WO1990012094A1 - Clone d'un virus arn a double brin et ses applications - Google Patents
Clone d'un virus arn a double brin et ses applications Download PDFInfo
- Publication number
- WO1990012094A1 WO1990012094A1 PCT/US1990/001716 US9001716W WO9012094A1 WO 1990012094 A1 WO1990012094 A1 WO 1990012094A1 US 9001716 W US9001716 W US 9001716W WO 9012094 A1 WO9012094 A1 WO 9012094A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- protein
- virus
- dna segment
- rna
- replication
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/16011—Human Immunodeficiency Virus, HIV
- C12N2740/16022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
Definitions
- the present invention is related generally to the field of genetic engineering. More particularly, the present invention is related to providing a cDNA clone of the double- stranded RNA genome of a yeast virus and various applications of the clone.
- Retroviruses use a wide variety of strategies to replicate and differentially express the proteins they encode.
- Retroviruses double-stranded RNA (dsRNA) viruses and (+) strand RNA viruses including Picornaviruses and Togaviruses, have in common their use of genomic (+) strand RNA as a template for replication and as a message for protein synthesis.
- DNA viruses and (-) strand RNA viruses use splicing of mRNA to produce, in different amounts, proteins sharing part of their sequence (Livingston et al, 1985, Replication of Papovaviruses. In Virology, B.N. Fields, ed., New York: Raven Press, pp.
- Retroviruses splice their genomic RNA to make the env protein, but the spliced RNA lacks the Psi sequence necessary for packaging (Watanabe et al, 1933, Mol. Cell, Biol. 3:2241-2249; Mann et al, 1983, Cell 33:153-159; Markowitz et al, 1988, J. Virol 62:1120-1124).
- retroviruses use ribosomal frameshifting to make a large amount of the gag protein and a small amount of the gag-pol fusion protein (Jacks et al, 1988, Cell 55:447-458).
- Murine leukemia virus (Varmus, 1988, Science 240:1427-1435) and two ⁇ viruses (Strauss et al, 1983, Proc. Natl. Acad. Sci. USA 80:5271-5275) use nonsense suppression in the same way.
- the rates of transcription and translation of different reovirus dsRNA segments vary over a range of more than 20-fold to give overall rates of expression that vary over 400-fold (Joklik, 1981, Microblol Rev. 45:483-501).
- L-A is a dsRNA virus of Saccharomyces cerevisiae.
- L-A replicates by a conservative mechanism, with (+) strands made by transcription of dsRNA and (-) strands then made by copying the (+) strand's to form dsRNA again (sequential synthesis) (Newman et al, 1981, J. Virol 38:263-271; Sclafani et al, 1984, Mol. Cell. Biol. 4:1618-1626; Newman et al, 1986, The replication of dsRNA.
- (+) single-stranded RNA (ssRNA) is packaged in a new coat to form new viral particles (Fujimura et al, 1986, supra; Fujimura et al, 1987, Mol. Cell. Biol. 7:420-426). Both (+) and (-) strands are synthesized within viral particles, and because the size of the heads appears to be designed to contain one L-A molecule (4.6 kb), dsRNAs less than half the size of L-A replicate within. the head until they fill it with multiple copies.
- ssRNA single-stranded RNA
- the 4.6 kb L-A dsRNA genome with a coding capacity of about 180 kDa encodes both the 80 kDa major coat protein (over 100 molecules per viral particle) and a 180 kDa minor viral protein (about 1 molecule per particle).
- the 180 kDa protein shares immunodeterminants with the major coat protein and, unlike the major coat protein, has ssRNA-binding activity which could play a role in both packaging and replication.
- L-A carries several genetic activities, called [HOK], [SEX], [EXL] and [B] defined by the interactions of L-A with M dsRNA (see review by Wickner, 1986, Ann. Rev. Biochem. 55: 373-395; Uemura et al, 1988, Mol. Cell.
- M 1 is a dsRNA that encodes a secreted toxin and immunity to the toxin (Bussey, 1988, Yeast 4:17-26) and uses the same particles as L-A for replication. Although both L-A and M 1 are affected by a variety of chromosomal genes, only three of the genes required for the maintenance of M 1 (MAK3, MAK10, and PET18) are necessary for the maintenance of L-A (see review by Wickner, 1986, supra). A deletion mutant of L-A, called X dsRNA, requires most, if not all, of the MAK genes (Esteban et al, 1988, J. Virol. 62:1278-1285).
- an object of the present invention to provide a substantially complete cDNA clone of the L-A viral genome of S. cerevisiae.
- Figure 1 shows a summary of the overall structure of the L-A genome.
- the two open reading frames, ORF1 and ORF2 encode the two products of the L-A genome, the major coat protein of the viral particles and the chimeric protein having a major coat protein domain and a single-stranded RNA binding-RNA polymerase domain.
- Figure 2 shows the complete sequence of the L-A genome and specific features thereof, including possible frameshifting. sequences near base 2000.
- Figure 3 shows the similarity between the sequences of HIV-1 and RSV that are known to produce ribosomal frameshifting and sequences in L-A in the 130 base region of overlap of ORF1 and ORF2.
- Figure 4 shows the homology between L-A's ORF2 and the RNA-dependent RNA polymerase genes of a number of RNA viruses that allowed the identification of the 180 kDa protein as the L-A RNA polymerase.
- Figure 5 shows the schematic design of a frameshift vector based on the frameshift sequences of the L-A virus.
- Figure 6 shows constructs useful .for producing particles carrying multiple copies of a protein antigen on its surface for i-nducing an immune response.
- Figure 7 shows the use of a vector to support the replication and increase the copy number of the X dsRNA-based expression vector.
- substantially complete cDNA clone means that the clone has the complete nucleotide sequence of the L-A viral genome except for a few bases at each end which, however, are easily repaired by using oligonucleotide mutagenesis.
- modified cDNA as used herein means (1) modified to include the sequence encoding the protein whose production is desired; (2) modified to place the appropriate region with this encoding sequence downstream from a suitable promoter and upstream from a suitable transcription terminator; (3) modified in a suitable region to optimize the amount of transcript production by L-A (with the protein coding sequence); (4) modified to optimize the level of translation of the mRNA produced by L-A; (5) modified to result in secretion of the synthesized protein; (6) modified to include a multiple cloning site in an appropriate region, and the like.
- M-MLV reverse transcriptase, RNase H, and DNA polymerase I were obtained as a kit from Bethesda Research Laboratories. Exonuclease III. and SI nuclease were from Promega Biotec. Modified T7 DNA polymerase (Sequenase) and T4 polynucleotide kinase were from United States Biochemical. Other enzymes and substrates were obtained from Bethesda Research Laboratories, New England Biolabs, New England Nuclear, LBK- Pharmacia or Boehringer Mannheim.
- Saccharomyces cerevisiae strain RE59 (a argl-1 ski2-2 L-A-HNB [D] L-BC W) was used as a source of VLPs.
- This strain contains a variant of L-A, L-A-HNB, which results in high levels of L-A viral particles (Uemura et al, 1988, Mol. Cell Biol. 8:938-944).
- This strain has no M 1 killer dsRKA, which, if present, would strongly repress L-A replication, and the chromosomal ski2-2 mutation also contributes to the higher yield of VLPs.
- Escherichia coli strains, DH5 ⁇ F-, endA1, hsdR17(r-, m-).
- supE44, thi-1, -, recA1, gyrA96, relA1, (argF-lacZYA)U169, 0801acZ M15) and DH5 ⁇ F' were from Bethesda Research Laboratories.
- Plasmid SK-. SK-, and M13 helper phage, R408, were from Stratagene.
- L-A cDNA was synthesized using (+) strand message of L- A, synthesized in vitro, as a template.
- L-A- VLPs were prepared from strain RE59 as described by Fujimura et al, 1986, Proc. Natl. Acad. Sci. USA 83:4433-4437, except that the concentration of NaCl in the extraction buffer (buffer A) was raised to 500 mM to stabilize particles, and CsCl density gradient centrifugation was performed twice.
- L-A (+) strand RNA was synthesized from the purified VLPs as described by Welsh et al, 1980, Nucleic Acids Res. 8:2349-2363.
- each substrate (NTP) concentration was raised to 1.5 mM and the MgCl z concentration was adjusted to 10 mM. After 90 minutes incubation at 30°C, the reaction was stopped by phenol, and then standard phenol-chloroform extraction followed. After ethanol precipitation, the mixture of L-A ssRNA and dsRNA was used directly as a template for the cDNA synthesis without further manipulation. The presence of dsRNA interferes neither with cDNA synthesis nor with the ligation reaction.
- Two synthetic primers GCATATGGGTAATTCCCATTATCTTTTTGGC (PRIMER I) and GAAAAATTTTTAAATTCATATAACTCCCC (PRIMER II), were used to synthesize L-A cDNA. These primer sequences were based on the 3' and 5' terminal sequences of L-A dsRNA (Thiele et al, 1984, Mol. Cell. Biol. 4:92-100). The 5'- termini of these primers were phosphorylated by T4 polynucleotide kinase. The first strand was synthesized with m_MLV reverse transcriptase following the manufacturer's protocol, except that oligo dT was replaced by the primer I.
- the primer II was included in the reaction mixture, annealed, and the second strand synthesis was performed using DNA polymerase I with RNaseH. This use of the second primer allowed us to generate cDNA having an intact 5'-end. No labeled nucleotide was used at any point in the reaction process.
- the reaction was terminated by a phenol extraction and the full size cDNA which runs at the same position as dsRNA was purified from a preparative agarose gel using DEAE-cellulose paper.
- the size fractionated cDNA was ligated into the Smal site of the multiple cloning site of a Bluescript vector, SK-.
- the ligated DNA mixture was transformed into frozen competent cells of E.
- the plasmids, L03 and L05 have L-A cDNA inserts whose orientation is such that the 5' end of the L-A ( + ) strand sequence is next to the universal primer site in the SK- vector, whereas the insert in L28 has the opposite orientation.
- These plasmids were digested at the Hindlll and Apal sites in the multiple cloning site of the SK- vector, and a series of deletions were generated using ExoIII and SI nuclea ⁇ e (Henikoff, 1987, Methods Enzymol. 155:156-165). ssDNas were prepared following the protocol supplied by Stratagene with the following modifications.
- a deposit of the cDNA clone of the L-A dsRNA has been made at the ATCC, Rockville, Maryland, on February 10,1989 under accession number 67,888.
- the deposit shall be viably maintained, replacing if it becomes non-viable, for the life of the patent or a period of 30 years from the date of the deposit, or for 5 years from the last date of request for a sample of the deposit, whichever is longer, and made available to the public without restriction in accordance with the provisions of the law.
- the Commissioner of Patents and Trademarks, upon request, shall have access to the deposit.
- RNA expression vector and as a helper for such an RNA expression vector.
- ORF1 680 amino acids extends from base 30 to base 2072 of the L-A(+) strand and encodes the major coat protein.
- ORF2 868 amino acids extends from base 1940 to 4546 and encodes part of the ssRNA-binding protein.
- ORF1 and ORF2 apparently by a -1 translational frameshift, produces the complete 180 kDa protein.
- ORF2 also contains a sequence characteristic of the RNA-dependent RNA polymerases of several picorna- and togavriuses (Fig. 4).
- Retroviruses including HIV, use ribosomal frameshifting to make a large amount of the gag protein (the major coat protein of the viral cores) and a small amount of the gag-pol fusion protein.
- the gag-pol fusion protein contains a number of domains, such as a domain that is identical to the gag protein itself, a domain that has the reverse transcriptase activity, and other protease, integrase and RNase H domains.
- the retroviruses cannot replicate unless they are able to make the host ribosomes carry out this frameshifting from the upstream gag reading frame to the downstream pol reading frame.
- ORF1 of L-A encodes the major coat protein of the viral particles in which L-A is found in the cell (like gag of retroviruses).
- ORF2 encodes a part of the 180 kDa protein with homology to RNA-dependent RNA polymerases that has single-stranded RNA binding activity.
- the L-A major coat protein encoded by ORF1 is made in large amounts.
- the ORF1- ORF2 fusion protein (the 180 kDa protein) is made in small amounts. The mechanism appears to be same. The shift from ORF1 to ORF2 must occur in the 130 bp region of overlap between ORF1 and ORF2.
- the exact site of the shift in HIV, RSV and in several, other retroviruses has been precisely determined and has been shown to occur at the sites shown in Fig. 3 for HIV and for RSV.
- the essential elements of this site are tbe senquences, 5' UUUUUUA 3' for HIV or 5 ⁇ AAUUUA 3' for RSV, followed closely by an inverted repeat sequence that most likely functions to slow down the ribosomes.
- a similar sequence was found in L-A in the 130 bp overlap region.
- the reading frame in this homologous region is the same as that in HIV where it frameshifts.
- the ORF1 frame in this G GGU UUA sequence is such that a -1 base "simultaneous slippage" (Jacks et al, 1988, Nature 331:280- 283; Jacks et al, 1988, Cell, 55: 447-458) of peptidyl tRNA z1y bound to the GGU and leucyl tRNA 1zu bound to the UUA leaves the non-wobble bases of each tRNA anticodon still paired to the mRNA.
- This mechanism has been demonstrated by Jacks et al, supra, for RSV, and is strongly suggested for other retroviruses which frameshift.
- L-A apparently uses the same mechanism for the synthesis of its fusion protein.
- ribosomal frameshifting is an interaction of the ribosome and the mRNA, it is reasonable to use any message construct to examine its mechanism whether or not that construct comes from a retrovirus or not. At the time the ribosomes are frameshifting on HIV message, they have no way of knowing whether the RNA came from a retrovirus or not.
- the yeast system of the present invention provides easy genetic manipulability for host genes , viral components and clones.
- the region at which the frameshifting occurs is placed upstream of the beta- galactosidase gene or of a gene such as LEU2 or URA3 or LYS2 or CAN1 whose increased or decreased expression can be selected (Fig. 5).
- the frame is adjusted so that only if the frameshifting occurs will the downstream signal gene be expressed.
- One or more of these constructs (Fig. 5) are introduced into yeast strains and mutants are isolated in genes that affect frameshifting efficiency by either increasing or decreasing it. Drugs are screened for their effects on frameshifting using cells containing these "frameshift vectors". A decrease in frameshifting would interfere with retroviral replication by interfering with the supply of reverse transcriptase.
- control constructs are prepared in which the signal gene is in frame with the upstream region so that no frameshift is needed for expression. Yet other control constructs have the signal gene in the +1 frame.
- Particle-bound antigens have long been known to be more antigenic than soluble antigens (Adams et al, 1987, Nature 329:68-70).
- gene fusions of ORF1 encoding the major coat protein of L-A are made with the gene of the protein antigen against which immunization is desired.
- the fusion is introduced into yeast and expressed.
- the particles formed by the major coat protein then have the protein antigen attached at multiple locations on each of the particles.
- Expression at various levels in the presence or absence of endogenous L-A virus can be used to produce particles having various numbers of antigen side chains per particle.
- the DNA sequence for the protein antigen is introduced at various sites within the major coat protein gene.to determine which sites give the most immunogenic particles.
- the particles can be purified easily using their physical properties.
- the particles can then be inoculated to induce the desired immune response.
- L-A cDNA clones to express and produce a desired protein and as a helper for an X cDNA-based RNA vector.
- the viral (+) strands are an intermediate.
- Viral (+) strands are synthesized by viral particles that contain the viral double- stranded RNA genome and extruded from the viral particles. They then serve a dual role:
- (+) strands are the mRNA that is used by the ribosomes to make the two viral proteins needed for viral packaging and replication, namely, the major coat protein (80 kDa) and the major coat protein-RNA polymerase fusion protein (180kDa).
- the L-A cDNA clone can also be modified to encode the desired protein instead of, or in addition to, the normally encoded proteins.
- Replication requires the 3' terminal 30 bases and a region about 400 bases from the 3' end (the Internal Replication Enhancer).
- the region coding for the viral proteins is replaced by the gene for the desired protein.
- the signals for transcription and packaging and replication are left intact and the desired protein is allowed to be expressed.
- the L-A cDNA clone is altered as above to contain the desired gene and upstream of the modified L-A sequence is placed either a yeast promoter or a T7 RNA polymerase promoter.
- This vector is then introduced into a yeast strain that carries a normal L-A virus to supply the replication and packaging proteins. Then, the transcription of the modified L-A is turned on.
- the (+) strands thus produced (because they have the packaging sequences) are packaged in virus particles replicated and transcribed.
- the (+) strand transcripts are translated to produce the desired product.
- L-A cDNA clone in producing the desired protein is as a source of large amounts of replication proteins.
- the normal L-A produces the replicase (RNA.rdependent RNA polymerase) as a fusion protein with the major coat protein at about 1% of the amount of coat protein alone. While this ratio may be optimal for maintenance and replication of L-A in a normal host strain, it is probably sub-optimal for maximal copy number and expression in the ski-mutant hosts that give up to 10-20% of host proteins as L-A major coat protein.
- the mechanism of formation of the fusion protein is ribosomal frameshifting.
- RNA-dependent RNA polymerase can be supplied to the replicating virus to increase its copy number and rate of transcription.
- This example shows the construction of a frameshift vector' using the frameshift region of the L-A viral sequence.
- the structure is schematically illustrated in Fig. 5.
- the yeast PYK1 promoter is linked to an AUG start codon followed by the frameshift sequence from the L-A virus.
- the region of L-A analogous to HIV or RSV is shown for illustrative purposes in Fig.5, but the exact region of L-A responsible for frame shifting is inserted during the construction.
- a termination codon, TAA is a termination codon, in the unshifted frame, so that ribosomes that have not shifted will cease translation and not have the opportunity to shift further downstream.
- TAA termination codon
- coli lacZ gene encoding beta-galactosidase is placed next and is in the -1 frame relative to the AUG. This means that the ribosomes must shift back one base on the mRNA in order to properly translate this region.
- Control vectors with beta-galactosidase in the original "0" frame or in the "+1” frame are also made, but are not shown in Fig. 5.
- the vector also carried replication origins and selectable markers for yeast and E. coli.
- the vectors are transformed into a wild- type yeast strain and the levels of beta-galactosidase in the "0" frame with the "-1" frame and the "+1" frame.
- the amount of beta-galactosidase in a colony can also be estimated using plates containing X-gal and the blue color that results from its breakdown by the enzyme.
- Cells carrying the "-1" vector (the construct shown in Fig. 5) are grown on plates containing a drug to be tested for its effects on frameshifting.
- a change in the shade of blue can be used as a simple qualitative screen for an increase or decrease of the degree of frameshifting.
- hundreds of drugs can be quickly screened for such an effect.
- More careflul quantitative assays can then be carried out on promising drugs using the simple beta-galactosidase assay of permeabilized whole cells. Since the yeast translation apparatus closely resembles that of animal cells, this method can be used to screen and determine the direct effects of drugs on the replication of retroviruses in tissue culture or in vivo tests.
- the same strain carrying the frameshift vector can be mutagenized and plated for single colonies. Those colonies that are more or less blue than the parent strain can then be analyzed to detect single-gene mutations causing increased or decreased ribosomal frameshifting.
- the genes involved can be cloned and characterized and their mammalian counterpart examined for similar effects on translation in mammalian cells.
- constructs such as are shown in Fig. 6 are prepared.
- the L-A ORF1 encoding the major coat protein is fused in frame to the p24 gene. [In other constructs not shown the p24 sequence is inserted within the L-A ORF1 or at the N-terminus.]
- the expression vector carrying this construct is introduced into a yeast host.
- the major coat protein with the p24 sequences attached forms viral particles which are then purified in large amounts by conventional methods.
- the L-A ORF1- ORF2 fusion protein is expressed separately from a separate vector to determine whether this fusion protein is, as we have hypothesized, necessary for particle formation (Fujimura & Wickner, 1988, Cell, 55:663-671).
- the purified particles are used to induce an immune response or to generate antibody reagents.
- the particles are also used as the antigen in tests for determining the presence of antibody in serum of patients or animals.
- the L-A ORF1 and ORF2 are fused in an expression vector by simply inserting one base in the region of overlap between ORF1 and ORF2. This vector then expresses the viral RNA polymerase.
- ORFs are used to supply needed products to the X dsRNA-based expression vector which has all cis sites necessary for replication, transcription and packaging, using the cDNA clone of X, the gene for a protein whose production is desired can be inserted, introduced into yeast, regenerated as an RNA virus and expressed by the L-A encoded transcription apparatus.
- the cloning of the L-A genome makes possible supplying or modifying the protein components of the L-A packaging and transcription apparatus from these clones in such a way as to optimize expression from the modified X virus-vector. This is schematically shown in Fig. 7.
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Virology (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Un clone ADN complémentaire du génome ARN à double brin d'un virus de levure et diverses applications de ce clone sont décrits.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US31121789A | 1989-04-05 | 1989-04-05 | |
US311,217 | 1989-04-05 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO1990012094A1 true WO1990012094A1 (fr) | 1990-10-18 |
Family
ID=23205928
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1990/001716 WO1990012094A1 (fr) | 1989-04-05 | 1990-04-04 | Clone d'un virus arn a double brin et ses applications |
Country Status (2)
Country | Link |
---|---|
AU (1) | AU5421090A (fr) |
WO (1) | WO1990012094A1 (fr) |
Cited By (12)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6602705B1 (en) | 1998-12-31 | 2003-08-05 | Chiron Corporation | Expression of HIV polypeptides and production of virus-like particles |
US6689879B2 (en) | 1998-12-31 | 2004-02-10 | Chiron Corporation | Modified HIV Env polypeptides |
US7211659B2 (en) | 2001-07-05 | 2007-05-01 | Chiron Corporation | Polynucleotides encoding antigenic HIV type C polypeptides, polypeptides and uses thereof |
US7282364B2 (en) | 2001-08-31 | 2007-10-16 | Novartis Vaccines And Diagnostics, Inc. | Polynucleotides encoding antigenic HIV type B polypeptides, polypeptides and uses thereof |
US7560438B2 (en) | 1997-12-23 | 2009-07-14 | The Carnegie Institution Of Washington | Genetic inhibition by double-stranded RNA |
US7888325B2 (en) | 1999-01-28 | 2011-02-15 | Medical College Of Georgia Research Institute, Inc. | Composition and method for in vivo and in vitro attenuation of gene expression using double stranded RNA |
US7943375B2 (en) | 1998-12-31 | 2011-05-17 | Novartis Vaccines & Diagnostics, Inc | Polynucleotides encoding antigenic HIV type C polypeptides, polypeptides and uses thereof |
US8053419B2 (en) | 1998-03-20 | 2011-11-08 | Commonwealth Scientific And Industrial Research Organisation | Synthetic genes and genetic constructs |
US8168774B2 (en) | 1998-03-20 | 2012-05-01 | Commonwealth Scientific And Industrial Research Organisation | Control of gene expression |
US8183217B2 (en) | 1999-08-13 | 2012-05-22 | Commonwealth Scientific And Industrial Research Organisation | Methods and means for obtaining modified phenotypes |
US8263394B2 (en) | 1998-12-31 | 2012-09-11 | Novartis Vaccines & Diagnostics Inc. | Polynucleotides encoding antigenic HIV type B polypeptides, polypeptides, and uses thereof |
US9051566B2 (en) | 2001-01-31 | 2015-06-09 | Alnylam Pharmaceuticals, Inc. | Post-transcriptional gene silencing using expressed double stranded RNA |
-
1990
- 1990-04-04 AU AU54210/90A patent/AU5421090A/en not_active Abandoned
- 1990-04-04 WO PCT/US1990/001716 patent/WO1990012094A1/fr unknown
Non-Patent Citations (8)
Title |
---|
BIOLOGICAL ABSTRACTS, Volume 86, issued 15 September 1988, R. ESTEBAN et al.: "Site-specific binding of viral plus single-stranded RNA to replicase-containing open virus-like particles of yeast", see Ref. No. 58368, PROC. NATL. ACAD. SCI. USA 85(12): 4411-4415. * |
CELL, Volume 55, published 18 November 1988, T. FUJIMURA et al.: "Gene overlap results in a viral protein having an RNA binding domain and a major coat protein domain", pp. 663-671, see the entire article. * |
CELL, Volume 55, published 23 December 1988, W. WILSON et al.: "Ribosomal frameshifting is directed by a short sequence in both mammalian and yeast systems", pp. 1159-1169, see entire article. * |
GenBank and UEMBL nucleotide sequence data bases. Sequence provided to GenBank data base on 08 September 1988 by R.B. WICKNER. (93% sequence homology with nucleotides 4041 to 4500 of the instant application). * |
J. BIOL. CHEM., Volume 264, published 25 April 1989, T. ICHO et al.: "The double-stranded RNA genome of yeast virus encodes its own putative RNA polymerase by fusing two open reading frames", pp. 6716-6723, see entire article. * |
MOL. CELL. BIOL. Volume 1, published January 1984, D.J. THIELE et al.: "Multiple L double-stranded RNA species of Saccharomyces cerevisiae: evidence for separate encapsidation", pp. 92-100, see the entire article. * |
NUCL. ACID. RES. Volume 13, Number 5, published April 1985, J. BRUENN et al.: "Long internal inverted repeat in a yeast viral double-stranded RNA", pp. 1575-1591, see the entire article. * |
YEAST, Volume 4, special issue, published August 1988, W. WILSON et al.: "Human Immunodeficiency virus (HIV-1) gene expression: ribosomal frameshifting requires a short sequence and no secondary in yeast and mammalian systems", pp. S177, see the entire abstract. * |
Cited By (24)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7622633B2 (en) | 1997-12-23 | 2009-11-24 | Carnegie Institution Of Washington | Genetic inhibition by double-stranded RNA |
US9102939B2 (en) | 1997-12-23 | 2015-08-11 | The Carnegie Institution Of Washington | Genetic inhibition by double-stranded RNA |
US7560438B2 (en) | 1997-12-23 | 2009-07-14 | The Carnegie Institution Of Washington | Genetic inhibition by double-stranded RNA |
US8053419B2 (en) | 1998-03-20 | 2011-11-08 | Commonwealth Scientific And Industrial Research Organisation | Synthetic genes and genetic constructs |
US9963698B2 (en) | 1998-03-20 | 2018-05-08 | Commonwealth Scientific And Industrial Research Organisation | Control of gene expression |
US8168774B2 (en) | 1998-03-20 | 2012-05-01 | Commonwealth Scientific And Industrial Research Organisation | Control of gene expression |
US9029527B2 (en) | 1998-03-20 | 2015-05-12 | Commonwealth Scientific And Industrial Research Organisation | Synthetic genes and genetic constructs |
US7348177B2 (en) | 1998-12-31 | 2008-03-25 | Novartis Vaccines And Diagnostics, Inc. | Expression of HIV polypeptides and production of virus-like particles |
US8168418B2 (en) | 1998-12-31 | 2012-05-01 | Susan W Barnett | Expression of HIV polypeptides and production of virus-like particles |
US7943375B2 (en) | 1998-12-31 | 2011-05-17 | Novartis Vaccines & Diagnostics, Inc | Polynucleotides encoding antigenic HIV type C polypeptides, polypeptides and uses thereof |
US6689879B2 (en) | 1998-12-31 | 2004-02-10 | Chiron Corporation | Modified HIV Env polypeptides |
US8263394B2 (en) | 1998-12-31 | 2012-09-11 | Novartis Vaccines & Diagnostics Inc. | Polynucleotides encoding antigenic HIV type B polypeptides, polypeptides, and uses thereof |
US6602705B1 (en) | 1998-12-31 | 2003-08-05 | Chiron Corporation | Expression of HIV polypeptides and production of virus-like particles |
US7662916B2 (en) | 1998-12-31 | 2010-02-16 | Novartis Vaccines & Diagnostics, Inc | Modified HIV Env polypeptides |
US8148345B2 (en) | 1999-01-28 | 2012-04-03 | Georgia Health Sciences University Research Institute, Inc. | Composition and method for in vivo and in vitro attenuation of gene expression using double stranded RNA |
US7888325B2 (en) | 1999-01-28 | 2011-02-15 | Medical College Of Georgia Research Institute, Inc. | Composition and method for in vivo and in vitro attenuation of gene expression using double stranded RNA |
US8183217B2 (en) | 1999-08-13 | 2012-05-22 | Commonwealth Scientific And Industrial Research Organisation | Methods and means for obtaining modified phenotypes |
US9708621B2 (en) | 1999-08-13 | 2017-07-18 | Commonwealth Scientific And Industrial Research Organisation | Methods and means for obtaining modified phenotypes |
US10190127B2 (en) | 1999-08-13 | 2019-01-29 | Commonwealth Scientific And Industrial Research Organisation | Methods and means for obtaining modified phenotypes |
US9051566B2 (en) | 2001-01-31 | 2015-06-09 | Alnylam Pharmaceuticals, Inc. | Post-transcriptional gene silencing using expressed double stranded RNA |
US8133494B2 (en) | 2001-07-05 | 2012-03-13 | Novartis Vaccine & Diagnostics Inc | Expression cassettes endcoding HIV-1 south african subtype C modified ENV proteins with deletions in V1 and V2 |
US9598469B2 (en) | 2001-07-05 | 2017-03-21 | Novartis Vaccines And Diagnostics, Inc. | HIV-1 south african subtype C env proteins |
US7211659B2 (en) | 2001-07-05 | 2007-05-01 | Chiron Corporation | Polynucleotides encoding antigenic HIV type C polypeptides, polypeptides and uses thereof |
US7282364B2 (en) | 2001-08-31 | 2007-10-16 | Novartis Vaccines And Diagnostics, Inc. | Polynucleotides encoding antigenic HIV type B polypeptides, polypeptides and uses thereof |
Also Published As
Publication number | Publication date |
---|---|
AU5421090A (en) | 1990-11-05 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Timm et al. | Escherichia coli-mycobacteria shuttle vectors for operon and gene fusions to lacZ: the pJEM series | |
US5378806A (en) | Fusion protein produced by retrovirus-mediated secretion | |
US4797368A (en) | Adeno-associated virus as eukaryotic expression vector | |
US4663290A (en) | Production of reverse transcriptase | |
US5955280A (en) | Reverse two-hybrid system | |
CA2087270C (fr) | Baculovirus modifie, son procede d'obtention, et vecteurs d'expression obtenus a partir dudit baculovirus | |
Rappleye et al. | A Tn10 derivative (T-POP) for isolation of insertions with conditional (tetracycline-dependent) phenotypes | |
US4788135A (en) | System for efficient isolation of genes using probes | |
Glover | Gene cloning: the mechanics of DNA manipulation | |
Siegel et al. | The role of the host cell membrane in the replication and morphogenesis of bacteriophages | |
WO1990012094A1 (fr) | Clone d'un virus arn a double brin et ses applications | |
JP2002517995A (ja) | 所望の特性を有するポリヌクレオチドを生成するための方法 | |
JPS6229966A (ja) | pho A−変異菌E・コリ−SB44、その製法、これを利用するpho A−遺伝子含有プラスミドの単離法、新規プラスミド及びプラスミドベクタ−、pho A−遺伝子含有プラスミドの製法、新規菌株の製法及びアルカリホスフアタ−ゼの製法 | |
JPH0779708B2 (ja) | 遺伝子産物の製造法 | |
JP2001525187A (ja) | 細菌マルチハイブリッド系および用途 | |
EP0850299B1 (fr) | Presentation combinee ligand et recepteur | |
Marvik et al. | Bacteriophage P2 and P4 assembly: alternative scaffolding proteins regulate capsid size | |
WO1990012488A2 (fr) | Clone d'un virus arn a double brin applique a la production d'anticorps, etude du changement de structure semblable au retrovirus et production de proteines dans la levure | |
Wu et al. | Hepatitis delta virus mutant: effect on RNA editing | |
Bold et al. | Biologically active mutants with deletions in the v-mos oncogene assayed with retroviral vectors | |
Cole et al. | Biological properties of simian virus 40 host range mutants lacking the COOH-terminus of large T antigen | |
Merkulov et al. | Libraries of green fluorescent protein fusions generated by transposition in vitro | |
EP0803574A2 (fr) | Sécrétion de produits recombinants par l'intermédiaire d'un rétrovirus | |
US20020187497A1 (en) | Method to identify IRES elements | |
PL152527B1 (en) | Process for preparing plasmid vectors having a high copy-number |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AU CA JP |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): AT BE CH DE DK ES FR GB IT LU NL SE |