WO1988008428A1 - Method for purifying granulocyte/macrophage colony stimulating factor - Google Patents
Method for purifying granulocyte/macrophage colony stimulating factor Download PDFInfo
- Publication number
- WO1988008428A1 WO1988008428A1 PCT/US1988/001228 US8801228W WO8808428A1 WO 1988008428 A1 WO1988008428 A1 WO 1988008428A1 US 8801228 W US8801228 W US 8801228W WO 8808428 A1 WO8808428 A1 WO 8808428A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- csf
- process according
- microorganism
- glutathione
- solution
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K1/00—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
- C07K1/14—Extraction; Separation; Purification
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/53—Colony-stimulating factor [CSF]
- C07K14/535—Granulocyte CSF; Granulocyte-macrophage CSF
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P21/00—Preparation of peptides or proteins
Definitions
- the present invention provides a method for purifying granulocyte-macrophage colony stimulating factor
- GM-CSF GM-CSF
- the present invention relates to procedures for rapid and efficient isolation and purification of biologically active GM-CSF produced from a transformed E. coli microorganism.
- Colony-stimulating factors are glycoproteins that stimulate the growth of hematopoietic progenitors and enhance the functional activity of mature effector cells.
- Human GM-CSF is a 22-kDa glycoprotein that stimulates the growth of myeloid and erythroid progenitors in vitro and increases the responsiveness of neutrophils, monocytes, and eosinophils to physiologic stimuli.
- bacterially produced GM-CSF was lysed from the microorganism, suspended in guanidinium hydrochloride and mercaptoethanol and chromatographed over G-100 Sephadex. The fractions were collected and the denaturant and reductant removed by dialysis against neutral Tris buffer. The final purification step was gradient elution from a reverse-phase support at pH 2.1.
- the present invention provides a novel process for isolating and purifying GM-CSF from a GM-CSF producing microorganism comprising:
- Figure 1 is a schematic representation of the preparation of plasmid pCFM1156 GM-CSF3.
- GM-CSF refers to a protein that is produced by a microorganism that has been transformed with a GM-CSF gene or modification thereof that encodes a protein having (1) an amino acid sequence that is at least substantially identical to the amino acid sequence of native GM-CSF and (2) biological activity that is common to native GM-CSF.
- Substantial identical amino acid sequence means that the sequences are identical or differed by one or more amino acid alterations (i.e., deletions, additions, substitutions) that do not produce an adverse functional dissimilarity between the synthetic protein in native GM-CSF.
- GM-CSF producing microorganism refers to a microorganism that has been genetically engineered to produce a protein that possesses biological activity associated with GM-CSF.
- biological activity of GM-CSF includes therapeutic activity of GM-CSF.
- the microorganisms are grown in a suitable growth media, the composition thereof will depend upon the particular microorganism involved.
- the cells are harvested from the culture, and may be concentrated if necessary, by filtration, centrifugation, and other conventional methods.
- the cell membranes of the microorganisms are lysed using conventional techniques such as homogenization, sonication, or pressure cycling.
- Preferred methods include sonication or homogenization with a MantonGaulin homogenizer.
- the particulate matter containing GM-CSF is separated from the liquid phase of lysate and resuspended in water.
- the particulate matter may be optionally washed to remove any water soluble E. coli proteins therein.
- the GM-CSF in the particulate matter is solubilized in the presence of a solubilizing agent preferably under basic pH conditions.
- the solubilizing agent is a chaotropic agent (i.e., a protein denaturant that dissociates hydrogen bonds and effects the tertiary structure of the proteins) generally in an aqueous solution.
- chaotropic agents include urea and guanidinium hydrochloride. Urea is preferred.
- concentration of the chaotropic agent will depend upon the particular agent that is used and the amount of cellular material present. Preferably a urea solution having a concentration of 6-8M is employed and most preferably an 8M urea solution is employed.
- the pH may be adjusted by adding suitable buffers, and preferably the pH will range from about 8 to about 9.0.
- GM-CSF GM-CSF
- insoluble particulate matter is separated and discarded.
- the soluble GM-CSF is oxidized in the presence of a reducing agent. It has been found that the yield of correctly folded GM-CSF, that is, oxidized GM-CSF having the correct native conformation of disulfide bonds, is increased by facilitating rearrangement of disulfide bonds through the use of a glutathione redox buffer (glutathione and oxidized glutathione).
- the GM-CSF is oxidized by the oxidized glutathione and the presence of the reducing agent, glutathione, in the redox buffer substantially reduces the formation of incorrectly folded GM-CSF, that is GM-CSF with incorrect disulfide bonds.
- the ratio of glutathione: oxidized glutathione in the redox buffer is readily ascertained by one of ordinary skill in the art.
- an excess of glutathione is employed, more preferably a ratio of from 2:1 to 10:1 on a weight basis glutathione: oxidized glutathione is employed.
- Most preferably a 5:1 ratio on a weight basis of glutathione: oxidized glutathione is employed.
- the resulting solution is concentrated and any remaining particulate matter is removed.
- the concentrated solution is buffer exchanged to remove residual urea and glutathione.
- the correctly folded GM-CSF is selectively separated from incorrectly folded GM-CSF by adjusting the pH of the concentrated solution to a pH range of from about 4.5 to 6.0 and preferably to 5.0 to 5.5 using an appropriate acid such as acetic acid. It has been found that within this pH range (i.e., 4.5-6.0) incorrectly folded GM-CSF is precipitated and the correctly folded GM-CSF remains soluble in solution.
- the resulting mixture is centrifuged and any insoluble particulate matter is removed and the soluble correctly folded GM-CSF is recovered from the remaining solution.
- the purified GM-CSF (i.e., correctly folded GM-CSF) is separated from any remaining contaminants employing chromatographic procedures. It is preferred to employ ion exchange or reverse phase high pressure liquid chromatography or combinations thereof to recover the purified GM-CSF.
- high yields of purified GM-CSF are recovered through use of a CM-Sepharose ion exchange column followed by separation using a C4 silica gel column in Tris buffer containing about 60% aqueous ethanol. Culture supernatants are preferably concentrated before chromatographic treatment and suitable steps are taken to remove ethanol from the collected eluent fraction containing GM-CSF.
- the ethanol may be removed using ion exchange chromatography.
- the GM-CSF thus separated may be formulated with pharmaceutically acceptable adjuvants, preferably phosphate buffered saline (pH 7.5) to yield a final product that is acceptable for administration to patients.
- RNA obtained from bladder carcinoma cell line 5637 ((subclone 1A6) as obtained from Dr. Platzer, University of Er Weg-Nurnberg, West Germany) was probed with the oligonucleotide:
- the Wong et al. sequence had the codon ACT coding for threonine, while the sequence for the positive clone obtained herein had the codon ATT coding for isoleucine.
- the GM-CSF gene was cloned for expression into an E. coli expression vector, pCFM1156, using a synthetic sequence containing a ribosome binding site, an amino terminal methionine, and the first 25 amino acids of the mature protein, along with the portion of the cDNA clone containing the carboxy terminal 102 amino acids and termination codon.
- the expression plasmid pCFM1156 may readily be contructed from a plasmid pCFM836, the construction of which is described in published European Patent Application No. 136,490.
- pCFM836 is first cut with NdeI and then blunt-ended with PolI such that both existing NdeI sites are destroyed.
- the vector is digested with ClaI and SacII to remove an existing polylinker before ligation to a substitute polylinker as illustrated in Table I.
- This substitute polylinker may be constructed according to the procedure of Alton, et al., PCT Publication No. W083/04053.
- Control of expression in the expression pCFM1156 plasmid is by means of a lambda P L promoter, which itself may be under the control of a C 1857 repressor gene (such as is provided in E. coli strain K12 ⁇ Htrp).
- the plasmid pCFM1156 was cut with Xbal and Ncol and the large DNA fragment was isolated.
- the synthetic Fragment A contained an Xbal end, a HaeII end, and internal Hpal and Ndel sites and has the following sequence:
- the GM-CSF cDNA clone, pBR GM-CSF was cut HaeII to Ncol and the DNA fragment was gel purified. The three DNA fragments were ligated together to generate plasmid pCFM1156 GM-CSFl.
- the plasmid pCFM1156 GM-CSFl was cut with Ndel and Hpal and phosphatased. It was then ligated with synthetic Fragment B to generate pCFM1156 GM-CSF2.
- GM-CSF codon for leucine at position 25 was changed from CTC to CTG. This modification reduces RNA secondary structure and was accomplished by site directed mutagenesis.
- Site directed mutagenesis was performed using the oligonucleotide TCGGCGCCTGCTGAACCTGA, and positive clones (M13mp10 GM-CSF3) were identified by hybridizing to this same oligonucleotide phosphorylated with 32 P.
- the GM-CSF producing microorganism was inoculated under a laminar airflow hood into Fernbach flasks, each containing Luria broth (Luria Broth: Bactotryptone 10 g/L, Yeast Extract 5 g/L, NaCl 5 g/L).
- the inoculated flasks were shaken at approximately 28°C until the cell density was approximately 0.5 OD units.
- the flasks were then rapidly shifted to 42°C and were maintained at 42°C for 3 hours and a cell paste was harvested by centrifugation.
- Cell paste containing GM-CSF in transformed E. coli cells, such as obtained from Example 2 was dispersed with a Brinkman homogenizer at a temperature of approximately 3°C until completely dispersed. The suspension was passed through a Gaulin homogenizer three times.
- the homogenate was maintained at a temperature of less than 18oC.
- the homogenate was diluted to 6 parts water and the resulting mixture was centrifuged at a temperature of 3°C.
- the supernatant was decanted and the remaining residue was resuspended with water to yield a mixture having a final volume of 6 parts water.
- the resulting mixture was centrifuged at a temperature of 3°C and the supernatant was decanted and the remaining residue was suspended with water to yield a mixture having a final volume of 0.9 parts water.
- To the resulting mixture was added 0.3 parts of 1M Tris (pH 8.5) and 4.8 parts of 10M urea.
- the resulting mixture was centrifuged at a temperature of 14°C and the supernatant was collected. To the supernatant was added a solution containing 0.04 parts glutathione and 0.008 parts oxidized glutathione in 54 parts of 20 mM Tris (pH 8.5). The resulting mixture was maintained at approximately 5°C for 20 hours. The mixture was concentrated by passing through a 10,000 MW membrane. The retentate was diafiltered through a 10,000 MW membrane at 5oC with at least 30 parts of 20 mM Tris (pH 8.5).
- the pH of the retentate was adjusted to pH 5.3 with 50% acetic acid.
- the mixture was centrifuged at a temperature of 3°C.
- the supernatant was removed and was loaded onto a CM-Sepharose column and eluted with 20 mM sodium acetate, 45 mM NaCl (pH 5.4).
- the pH of the eluent was adjusted to pH 7.7 with 1M Tris (pH 8.5).
- the eluent from the CM-Sepharose column was chromatographed on a C4 Silica column at 5°C using first 20% ethanol, 50 mM Tris (pH 7.7) and then 40% ethanol, 50 mM Tris (pH 7.7).
- Biologically active GM-CSF was eluted from the column with a gradient from 40% ethanol, 50 mM Tris-HCl (pH 7.7) to 60% ethanol, 50 mM Tris-HCl (pH 7.7).
- the eluent collected was chromatographed on a DEAE-Sepharose column at 5°C using 20 mM Tris (pH 7.7), then.10 mM NaPO 4 (pH 7.5) and then 10 mM NaPO 4 , 15 mM NaCl (pH
- the GM-CSF was eluted off the column with 10 mM NaPO 4 , 60 mM NaCl, pH 7.5.
- the eluent containing purified GM-CSF was diluted with water to a final concentration of 0.5 mg/ml with 10 mM NaPO 4 , 60 mM NaCl pH 7.5.
- To the resulting solution was added 1/62.5 volume of 5M NaCl to yield final product.
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biochemistry (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Toxicology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Microbiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| FI885986A FI94867C (fi) | 1987-04-28 | 1988-12-27 | Menetelmä granulosyytti-makrofaagi-pesäkkeitä stimuloivan tekijän puhdistamiseksi |
| NO885777A NO175638C (no) | 1987-04-28 | 1988-12-27 | Fremgangsmåte for isolering av granulocytt/makrofag-kolonistimulerende faktor (GM-CSF) fra en GM-CSF-produserende mikroorganisme |
| DK724288A DK724288D0 (da) | 1987-04-28 | 1988-12-27 | Fremgangsmaade til oprensning af granulocyt/makrofag koloni-stimulerende faktor |
| KR88701747A KR960001740B1 (en) | 1987-04-28 | 1988-12-28 | Method for purifying granulocyte/macrophage colony stimulating |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US4333187A | 1987-04-28 | 1987-04-28 | |
| US043,331 | 1987-04-28 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO1988008428A1 true WO1988008428A1 (en) | 1988-11-03 |
Family
ID=21926624
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US1988/001228 Ceased WO1988008428A1 (en) | 1987-04-28 | 1988-04-19 | Method for purifying granulocyte/macrophage colony stimulating factor |
Country Status (15)
| Country | Link |
|---|---|
| EP (1) | EP0289267B1 (https=) |
| JP (1) | JPH0771506B2 (https=) |
| KR (1) | KR960001740B1 (https=) |
| AT (1) | ATE83780T1 (https=) |
| AU (1) | AU621051B2 (https=) |
| CA (1) | CA1302652C (https=) |
| DE (1) | DE3876843T2 (https=) |
| ES (1) | ES2036680T3 (https=) |
| FI (1) | FI94867C (https=) |
| GR (1) | GR3006984T3 (https=) |
| IL (1) | IL86163A (https=) |
| NO (1) | NO175638C (https=) |
| NZ (1) | NZ224371A (https=) |
| WO (1) | WO1988008428A1 (https=) |
| ZA (1) | ZA882808B (https=) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA1339757C (en) * | 1987-04-16 | 1998-03-17 | Robert F. Halenbeck | Production of purified biologically active, bacterially produced recombinant human csf-1 |
| US4929700A (en) * | 1987-04-16 | 1990-05-29 | Cetus Corporation | Production of purified, biologically active, bacterially produced recombinant human CSF-1 |
| JP2796388B2 (ja) * | 1988-05-13 | 1998-09-10 | アムジエン・インコーポレーテツド | G−csfの精製方法 |
| JP2517100B2 (ja) * | 1989-03-08 | 1996-07-24 | 協和醗酵工業株式会社 | ヒト顆粒球コロニ―刺激因子活性を有する蛋白質の精製法 |
| GB9107846D0 (en) * | 1990-04-30 | 1991-05-29 | Ici Plc | Polypeptides |
| US6911204B2 (en) | 2000-08-11 | 2005-06-28 | Favrille, Inc. | Method and composition for altering a B cell mediated pathology |
| EP2050645A4 (en) | 2006-11-16 | 2011-12-07 | Mitsubishi Heavy Ind Ltd | FRONT PANEL STRUCTURE FOR RAIL VEHICLE |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0114506A1 (en) * | 1982-12-22 | 1984-08-01 | Genentech, Inc. | Methods of purification and reactivation of precipitated heterologous proteins |
| US4530787A (en) * | 1984-03-28 | 1985-07-23 | Cetus Corporation | Controlled oxidation of microbially produced cysteine-containing proteins |
| WO1986005809A1 (en) * | 1985-03-29 | 1986-10-09 | Thomas Edwin Creighton | A process for the production of a protein |
| US4734362A (en) * | 1986-02-03 | 1988-03-29 | Cambridge Bioscience Corporation | Process for purifying recombinant proteins, and products thereof |
| US4748234A (en) * | 1985-06-26 | 1988-05-31 | Cetus Corporation | Process for recovering refractile bodies containing heterologous proteins from microbial hosts |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| IL77080A (en) * | 1984-11-20 | 1998-02-08 | Schering Biotech Corp | Polypeptides exhibiting human granulocyte macrophage and eosinophil cellular growth factor activity, vectors and transformed cells for their production and pharmaceutical compositions comprising them |
| DE3537708A1 (de) * | 1985-10-23 | 1987-04-23 | Boehringer Mannheim Gmbh | Verfahren zur aktivierung von t-pa nach expression in prokaryonten |
-
1988
- 1988-04-19 AU AU17115/88A patent/AU621051B2/en not_active Expired
- 1988-04-19 WO PCT/US1988/001228 patent/WO1988008428A1/en not_active Ceased
- 1988-04-21 ZA ZA882808A patent/ZA882808B/xx unknown
- 1988-04-25 IL IL86163A patent/IL86163A/xx not_active IP Right Cessation
- 1988-04-26 ES ES198888303757T patent/ES2036680T3/es not_active Expired - Lifetime
- 1988-04-26 NZ NZ224371A patent/NZ224371A/en unknown
- 1988-04-26 EP EP88303757A patent/EP0289267B1/en not_active Expired - Lifetime
- 1988-04-26 AT AT88303757T patent/ATE83780T1/de active
- 1988-04-26 DE DE8888303757T patent/DE3876843T2/de not_active Expired - Fee Related
- 1988-04-27 JP JP63105372A patent/JPH0771506B2/ja not_active Expired - Lifetime
- 1988-04-27 CA CA000565271A patent/CA1302652C/en not_active Expired - Lifetime
- 1988-12-27 FI FI885986A patent/FI94867C/fi not_active IP Right Cessation
- 1988-12-27 NO NO885777A patent/NO175638C/no unknown
- 1988-12-28 KR KR88701747A patent/KR960001740B1/ko not_active Expired - Lifetime
-
1993
- 1993-02-04 GR GR930400234T patent/GR3006984T3/el unknown
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0114506A1 (en) * | 1982-12-22 | 1984-08-01 | Genentech, Inc. | Methods of purification and reactivation of precipitated heterologous proteins |
| US4530787A (en) * | 1984-03-28 | 1985-07-23 | Cetus Corporation | Controlled oxidation of microbially produced cysteine-containing proteins |
| US4530787B1 (https=) * | 1984-03-28 | 1993-07-20 | Cetus Corp | |
| WO1986005809A1 (en) * | 1985-03-29 | 1986-10-09 | Thomas Edwin Creighton | A process for the production of a protein |
| US4748234A (en) * | 1985-06-26 | 1988-05-31 | Cetus Corporation | Process for recovering refractile bodies containing heterologous proteins from microbial hosts |
| US4734362A (en) * | 1986-02-03 | 1988-03-29 | Cambridge Bioscience Corporation | Process for purifying recombinant proteins, and products thereof |
Non-Patent Citations (4)
| Title |
|---|
| BLOOD, Vol. 67, No. 2, issued February 1986, "The Molecular Biology and Function of the Granulocyte Colony Stimulating Factors", (METCALF), pages 257-67. * |
| EMBO, Vol. 4, No. 10, issued 1985, "Recombinant Murine GM-CSF from E. Coli has Biological Activity and is Neutralized by a Specific Antiserum", (DELAMARTER), pages 2575-81. * |
| PROC. NATL. ACAD. SCI. U.S.A., issued September 1985, "Cloning, Sequence and Expression of a Human Granulocyte/Macrophage Colony Stimulating Factor", (CANTRELL), pages 6250-54. * |
| PROC. NATL. ACAD. SCI. U.S.A., Vol. 82, issued July 1985, "Isolation of cDNA for a Human Granulocyte-Macrophage Colony-Stimulating Factor by Functional Expression in Mammalian Cells", (LEE), pages 4360-64. * |
Also Published As
| Publication number | Publication date |
|---|---|
| NZ224371A (en) | 1990-11-27 |
| NO175638B (https=) | 1994-08-01 |
| ZA882808B (en) | 1988-10-20 |
| DE3876843T2 (de) | 1993-04-29 |
| IL86163A (en) | 1992-11-15 |
| IL86163A0 (en) | 1988-11-15 |
| AU621051B2 (en) | 1992-03-05 |
| EP0289267B1 (en) | 1992-12-23 |
| CA1302652C (en) | 1992-06-02 |
| JPS6427492A (en) | 1989-01-30 |
| KR890701616A (ko) | 1989-12-21 |
| EP0289267A3 (en) | 1989-11-08 |
| NO885777L (no) | 1988-12-27 |
| EP0289267A2 (en) | 1988-11-02 |
| GR3006984T3 (https=) | 1993-06-30 |
| ATE83780T1 (de) | 1993-01-15 |
| NO885777D0 (no) | 1988-12-27 |
| ES2036680T3 (es) | 1993-06-01 |
| KR960001740B1 (en) | 1996-02-05 |
| FI94867C (fi) | 1995-11-10 |
| FI885986L (fi) | 1988-12-27 |
| FI94867B (fi) | 1995-07-31 |
| JPH0771506B2 (ja) | 1995-08-02 |
| NO175638C (no) | 1994-11-09 |
| AU1711588A (en) | 1988-12-02 |
| DE3876843D1 (de) | 1993-02-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP0077670B1 (en) | Human immune interferon | |
| EP0043980B1 (en) | Mature human leukocyte interferon a, process for its microbial preparation, intermediates therefor and compositions containing it. | |
| US5464939A (en) | Highly purified protein, production and use thereof | |
| US6482613B1 (en) | Microbial production of mature human leukocyte interferons | |
| US5582824A (en) | Recombinant DES-CYS-TYR-CYS human immune interferon | |
| EP0165654B1 (en) | Purified interleukin 1 | |
| EP1837346A2 (en) | Method for purifying granulocyte-colony stimulating factor | |
| EP0818466B1 (en) | Purified, biologically active bacterially produced recombinant human CSF-1 | |
| EP0315650B1 (en) | Purification of recombinant interleukin-1 | |
| EP0390252A2 (en) | Purification of recombinant human interleukin-3 | |
| EP0299782B1 (en) | Expression vectors for the production of human granulocyte-macrophage colony stimulation factor in a mammalian cell host(18.05.92) | |
| EP0289267B1 (en) | Method for purifying granulocyte-macrophage colony stimulating factor | |
| US5047504A (en) | Method for purifying granulocyte-macrophage colony stimulating factor | |
| Breton et al. | Structure, stability and biological properties of a N‐terminally truncated form of recombinant human interleukin‐6 containing a single disulfide bond | |
| EP0353516A2 (en) | A method for the preparation of recombinant human beta interleukin-1 in the homogeneous form | |
| JPH0353884A (ja) | ポリペプチドの発現ベクター及びポリペプチドの製造法 | |
| IE75354B1 (en) | Method for purifying interleukin-4 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AU DK FI KR NO |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 885986 Country of ref document: FI |
|
| WWG | Wipo information: grant in national office |
Ref document number: 885986 Country of ref document: FI |