000 rpm supernatant fraction of E. coli extract. 5 and 10ul: 3p”.

', IO, 10,00 Qrpm Purified GST-CoPc obtained from Heret fraction 2.5 and 10 ur: 3T, DHI/pGEX3: CoPc-derived total tan Protein extract, XT.

Total protein extract from DHI/pGEX3.

Figure 10 shows the GST-CoPc fusion protein expressed by E. coli. Electron microscopy of rod-shaped PVLPs obtained by self-assembly This is a mirror photo. Bar=Q, 05u.

Figure 11 shows the expression vector pGEX3:L:CoPc combined with the relevant restriction enzymes. It is shown with the parts. L is an 18 amino acid long linker (hinge) sequence. ,C.

Pc represents the core and C-terminal region of the coat protein, ■ represents the multiple cloning and The a-factor cleavage site is indicated. The remaining abbreviations have the same meanings as above.

Figure 12a shows the anti-GST-L-CoPc expressed in E. coli DHl. Serum JG: Plasma with antiserum against core As and GST (GST, As) Shows the results of lobed 5DS-PAGE and Western plot analysis. . The corresponding Coomassiegel is also shown. Lane: Jg, JGMV; MW, min 10,000 rpm Pepsi of molecular marker A3p, sonicated E. coli extract. DH1/pC purified from the let fraction; EX3: CoPc-protein; 3s , DHI/pGEX3 purified from 10,000 rpm supernatant: CoPc-ta Protein; 50p, 10. DHI/pGEX purified from OOOrpm pellet 3: L: CoPc-protein; 50s, 10゜000 rpm from supernatant Purified DH1/pGEX3:L:CoPc-protein; GSTSE, co A sample of GST purified from li.

Figure 13 shows the self-assembly of GST-L-CoPc expressed in E. coli. This figure shows an electron micrograph of the particles obtained. GST-CoPc self edition Particles obtained by synthesis and full-length coat protein expressed in E. coli Also exemplified is o Bar=0. 05a TrL.

Example I Portion of N- and C-terminally absent coat protein monomers into potyvirus-like particles Rimmerization JGMV (John Son Blais mosaic virus, belonging to the group of potyviruses), Sylendopeptidase cleaves after the 68th amino acid residue and deletes the N-terminus. (68a a), and trypsin was added to the 68th amino acid and the 268th amino acid. Cleavage after the amino acid residue removes the N (68a　a) and C-terminus (18a　a). It has been previously shown that each of these two methods (11) The remaining part of the particle is 2 It is 18 amino acids long and is called the core part of the coat protein. Morphologically, The enzyme-treated particles were similar to untreated JGMV particles under an electron microscope. (Figure 1 a and b), which means that the N and C termini are in the shape of the virus. This suggests that it may not be necessary for ecological stability.

The core of the coat protein is used to polymerize into potyvirus-like particles (PVLP). Lysyl endopeptidase or Wild-type JGMV particles gently treated with lipsin were incubated in the presence of formic acid (60% V/V). The cells were then incubated in the presence of a host to disassemble (disassemble) them. Then, the dissociated protein water, then 10mM NaPO4 pH 7.2 and 100mM NaCl. The cells were dialyzed for 54 hours against a buffer solution (4°C). Determined by electron microscopy analysis These proteins were shown to rearrange to form botivirus-like particles. (Figure 1C). These particles have a stacked ring structure, are long (curved, and have a geometries). demonstrated the property of potyviruses being organized in the absence of a nomome (12.13).

Example 2 Cloning, expression and expression of full-length JGMV coat protein in E. coli and polymerization Co-terminus of full-length coat protein and reduced nuclear inclusion protein (NIb) The synthetic cDNA fragment encoding the code has already been cloned and sequenced (15 , Fig. 2, Fig. 3a). The BglII-5caI fragment encoding this sequence was cloned into the multipurpose E, coli vector pT3T718U (Pharmacia), pT3T718U: BglII-ScaI was obtained. To many potyviruses Amino acid sequence analysis of purified coat protein related to polyprotein Proteolytic processing occurs between QSSQG or QA residues and coat protein It was determined that the quality was separated from NIb. Contains only coat protein sequences In order to express clones that (CAG) was changed to M(ATG). -8 to 113th place Ba■H1 limit error nuclease cleavage site and at the same time for efficient transcription initiation in yeast. In order to introduce base A to the 13th position, 43a + er's bly? -[5' GA AGATGTGGTGGATweakAGAAΔATATGGC^α;CATTGAG G^TG3’]■■ (jFIab diagram). Recommended by Bio-Rad According to the operating instructions, a single cell was isolated from the RZ 1032 (dat-ung') strain of E. coli. Using the single-stranded DNA of pT3T718U:BgllI-3caI, Gonucleotide mutations were performed. Base changes can be detected using restriction enzymes and DNA sequence analysis. I confirmed it more. This construct was named SCMBI-1. full-length coat protein The BamHI-BalI fragment encoding the pol quality was isolated from SCMBl-1 and Filled with IK, pTTQ19 (Amersian) pot IK filled Ba Cloned into mHI-ScaI site to generate pTTQ19:CP (No. Figure 3d, Figure 4). pTTQ19 contains an IPTG-inducible tac promoter There is. pTTQ19: Used in CP to clone the coat protein gene From the multiple cloning site located upstream of the BamHI-5Ila1 site 16 amino acids, 12 produced and 4 derived from the C-terminal region of the Nlb gene. The amino acid would have been added to the N-terminus (Figure 3a and d).

To construct a cell-free assembly system for the potyvirus coat protein, standard E. coli using the expression vector pTTQ19:CP according to the method (16) DHI was transformed. E, co grown in LB + ampicillin (37°C) li DHI/pTTQ19:CP overnight culture diluted 1=50 in fresh medium After growing for 1 hour, 500 μM of IPTG (final concentration) was added and further incubated at 37°C for 9 hours. Induction was achieved by incubating for 0-120 minutes. 1 volume of culture (approximately O D. . = 0.52) and loaded with loading buffer (6011M Tri S-Hel pH 7,5, 2% SDS, 10% glycerin, 5% β-mercaptoester Tanol, 0.001% bromophenol blue) 100μ! resuspended in Boiled for 3 min and a 10-20 μm aliquot used for 5DS-PAGE analysis (17 ). Separated proteins were electrophoretically transferred to nitrocellulose membranes. this membrane was processed using standard immunoplotting procedures (18) to detect JGMV envelope proteins. Rabbit polyclonal antiserum (JG : core AS). Horseradish peroxidase [5ilen Bands can be visualized by [Us] or alkaline phosphatase [Prosega] reaction. I woke up. Prestained protein molecular weight markers obtained from BRL (range 14, 000-200,000) was used.

E. coli DHI/pTTQ19: 5D protein extract derived from CP When subjected to S-PAGE and Western plot analysis, CP was found to be It was shown that it was synthesized in Here, antiserum JG: reacts with core AS. There were two major bands. The larger of these, Nokurado, is a natural CP ( 34kDa), which is probably due to the 16 amino acids at the N-terminus. This is probably because it is added (Figure 3a). Also, the size is relatively small. A core protein-specific band is also present, which is associated with plant-transmitted virus preparations. It is presumed that it is produced by partial degradation of the full-length coat protein, as observed in (11). Relatively small proteins also play a role in translation during gene expression. It also appeared to occur by internal initiation or prematuration termination. E.coli Expression vector pTTQ1 lacking DHI or coat protein coding region In the lane containing the protein extract from E. coli DHI containing 9, No coat protein-specific band was detected (Fig. 5a).

The coat protein expressed in E. coli is folded into correct monomers. or in a manner that resists cleavage of the core part of the coat protein. Protein extracts were lysed to test whether they are organized into rus-like particles. It was subjected to endopeptidase treatment. 100 spheroplasts from E. coli μl (see below) was added to lysyl endopeptidase jfako Chem icals, Dallas, Texas] at room temperature in the presence or absence of 2-3 μg. Incubated for minutes. Purified JGMV particles in sterile water and pretreatment with formic acid. Purified coat protein, which had been denatured, dialyzed, and lyophilized, was used as a control. Ta. in a Beckman TL-100 ultracentrifuge using a TLAloo-20-tar. The enzyme-treated samples were centrifuged at 100.0 OOG for 8 minutes at 4°C. Obtained The pellet was resuspended in loading buffer, subjected to 5DS-PAGE and The analysis was performed using the turn plotting method. The results obtained are based on the coat protein part. (lanes 5 and 6 in Figure 5a). ). The size of this band is 26 kDa, and the purified JGMV particles treated with the enzyme (Fig. 5a, lanes 7 and 8). This is true for E. coli. We show that the morphology of the expressed coat protein is similar to the structure of JGMV particles. It is something. This further indicates that the N-terminal region is surface-exposed and that wild-type particles Similarly, coat protein monomers and lipids are susceptible to proteolytic attack. This suggests that the folding may even be folded. Purified JGMV without enzymes a 34 kDa band corresponding to the full length (Fig. 5a, lane 8), and Relatively large bands that may correspond to multiple forms of coat protein, and when stored at 4°C. It corresponds to the coat protein produced from the partial decomposition of virus particles. Contains a relatively small band (26 kDa or less) obtained. On the other hand, fermentation The JGMV particles (jlISa diagram, lane 7) treated with a major band of , minor multiple forms of uncleaved or partially cleaved coat protein, and Contains a small amount of coat protein of less than 26 kDa due to excessive enzymatic cleavage. ing.

Partially purified protein extract from E. coli containing coat protein enriched the fraction. Cells were obtained from 100 liters of the induced culture and mixed. 1 [20% sucrose, 100mM 1-Lith-HC1 pH 8, 0, 10 M ED Resuspend in 4 ml of 5 wg/ml lysozyme, add 80 μl of 5 wg/ml lysozyme, and resuspend at room temperature. After incubation for 10 minutes, it was incubated on ice for 15 minutes. obtained Resuspend the spheroplasts in 1 ml of sterile water and transfer them to Sepharose S-1000. It was subjected to column chromatography. Alternatively, mix spheroplasts I I[1001M Tris-H (JpH8, 20% sucrose, 105M MgC111 Resuspend in 10.4 ml of 1 μg/wing lDNase and ljg/mi'RNase. The mixture is turbid, further diluted with water to a final volume of 2 liters, and then column separated. The column is Monitored by absorbance at 280 nm. Collect peak fractions and incubate at 50K Spin down for 80 minutes at The analysis was carried out using the fitting method. For electron microscopy analysis, virus samples or E,c A portion of the extract from Oli was loaded onto a Formvar carbon-coated grid. child The grid was washed with 30 drops of phosphate buffer and 60 drops of deionized water. The obtained graph The lid was negatively stained with 1% uranyl acetate (pH 4) and subjected to Joel electron microscopy. I observed it in the mirror. By electron microscopy observation of the boule fraction containing the mantle tannocuriga , the presence of multiple potyvirus-like particles was demonstrated. These particles were long, curved, and All of them had lln-type width (Fig. 7 a, b). child The particles are composed of potyvirus coat protein monomers assembled in the absence of RNA. The stacked ring structure (5truc) is a feature of ture) (12). Capture virus particles on antiserum-coated grids E. coli DHI/pTTQ19: CP-derived Applied to crude extract. This procedure also produced similar results to those observed in the purified fraction. The presence of potyvirus-like particles was observed. Coding region for coat protein exists In protein extracts from strains containing the expression vector pTTQ19 that do not , such a structure was not observed. Finally, a decoration test (dec (oration test), the dissociated JGMV coat protein monomer Particles derived from E. coli that are similar to those derived by Decorate with antiserum JG:AS (antiserum raised against purified JGMV particles) (decoration) (Fig. 7e, f).

Example 3 ``J's addition'' ``Competition two, upper 2nd generation, 1 animal M fallen Toyomu otsuko μ cloning, structural expression and A Ba-layer H1-BalI fragment (No. Figures 3a, b) were isolated from the previously described plasmid SCMBI-1 and transformed with pollK. Filled in and cloned into the polIK filled Hindm site of pAAH5, pAAH5 : CP was generated (Figure 4b). Expression vector pAAH5 is constitutively expressed E. coli/enzyme containing the ADCI promoter and ADCI terminator This is the mother shuttle plasmid (20). Expression vector pAAH5:CP is S, SE Levisiae JHYR1-5Dα, Ieu2-3.112, his4-519, u It was introduced into ra3-52, trpl, and pep4-3. Yeast cells contain plasmids Y in the presence or absence of appropriate amino acids/nucleotides for selection and maintenance. Grown at 30°C in EPD or minimal medium. For yeast transformation, It The procedure described in O et al. (21) was used.

Yeast selective medium (histidine, uracil) was used to analyze yeast-expressed coat proteins. early to mid-logarithmic gain grown in minimal medium containing tryptophan and Reproductive phase (ODaae=0.2-1.5) cells 10 10 ChI! Pellet solution 1 (0.9M sorbitol, O, LM EDTA pH8,0,14■Mβ-mercaptoethanol and 10ch g/xi Zymolyase 100T) 1-10m Spheroplasts were resuspended in 100 ml of spheroplasts and incubated for 30-45 min at 37°C. was generated. Wash the spheroplasts with zymolyase-free solution I. and sterile water or soluble loading buffer (2% SDS, 1.5mM PMSF) , 100++/++j! Trasylol, 10% β-mel captoethanol, 15% glycerin and 0.05% bromophenol blue) Cells were lysed by resuspending in 0.1-1 gA. Using that portion amount, 5DS-PAGE analysis. In yeast, most coat proteins synthesized are approximately 3 It appeared to undergo specific cleavage to form a QkDa sized band. (Figure 5b, lane 4). Nevertheless, it corresponds to the full-length coat protein. A 34 kDa band could be recognized. This specific cleavage as occurs during protein extraction using enzyme-treated spheroplasts. Proteins can be extracted by homogenizing cells with glass peas. (See below). However, full-length mantle Smaller proteins expected to be produced by further partial breakdown of proteins There were a large number of coat protein-specific bands of a certain size. When treated with endopeptidase, the coat protein expressed in yeast The offspring were partially resistant to enzymatic cleavage (Fig. 5b, lanes 4 and 5) and therefore a correctly folded heptad shape, or just a bulge, as in E. coli. It was shown to have a virus-like structure.

To isolate botivirus-like particles from yeast, JHYRI-5D/pAAH5: The overnight culture of CP was diluted into 1 liter of yeast selection medium and further grown at 30°C. OD after 18 hours of development. . = 1.2. Cells were washed with 1x PBs (phosphate chloride). Wash once with buffered saline, pH 7.3, 0xoid) and re-incubate in IXPBS3t/ Suspend 6 g of glass peas (0,45-0,50 irises) and O-2M PMSF (Phenylmethylsulfonyl Shattered. The obtained cell extract was centrifuged at 3000 rpm for 5 minutes, and the supernatant was freshly drained. The resulting pellet was further extracted with IXPBS3 and centrifuged. Then, add 0.2M PMSFIO μl to both upper grooves and pool. did. Adams et al. (22) and Muller et al. The method described by (23) was followed extensively and the resulting extract was 10-4 It was subjected to 0% sucrose density gradient centrifugation. Collect the fraction from the upper part of the Western It was analyzed by the plotting method (Fig. 6 a, b). intact coat protein Both bulk-containing aliquots were pooled and subjected to a second sucrose density gradient centrifugation. two shi After sucrose gradient centrifugation, a partially purified fraction containing coat protein was obtained (Fig. 6c). , d). Fractions containing coat protein were pooled and diluted with 100 mM NaCl. 10M phosphate buffer with pH 7. Dialyzed against 2 at 4°C for 48 hours, or Directly analyzed by ultracentrifugation. Beckman using TLAloo-20-tar A volume of 100-50 μl was divided into 100 μl using a TL-100 centrifuge. 8 minutes at OOOG It was centrifuged (4°C). The resulting pellet was loaded slowly for electron microscopy analysis. solution or IXPBS or TEN buffer (Low M Tris-pH 7.5, 2mM 　EDT. A, resuspended in 100mM Na(J). By EM analysis, the above E. Potyvirus-like particles with a structure similar to E. coli-produced particles were observed. (Figure 7c). Also, E. Particles derived from yeast as well as particles derived from E. coli were also captured on antiserum-coated grids in immunoelectron microscopy and were used in antiserum decoration tests. It could be decorated with JG:AS.

Example 4 GEX3: Construction of CoPc, E. Expression of GST-CoPc in coii and polymerization The ability of the fusion coat protein to polymerize into potyvirus-like particles remains In order to test whether the retention of A JGMV coat protein was constructed containing foreign sequences.

The foreign sequence used here is Schistosoma japonicum. GST (glutathione-S-trans), a 26 kDa host-protective antigen derived from ferase). GST has been shown to be able to provide protection against schistosomiasis. (24, 25). In oligonucleotide mutation experiments, 5' CGG GTGGAACGAATTCTACAATG ACAAAGAAGGGATAAG Translation initiation ATG and EcoRI restriction enzyme using G3' 39mer primer The primary cleavage site was created using the N-terminal tryptic cleavage site in pT3T718U:Bglll-ScaI. 9 and 9 upstream of the lysyl endopeptidase cleavage site (KK and DKD), respectively. and into the 21 base region (Fig. 3a and C). The resulting construct was SCMEA7 It was named -1.

The EcoRI fragment derived from SCMEA7-1 was By cloning into the unique EcoR1 site of pGEX3:Co Pc was generated (CoPc is the coat protein and the C° terminal region of the coat protein). area). This fragment consists of the core region (218 aa) and the N-terminus of the coat protein. 7 amino acids from the end, 18 amino acids from the C-terminus, and a short length of 3' untranslated Contains all translation areas. pGEX3: CoPc construct (Figure 8) Consists of JGMV-CP containing its N-terminal 61aa replaced with ST However, the multiple cloning site and factor Xa cleavage site (24 bp) It is separate from that.

E. coli DHI/pGEX3: Protein extract derived from CoPc was Very high level analysis by OS-PAGE and Western plot analysis Expression of the GST-CoP fusion protein was observed. This is about 54kDa size and could be easily visualized by Coomassie gel staining (No. 9 Figure a). Western blot analysis showed that this fusion protein Antiserum raised against As and purified GST (GST.As) reacted. GST-CoPc fusion protein was absorbed into reduced glutathione agarose. (24). Unlike GST alone, sonicated E.co 10. of li extract. A very high percentage in the OOOrpm pellet fraction GST-CoPc was found, which means that GST is different from GST alone. This indicates that it has a physical form.

GST-CoPc fusion protein (using reduced glutathione agarose adsorption) Purified) is immunogenic, and the antiserum is effective in New Sealant white rabbits. This is proven by the fact that it was produced in

Electron microscopy analysis shows that hybrid GST-Code monomers are organized and stacked. It was observed that the virus forms overlapping rings, resulting in botivirus-like particles. (Figure 10). However, the particles may be natural particles or Il::, coli and compared to particles produced by expression of full-length coat protein in yeast. , the number is small, the length is short (200 nm), and the width is wide (22u ). The background is made of rings that cannot be easily stacked under the conditions used. There was agglomeration that could have caused the problem.

Example 5 pGEX3:L: Construction of CoPc, E. GST-L-C in coli Expression of oPc (in case of GST) folds into correct native conformation Therefore, we adopted it as a foreign protein (GS) that prevents it from becoming a potyvirus-like particle. T) can provide a curved hinge-like structure to minimize the possibility of Wear.

pGEX3:L:CoPc (Figure 11) was constructed as follows: Two complementary oligos 7-(5') of 51 bases encoding aa(SGGGG)' 　AAT.

TCC, GGA, GGC, GGT, GGC, TCA, GGc, GGT, GGA, GGC, TCG, GGT, GGC, GGCRGGT, TCT , 3') T array, each with EcoRI sticky end was synthesized. ; these oligomers were purified, mixed in equimolar amounts, annealed, and incubated at 85°C. Incubate in a water bath and then gradually cool to room temperature. Then 51b The p fragment was cloned into the EcoRI site of pGEX3. CoPc with EcoRI Partially severed. Southern hybridization followed by 5DS-PAG By screening positive clones by E. A clone (pGEX3: L: CoPc) was selected. Additional 17 amino acids of linker (hinge) 05-L-CoPc of about 2 kDa, which is larger than GST-CoPc by just hitting The fusion band is JG: core, As and GST, As antiserum is GST-CoPc A few botiviruses that are slightly larger overall than the particles obtained from the fusion protein. The existence of similar particles was shown.

Example 6 Coat tannos containing HTV epitopes and yeast copper metallothioneins. inserted into one terminal domain. Fusion protein in yeast and E. coli It was expressed.

Similarly, yeast-derived copper metallothionein protein was used as potyvirus coat protein. and expressed in yeast.

References 1. Valenzuela, P., Colt, D., Medina-3elb y,i[,A,,Kuo,C,H,,Van~est,G,, Burke , R, L, , Bull, P, , Urdea, M, S, and Grave s, P, V.

Antigen Manipulation in Yeast - Hybrid Hepatitis B Surface Antigen - Synthesis of Herpes Simplex 1gD Particles Construction and organization (＾ntigen engineering in yeast: 5 synthesis and assembly of hybrid hepa titis B 5 surface antigen-herpes simple ex IgD particles), Bio/Technolog3’3 (1985) 323-326°2, Rutgers, T., Cabezo u, T., ,Harford, N., ,Vanderbrugge, D., ,Desc. rieux, M,, Van 0pstal, O,, Van fijned aele, F,, Hauser, P, Voet.

Hepatitis B virus envelope of various forms of P, and Defilde, M. Expression of different particles in yeast forms of hepatitis B virusenvelope proteins in yeast) In Zukerman, AJ.

(Ed) Viral l1lepatitis and Liver Dis ease, Li5s New York, (1988a) 304-308° 3. Rutgers, T., Gordon, D., Gathoye, A.J. Hollingdale, l [,, Illockmeyer, ? ,, Ros enberg, M., and De filde, M., Pasmodium fal. Carrier Matrix for Repeated Epitopes of Circumsborozyte Protein of M. Hepatitis B surface antigen as a trix e antigen as carrier matrix for the repetitive epitope of the circuit sporo zite protein of Plas II lodium falcipa raua+) Bio/TechnologY 6 (1988b) 1065 -1070゜4, Delpeyroux, F, Chenciner, N,, Lim, ^,, Malpiece, Y, Blodel.

B, ta Crainic, R,, Van der *erf, S, and 5treeck, R, E, Variou expressed on hybrid hepatitis B surface antigen particles Virus neutralization epitope (^poliovirus neutralization) n epitope expressed on hybrid hepati tis B 5 surface antigen particles), 5c ience 233 (1986) 472-4755, C1arke, B. E., Newton, S.E., Carroll, A.R., Francis, M. , J, , ^ppelyard, G, , 5yred, A, D, , High field, P. E., Rowlands, D. J., and Brown, F. Immunization of peptide epitopes after fusion with hepatitis B coat protein Improved immunogenicity of ap eptide epitape after fusion to hepat itis B core protein:l, Nature 330 (19 87) 381-384° 8, Evans, DJ, McKeating, J, 1lered ith, 1. M, Burke, K, L, Kat Ni k, K, John, A, Ferguson, M, Minor , P, D, , feiss, RlA, and ^1mand, J,? , extensive Engineered poliovirus that induces reactive HIV-1 neutralizing antibodies (An engineered poliovirus chimaera elici ts broadly reactive HIV-1neutralizin g ar + tibodies), Nature, 339 (1989) 3 85-388°7, AdaIIls, S.E., Davrson, L., GuH. , , Kingsman, S, M, and Kingsman, A, J, Hybrid H Expression of 4v virus-like particles in yeast hybrid Hid-TY virus-1ike particles in yeast), Nature329 (1987) 6g-71 8, Hayes, J.R., Cunningham, J., 5eefri ed, A.J., Lennick, M., Garvin, R.T., and 5hen, S, H, Self-assembly property of coat protein of tobacco mosaic virus Development of genetically engineered polio vaccine candidates using opa+ent of a genetically engineered candidate poliovaccine employing the self-assembly properties of the tob acco mosaic virus coat protein), Bi o/Technology 4 (1986) 637-641゜ 9, Jennings, P. A., B111s, M. M., Irving, D. 0. and Mattick, J.S.

Bacteriodes nodosaurus tuft: structural subunit for the production of foreign peptides Fimbriae of Bacter protein engineering iodes nodosous: Protein engineering of the 5structural 5ubunit for the pr ductions of exogenous peptide, protect in Engineering, 2 (1989) 365-369°10, fu, J. Y., Newton, S., Judd, A., 5tocker, B. , and Robinson, 1. s.

, Hepatitis B using hybrid flagellin protein with Salmonella strain vaccine Expression of immunogenic epitopes on surface antigens ogenic epitopes of hepatitis B 5urfa ce antigen with hybrid flagellin pro teins by a vaccine 5 train of Salmone lla), Proc, Natl, Acad, Sci, (USA) 86 (1989) 4726-4730゜11, 5hukla, D, D,, 5 trike, F’, M,, Tracy, S, L,, Gough, K, IIl, and WarпB C11, the N and C termini of the potyvirus coat protein are located on the surface; The termini contain the major virus-specific epitopes (The Nand Cter mini of the coat proteins of potyvir uses are 5 surface located and the N te rminus contains the ll1ajor virus 5p ecific ■ pitopes), J, Gen, Virol, 69. (198g) 1 497-1508°12, 1IcDonald, J.G., and Bancroft. , J.B., Organizational studies in potato Y virus and its coat protein. (＾ssembly 5tudies on Potato Virus Y and its coat protein), J, Gen, Virol , 35 (1977) 251-263゜ 13. McDonald, J. G., Beveridge, T. J., and Ban. craft, J.B., Self-assembly of proteins derived from curved viruses (Self -assembly of protein from flexible virus), Virology 69 (1976) 327-331゜ 14, 5 Hukla, D. D. and Ward, C.1., Botivirus Envelope Ta Structure of proteins and its application to classification of botivirus groups of portyviruses coat proteins and i ts applications in the taxonomy of ts hepotyvirus group), Adv, in Virus Re s, 36. (1989) 273-314゜15, Gough, K.H. , ,Azad, A., A., ,Hanna, P.J., and 5hukla, D. D. Capsid and sugarcane viral RNA derived from Johnson grass strain. Nucleotide sequence of nuclear inclusion protein gene (Nucleotide 5eq uence of the capsid and nucleus sion protein genes from the Johnson Grass 5 train of Sugar-cane Virus RNA ), J, Gen, ViroL (1987) 68.297-304° 16, 31aniatis, T., Frltsch, E. F., and Sambro. ok, J, Molecular cloning, A Laborat ory manual, (1982) Co1d Spring Harbo r Laboratory, Colorado Spring Harbor, NY.

17. Lae+uli, U, during the organization stage of the head of bacteriophage T4. Cleavage of structural proteins proteinsduring assembly of the head of the bacteriophage T4), Nature227 (1970) 680-685゜1g, Harlov, E. and Lane, Dl, ＾ntibodies A Laboratory Manual ( 191ig) Cold Spring Harbor Laboratory, NY.

19, 5hukla, D., D., Ribbick, G., Mason, T. J., ,Bevish, D.R., ,Geysen.

H, II, and Ward, C1f, global immunochemical analysis of 9 overlapping peptide fragments. Location of virus-specific and group-specific epitopes of plant botiviruses by Localization of virus-specific and group 5 specificepitopes of plant pot yvirus=s by 5yteIllatic i+u+unochemi cal　an≠■ ysis of overlapping peptide fragment s), Proc, Natl, Acad.

Sci, (USA) 86 (1989) 8192-8196゜20, Ar Genes in yeast using the ntnerer, F, ADCI promoter Gene expression in yeast with the ADCI promoter), Methods in Enzymol , 101 (1983) 192-201゜21, rto, H,, Fuku da, Y, Murata, K, and Kimura, A, Alkali Transformation of intact public cells treated with cations s of 1ntact yeast cells treated with alkali cations), J. Bacteriol.

152 (1983) 163-168゜22, ＾dams, S, E,... Mellor, 1. , Gull, K, , Sin, R, B, , Tuf te, M, F,, jin gsman, S. M., and Kingsman, ^, J., TV- in yeast. The functions and interrelationships of VLP proteins are similar to those of mammalian retrovirus proteins. The functions and relationships ps of TyJLP proteins in yeast reflect those of matmtnarian retroviral pr oteins).

Ce1l (1987) 49.111-119゜23, 11u11er, F , ,Druhl, in ,B, ,Frleide1. In,,Kovallik.

K., V., and C1riacy, M., in Satucharomyces cerebinoae. TY1 protein processing and TYI virus-like particle formation (Pr ocessing of TYI proteins and formati on of TYI virus-1ike particles in Sa ccharomyces cerevisiae), Mo1ec, Gen, Gent, 207 (1987) 421-429゜ 24. Sm1th, D. B., and Johnson, K. S., Glutathione Polypeptide expressed in Escherichia coli as a fusion with N-8-transferase Single-step purification of polypeptides expressed 1n25, Sm1th, D, B, , Davern, K, il, , Board, P, G, , T u, f, U,, Garcia, d, G.

and l[1tcell, G, F, by resistant WEHI 129/J mice. The molecular weight 26,000 antigen of Cystocyma japonicum is recognized as a parasite. Glutathione-5-transferase (Mr, 26,000 antige n.

f Schistosoma japonicutm recognized by resistant fEIII 129/J high P ce is a parasite glutathione-s-trans ferase), Proc, Natl, Acad, Sci, (USA) 83 (1986) 8703-8707゜26, Chaudhary, V , ,Queen, C., ,Junghans, R.B., ,Waldmann,. T,^,, Fitzerald, DJ, and Pa5tan, 1. , pseudo Recombinant immunotoxin composed of two antibody variable domains fused to Monas exotoxin ＾recombinant i+a+aunotoxin consist ing of two antibody variable domains fused to Pseudomonas exotoxin), Nat ure (1989) 339.394-397゜1\+S1' +-1℃ ＼－＼－ゝ－ゝ－ ― ― GST-L-CoPc GST-L-CoPcGST-Coρ [full length] [P Summary book The N-terminal and/or C-terminal domains contain a foreign port that may encode an antigen of the pathogenic tissue. potyvirus coat protein substituted or partially substituted with a lipeptidase; and the nucleic acid sequences encoding the same. Potyvirus coat protein Proteins organize or polymerize into antigenic, high molecular weight structures or aggregates. Therefore , potyvirus coat protein or its high molecular weight aggregates in humans and animals. Useful as a vaccine.

international search report 0 shots luminary Ward, Colin Wesley Federation of Oheastralia 3103B Kutoria, No. 44 Avenue (Lewin, Winmei 1)

Claims (23)

[Claims] 1. Foreign polypeptides with one or more N-terminal and/or C-terminal domains Botevirus coat protein substituted or partially substituted with de. 2. If the foreign polypeptide is one or more bacterial, viral or parasitic antigens, The botevirus coat protein according to claim 1, which consists of all or a part thereof. 3. One or more foreign polypeptides or hormones, growth factors, cytokines or the botevirus coat protein according to claim 1 selected from lymphokines. quality. 4. The N-terminal domain is replaced with a foreign polypeptide having up to 177 amino acids. The botevirus coat protein according to claim 1, which has been modified. 5. Botevirus coat protein polypeptide according to any one of claims 1 to 4. polymers or high molecular weight aggregates. 6. Botevirus coat protein or its botevirus or high molecular weight aggregates A vaccine containing a pharmaceutically, veterinarily or agriculturally acceptable carrier. and the N-terminal and/or C-terminal domain of the coat protein is one or more. substituted or partially replaced with more than one bacterial, viral or parasitic antigen or part thereof; vaccines being replaced. 7. A nucleic acid sequence encoding a botevirus coat protein, the N- one or more nucleotide sequences encoding the terminal and/or C-terminal domains; one or more nucleotides encoding one or more foreign polypeptides or portions thereof; A nucleic acid sequence characterized in that it is wholly or partially replaced by a tide sequence. Column. 8. One or more bacteria, viruses with one or more nucleotide sequences or a nucleic acid sequence according to claim 7 encoding the whole or a part of a parasite antigen. . 9. One or more nucleotide sequences are associated with one or more hormones, growth Claims encoding all or part of a factor, cytokine or lymphokine Nucleic acid sequence according to item 7. 10. Coating the coat protein in order to secrete the coat protein from the host cell. 8. The nucleic acid sequence according to claim 7, wherein a leader sequence is located upstream of the coding sequence. 11. Transcriptional promoter capable of transcribing botevirus coat protein mRNA 8. The nucleic acid sequence according to claim 7, comprising a vector. 12. A vector containing a nucleic acid sequence encoding the coat protein of botevirus. a protein that encodes the N-terminal and/or C-terminal domain of the coat protein. A nucleotide sequence that encodes one or more foreign polypeptides or portions thereof. replaced in whole or in part by one or more encoding nucleic acid sequences A vector characterized by: 13. One or more foreign polypeptides are present in one or more bacteria, viruses, etc. 13. The vector according to claim 12, encoding the whole or a part of a parasite antigen. ctor. 14. One or more exogenous polypeptides are linked to one or more hormones, A claim that encodes all or part of a long-term factor, cytokine, or lymphokine. The vector according to claim 12. 15. in the form of DNA or RNA and either single-stranded or double-stranded A vector according to any of claims 12 to 14. 16. The vector according to claim 12, which is a plasmid. 17. Any one of claims 12 to 16 containing a detectable marker. Vectors listed. 18. The detectable marker confers resistance to one or more antibiotics. 18. The vector according to claim 17. 19. Claim 1 wherein the detectable marker encodes a detectable polypeptide. 7. The vector described in 7. 20. Botevirus coat protein according to any one of claims 1 to 5, or A host cell containing the polymer. 21. A host cell containing the nucleic acid sequence according to any of claims 7 to 11. Cell. 22. A host containing the vector according to any one of claims 12 to 19. cell. 23. The nucleic acid sequence is integrated into the genome of the host cell or is attached to an extrachromosomal element. 22. The host cell according to claim 21, wherein the host cell is loaded with a host cell.