WO1991007423A1 - Proteines de liaison d'adn comprenant un recepteur d'androgene - Google Patents

Proteines de liaison d'adn comprenant un recepteur d'androgene Download PDF

Info

Publication number
WO1991007423A1
WO1991007423A1 PCT/US1990/006015 US9006015W WO9107423A1 WO 1991007423 A1 WO1991007423 A1 WO 1991007423A1 US 9006015 W US9006015 W US 9006015W WO 9107423 A1 WO9107423 A1 WO 9107423A1
Authority
WO
WIPO (PCT)
Prior art keywords
dna sequence
dna
cdna
receptor
androgen receptor
Prior art date
Application number
PCT/US1990/006015
Other languages
English (en)
Inventor
Shutsung Liao
Chawnshang Chang
Original Assignee
Arch Development Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Arch Development Corporation filed Critical Arch Development Corporation
Priority to JP91500413A priority Critical patent/JPH05506141A/ja
Publication of WO1991007423A1 publication Critical patent/WO1991007423A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/72—Receptors; Cell surface antigens; Cell surface determinants for hormones
    • C07K14/721—Steroid/thyroid hormone superfamily, e.g. GR, EcR, androgen receptor, oestrogen receptor

Definitions

  • the present invention relates generally to DNA binding regulatory proteins and more particularly to DNA sequences encoding androgen receptor protein and novel DNA binding proteins designated TR2, to the polypeptide products of recombinant expression of these DNA sequences, to peptides whose sequences are based on amino acid sequences deduced from these DNA sequences, to antibodies specific for such proteins and peptides, and to procedures for detection and quantification of such proteins and nucleic acids related thereto.
  • steroid hor- mones There are five major classes of steroid hor- mones: progestins, glucocorticoids, mineralocorticoids, androgens, and estrogens.
  • Receptor proteins each specific for a steroid hormone, are distributed in a tissue specific fashion and in target cells, steroid hormones can form specific complexes with corresponding intracellular receptors.
  • Anti-AR autoantibodies were identified in the sera of prostate cancer patients, as described in Liao, S., et al., Proc. Nat'l. Acad. Sci. (USA), 82:8345 (1984) (one of the co-inventors herein), and were characterized with respect to their titer, affinity, and specificity. Subsequently, lymphocytes from the blood of those patients having high antibody titers were isolated, transformed with Epstein-Barr Virus (EBV) , and cloned for anti-AR monoclonal antibody production. These monoclonal antibodies were found to interact with androgen receptors from-rat prostate. An attempt to scale-up antibody production resulted in a decline of antibody secretion.
  • EBV Epstein-Barr Virus
  • novel DNA sequences comprise cDNA sequences encoding human and rat androgen receptor and human TR2 protein.
  • Alternate DNA forms such as genomic DNA, and DNA prepared by partial or total chemical synthesis from nucleotides as well as DNA with deletions or mutations, is also within the contemplation of the invention.
  • DNA sequences provided by the invention with homologous or heterologous species expression control DNA sequences, such as promoters, operators, regulators and the like, allows for _in vivo and i ⁇ vitro transcription to form messenger RNA which, in turn, is susceptible to translation to provide androgen receptor and TR2 proteins, and related poly- and oligo-peptides in large quantities.
  • AR and TR2 encoding DNA is operatively associated with a viral (T7) regulatory (promoter) DNA sequence allowing for in vitro transcription and translation in a cell free system to provide, e.g., a 79 kD and 98 kD human androgen receptor (hAR) protein, 79 kD and 98 kD rat androgen receptor (rAR) protein and smaller forms of these proteins; as well as TR2 protein, including 20 kD, 52 kD, and 67 kD species.
  • T7 regulatory (promoter) DNA sequence allowing for in vitro transcription and translation in a cell free system to provide, e.g., a 79 kD and 98 kD human androgen receptor (hAR) protein, 79 kD and 98 kD rat androgen receptor (rAR) protein and smaller forms of these proteins; as well as TR2 protein, including 20 kD, 52 kD, and 67 kD species.
  • Systems provided by the invention included transformed E. coli DH5 ⁇ cells, deposited January 25, 1989, with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland 20852 in accordance with the U.S. Patent and Trademark Office's requirements for microorganism deposits, and designated EC-hAR3600 under A.T.C.C. Accession No. 67879; EC-rAR 2830, A.T.C.C. No. 67878; EC-TR2-5, A.T.C.C. No. 67877; and EC TR2-7, A.T.C.C. No. 67876; as well as transformed E. coli DH5 ⁇ cells, deposited November 14, 1989 and designated EC
  • Novel protein products of the invention include polypeptides having the primary structural con ⁇ formation (i.e., amino acid sequence) of AR and TR2 proteins as well as peptide fragments thereof and syn ⁇ thetic peptides assembled to be duplicative of amino acid sequences thereof.
  • Proteins, protein fragments, and synthetic peptides of the invention are projected to have numerous uses including therapeutic, diagnostic and prognostic uses and will provide the basis for prepara ⁇ tion of monoclonal and polyclonal antibodies specifi- cally immunoreactive with AR and TR2 proteins.
  • Preferred protein fragments and synthetic peptides include those duplicating regions of AR and TR2 proteins which are not involved in DNA binding functions and the most preferred are those which share at least one anti ⁇ genic epitope with AR and TR2 proteins.
  • polyclonal and monoclonal antibodies characterized by their ability to bind with high immunospecificity to AR and TR2 proteins and to their fragments and peptides, recognizing unique epitopes which are not common to other proteins especially DNA binding proteins.
  • AN1-6, AN1-7, AN1-15 monoclonal antibodies, designated AN1-6, AN1-7, AN1-15; and produced by hybridoma cell lines designated H-AN1-6, H-AN1-7, H-AN1-15; deposited January 25, 1989, under Accession Nos. HB 10,000; HB 9,999; and HB 10,001, respectively, with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland 20852 in accordance with the U.S. Patent and Trademark Office's requirements for microorganism deposits.
  • These antibodies are charac ⁇ terized by (a) capacity to bind androgen receptors from rat ventral prostate and synthetic peptides having sequences predicted from the structure of hAR-cDNA and rAR-cDNA; (b) specific immunological reactivity with, and capacity to reversibly immunobind to, naturally occurring and recombinant androgen receptors, in native and denatured conformations; and (c) specific immuno- logical reactivity with, and capacity to reversibly immunobind to, proteinaceous materials including all or a substantially, immunologically significant, part of an amino acid sequence duplicative of that extant at residues- 331 through 577 of hAR and corresponding amino acid sequences in rAR.
  • A-TR-2-lla monoclonal antibodies to TR2 proteins designated A-TR-2-lla. These antibodes are characterized by their capacity to bind TR2 proteins as well as synthetic peptides having sequences predicted from the structure of hTR-2-cDNA.
  • the monoclonal antibodies of the invention can be used for affinity purification of AR and TR-2 receptor from human or rat prostate, and other sources such as AR-rich organs and cultured cells.
  • novel procedures for the detection and/or quantification of normal, abnormal, or mutated forms of AR and TR2, as well as nucleic acids (e.g., DNA and mRNA) associated therewith are novel procedures for the detection and/or quantification of normal, abnormal, or mutated forms of AR and TR2, as well as nucleic acids (e.g., DNA and mRNA) associated therewith.
  • antibodies of the invention may be employed in known immunological procedures for quantitative detection of AR and TR2 proteins in fluid and tissue samples, of DNA sequences of the invention (particularly those having sequences encoding DNA binding proteins) that may be suitably labelled and employed for quantitative detection of mRNA encoding these proteins.
  • viral or circular plasmid DNA vectors incorporating such DNA sequences and procaryotic and eucaryotic host cells transformed or transfected with such DNA sequences and vectors as well as novel methods fox the recombir _ production of AR and TR2 proteins through cultured growth of such hosts and isolation of these proteins from the hosts or their culture media.
  • Preferred polypeptide products of the inven ⁇ tion include the approximately 79 kD (starting from the second ATG/Met) and 98 kD (starting from the first ATG/Met) hAR polypeptides having the deduced amino acid sequence of 734 and 918 residues, respectively, as set out in Figure 3.
  • 79 kD and 98 kD rAR species polypeptides having the deduced sequence of 733 and 902 residues set out in Figure 3; as well as the 20 kD, 52 kD, and 67 kD species human TR2 polypeptides having the deduced amino acid sequences of 184, 483, 467, and 603 residues set out in Figures 4, 5, and 6, respectively.
  • the preferred 79 kD and 98 kD hAR and rAR polypeptides may be produced ii vitro and are characterized by a capacity to specifically bind androgens with high specificity and by their immunopre- cipitatability by human auto-immune anti-androgen receptor antibodies.
  • Figure 2 illustrates the strategy employed in construction of rat androgen receptor cDNA vectors
  • Figure 3 provides a 3715 base pair nucleotide sequence for a human androgen receptor (hAR) DNA clone and the deduced sequence of 734 and 9-8 amino acid residues for hAR proteins; and in addition provides a 3218 base pair nucleotide sequence for a rat androgen receptor (rAR) DNA clone and the deduced sequences of 733 and 902 amino acids for two rAR species;
  • Figure 4 provides a 2029 base pair nucleotide sequence for a human TR2 DNA clone and a deduced sequence of 483 amino acids for a "TR2-5" species with a calculated molecular weight of 52,982 daltons and a deduced sequence of 184 amino acids for a "TR2-7" species with a calculated molecular weight of 20,528 daltons.
  • Figure 5 provides a 1785 base pair nucleotide sequence for a human TR2 DNA clone and a deduced sequence of 467 amino acids for a "TR2-9" species with a calculated molecular weight of 50,849 daltons; the amino acid sequence in the DNA-binding domain is boxed.
  • the polyadenylation signal AATAAA is underlined.
  • Figure 6 provides a 2221 base pair nucleotide sequence for a human TR2 DNA clone and a deduced sequence of 603 amino acids for a "TR2-11" species with a calculated molecular weight of 67,223; the amino acid sequence in the DNA-binding domain is boxed.
  • the polyadenylation signal AATAAA is underlined.
  • Figure 7 provides an amino acid sequence alignment of the cysteine-rich DNA binding domain of human androgen receptor, glucocorticoid receptor, mineralocorticoid receptor, progesterone receptor, estrogen receptor, TR2, rat AR, chick vitamin D receptor (c-VDR), and the v-erb A oncogene product of avian erythroblastosis virus.
  • Figure 8 provides a schematic comparison of the four variants of human TR2 receptors: TR2-5; TR2-7; TR2-9; and TR2-11; numbers above the boxes indicate the positions of amino acid residues.
  • the DNA-binding domain (DNA) and the hormone-binding domain (Hormone) are shown.
  • the sequences for TR2-5, TR2-9, and TR2-11 are identical from amino acid number 1 to 464.
  • Figures 9, 10, and 11 illustrate, respectively, the in-frame fusion of three different parts of the AR gene (the N-terminal, the DNA-binding domain and the androgen-binding domain) to the N- terminal half of the trpE gene using pATH expression vectors.
  • Example 1 relates to the isolation, preparation, and partial structural analysis of cDNA for human and rat androgen receptors.
  • Example 2 relates to confirmation of the presence on the human X-chromosome of an AR-type cDNA sequence.
  • Example 3 relates to the preparation of human and rat cDNAs containing AR-type cDNA from different clones and ligation into the pC -3Z plasmid.
  • Example 4 relates to transcription and trans ⁇ lation of the AR-type cDNA plasmid DNA.
  • Example 5 relates to steroid binding activity of the expression product of Example 4.
  • Example 6 relates to the binding activity of the expression product of Example 4 to human auto-antibodies.
  • Example 7 relates to the characteriza ⁇ tion of TR2-cDNA.
  • Example 8 relates to the m. vitro transcription and translation of TR2-CDNA.
  • Example 9 relates to the binding activity of TR2-CDNA expression product.
  • Example 10 provides a schematic comparison of the four variants of human TR2 receptors.
  • Example 11 relate to the androgen regulation of TR2 mRNA levels in the rat ventral prostate.
  • Example .12 relates to recombinant expression systems of the invention.
  • Example 13 relates to the production of fusion proceins and their use in producing polyclonal and monoclonal antibodies according to the invention.
  • Example 14 relates to use of DNA probes of the inventions.
  • Example 15 relates to development of transgenic animals by means of DNA sequences of the invention. These examples are for illustrative purposes only and are not intended in any way to limit the scope of the invention.
  • ⁇ GTll cDNA libraries The isolation of cDNA for human androgen receptor (hAR) and rat androgen receptor (rAR) was accomplished using ⁇ GTll cDNA libraries.
  • the human testis and prostate ⁇ GTll libraries were obtained from Clontech Co., Palo Alto, California and a rat ventral prostate ⁇ GTll library in E. coli Y1090 was constructed as described in Chang, et al., J. Biol. Chem., 262:11901 (1987).
  • clones were differentiated using oligonucleotide probes specific for various steroid receptors.
  • the cDNA libraries were initially screened with a set of 41-bp oligonucleotide probes designed for homology to nucleotide sequences in the DNA-binding domain of glucocorticoid receptors (GR) , estrogen recep ⁇ tors (ER), progesterone receptors (PR), mineralocorti- coid receptors (MR) , and the v-erb A oncogene product of avian erythroblastosis virus.
  • the set of probes had the following sequence: TGTGGAAGCTGT/CAAAGTC/ATTCTTTAAAAGG/ AGCAA/GTGGAAGG.
  • the plaques were replicated on a nitrocellu ⁇ lose filter and screened with 5'-end 32 P-labeled 41-bp oligonucleotide probes.
  • the conditions of hybridization were 25% formamide, 5X Denhardt's solution (0.1% Ficoll 400, 0.1% polyvinylpyrrolidone, 0.1% bovine serum albumin), 0.1% SDS, 5X SSC (IX SSC is 150 mM NaCl, 15 mM sodium citrate), 100 ug/ml denatured salmon sperm DNA, and 1 ug/ml poly(A) at 30°C. Filters were washed with a solution containing 0.1% SDS, 0.05% sodium pyrophosphate and 0.4X SSC at 37°C.
  • a less stringent hybridization condition (2X SSC at 37°C) was used for the first screen employing the 41 bp probes.
  • the remaining clones were then probed again at more stringent conditions by reducing the con- centration of SSC, eventually to 0.4X SSC at 37°C, or by increasing the temperature, or by increasing the concen ⁇ tration of formamide.
  • 5X SSC, 8% dextran sulfate, and 20% formamide, at 42°C was employed and the result was equivalent to that obtained with 0.6X SSC.
  • the GR-cDNA clones were eliminated by screening with two GR-specific 24-bp probes that had nucleotide sequences identical to nucleotide segments immediately next to the 5'-end or the 3'-end of the DNA binding- region of hGR-cDNA , i.e., TGTAAGCTCTCCTCCATCCAGCTC and CAGCAGGCCACTACAGGAGTCTCA. 244 and 14 clones, respec ⁇ tively, were eliminated as hGR- and rGR-cDNA clones.
  • TR2-type cDNA comprised 30 human testis clones having sequences that overlap to form a 2.1 kb cDNA.
  • AR- type comprised 24 human testis and 6 rat prostate clones having sequences that overlap to form a cDNA of about 2.7 kb.
  • the length between the putative polyadenylat- ion signal (AATAAA) and the 5'-end in the "TR-2 type” cDNA is only 2.0 kb, which is considerably shorter than that for the cDNA of other steroid receptors. There ⁇ fore, it was suspected that the "AR-type” cDNA, rather than the "TR2-type” cDNA, encoded androgen receptor.
  • a human X-chromosome library prepared according to Kunkel, et al.. Nucleic Acids Research, 11:7961 (1983) was probed with the TR2- type cDNA and AR-type cDNA of Example 1.
  • Two human clones containing DNA inserts that overlapped to form a 2.7 kb cDNA were designated AR 132 and AR 5.
  • Two rat clones containing DNA inserts that overlapped to form a 2.8 kb cDNA were designated rAR 1 and rAR 4.
  • the DNA segments from these AR-type clones were ligated, selected and amplified using pBR322 and pGEM-3Z vectors as described in Example 3 below.
  • Plasmid Figure 1 relates to the strategy employed in the construction of a full length hAR-cDNA clone.
  • cDNA of clone AR 132 was digested with Eco RI to obtain a 1.9 kb fragment which was then digested with Kpn I to pro ⁇ vide a 1 kb Eco RI-Kpn I fragment. This 1 kb fragment was ligated to a 3 kb fragment obtained by digestion of clone AR 5 with Kpn I and Pvu I.
  • the resulting 4 kb fragment was inserted into Eco RI and Pvu I-digested pBR322 vector and used to infect E. coli DH5 ⁇ .
  • the transformed clones were selected by tetracycline-resis- tance.
  • the plasmid with the DNA insert was digested with Cla I and Nde I to obtain a 2.6 kb fragment.
  • the fragment was blunt-ended with the Klenow fragment of E. coli DNA polymerase I and ligated to the cloning vector pGEM-3Z plasmid DNA (Promega Biotec, Madison WI.) which was previously blunt-ended by digestion with Sma I.
  • E_ ⁇ coli DH5 ⁇ cells were transformed with the plasmid so formed (designated plasmid PhAR3600) and colonies containing the plasmid were selected by ampicillin resistance and amplified.
  • E. coli DH5 ⁇ cells, transformed with plasmid PhAR3600, were designated EC-hAR3600 and were deposited with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland 20852 on January 25, 1989 under Accession No. 67879.
  • the plasmid DNA was isolated and its structure analyzed by restriction enzyme mapping and sequencing.
  • the 2.0 kb hAR fragment obtained by NruI-BamHI digestion of a 2.6 kb hAR in pGEM3Z was then ligated to another 1.6 kb ECORI-NruI fragment of hHR to obtain the full length 3715 bp hAR.
  • the open reading frame is about 2.8 kb which is sufficient to code for a protein with more than 900 amino acids. Near the middle of the protein is a cysteine-rich region with a 72 amino acid sequence highly homologous to regions in other steroid receptors considered to be the DNA binding domain.
  • the 2.4 kb Eco RI-Eco RI cDNA insert of clone rAR 1 was digested with Xmn I to obtain a 2.3 k b fragment.
  • This 2.3 kb Xmn I-EcoR I fragment was ligated to a 400 bp fragment that was obtained by digestion of another cDNA clone insert (Eco RI-Eco RI insert of rAR 4) with Pst I.
  • the ligated 2.7 kb fragment was inserted into Sma I and Pst I-digested pGEM-3Z vector and used to infect E. coli DH5 ⁇ .
  • the E. coli DH5 ⁇ cells were transformed with the plasmid and colonies containing the plasmid were selected by ampicillin resistance and amplified. These cells were designated EC-rAR 2830 and were deposited with the
  • the 2.4 kb Eco RI-Eco RI cDNA insert of rAR 1 was digested with Hind III to obtain a 1.68 kb frag ⁇ ment.
  • the 1.68 kb Eco RI-Hind III fragment was ligated to a 1.15 kb DNA fragment obtained by digestion of another cDNA clone insert (rAR 6) with Hind III and Pst I.
  • the ligated 2.83 kb fragment was inserted into Eco RI and Pst I-digested pGEM 3Z vector and used to infect E. coli DH5 ⁇ .
  • E. coli (DH5 ⁇ ) cells were transformed with the plasmid and colonies containing the plasmid were selected by ampicillin resistance and amplified. As noted in Figure 2, this construction allowed for a transcription product translated beginning at the first of two in-frame methionine-specifying codons (designated
  • Figure 3 provides the nucleotide sequence of the DNA sequence of the longer "full length” rat and human AR clones and includes the deduced amino acid sequences.
  • the first and second methionine-specifying codons are designated at amino acid positions 1 and 170 of rAR and positions 1 and 185 of hAR.
  • the linearized plasmid was transcribed in a reaction mixture containing 40 mM Tris-HCl, pH 7.5, 6 mM MgCl 2 r 2 mM spermidine, 10 mM NaCl, 10 mM DTT, 500 uM each of ATP, GTP, CTP, and UTP, 160 units ribonuclease inhibitor, 5 ug plasmid, 30 units T7 RNA polymerase (Promega Biotec, Madison, WI) and diethylpyrocarbonate (DEPC)- treated water to a final volume of 100 yl.
  • T7 RNA polymerase was used in the transcription of the plasmid DNA, because a T7 promotor, rather than the SP6 promotor, was found ahead of the 5 '-end of the ligated AR-cDNA.
  • RNA trans ⁇ cribed was isolated and then translated in a rabbit reticulocyte lysate system.
  • RNA was carried out in a micro- coccal nuclease-treated rabbit reticulocyte lysate
  • the reticulocyte lysate of Example 4 containing the newly synthesized protein was incubated with 17 ⁇ [ 3 H]-methyl-17 ⁇ -hydroxy- estra-4,9,ll-trien-3-one ([ 3 H] R1881), a potent syn ⁇ thetic androgen that binds AR with high affinity [Liao, et al., J. Biol. Chem., 248:6154 (1973)].
  • RNA transcribed from the cloned cDNA, as described in Example 4 was translated in a rabbit reticulocyte lysate system and aliquots of the lysate were then incubated with 5 nM [ 3 H] R1881 (87 Ci/mmol) in the absence or presence of 25 nM, 50 nM, or 250 nM of non-radioactive steroid.
  • the final incubation volume was 100 ul.
  • the radioactive androgen binding was measured by the hydroxylapatite-filter method as des ⁇ cribed in Liao, S., et al., J. Steroid Biochem. , 20:11 (1984). The result was expressed as a percentage of the radioactivity bound in the control tube (5000 dpm) with ⁇ out additional non-radioactive steroid and is listed in Table 1.
  • Non-radioactive [ 3 H] R1881-bound (% of control) steroid added 25 nM 50 nM 250 nM
  • the active natural andro ⁇ gen, 17s-hydroxy-5 ⁇ -androstan-3-one(5 ⁇ -dihydro-testos- terone) competed well with [ H] R1881 binding, but the inactive 5 ⁇ -isomer did not compete well with [ 3 H] R1881 suggesting that it does not bind tightly to AR.
  • the binding activity was steroid specific; dexamethasone, hydrocortisone, progesterone, and 17 ⁇ -estradiol did not compete well with the radioactive androgen for binding to the 79 kD protein.
  • the ability of human auto-antibodies to recognize the 79 kD protein made by the reticulocyte lysate system was therefore studied.
  • the receptor protein made in the lysate system of Example 4 was incubated with [ E ] R1881 to allow the formation of radioactive androgen-androgen receptor (A-AR) complexes and was then mixed with serum containing auto-antibodies.
  • A-AR radioactive androgen-androgen receptor
  • Reticulocyte lysate containing translated AR was incubated with [ 3 H] R1881, as described in Example 4, and then incubated again in either the presence of or absence of 5 ul of human male serum containing anti- bodies to AR (anti-AR serum) for 4 hrs. at 4°C.
  • Rabbit serum containing anti-human immuglobulins (Anti-IgG) was then added as the second antibody. After 18 hrs. of incubation at 4°C, the mixture was centrifuged and the radioactivity associated with the precipitate was esti ⁇ mated. Human female serum, not containing anti-AR anti ⁇ body, was also used for comparison.
  • Anti-human immunoglobulin ⁇ dependent precipitation of hAR made by the translation of RNA transcribed from cloned cDNA
  • Reticulocyte lysate containing AR was heated at 50°C for 20 mins. to inactivate receptor and release the radioactive androgen bound before the addition of antiserum.
  • c Brome Mosaic Virus RNA was used in the reti ⁇ culocyte lysate translation system instead of RNA trans ⁇ cribed from cloned cDNA.
  • TR2-type cDNA Of the more than 40 TR2-type human cDNA clones obtained, including the 30 described in Example 1, the clone designated TR2-5 was found to be 2029 base pairs in length as indicated in Figure 4.
  • the open reading frame between the first ATG and terminator TAA can encode 483 amino acids with a calculated molecular weight of 52 kD.
  • the putative DNA binding region is underscored.
  • the putative initiator ATG matched closely with Kozak's concensus sequence for active start codons. [See, Kozak, M. , Nature, 308:241 (1984).] Two triplets upstream of this ATG codon is an in-frame terminator (TAA) further supporting initiator function for the ATG.
  • TAA in-frame terminator
  • TR2-9 receptor cDNA was isolated from a human prostate cDNA library has 1785 bp (Figure 5).
  • TR2-11 receptor cDNA has 2221 bp, with a shorter 5'-untranslated region ( Figure 6).
  • the predicted initiator ATG of these two cDNA sequences matches well with Kozak's consensus sequence for an active start codon (Kozak, M.
  • a eukaryotic polyadenylation signal AATAAA is present between nucleotide numbers 1710-1715 for the TR2-9 receptor and between 2180-2185 bp for the TR2-11 receptor.
  • TR-2 with open reading frames at the putative ligand-binding domains may code for receptors for new hormones or cellular effectors. It is anticipated that the knowledge of TR2-CDNA sequences will be utilized in isolation and structural analysis of other cellular receptors, their genes, and ligands (endogenous or therapeutic agents) that can regulate cellular growth and functions in both normal and diseased organs.
  • TR2 receptors There is a conservation of the DNA-binding domain for TR2 receptors and for other members of the steroid hormone receptor family.
  • the putative DNA- binding domain of TR2 receptor shares 50-60% homology with that of other steroid receptors and TR3 receptor (Chang, C. , Kokontis, J. and Liao, S., Science, 240:324-3.26 (1988); Chang, C. , Kokontis, J., Chang, C.T., and Liao, S., Nucleic Acid Res. , 22:9603 (1987); Green, S.
  • TR3 receptor is another member of the steroid receptor family, which may be a human homologue of the mouse NUR/77 gene product (Chang, C.
  • Figure 7 depicts an amino acid sequence align ⁇ ment of the cysteine-rich DNA binding domain of human androgen receptor, glucocorticoid receptor, mineralocor- ticoid receptor, progesterone receptor, estrogen recep ⁇ tor, human TR2 protein, rat AR, chick vitamin D receptor (c-VDR), and the v-erb A oncogene product of avian erythroblastosis virus.
  • the numbers in the left margin represent the positions of amino acid residues in the individual receptors. Common residues are boxed with solid lines. The residues in dotted boxed represent those not in common with those in the solid boxes.
  • V-erb A has two more amino acids at the starred posi ⁇ tion.
  • the human and rat cDNAs for AR have identical amino acid sequences, although for some amino acids different codons are employed. Also in this region, the homology between human AR or rat AR and other receptors is as follows: glucocorticoid receptor (GR) , 76.4%; mineralo-corticoid receptors (MR), 76.4%; progesterone receptors (PR), 79.2%; estrogen receptors (ER), 55.6%; TR2, 45.8%; chick vitamin D receptor (c- VDR) , 40,3%; and the v-erb A oncogene product of avian erythroblastosis virus, 40.3%.
  • GR glucocorticoid receptor
  • MR mineralo-corticoid receptors
  • PR progesterone receptors
  • ER estrogen receptors
  • TR2 chick vitamin D receptor
  • c- VDR chick vitamin D receptor
  • v-erb A oncogene product of avian erythroblastos
  • the homology between human AR or rat AR and hGR, hMR, or hPR is about 45-55%, whereas the homology between human AR and rat AR and hER is less than 20%.
  • human and rat AR appear to be more closely related to GR, MR, and PR, than to v-erb A or to receptors for estrogen, vitamin D, and thyroid hormones.
  • TR2 (amino acids 111 to 183) has a high homology with the steroid receptor super-family as follows: retinoic acid receptor (RAR), [Giguere, et al..
  • T 3 R thyroid receptor
  • MR mineralocorticoid receptor
  • VD 3 R vitamin D 3 receptor
  • hERRl and hEER2 [Giguere, V., et al., .Nature, 331:91 (1988)], 51% estrogen receptor (ER), [Hollenberg, et al..
  • TR2-7 were isolated and ligated to an EcoRI digested pGEM-3Z vector for iji vitro transcription essentialy as described in Example 3.
  • E. coli DH5 ⁇ _ cells, transformed with these plasmids were designated
  • TR2-7 which has an internal 429 bp, insertion
  • TR2-5 The major translated product of TR2-5 was a 52 kD protein.
  • TR2-11 receptor cDNA was isolated and ligated to EcoRI-digested pGEM-3Z vector for ⁇ n vitro transcription, essentially as described in Example 3.
  • RNA was translated in a rabbit reticulocyte lysate system. SDS polyacrylamide gel analysis showed a major band around 67 kd, consistent with the calculated molecular weight of 67,223 daltons.
  • TR2-5, TR2-7, and TR2-11 clones To study the steroid binding activity of the translation products of the TR2-5, TR2-7, and TR2-11 clones, the products were incubated with all major classes of steroids, including androgens, progesterone, glucocorticoid and estrogen but no significant binding with the above steroids was observed. This does not necessarily rule out a steroid binding function for these proteins. Possibly the TR2-5, TR2-7, and TR2-11 expression products' steroid binding activity may involve some post-translation modifications missing in the rabbit reticulocyte lysate system.
  • the TR2-5, TR2-7, and TR2-11 translated proteins may be steroidal independent or may bind to an unidentified ligand present in the human testis or rat ventral prostate, or, alternatively, may be dependent upon an unknown steroidal or non-steroidal hormone.
  • TR2 mRNA The size of TR2 mRNA was determined by Northern blot analysis with TR2-5 cDNA insert as a probe. One 2.5 kb band was detected which should include enough sequence information to code for a 52 kD 5 protein.
  • TR2 mRNA tissue distribution was also analyzed by dot hybridization. The hybridization was visualized by densitometric scanning of the autoradio- graphs, individual dots were cut and radioactivity measured by liquid scintillation counting. Chang, et Q al., J. Biol. Chem., 2_62.2826 (1987).
  • TR2 mRNA was most abundant in the rat ventral prostate with the relative amounts in other tissues being: prostate 100%, seminal vesicle 92%; testis, 42%; submaxillary gland, 18%; liver, 13%; 5 kidney, ⁇ 1%; and uterus, ⁇ 1%.
  • TR2-7 receptor contains an internal extra 429 base point segment between nucleotide number 670 and 671 base point, which generates a termination codon and shortens 0 the open reading frame to 184 amino acids.
  • TR2-5, TR2-9, and TR2-11 receptors are identical from amino acid number 1 to 464. However, the C-terminal hormone-binding domains of 5 these three TR2 receptors are different. Chang, C, Kokontis, J., B.B.R.C, 155:971-977 (1988).
  • TR2-9 receptor has 16 fewer amino acids and 3 different amino ci- ds as compared with TR2-5 receptor, due to a 244 bp insertion between nucleotide number 1518 and 1763 of
  • TR2-11 receptor has more and quite different amino acids in the hormone-binding domain.
  • TR2 receptors like multiple forms of thyroid hormone receptors, (Evans, vans, and others.
  • TR2-11 receptor cDNA was isolated from human prostate cDNA library, all other TR2 receptor cDNAs (TR2-5, TR2-7, and TR2-9) were isolated from a human
  • RNA splicing can generate messages encoding TR2 receptors with multiple hormone-binding domains. If this is the case, regulation at the RNA splicing level may be important during the transition of hormone-dependent organs/tumors to hormone-independent organs/tumors.
  • the co-expression of variant receptors may provide competition for ligands among receptors, and the activation level of the target genes could be regulated by adjusting the expression ratio of different variant receptors. This expression ratio could vary with tissue-specificity or developmental stage-specificity.
  • TR2 receptor mRNA was most abundant in the androgen-sensitive ventral prostate (Chang, C, Kokontis, J., B.B.R.C, 155:971-977 (1988)), it is of interest to examine the expression ratio of variant TR2 receptors in normal, neoplastic, or hyperplastic prostate tissue and study their possible roles in prostate growth and development. It is anticipated that a determination of the genomic structure of TR2 receptor genes and the natural TR2 receptor ligand may lead to elucidation of the mechanism by which variant receptors are generated and elucidation ofthe cellular function of this new member of the steroid hormone receptor superfamily. EXAMPLE 11
  • rat ventral prostate is an androgen- sensitive organ and contains the greatest amount of AR and TR2 mRNA
  • the effect of androgen depletion and replacement on the mRNA levels was studied by RNA dot hybridization and Northern blot analysis.
  • Total RNA was extracted from the ventral prostate of normal rats, rats castrated and rats previously castrated and treated with 5 ⁇ -dihydrotestosterone (17 ⁇ -hydroxy-5 ⁇ -androstand-3- one).
  • AR mRNA levels per unit of DNA increased 200 to 300% of the level for normal rats within 2 days after castration.
  • Administration of 5 ⁇ -dihydrotestosterone (5 mg/rat/day) into castrated rats reduced the AR mRNA level to that of normal rats.
  • TR2 mRNA levels per unit of DNA, were increased to 170% of the normal rat within 2 days after castration. Injection of 5 ⁇ -dihydrostes- tosterone (5 mg/rat/day) into castrated rats reduced the TR2 mRNA to the levels of normal rats. Interestingly, the total prostate RNA levels, at the same period of time, were decreased to 40% of the normal level. The effects of androgen on the levels of prostatic TR2 mRNA were further confirmed by flutamide injection experi ⁇ ments. Flutamide, an anti-androgen which antagonizes the effects of 5 ⁇ -dihydrotestosterone on the ventral prostate weights in castrated rats [Neri, et al.. Invest.
  • the most efficient transcription units can be constructed using viral, as well as non-viral, vectors with regulatory signals that can function in a variety of host cells.
  • SV40, pSV2, adenoviruses, and bovine papilloma virus DNA have been used successfully for introduction of many eukaryotic genes into eukaryotic cells and permit their expression in a controlled genetic environment. These and similar systems are expected to be appropriate for the expression of AR- and TR2-genes.
  • the two most widely used methods the "calcium phosphate precipitation" and the "DEAE-dextran technique" can be used.
  • Genes can be introduced into cells either transiently, where they continue to express for up to 3 days, or, more permanently to form stably transformed cell-lines.
  • the expressed proteins can be detected by androgen binding or antibody assays.
  • the expression of cloned AR-genes was achieved as follows in a eukaryotic system. NIH 3T3 cells, contact-inhibited cells established from NIH Swiss mouse embryo, were co-transfected with hAR cDNA inserted into pBPVMTH vectors as described by Gorman, "DNA Cloning", 2:143-190 D. M. Glover, ed.; (Oxford, Washington, D.C 1985). Transfected cells were cloned and grown in multiple-well cell culture plates. About 100 individual cell lines were isolated. Of these, 6 demonstrated [ H] R1881-binding activity at least 4-fold the activity of cells transfected with pSV2 vector alone, i.e., without the hAR cDNA sequence.
  • hAR and rAR cDNAs were inserted into a number of expression vectors including pUR, ⁇ GTll, pKK223-3, pKK233-2, pLEX, pATHl, pATH2, pATHIO, and pATHll.
  • Vectors with AR cDNA inserts were used to infect E. coli strains (JM109, DH5o, Y1089, JM105, and RR1). According to polyacrylamide gel electrophoresis analysis, the infected bacteria can synthesize AR fragments coded for by the AR cDNA inserts. Some of these AR polypeptides 5 are degraded in culture. Amino terminal, DNA-binding, and androgen binding domains were used, as described in Example 13, to construct fusion proteins representing these domains.
  • oligopeptides representing sequences unique to AR, (i.e., PYGDMRLETARDHVLP; CPYGDMRLETARDHVLP; and fJ SIRRNLVYSCRGSKDCIINK) were bound to BSA or KLH carrier proteins and were used to immunize mice. Spleen cells from these mice were fused to myeloma cells to produce hybrid antibody producing cells. Analysis by ELISA (enzyme-linked immunoassay) of the supernatants of 4 5 hybrid cultures appeared to indicate the presence of immunoglobulin that interacts with AR of rat ventral prostate. It is anticipated that these cells which produce monoclonal antibodies can be injected intraperitoneally into BALB/c mice previously treated with pristane. Ascites fluids can then be harvested and antibodies precipitated with ammonium sulfate.
  • the induced fusion proteins i.e., those proteins not present in the control pATH vector (no AR gene insert) were sliced from the gels and then used for immunization.
  • Fusion proteins other than the three specifically exemplified, can also be constructed using these means. Production and Purification of Anti-AR Antibodies
  • the immunized rats were judged ready to be sacrificed for a fusion when their serum tested positive anti-AR antibodies by ELISA. Spleens were removed and grinded to release the cells into DMEM (Dulbeco's
  • hybridomas that caused a positive reaction with the AR fusion protein were "limit diluted” to a concentration of 10 cells/ml and were then distributed among half of a 96-well plate. The remaining cells from the original well were transferred to a 24-well plate. Each of these plates had a thymocyte feeder layer.
  • the tymocyte feeder layer was made up of thymus cells isolated from an un-injected rat, purified through centrifugation, irradiated with 1200 to 1400 RADS, and diluted to 1 x 10 7 cells/ml of DMEM with 20% FCS. Positives from these thymocyte 96-well plates were again tested by ELISA.
  • the monoclonal antibodies were designated ANl-6, ANl-7, and AN1-15 and the three cell lines were designated HAN1-6, HAN1-7, and HAN1-15; Accession Nos. 10,000; 9,999; and 10,001; respectively, deposited on January 25, 1989 with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland 20852.
  • Buffer A 50 mM sodium phosphate, pH 7.5, 1 mM EDTA, 2 mM DTT, 10 mM sodium molybdate, 10% (v/v) glycerol and 10 mM sodium floride
  • Buffer A 50 mM sodium phosphate, pH 7.5, 1 mM EDTA, 2 mM DTT, 10 mM sodium molybdate, 10% (v/v) glycerol and 10 mM sodium floride
  • the homogenate was centrifuged at 5,000 x g for 10 mins., adjusted to 10 nM 3 H-androgen, spun at 225,000 x g for 45 mins.
  • cytosol solution containing 3H-A-AR complexes
  • ANl-6 the purified anti- androgen receptor monoclonal antibody
  • Sucrose gradient centrifugation was performed by centrifugation at 257,000 x g for 16 hrs. at 4°C on a 3.8 ml, linear 5-20% (w/v) sucrose gradient containing 20 mM Tris-HCl, pH 7.5, 1 mM EDTA, 1 mM DTT, 10% (v/v) glycerol, and 0.4 M KC1.
  • the [ H]AR and other steroid receptor complexes had a sedimendation coefficient of about 4-5S in the sucrose gradient media containing 0.4M KC1.
  • Anti-AR antibodies do not alter the sedimentation coefficient of 4-5S for [ H]glucocorticoid receptors complexes of rat liver, estrogen receptor complexes of MCF-7 cells, and progesterone receptor complexes of T47D cells, but do shift the sedimentation coefficient of
  • high molecular weight genomic DNA isolated from target organs, tumors, and cultured cells can be used in identifying and characterizing AR genes.
  • Different restriction endonucleases can be used to cleave DNA.
  • the fragments can be analyzed by Southern analysis (agarose electrophoresis, transfer to nitrocellulose and hybridization with AR cDNA probes). After identification, selected fragments can be cloned and sequenced. It is also possible to use appropriate oligonucleotide fragments of AR or TR2 cDNA as primers to amplify genomic DNA isolated from normal and abnormal organs or cells by specific DNA polymerases.
  • the amplified genomic DNA can then be analyzed to identify sequence abnormality using the polymerase chain reaction (PCR) assay.
  • PCR polymerase chain reaction
  • dot hybridization and Northern hybridization analysis could be used to characterize mRNA and AR or receptor-like molecules quantitatively and qualitatively. From these studies valuable information about the number of different forms of AR genes and their expression in androgen insensitive and sensitive tumor cells can be obtained.
  • DNAs and RNAs obtained from androgen sensitive and insensitive tumors and from cell lines from rats and humans with testicular feminization syndromes have been analyzed by the above methods. Preliminary studies indicated that abnormality in androgen responses may be due to sequence deletion/mutation in genes for ARs.
  • Transgenic techniques have been employed for expression of exogenous DNA. It may therefore be poss ⁇ ible to confer androgen sensitivity to animals with androgen receptor defects.
  • androgen insen- sitive animals such as testicular feminized mice or rats, are known to have defective AR genes or defective AR itself. If DNA containing a normal AR gene is injected into fertilized mouse embryos, the transgenic mice may carry and express the gene and produce a functional AR necessary for androgen responses. For micro-injection, it is necessary to use AR genes containing DNA that can be expressed in the insensitive animals.
  • Clones containing AR sequences will be characterized by endonuclease mapping, by Southern hybridization and by Sl-nuclease mapping. The 5' and 3' untranslated regions thus identified will aid in determining the minimal size of the DNA that would be required for tissue specific expression of the AR coding region.
  • Partial sequence analysis of the 5' and 3' regions would locate the minimal region that represents the promoter and the polyadenylation region. Approxi- mately 2 to 5 kb of upstream un-translated region and 0.5 to 1 kb of sequences downstream from the poly(A) site may be fused to the cDNA clone (minimal-gene) and injected into embryos of mice. Transgenic mice would be identified by analysis of their tail DNA using mini-gene specific probe(s).
  • Transgenic mouse lines can express their transgenes.
  • Transgenes may be inactive because of the presence of inhibitory sequences, integration of the exogenous gene into a transcriptionally inactive chromosomal location, or the juxtaposition of the transgene and an endogenous enhancer.
  • androgen insensitivity may be due to various other factors and not due to abnormality in the AR gene or its expression.
  • the foregoing illustrative examples relate to the isolation of human and rat cDNAs encoding DNA bind ⁇ ing proteins including androgen receptor and TR-2 and more particularly describe the transcription of the corresponding cDNAs and translation of the corresponding mRNAs in cell-free systems. While the present invention has been described in terms of specific methods and compositions, it is understood that variations and modi ⁇ fications will occur to those skilled in the art upon consideration of the present invention.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Toxicology (AREA)
  • Cell Biology (AREA)
  • Endocrinology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Polishing Bodies And Polishing Tools (AREA)

Abstract

Séquences d'ADN de codage de polypeptides de liaison d'ADN contenant un récepteur d'androgène (AR) et des polypeptides TR2. A titre d'illustration, des ADNc-AR humain et murin ont comme produits d'expression des polypeptides 79kD et 98 kD immunoprécipitables par des anticorps récepteurs auto-immunitaires humains d'anti-androgène et sont capables de lier des androgènes de manière spécifique et avec une affinité élevée. Anticorps, procédés et matériaux immunologiques de détection du récepteur d'androgène et des polypeptides TR2, ainsi que des procédés et des matériaux d'hybridation utiles pour détecter des acides nucléiques apparentés à AR et à TR2.
PCT/US1990/006015 1989-11-17 1990-10-19 Proteines de liaison d'adn comprenant un recepteur d'androgene WO1991007423A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
JP91500413A JPH05506141A (ja) 1989-11-17 1990-10-19 アンドロゲン受容体を含むｄｎａ結合蛋白質

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US43877589A 1989-11-17 1989-11-17
US438,775 1989-11-17

Publications (1)

Publication Number Publication Date
WO1991007423A1 true WO1991007423A1 (fr) 1991-05-30

Family

ID=23741964

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1990/006015 WO1991007423A1 (fr) 1989-11-17 1990-10-19 Proteines de liaison d'adn comprenant un recepteur d'androgene

Country Status (3)

Country Link
EP (1) EP0505387A4 (fr)
JP (1) JPH05506141A (fr)
WO (1) WO1991007423A1 (fr)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993004166A1 (fr) * 1991-08-16 1993-03-04 Carnegie Institution Of Washington Proteine de liaison d'adn de region purique
US6235872B1 (en) * 1998-03-12 2001-05-22 The Burnham Institute Proapoptotic peptides dependence polypeptides and methods of use
US6576421B1 (en) 1991-10-28 2003-06-10 Arch Development Corporation Methods and compositions for the detection of chromosomal aberrations
WO2003072700A2 (fr) * 2002-02-28 2003-09-04 Pfizer Products Inc. Recepteur androgene surexprimant des myoblastes squelettiques
EP2023951A2 (fr) * 2006-05-19 2009-02-18 University of Rochester Le récepteur d'androgène de l'épithélium prostatique supprime la croissance de la prostate et l'invasion tumorale
US20120156770A1 (en) * 2008-09-17 2012-06-21 University Of Maryland, Baltimore Human androgen receptor alternative splice variants

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4800159A (en) * 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
WO1989009223A1 (fr) * 1988-03-30 1989-10-05 Arch Development Corporation Proteines de liaison d'adn comprenant un recepteur d'androgene
WO1989009791A1 (fr) * 1988-04-14 1989-10-19 University Of North Carolina At Chapel Hill Adn codant pour des proteines receptrices d'androgene

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4800159A (en) * 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
WO1989009223A1 (fr) * 1988-03-30 1989-10-05 Arch Development Corporation Proteines de liaison d'adn comprenant un recepteur d'androgene
WO1989009791A1 (fr) * 1988-04-14 1989-10-19 University Of North Carolina At Chapel Hill Adn codant pour des proteines receptrices d'androgene

Non-Patent Citations (13)

* Cited by examiner, † Cited by third party
Title
Biochemical and Biophysical Research Communications, Volume 153, No. 1, issued 31 May 1988, (Academic Press, Orlando, USA) TRAPMAN et al., "Cloning, structure and expression of a cDNA encoding the human androgen receptor", pages 241-248, see entire document. *
Cold Spring Harbor Symposia on Quantitative Biology, Volume LI, published 1986, (Cold Spring Harbor Laboratory, New York, USA), MULLIS et al., "Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction", pages 263-273, see the entire document. *
Molecular Endocrinology, Volume 2, Number 12, issued December 1988 (Baltimore, USA), LUBAHN et al., "The human androgen receptor: complementary deoxyribonucleic acid cloning, sequence analysis and gene expression in prostate", pages 1265-1275, see the entire document. *
Molecular Endocrinology, Volume 2, Number 12, issued December 1988 (Baltimore, USA), TAN et al., "The rat androgen receptor: primary structure, autoregulation of its messenger ribonucleic acid, and immunocytochemical localization of the receptor protein", pages 1276-1285, see the entire document. *
Nature, Volume 324, issued 13 November 1986, (London, UK) SAIKI et al., "Analysis of enzymatically amplified B-globin and HLA-DQ DNA with allele-specific oligonucleotide probes", pages 163-166, see the entire document. *
Proceedings of the National Academy of Sciences, Volume 85, issued October 1988, (Washington, USA) CHANG et al., "Structural analysis of complementary DNA and amino acid sequences of human and rat androgen receptors", pages 7211-7215, see the entire document. *
Proceedings of the National Academy of Sciences, Volume 86, issued December 1989 (Washington, USA), LUBAHN et al., "Sequence of the intron/exon junctions of the coding region of the human androgen receptor gene and indentification of a point mutation in a family with complete androgen insensitivity", pages 9534-9538, see the entire document. *
Proceedings of the National Academy of Sciences, Volume 86, issued January 1989 (Washington, USA), TILLEY et al., "Characterization and expression of a cDNA encoding the human androgen receptor", pages 327-331, see the entire document. *
Progress in Cancer Research and Therapy, (Raven Press, New York, USA) Volume 35, issued July 1988, GOVINDAN et al., "Cloning of the human androgen receptor cDNA", pages 49-54, see the entire document. *
Science, Volume 240, issued 13 May 1988 (Washington, USA), EVANS, "The Steroid and thyroid hormone receptor superfamily", pages 889-895, see the entire document. *
Science, Volume 240, issued 15 April 1988, (Washington USA), CHANG et al., "Molecular cloning of human and rat complementary DNA encoding androgen receptor", pages 324-326, see the entire document. *
Science, Volume 240, issued 15 April 1988, (Washington, USA), LUBAHN et al., "Cloning of human androgen receptor complementary DNA and localization to the X chromosome", pages 327-330, see the entire document. *
See also references of EP0505387A4 *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993004166A1 (fr) * 1991-08-16 1993-03-04 Carnegie Institution Of Washington Proteine de liaison d'adn de region purique
US6576421B1 (en) 1991-10-28 2003-06-10 Arch Development Corporation Methods and compositions for the detection of chromosomal aberrations
US6235872B1 (en) * 1998-03-12 2001-05-22 The Burnham Institute Proapoptotic peptides dependence polypeptides and methods of use
WO2003072700A2 (fr) * 2002-02-28 2003-09-04 Pfizer Products Inc. Recepteur androgene surexprimant des myoblastes squelettiques
WO2003072700A3 (fr) * 2002-02-28 2004-10-14 Pfizer Prod Inc Recepteur androgene surexprimant des myoblastes squelettiques
EP2023951A2 (fr) * 2006-05-19 2009-02-18 University of Rochester Le récepteur d'androgène de l'épithélium prostatique supprime la croissance de la prostate et l'invasion tumorale
EP2023951A4 (fr) * 2006-05-19 2010-01-13 Univ Rochester Le récepteur d'androgène de l'épithélium prostatique supprime la croissance de la prostate et l'invasion tumorale
US20120156770A1 (en) * 2008-09-17 2012-06-21 University Of Maryland, Baltimore Human androgen receptor alternative splice variants
US8841422B2 (en) * 2008-09-17 2014-09-23 University Of Maryland, Baltimore Human androgen receptor alternative splice variants

Also Published As

Publication number Publication date
EP0505387A4 (en) 1993-06-30
EP0505387A1 (fr) 1992-09-30
JPH05506141A (ja) 1993-09-16

Similar Documents

Publication Publication Date Title
US5614620A (en) DNA binding proteins including androgen receptor
US5538866A (en) Prostate-specific membrane antigen
US5639616A (en) Isolated nucleic acid encoding a ubiquitous nuclear receptor
Demyan et al. Estrogen sulfotransferase of the rat liver: complementary DNA cloning and age-and sex-specific regulation of messenger RNA.
US7129078B2 (en) DNA encoding androgen receptor fragment
US20070148662A1 (en) Prostate-specific membrane antigen
Ali et al. Production and characterization of monoclonal antibodies recognising defined regions of the human oestrogen receptor
KR19980041692A (ko) 신규한 에스트로겐 수용체
CA1341305C (fr) Proteines se liant a l'adn, comprenant un recepteur des androgenes
Sachiho et al. The gene encoding mouse lymphocyte antigen Ly-49: structural analysis and the 5'-flanking sequence
JP3779989B2 (ja) リンパ抗原ｃｄ３０
JPH0625295A (ja) 新規生理活性物質エピモルフィン、それをコードする 遺伝子及びエピモルフィンに対する抗体
Young et al. Overexpression of a partial human androgen receptor in E. coli: characterization of steroid binding, DNA binding, and immunological properties
WO1991007423A1 (fr) Proteines de liaison d'adn comprenant un recepteur d'androgene
WO1995017205A1 (fr) Proteines de thymopoietine humaine recombinee et leurs utilisations
JP3428441B2 (ja) タイトジャンクション構成膜蛋白質クローディンファミリー
JP2001512676A (ja) １−α−ヒドロキシラーゼの材料および方法
US6207375B1 (en) TGF-β inducible early factor-1 (TIEF-1) and a method to detect breast cancer
Sutherland et al. Oestrogen actions
EP0729975B9 (fr) Proteine ecdn et adn codant cette proteine
JP2001122900A (ja) 抗−ＤＮａｓｅγ抗体並びにその製造及び使用
WO1989012687A1 (fr) Recepteur d'acide retinoique
US8323916B2 (en) Method of detecting endometrial cancer comprising measuring levels of fibrocystin-L
JP2001513755A (ja) 癌を検出するためのヒスチジン・デカルボキシラーゼのアッセイ
Wu et al. Expression of a thyroglobulin (Tg) variant in mouse kidney glomerulus

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): JP

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IT LU NL SE

WWE Wipo information: entry into national phase

Ref document number: 1990917597

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1990917597

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1990917597

Country of ref document: EP