WO1988005993A2

WO1988005993A2 - Aminopeptidase for removing n-terminal methionine from proteins and proteins prepared therefrom

Info

Publication number: WO1988005993A2
Application number: PCT/EP1988/000096
Authority: WO
Inventors: Charles G. Miller; Rao Movva; Paul Wingfield; Gonzola J. Mazzei
Original assignee: Biogen, Inc.
Priority date: 1987-02-10
Filing date: 1988-02-09
Publication date: 1988-08-25
Also published as: EP0366662A1; AU1719988A; WO1988005993A3; GB8703015D0

Abstract

An aminopeptidase, peptidase M, that removes only N-terminal methionine, strains of microorganisms that produce the aminopeptidase, and polypeptides treated with the aminopeptidase. Peptidase M may be used to cleave polypeptides proteins in vitro, or the DNA of the strains that produce Peptidase M may be used to transform a recombinant host to prepare mature proteins in vivo. The strains that produce Peptidase M may themselves be used as recombinant hosts. Methods for isolating peptidase M and methods for isolating strains that overproduce peptidase M are also disclosed.

Description

AMINOPEPTIDASE FOR REMOVING N-TERMINAL METHIONINE FROM PROTEINS AND PROTEINS PREPARED THEREFROM

TECHNICAL FIELD OF THE INVENTION

This invention relates to enzymes, organisms producing such enzymes, methods for obtaining, culturing and using the enzymes and organisms, and polypeptides prepared using such enzymes. More specifically, this invention relates to enzymes capable of specifically removing an N-terminal methionine from a polypeptide and to polypeptides prepared using these enzymes.

BACKGROUND ART In protein synthesis, AUG is the universal

RNA translation start codon. It codes for the amino acid methionine (Met). Accordingly, all proteins, whether eukaryotic or prokaryotic in origin, are initially synthesized in vivo having a methionine as the N-terminal amino acid. In prokaryotes, these methionines are also formylated (f-Met). Mature proteins (e.g., those produced by maturation and by other in vivo post-translational modifications), however, frequently do not have f-Met or Met as the N-terminal amino acid. For example, approximately half of the proteins in E.coli have an N-terminal amino acid other than methionine after in vivo post-translational modification (J. P. Waller, "The NH₂-Terminal Residues of the Proteins from Cell-free Extracts of E.coli", J. Mol. Biol., 7, 483-96 (1963)). The N-terminal amino acids of the proteins are usually alanine, serine or threonine (S. S. Sarimo et al., "Taxonomic Comparison of the Amino Termini of

Microbial Cell Proteins", J. Bacteriol., 98, 368-78 (1969)).

There are two mechanisms which are believed to "mature" the nascent protein by removing the N-terminal methionine. For proteins that are secreted by the cell in which they are made, the initial N-terminal methionine is removed as part of the signal peptide during secretion. For example, the N-terminal methionines of pre-α-interferon, pre-growth hormone and pre-proinsulin are removed as part of the signal peptide during secretion.

For proteins that are not usually secreted by the cell, the N-terminal methionine of the nascent protein is usually deformylated (J. M. Adams, "On The Release Of The Formyl Group From Nascent Protein", J. Mol. Biol., 33, pp. 571-89 (1968)) and then the N-terminal methionine is removed in vivo by one or several enzymes present in the cell during protein production. With the advent of recombinant DNA technology, proteins began to be produced or overproduced in transformed unicellular hosts that had not previously produced them. These recombinant proteins, of course, had to be produced with an N-terminal methionine. However, the removal of that methionine to produce a protein identical in amino acid sequence to the corresponding or desired mature protein proved problematical .

For proteins that were normally secreted, various attempts were made to produce them together with their signal sequences and to secrete and to mature them in vivo to generate the N-terminus normally present in the mature protein. However, the rate of secretion proved in many cases to be too slow to permit commercial quantities of the mature protein to be secreted from the cell. Similar results were also observed when proteins that were not normally secreted were synthesized fused to various signal sequences to cause their secretion and maturation with attendant N-terminal methionine removal.

For proteins that were not usually secreted from the cell in which they were made, either the level of in vivo enzymes or their activity toward those overproduced, and usually foreign, proteins proved too low to be effective in producing high levels of substantially methionine-free proteins. Thus, these proteins could often only be obtained as mixtures of protein molecules some with N-terminal methionine and others with the N-terminal methionine removed. Such mixtures were difficult if not impossible to resolve into single components in commercial purification processes. Similar results were also observed when proteins that were normally secreted were prepared without signal sequences, e.g., recombinant met-interferon, recombinant met-human growth hormone and recombinant met-proinsulin. In addition to resulting in mixtures that were not easily resolved into a single component -- either methionine-free or methibnine-containing -- the presence of these N-terminal methionines on recombinant proteins that were prepared for pharmaceutical use caused several, at least perceived, problems. First, the health regulatory authorities are often slower to approve as drugs heterologous mixtures of proteins, than single components. Second, health regulatory authorites and others continue to be concerned that the presence of an additional N-terminal methionine on an otherwise native protein will cause the body's immune system to recognize the protein as foreign and thus produce antibodies against it. These antibodies, in addition to rendering continuing treatments with drugs less, effective, also may affect the activity of the mature protein itself. As a result of these problems, various attempts have been, and continue to be, made to remove the N-terminal methionine from proteins prepared by recombinant DNA technology.

Non-secreted mature proteins tend to have the following N-terminal amino acids: Ala, Gly,

Pro, Ser, Thr or Val (S. Tsunasawa et al., "Amino-terminal Processing of Mutant Forms of Yeast Iso-1-cytochrome c", J. Biol. Chem., 260, 5382-91 (1985)). Accordingly, non-secreted proteins having these N-terminal amino acids must have originally been synthesized with an N-terminal methionine and with Ala, Gly, Pro, Ser, Thr or Val as the second amino acid, the methionine apparently being removed during maturation. The required N-terminal methionine, however, is apparently not removed from non-secreted protein when the second amino acid is Arg, Asn, Asp, Glu, Gin, lie, Leu, Lys or Met.

Microorganisms typically contain many enzymes that remove N-terminal amino acids from peptides. Most of these enzymes, however, are broad specificity enzymes, and they may cleave amino acids other than methionine from the N-terminus of their substrates. Such peptidases will not only cleave the N-terminal amino acids from their substrates but will also continue to cleave additional amino acids. This makes them useless for the specific rgmoval of a single methionine from the N-terminus of a polypeptide. For example, at least four such enzymes are present in crude extracts of Salmonella typhimurium and E.coli (C. G. Miller et al., "Peptidase Mutants of Salmonella typhimurium", J. Bacteriol., 120, 355-63 (1974); C. G. Miller et al., "Peptidase-Deficient Mutants of Escherichia coli", J. Bacteriol, 135, 603-11 (1978); K. L. Strauch et al., "Isolation and Characterization Salmonella typhimurium Mutants Lacking a Tripeptidase (Peptidase T)", J. Bacteriol., 154, 763-71 (1983)). The presence of these enzymes increases the difficulty of isolating an aminopeptidase that affects only N-terminal methionines.

An N-terminal Met aminopeptidase that is specific for N-terminal methionine has not been isolated previously. While certain enzymes capable of cleaving methionine from various substituents have been isolated (V. M. Vogt, "Purification and Properties of an Aminopeptidase from Escherichia coli", J. Biol. Chem., 245, 4760-69 (1970)), these enzymes do not specifically remove N-terminal methionine from immature polypeptides. Rather, these enzymes are either nonspecific, removing many N-terminal amino acids other than methionine from their peptide substrates (Vogt, supra), or they are limited to dipeptides having N-terminal methionines (J. L. Brown, "Purification and Properties of Dipeptidase M from Escherichia coli B," J. Biol. Chem., 248, 409-16 (1973)). Other known aminopeptidases are also nonspecific, i.e., they remove many amino acids in addition to methionine from their substrates.

Thus, until now, no highly specific, N-terminal methionine aminopeptidase has been isolated. The location of its gene in the DNA of microorganisms has not been identified. And, it has not been possible to prepare specifically mature polypeptides, in vitro or in vivo through recombinant techniques, using this aminopeptidase.

SUMMARY OF THE INVENTION

The present invention solves the problems of the prior art by isolating a previously unisolated aminopeptidase, designated herein as peptidase M. Peptidase M is an enzyme capable of removing N-terminal methionine from polypeptides containing an N-terminal methionine. Peptidase M does not remove other N-terminal amino acids, nor does peptidase M hydrolyze methionine amino acids in polypeptides at locations other than the N-terminus.

In addition, the present invention provides mutant strains of microorganisms that overproduce peptidase M so that large amounts of the enzyme may be obtained from culturing the strains. The enzyme may then be isolated and used in vitro. These microorganisms may also be used as hosts for the production of recombinant proteins. In this embodiment of the invention eht enzyme acts in vivo to remove the N-terminal methionine of the co-produced recombinant protein.

This invention also provides for the cloning of the DNA sequence coding for peptidase M, or active fragments thereof, in host cells that produce a desired recombinant protein, to effect the removal of the N-terminal methionine of the recombinant protein in vivo. In the alternative, the enzyme may be produced in unicellular hosts transformed with that DNA sequence, and the enzyme may then be isolated and used in vitro.

Finally, the present invention provides mature polypeptides produced using peptidase M, and especially the preferred peptidase M found in certain strains of Salmonella typhimurium. Still other aspects and advantages of the invention will be apparent from the specification.

BRIEF DESCRIPTION OF THE FIGURE

Figure 1 displays a 12.5% acrylamide SDS gel prepared by the method of U.K. Laemmli, Nature (London), 227, 680-85 (1970). Wells 2 and 3 each contained 30 μg protein from extracts of S .typhimurium strain TN2529 (well 3) and TN2547 (well 2). Well 1 contained purified pepidase M from the active peak of the chromatofocusing column. The peptidase M band in the pepM100 extract (well 2) (a strain that overproduces peptidase M) appears much darker than in the wild-type peptidase M extract (well 3).

BEST MODE OF CARRYING OUT THE INVENTION

In order that the present invention may be more fully understood, the following detailed description is provided. In this specification some of the following terms are employed:

DNA Sequence: A linear array of deoxy nucleotides connected one to the other by phosphodiester bonds between the 3' and 5' carbons of adjacent pentoses .

Codon: A DNA sequence of three nucleotides (a triplet) that encodes, through its mRNA, an amino acid, a translation start signal, or a translation termination signal. The four DNA bases are adenine ("A"), guanine ("G"), cytosine ("C"), and thymine ("T"). The four RNA bases are A, G, C and uracil ("U"). For DNA, "P" indicates either of the purines (A or G), "Q" indicates either of the pyrimidines (C or T), and "N" indicates any of the four bases (A, G, C, or T). For RNA, "P," "Q" and "N" have the same meanings except that "U" is substituted for "T." For example, the nucleotide triplets TTA, TTG, CTT, CTC, CTA and CTG encode for the amino acid leucine ("Leu"); TAG, TAA and TGA are translation stop signals; and ATG is a translation start signal in DNA that also codes for methionine. Since these are more possible triplet combinations of nucleotides (64) than amino acids (26), the genetic code is said to be "degenerate", i.e., several different triplets may encode for the same amino acid. Two DNA sequences are "degenerate" when they encode for the same amino acid sequence though using different codons.

Polypeptide: A linear array of amino acids connected one to another by peptide bonds between the α-amino and carboxy groups of adjacent amino acids. When "polypeptide" is used in this specification, it will be understood by those skilled in the art to include the terms "protein" and "preprotein."

Genome: The entire DNA of a cell or a virus. It includes, inter alia, the DNA coding for the polypetides of the cell and operator, promoter, and ribosome binding and interaction sequences, including sequences such as the Shine-Dalgarno sequences for each of the those coding sequences. Gene: A DNA sequence that. encodes through its template or messenger RNA ("mRNA") a sequence of amino acids characteristic of a specific polypeptide.

Expression: The process undergone by a gene to produce a polypeptide. It includes transcription of the DNA sequence to an mRNA sequence and translation of the mRNA sequence into a polypeptide. For a DNA sequence coding for a polypeptide to be expressed, the DNA sequence must be operatively linked to an expression control sequence that regulates the expression process.

Protein: A polypeptide of 50 or more amino acids.

Preprotein: A polypeptide or protein having extra amino acids with respect to a mature (i.e., active) protein.

Cloning: The process of obtaining a population of organisms or DNA sequences derived from one such organism or sequence by asexual reproduction.

Recombinant DNA Molecule or Hybrid DNA: A molecule, comprising segments of DNA from different genomes joined end-to-end outside of living cells, that may be maintained in living cells. Cloning vehicle: A plasmid, phage DNA, or other DNA sequence that is able to replicate in a host cell. A cloning vehicle is also known as a recombinant vector.

The enzyme of the present invention is specific for removing the N-terminal methionine from polypeptides. While the examples below demonstrate the invention with peptidase M as found in Salmonella typhimurium, it will be apparent that other microorganisms, like E.coli, may also be used as sources of a peptidase M or an analog. An "analog" of peptidase M, as used herein, means an enzyme that cleaves N-terminal methionine from a polypeptide, without cleaving other N-terminal amino acids, even though the enzyme may not have an amino acid sequence identical to peptidase M. One skilled in the art will recognize that, since most organisms produce at least some non-secreted mature proteins without an N-terminal methionine, each such organism would be expected to have at least one enzyme capable of specifically removing an N-terminal methionine. And, therefore, such enzymes may be isolated, produced and used as described herein. The preferred microorganisms for producing the enzyme of the invention, however, are Salmonella typhimurium and E.coli, due to their ease of handling and ready availability. Salmonella typhimurium is especially preferred. Consequently, peptidase M as produced by S.typhimurium and E.coli is preferred and peptidase M from S.typhimurium is especially preferred.

The first step in isolating peptidase M or an analog is to obtain mutant strains of the chosen microorganism that do not substantially produce any broad specificity enzymes capable of cleaving N-terminal methionione. The availability of such strains allows the selection of mutants that over- produce the methionine-specific aminopeptidase. In addition, the absence of these broad specificity enzymes also aids purification by removing in advance other enzymes which would, if present in the purified preparation, render it useless for specifically removing methionine without causing any other modification in the peptide chain. Strains lacking these peptidases were isolated by a series of steps each one designed to generate a particular mutation leading to the loss of one of the peptidases. (See C.G. Miller, "Genetics and Physiological Roles of Salmonella typhimurium Peptidases," Microbiology-1985: 346-49 (1986)) In many cases it was necessary to carry out these steps in a particular sequence to generate the desired strains. For example, mutants lacking peptidase N were obtained from a wild type strain by directly screening for colonies unable to hydrolyze the chromogenic substrate L-alanyl-B-naphthyl amide. The pepN- mutant generated by this screen was then used to isolate mutants lacking peptidase A by penicillin selection (J.R. Roth, "Genetic Techniques in Studies of Bacterial Metabolism," Methods in Enzymol. 17:3-35 (1970)) for mutants unable to grow on the peptide L-leucyl-L-alanyl amide as leucine source. The resulting strain (pepN- and pepA-) was used to isolate mutants lacking peptidase D by penicillin selection for failure to use Leu-Gly as a leucine source. The mutant strain that resulted from this procedure (pepN- pepA- pepD-) was then used in penicillin selection for failure to utilize Leu-Leu. This procedure yielded mutants lacking peptidase B. (Isolation of these strains is described in C.G. Miller and K. MacKinnon, "Peptidase Mutants of Salmonella typhimurium," J. Bacteriol. 120:355-363 (1974)). Mutations lacking peptidases P and Q were obtained from these mutants by penicillin selection for failure to use Leu-Pro as a proline source. (G.L. McHugh and C.G. Miller, "Proline Peptidase Mutants of Salmonella typhimurium," Journal of Bacteriology, 120:364-371 (1974)). Mutants lacking peptidase T were obtained from strains already lacking peptidases N, A, B, and D by direct screening of microcultures for mutants lacking this activity (Strauch, et al., "Isolation and Characterization for Salmonella typhimurium Mutants Lacking a Tripeptidase (Peptidase T)," J. Bacteriol, 154:763-771 (1984)). The genetic characterization of all of these mutations allowed them to be combined in a variety of useful ways. Strains carrying any combination of peptidase deficiencies were constructed. For the present purposes the culmination of all of these procedures was the isolation of strains similar to TN 2624 which lacks peptidases N, A, B, P, Q, and T. Although this strain fails to use most small peptides as amino acid sources, it will use certain N-terminal methionine peptides (Table 2) as sources of methionine. This suggested that the removal of the broad specificity peptidases (especially peptidases N, A, B, and T all of which hydrolize N-terminal methionine peptides) had allowed detection of methionine-specific peptidase activity from a new peptidase, peptidase M.

Strains that are mutationally deficient in the broad specificity enzymes (especially peptidases N, A, B, and T) were used to isolate mutants that substantially overproduce peptidase M. A selection for such mutants was suggested by the observation that multiply-peptidase deficient strains such as TN2624 can use as methionine sources Met-Ala-Ser or Met-Ala-Met but not Met-Gly-Gly (Table 2). Extracts of such a strain hydrolized Met-Gly-Gly at about one-tenth the rate of Met-Ala-Ser. Selection was therefore applied to a mutagenized culture of such a multiply-peptidase deficient strain for growth on Met-Gly-Gly as a source of methionine. This selection produced mutants with elevated levels of peptidase M. One such mutant strain carrying the pepM100 mutation showed a 20-30 fold elevation in the level of Met-Ala-Ser hydrolyzing activity, and it was concluded that this strain overproduced peptidase M. The specificity of the overproduced peptidase in strains carrying the pepM100 is demonstrated by the peptide use pattern shown in Table 2. This strain does not gain the ability to grow on nonmethionine peptides. The selection described requires the use of multiply peptidase deficient strains that carry stable, non-reverting alleles of mutations in peptidase in N, A, B, D, and T as described in Strauch, et al. (cited above).

It will be apparent to those of skill in the art that the process for isolating overproducing mutant strains of other organisms may require modification of the process outlined above, and use of a different tripeptide as the only methionine source may be more appropriate with other organisms in selecting for mutants lacking broad specificity peptidases.

Analogs of peptidase M may have different levels of activity with respect to different polypeptides having N-terminal methionine. The technique for producing a mutant strain that overproduces an analog of peptidase M will require met-polypeptide having a hydrolysis rate low enough to prevent growth by non-overproducing strains. In the case of

S .typhimurium and peptidase M, the met-polypeptide was observed to be Met-Gly-Gly, and that tripeptide is the preferred tripeptide for selecting overproducing strains of S.typhimurium, but other tripeptides may be more preferable for selecting peptidase M analogs in other strains. Once the mutant overproducing strains have been cultured, the enzyme itself may be isolated. The cells obtained from culturing are washed in an isotonic medium and broken using means known in the art. The particulate material from breaking is removed by known means, such as centrifugation and filtering. The supernatant may be applied to a chromatography column and peptidase M concentrated. When we used the preferred microorganism, S.typhimurium, we obtained an overproducing mutant strain, TN2270, using the procedure described above. The strain is grown in minimal glucose medium containing 0.4 mM Leu and 0.4 mM Met. The resulting culture is pelleted and suspended in 0.01M potassium phosphate buffer (pH 7.5), and the cells are disrupted by sonication. The disrupted cells are centrifuged. The supernatant is fractionated by chromatography. The active fractions, i.e., those fractions that remove N-terminal methionine from met-polypeptides, are combined and concentrated. When strain TN2270 is used, the chromatography column is preferably a DEAE-cellulose (Whatman DE-52) column equilibrated with potassium phosphate buffer (pH 7.5). The column is eluted in the same potassium phosphate buffer. The active fractions are preferably concentrated over an ultrafiltration membrane (YM-10, Amicon Corp.).

When strain TN2270 is the overproducing strain, the active fractions from the chromatographic separation are determined by adding each fraction to a mixture containing: 0.6 μmol substrate (.preferably Met-Ala-Ser); 0.03 μmol CoCl₂ ; and 6 μmol potassium phosphate buffer (pH 7.5); to make a total volume of 30 μl. The mixture is incubated for 30 minutes at 37°C and the reaction is then stopped by adding 3 μl 50% trichloroacetic acid. Precipitated polypeptides are removed by centrifugation. An aliquot of the reaction mixture is derivatized with trinitrobenzene sulfonic acid and analyzed by HPLC using an Altex Ultrasphere ODS column and appropriate gradients of 0.1% trifluroacetic acid/H₂O-0.1% trifluroacetic acid/acetonitrite. Once an active fraction has been determined using the procedure described above, this active fraction may again be isolated from a disrupted colony of strain TN2270. The active fraction may then be tested against a different N-terminal met-polypeptide. This procedure may be used to determine the activity of peptidase M with respect to any met-protein or met-polypeptide by substituting the particular met-protein or met-polypeptide as the substrate. Eventually, a profile of activity, such as that shown in Table 2; is created.

The active fraction concentrated over the ultrafiltration membrane, discussed above, is passed through an Ultrogel AcA54 column (LKB) equilibrated in 0.05 M potassium phosphate buffer (pH 7.5). For strain TN2270, the Met-Ala-Ser hydrolyzing fractions (from the procedure described above) were again combined and concentrated over an ultrafiltration membrane. This second concentrate was further purified by chromatofocusing using a Pharmacia PBE94 column in 0.025 M imidazole-HCl (pH 7.4, pi 5.2) and eluted with polybuffer 74-HCl (pH 4.0).

An alternative technique for isolating the enzyme is discussed below in Example 4. Cells from strain TN2270 are broken using the French Pressure Cell technique and centrifuged. The supernatant is then filtered. The supernatant may then be fractionated using chromatography and chromatofocusing. As disclosed in Example 4, this alternate technique produces highly purified peptidase M. The isolated peptidase M may be used to remove or "clip" N-terminal methionine from polypeptides in vitro. As disclosed in the examples below, peptidase M may simply be mixed with the desired met-polypeptide to produce mature polypeptides. Though the preferred method of producing mature polypeptides is by exposing the met-polypeptide to purified or partially purified peptidase M, even crude extracts of broken cells that contain peptidase M have activity with respect to removing the N-terminal methionine from met-polypeptides. Of course, crude extracts of strains not lacking broad specificity peptidases would not be useful in this invention because the broad specificity peptidases would remove other N-terminal amino acids.

Purified peptidase M may be added to the met-polypeptide in a ratio of about 1:100. Under ordinary conditions, no more than two hours are generally necessary to complete the removal of the N-terminal methionine from the polypeptide. Ordinary conditions are defined as approximately room temperature and pressure and a pH of about 7.0. Table 3 shows that a crude cell extract of

S.typhimurium strain TN2624 (a strain lacking the broad-specificity peptidases, peptidases N, A, B and T, and carrying the pepM100 mutation) hydrolyzed all of the N-terminal Met tripeptides that support growth as Met sources. In every case only one peptide bond was hydrolyzed, yielding Met as the only single amino acid product. These extracts did not contain detectable activity towards Met-Leu-Gly, Met-Met-Ala, or Met-Met-Met, but did hydrolyze Met-Gly-Gly at about 0.1 the rate of Met-Ala-Ser or Met-Ala-Met. This specificity pattern strongly suggests that the nature of the second amino acid in the peptide determines whether peptidase M will remove N-terminal methionine. The observed specificity is completely consistent with the idea that peptidase M is the enzyme that carries out N-terminal Met removal in the living cell. The extracts also did not contain measurable activity towards several peptides with amino acids other than Met at their N-termini. Unlike other Salmonella and E.coli peptidases (Miller, C. and MacKinnon, K., "Petidase Mutants of Salmonella typhimurium," J. Bacteriol., 120, 355-63 (1974); Miller, C. and Schwartz, G., "Peptidase-Deficient Mutants of Escherichia coli, " J. Bacteriol., 135, 603-11 (1978)), the activity could not be detected by activity strain after electrophoresis of crude extracts in nondenaturing PAGE gels (Miller, C. and MacKinnon, K., "Peptidase Mutants of Salmonella typhimurium," J. Bacteriol., 120, 355-63 (1974)).

Peptide hydrolysis was stimulated by Co⁺² but not by

Mg⁺², Mn⁺², or Zn⁺² and was inhibited by EDTA (Table 4).

As shown below incubation of met-polypeptide with substantially purified or isolated peptidase M is the preferred method for in vitro use. Those skilled in the art will recognize that the incubation time of substrate will vary with the ratio of substrate to peptidase M in the reaction mixture. Less time will generally be required to complete removal of N-terminal methionine from a substrate when there is more peptidase M present in the reaction mixture per unit of substrate.

Peptidase M may also be used in vivo using a strain in which the enzyme is overproduced as a host for the production of a desired recombinant protein or by isolating the DNA sequence coding for peptidase M, and inserting that DNA sequence, a DNA sequence degenerate with that DNA sequence, or a DNA sequence coding for an active fragment of peptidase M, into a recombinant host that so produces the polypeptides from which met-removal is desired. Recombinant hosts that produce a desired protein often produce the associated met-protein in large amounts, but not all of the met-protein is matured by the host's natural peptidases. Insertion of the DNA sequence coding for peptidase M into such a host so as to permit its expression as that host thus is a great advantage for recombinant systems, because enhanced levels of peptidase M assist in removing N-terminal methionine from preproteins during expression of the protein in vivo. In this way, large amounts of the desired Met- _ protein be produced by the recombinant host. As shown more fully below, the DNA sequence coding for peptidase M from S.typhimurium has been isolated and inserted into a phage. The peptidase M DNA from that phage was then inserted into a plasmid which, in turn, was placed into E.coli. This recombinant host produced peptidase M. E.coli is known as a host capable of producing recombinant proteins. Accordingly, one possible and preferred method of using peptidase M in vivo is to insert the DNA sequence coding for peptidase M into a host so as to allow the peptidase M expressed in the recombinant host to remove N-terminal methionine from a natural or recombinant protein also produced by the host. Preferably, the host will overproduce both the desired protein and peptidase M. Alternative means of using peptidase M are also available. Strains that overproduce peptidase M, shown in more detail below, may themselves serve as recombinant hosts. On the other hand, the DNA sequence coding for peptidase M may be operatively linked to an expression control sequence and inserted into a strain that already overproduces the desired protein using a recombinant vector.

The present invention also includes the in vitro use of peptidase M produced by recombinant means. Peptidase M may be overproduced by a recombinant host, and that peptidase may remove N-terminal methionine from any polypeptide either in vitro or in vivo, whether or not that polypeptide is produced by recombinant means.

This invention also includes polypeptides that have N-terminal methionine removed by peptidase M. The polypeptides may act as the substrate for peptidase M in vitro or in vivo. Peptidase M may exist in vivo or in vitro, hence any combination of a met-polypeptide and peptidase M that results in removal of the N-teminal methionine from the polypeptide is within the scope of this invention.

This invention also includes a method for isolating strains of a microorganism that produce enzymes capable of removing an N-terminal methionine from a polypeptide which would not ordinarily be removed in vivo. As disclosed above, N-terminal methionine is apparently not removed from a non-secreted polypeptide when the second amino acid is Arg, Asn, Asp, Glu, Gin, lie, Leu, Lys or Met. Enzymes capable of removing an N-terminal methionine from a polypeptide having one of these amino acids as its second polypeptide may be produced by mutating a peptidase M producting strain (that does not have broad specificity amino peptidases) and growing the mutated strains in a medium containing the polypeptide as the only source of methionine. Strains that grow in such an environment have an enzyme capable of removing N-terminal methionine.

Enzymes act upon many different substrates, though with differing degrees of activity. In the case of peptidase M, tripeptides of Met-gly-gly are not hydrolyzed as rapidly as some other tripeptides. This lower activity provides a technique for isolating strains that overproduce an enzyme having more than one substrate. Overproducing strains grow in media containing the slower reacting substrate as the only source of an essential nutrient, while strains that do not overproduce the enzyme do not grow in such media. An overproducing strain may then be isolated by culturing mutated microorganisms in such a medium. This technique may be used along with known mutation techniques to produce enzymes in strains, for example, that can cleave N-terminal methionine from any polypeptide, even from polypeptides having a second amino acid that does not normally allow methionine cleavage in vivo.

The following, non-limiting examples will serve to further illustrate the present invention.

Example 1

Selection of Mutants Capable of Overproducing Peptidase M

The observation that Met-Gly-Gly does not support growth in strains lacking broad specificity peptidases but is hydrolyzed by extracts at a slower rate than substrates with alanine as the second amino acid suggested a method for isolating strains that overproduce peptidase M. When a Met-requiring strain carrying nonreverting mutations in the genes specifying the broad-specificity aminopeptidases described above was plated on medium containing Met-Gly-Gly as a Met source, mutants capable of using this peptide were obtained (K. L. Strauch et al., "Overproduction of Salmonella typhimurium Peptidase T," J. Bacteriol., 156, 743-51 (1983)).

Mutant strains lacking peptidases N, A, B, D, P, Q and T and dipeptidyl carboxypeptidase were obtained using the procedure of K. L. Strauch et al., "Isolation and Characterization Salmonella typhimurium Mutants Lacking a Tripeptidase (Peptidase T)," J. Bacteriol., 154, 763-71 (1983). These strains were cultured in E medium supplemented by 0.4% glucose and 0.4 mM L-amino acids. Mutagenesis of the strains lacking the broad-specificity peptidases was carried out with diethylsulfate to increase the frequency of mutation. Such mutagenesis was not necessary, however, and spontaneous mutants could be found at a detectable frequency. Mutants able to use Met-Gly-Gly as a methionine source were selected by plating 0.1 ml of a minimal overnight culture of TN2183 on an appropriately supplemented minimal plate containing Met-Gly-Gly (0.1 mM) as a Met source. Several of these mutants were purified and characterized. Although these mutant strains grew well on Met-Gly-Gly, they did not use Met-Leu-Gly, Met-Met-Ala, or Met-Met-Met, nor did they grow on any of several N-terminal leucine peptides as Leu sources. Assays of peptide hyrolysis in an extract of one mutant, pepM100, showed a 20-30 fold increase in Met-Ala-Ser hydrolyzing activity. This strain was chosen for further characterization.

The peptide use profile of a strain carrying pepM100 is compared to its parent in Table 2. The data in Table 3 shows that, in an extract of the mutant strain, the levels of activity toward N-terminal Met peptides with Ala, Thr, or Gly in the second position all show an approximately 20 fold increase relative to the activity in a wild-type peptidase M-containing strain. Met-Leu-Gly, Met-Met-Met, Met-Met-Ala and several other peptides with N-termini other than methionine are not hydrolyzed by either the mutant or parental extracts. The relative rates of hydrolysis for all substrate peptides are the same in the two extracts. The level of a single peptidase is, therefore, increased by the pepM100 mutation. This peptidase is specific for

N-terminal methionine and is affected by the peptide's second amino acid.

The removal of N-terminal Met from Met-Gly-Met-Met shows that the enzyme is capable of hydrolyzing tetrapeptides and is not limited in specificity to tripeptides. The mutant strain did not grow on any of several N-terminal Met dipeptides (for example, Met-Gly and Met-Ala), and extracts did not hydrolyze these dipeptides.

Table 1

Strain Genotype

TN2183 leuBCD485 metA15 pepN90 pepA16 pepB11 pepP1 pep01 pepT7::Mu d1(x)

TN2270^*a pepM100 zae-3149::Tn10Δ16Δ17

TN2501^*a pepM100 zad1615::Tn10Δ16Δ17

TN 2529 pepD3

TN2547^*a pepD3 pepM100 zae-3149: :Tn10Δ16Δ17

TN2563^* pepD3 [pyrA685 : :Tn10/pyraA⁺]^b

TN2565^*a pepD3 [pyrA685 : :Tn10oepM⁺/pyrA⁺ pepM100 zae1614: :TnlOΔl6Δl7 Kan^r]^+b

TN2624^* pepD3 dcp-1 zcf845::Tn10

TN2626^* pepD3 dcp-1 zcf845::Tn10 pepM100 zae1614::Tn10Δ16Δ17 Kan^r

TT421 panC540::Tn10

* This strain carries all the markers in TN2183, in addition to those indicated. a Tn10Δ16Δ17 and Tn10Δ16Δ17 Kan^r are described in Foster, T., et al., "Genetic Organization of Transposon Tn 10," Cell, 23, 201-13 (1981).

Square brackets contain markers for which the chromosomal tandem duplications are heterozygous. Example 2

Isolation of Peptidase M from Overproducing Strains

Strain TN2270 was grown in minimal glucose medium containing 0.4 mM Leu and 0.4 mM Met. A cell pellet from the culture was suspended in 0.01 M potassium phosphate buffer (pH 7.5) and disrupted by sonication. After centrifugation, the supernatant was applied to a DEAE-cellulose (Whatman DE-52 ) column equilibrated with the phosphate buffer and eluted with a linear gradient of KCl to 0.4M in the same buffer. The active fractions were combined, concentrated over an ultrafiltration membrane (YM-10, Amicon Corp.), and passed through an Ultrogel AcA54 column (LKB) equilibrated in 0.05 M potassium phosphate buffer (pH 7.5). The Met-Ala-Ser hydrolyzing fractions were combined and concentrated as above. The specific activity of this material was approximately 13 fold higher than the starting extract and approximately 290 fold higher than that of a wild-type extract. This material was further purified by chromatofocusing (Phamacia PBE 94 in 0.025 M imidazole-HCl pH 7.4, pi 5.2 eluted with Polybuffer 74-HCl pH 4.0). The purified material from the peak fraction of this column was used for the experiment shown in Fig. 1.

Example 3

Alternate Method of Isolating Peptidase M from Overproducing Strains Cells from strains TN2270 were washed in an isotonic medium, 20mM sodium phosphate, pH 7.5, containing 250 mM sucrose and 5mM MgCl₂, and then resuspended (50g net weight per 130 ml) with 100mM sodium phosphate, ImM sodium azide. The cells were then broken using the French Pressure Cell and the particulate material removed by centrifugation at 10,000g for 30 minutes and 60,000g for 90 minutes. The final supernatant was filtered with a 0.45 μ nitrocellulose membrane and applied to a DEAE-Sepharose column (14 x 5 cm diameter) equilibrated with 100mM sodium phosphate, pH 7.0, 1mM sodium azide. The peptidase M that bound to the column was eluted early during the application of 1.5L gradiant of 0 - 0.3M NaCl. The Peptidase M was pooled on the basis of activity (about 300ml total volume was obtained), and concentrated to 20ml using a Diaflo PM10 ultrafiltration membrane. The concentrate after filtration with a Millex-GV 0.22 μ filter unit was applied to an Ultrogel AcA54 column (95 x 2.5 cm dia) equilibrated with 50mM potassium phosphate, pH 7.0. The column was eluted at 35 ml/hr and 6.50 ml fractions were collected. The peptidase M was again pooled on the basis of activity (about 66ml total volume obtained) and concentrated to about 5ml. SDS-PAGE of the concentrate indicated a major band of 32-35,000 M_R. Further purification was carried out by FPLC using either chromotofocusing (mono P) or anion exchange chromotography (Fast Q).

Chromatofocusing was carried out by placing partially purified Peptidase M, as obtained above, in 50 mM sodium- phosphate, pH 7.0 (0.5 to 1.5ml at about 4.0-6.0mg/ml) and applying it to a FPLC Mono P HR5/20 column (Pharmacia) equilibrated with 25mM bis-Tris-HCl, pH 7.4. The column was eluted at lml/min at room temperature with 49ml of Polybuffer 74-HC1 (Pharmacia) diluted 1:10 with water and adjusted to pH 4.0 with HCl. Fractions (0.5ml) were collected into tubes containing an equal volume of 200mM sodium phosphate, pH 7.0.

Anion exchange chromotography was carried out on an HR 5/5 column equilibrated with 50mM sodium phosphate, pH 8.0. Either method produces 90% Peptidase M (SDS-PAGE and analytical EGF). Example 4

Determination of the Map Position of Mutations Leading to Overproduction of Peptidase M, Construction of Duplications of the pepM Gene, and

Dominance of pepM100 to pepM+

An insertion of the minitransposon Tn10Δ16Δ17 (T. J. Foster et al., Cell, 23, 201-13 (1981)) near the pepM locus was isolated (K. L. Strauch et al., "Oxygen Regulation in Salmonella typhimurium," J. Bacteriol., 161, 673-80 (1985)). This insertion was used to target the formation of an Hfr with an origin of transfer at the site of the Tn10Δ16Δ17 insertion (F. G. Chumley et al., "Hfr Formation Directed by Tn10," Genetics, 91, 639-55

(1979)). Conjugation crosses using Hfrs constructed in this way indicated that pepM is located in the 98-7 map unit region of the Salmonella genome (K. E. Saunderson et al., Microbiol. Rev., 47, 410-53 (1983)). Phage P22 mediated transduction crosses with markers in this region showed that pepM100 is linked approximately 8% to leu at 3 map units. Other transposable elements linked to pepM were isolated and used as markers to further define the map position. Results of these crosses are shown in Table 5.

These results establish the location of the pepM gene and the transposable elements. Since all mutations leading to Met-Gly-Gly utilization tested are linked by P22 transduction to zae 3149:Tn10Δ16Δ17, it is likely that they are all alleles of the pepM locus.

A strain containing a duplication of the pepM locus was constructed by the method of Anderson and Roth, "Gene Duplication in Bacteria: Alteration of Gene Dosage by Sister-chromosome Exchanges", Cold Spring Harbor Symp. Quant. Biol., 43, 1083-87 (1978)), using a Tn10 insertion in the pyrA gene. This duplication strain was used for dominance testing and to NOT TO BE TAKEN INTO CONSIDERATION FOR THE PURPOSES OF INTERNATIONAL PROCESSING (See Section 309 (c) (ii) OF THE ADMINISTRATIVE INSTRUCTIONS)

embodiment of the invention, cobalt ions may be added to increase the activity of peptidase M. See Table 4.

The basis for selection of overproducer mutations is the observation that Met-Gly-Gly, although a substrate for the enzyme, is apparently not hydroloyzed sufficiently rapidly to allow its use as a Met source. The availability of an overproducer of peptidase M provides a convenient source for purification of the enzyme, but those of skill in the art will recognize that preparation of overproducing strains is not essential for preparing and isolating peptidase M. Overproduction of peptidase M is not expected to be deleterious to cell growth since strains containing the pepM100 overproducer mutation grow normally under all conditions that we have tested. The enzyme has a very pronounced specificity for the second amino acid so that overproduction does not result in removal of Met from proteins that normally remain unmodified. Strains that overproduce peptidase M will be useful for removing N-terminal Met from cloned proteins that are expressed at levels that are too high for efficient N-terminal modification in wild-type cells. Alternately, even if overproduction of peptidase M is detrimental to the cells, the pepM gene can be engineered to be expressed in high quantities, only when needed.

Example 6

Use of Peptidase M to remove N-terminal methionine from Met-Interleukin-1β (IL-1β)

A. Isolation of N-terminal methionylated interleukin 1β

IL-1β recombinant-derived IL-1β (Biogen S.A.) dissolved in 25mM imidazole acetate pH 7.6 (column buffer) was applied either to a FPLC Mono P HR5/20 column (Pharmacia; 2mg was applied at a protein concentration of 2mg/ml) or to a column (11cm x 1.5cm dia.) containing Polybuffer previously equilibrated with column buffer. The Mono P column was eluted at Iml/min at room temperature with 57ml of a Polybuffer 96/74 mixture (20:1 v/v) diluted 1:15 with water and adjusted to pH 6.0 with acetic acid. (Polybuffers from Pharmacia). The Polybuffer exchanger column was eluted at 50ml/h at 4°C with 200 ml of Polybuffer 96 diluted 1:13 with water and adjusted to pH 6.0 with acetic acid. Two distinct fractions were pooled based on their absorbance at 280mm. In order to remove Polybuffer from pooled fractions, solid ammonium sulphate was added to 82% of saturation. The precipitated protein was collected by centrifugation and dissolved in 20mM NH₄HCO₃. The clear solution was dialysed at 4°C against several changes of this buffer and then freeze dried.

Since the molecular weight difference between IL-1β and met-I1-1β is so slight, SDS-PAGE was not appropriate to determine which fraction contained which form of the protein, so Edman degradation was used.

Edman degradation of the two forms of IL-1β separated by chromatofocusing showed one pool to possess N-terminal Ala-Pro- and the other pool to possess N-terminal Met-Ala-.

Only about 25-30% of IL-1β molecules produced by recombinant techniques proved to have an N-terminal methionine.

B. Purification of Peptidase M

The standard reaction mixture contained, in a final volume of 0.2 ml, 40 μmol of sodium phosphate, pH 7.5, 40 μmol of NaCl, and 0.1 μmol of CoCl₂, 60-100 μg of Met-Gly-Gly or Leu-Gly-Gly as the substrate. The reaction was started by the addition of enzyme and was carried out for 15-30 min at 30°C. The amount of free amino acid was determined spectrophotometrically at 45 mm by adding 50 μl containing 50 μg L-amino oxidase, 0.5 μmol of MnCl₂, 100 μg horseradish peroxidase and 50 μg o-dianisidine (this premix allows the production of H₂O₂ on the oxidation of the free amino acids. H₂O₂ is then utilized as a substrate by the peroxidase which oxidizes the o-dianisidine that produces a change in color). Leucine aminopeptidase (from hog kidney) was used as a control aminopeptidase. Similar conditions were used with the control except 0.2 μmol of MnCl₂ was used as a metal activator.

C. Testing of Peptidase M on Met-IL-1β To test peptidase M on the recombinant

IL-1β, recombinant methionylated and non-methionylated IL-1β were separated by chromatofocusing as described above.

Electrofocusing was carried out on thin-layer polyacrylamide gels (LKB Ampholine PAG plates pH 3.5-9.5). SDS-PAGE was carried out on 13% acrylaraide slab gels using a discontinous buffer system. The purified methionine aminopeptidase was able to hydrolyze the N-terminal amino acid of Met-Gly-Gly and Leu-Gly-Gly at a rate of 10.33 and 0.4 units/mg of enzyme, respectively.

The purified IL-1β (100 μg), containing 20% N-terminal methionine, was incubated with peptidase M for different times (the ratio was 1:100 of enzyme to substrate). The N-terminal methionyl residue of the methionylated IL-1β was removed within 15 to 30 min. incubation without degradating the non-methionylated IL-1β.

N-terminal methionylated IL-1β form was separated from non-methionylated IL-1β in a mixture by chromatofocusing. Peptidase M (0.68 μg) completely removed the n-terminal methionine of the purified methionylated IL-1β (68 μg) after incubation for 1 to 2 hrs without degradating the non-methionylated form. Leucine aminopeptidase did not remove the N-terminal methionine of the methionylated IL-1β as observed on IEF.

To confirm that peptidase M is specific to N-terminal methionine and does not remove other N-terminal amino acids, an SDS-PAGE analysis was performed on samples of met-IL-β1 taken after various elapsed times in contact with Peptidase M. Also N-terminal sequencing was performed on protein eluted from bands separated by isoelectric focusing. The results showed no further processing of the N-terminal amino acid after methionine is removed.

Those of ordinary skill in the art will of course appreciate that peptidase M or its analog may be used to treat preproteins in vitro. Those of ordinary skill in the art will also appreciate the advantage of overproducer strains of the microorganisms of the present invention used as hosts for recombinant DNA. The gene coding for peptidase M may also be inserted into a host to assist in the production of mature recombinant or overproduced proteins.

Example 7

Identification of the DNA sequence coding for overproduction of Peptidase M

DNA from S.typhimurium strain TN2529 (wild type) was digested using Sau3A, and the 9-22 Kb fragment obtained was inserted into the DNA for phage λEMBL3 and the BamHI site. S.typhimurium strain TN2529 has been deposited with the Deutsche Sammlung Von Mikroorganismen, West Germany, and has been assigned DSM No. 3969. DNA from strain TN2547 (peptidase M overproducer) was also partially digested and the 9-22 Kb fraction was inserted into λEMBL3 at the BamHI site. Strain TN2547 was also deposited in the Deutsche Sammlung Von Mikroorganismen as DSM No. 3970. 1000 plaques in each phage were then screened using the procedure described by K. Kaiser & N.E. Murray in DNA Cloning Vol. I (D.M. Glover Ed.) (pages 1-47) IRL Press, Oxford, Washington, D.C. These two phages were set aside for later use. Peptidase M was isolated from a crude extract of strain TN2547 using the AcA54 chromatography column described in Example 4. The concentrated peptidase was then further purified by isoelectric focusing. The pi 5.2 band was resulting from isoelectric focusing was peptidase M. Approximately the first 30 amino acids at the N-terminal end of peptidase M were then sequenced in a protein sequencer. The first thirty amino acids of peptidase M are listed in Table 7.

The sequence was used to make two oligonucleotide probes, 32/1a and 32/1b, that were

32 γ-labelled with P using kmase. The two probes had only a single mismatch to assure hybridization. These probes were used to identify the two λEMBL3 phages containing the peptidase M DNA strands from strains TN2529 and TN2547 on immobilized nitrocellulose filters. In each case, the phage and probe were soaked in a solution of 6 x SSC; 5 x Dernharts solution; 0.1% SDS; and 0.1% sodium pyrophosphate. 10 μg/ml of calf thymus DNA was added as a carrier and the mixture was incubated overnight at 37°C.

For both strains TN2529 and TN2547, probe 32/1a gave positives and 32/1b gave negatives.

The probe-attached DNA was washed in 3.2M tetramethyl NH₄Cl/1% SDS solution at 52°C for 90 minutes. The DNA was then washed in six times SSC and 0.1% SDS at room temperature for 10 minutes. Clones were identified by autoradiography and five positive plaques were initially selected for each strain's DNA sequence. These phages were purified; the DNA was isolated; and one sequence from each strain was selected for further study. The DNA sequence originally from strain TN2529 (the wild type strain) was inserted into phage λ10A and the DNA sequence originally from strain TN2547 (the overproducer strain) was inserted into phage λ3B. The phage λ10A was also hybridized with two probes that were larger than the probes discussed above (the probes are shown in Table 8) to confirm that the inserted DNA sequence was the one coding for peptidase M. These longer probes are also shown in Table 8. The results confirmed that the proper DNA sequence was present.

The phage λ10A DNA sequence was hybridized with the 32/1a probes using the Southern blot techinque to confirm that the peptidase M DNA sequence was present. We cut the phage λ10A sequence with SalI and then cut the 9-10Kb fragment with AluI and inserted the fragment into plasmid m13mp19 at the SmaI site. This plasmid was reintroduced into E.coli and subjected to plaque hybridization with the probes to obtain the positive plaques. DNA from phage λ10A containing the DNA sequence for peptidase M from strain TN2529 was separately cut with XhoI and SalI to give DNA fragments of aproximately 3.5Kb and 4.5Kb. Each fragment was inserted into plasmid pUC18 and the resulting vector was inserted into E.coli strain JM83. This strain is also on deposit at the Deutsche Sammulung Von Mikroorganismen, DSM No. 3971. Gel electrophoresis showed that the recombinant plasmid containing larger fragments expressed peptidase M in E.coli and also in Salmonella strains. The identity of the enzyme is confirmed by immunoblotting, as well as by isolation. It will be apparent to those of skill in the art that various modifications may be made in the invention without departing from its spirit or scope, and the invention may be altered to provide other embodiments that utilize the processes and compositions of this invention. Therefore, it will be appreciated that the scope of this invention is to be defined by the claims appended hereto rather than the specific embodiments presented as examples.

Table 2. Utilization of peptides as amino acid sources.

Peptide^* pepM allele

pepM⁺ pepM100

Met-Ala - -

Met-Gly - -

Met-Ala-Ser + +

Met-Ala-Met + +

Met-Thr-Met + +

Met-Gly-Met + +

Met-Gly-Gly - +

Met-Gly-Met-Met + +

Met-Leu-Gly - -

Met-Met-Ala - -

Met-Met-Met - -

Leu-Gly - -

Leu-Leu-Leu _ -

* The Met peptides were tested as Met sources and the Leu peptides as Leu sources. Table 3. Peptide hydrolysis catalyzed by cell extracts . *

Substrate Relative hydrolysis rate**

TN2624 TN2626 (pepM⁺) (pepM100)

Met-Ala-Ser 1.0 1.0

Met-Ala-Met 1.0 1.0

Met-Thr-Met 0.2 0.2

Met-Gly-Met 0.5 0.5

Met-Gly-Gly 0.09 0.1

Met-Gly-Met- Met 0.8 0.7

Met-Leu-Gly 0*** 0***

Met-Met-Ala 0 0

Met-Met-Met 0 0

Leu-Gly-Gly 0.02**** 0.004****

Ala-Ala-Ala 0.004 0

Ala-Ala-Ala- Ala 0.04 0

* Assayed as described in the Examples, with a reaction time of 40 minutes.

** The hydrolysis rates for each extract are compared to the hydrolysis rate for Met-Ala-Ser for that extract. The specific activity for Met-Ala-Ser was .029 units/mg protein for TN2624 extract, and 0.53 units/mg protein for TN2626 extract. The assay contained either 140mg protein (TN2624 extract) or 14mg protein (TN2626 extract).

*** We estimate that a relative hydrolysis rate of 0.006 for the TN2624 extract assays or .003 for the TN 2626 assays would have been easily detected.

**** very small amounts of Gly and Leu-Gly were produced. This is almost certainly the result of peptidases other than peptidase M. Table 4. Effect of divalent cations on peptidase M activity.

Addition* Relative hydrolysis rate**

None 1

EDTA (1mM) <0.0002

Co⁺² 9

Mn⁺² 1 Mg⁺² 0.9

Zn⁺² 1

* All divalent cations were added as chloride salts at a final concentration of 3mM. Co⁺² showed the same stimulation at 1mM, the concentration used in the standard assay.

** Assayed as described using Met-Ala-Ser as substrate and crude extract of TN 2626 (8mg) as enzyme. Table 5 Mapping of pepM by P22 transduction.

Contransduction

Selected Unselected Frequency

Donor Recipient Marker Marker (%)

TN2695 TN2529 Leu⁺ pepM100^* 7.5 (6/80) leu pepM⁺ pepM100

LT2 TN2547 Leu⁺ pepM⁺ 8.3 (22/265) leu⁺ leu - pepM⁺ pepM100

TN2501 TN252.9 Kan^r pepM100^* 17.0 (52/305) pepM100 pepM⁺ zae1615:: Tn10Δ16Δ17 Kan^r

TN2501 TT421 Kan^r Tet^s 11.8 (17/144) zae1615:: panC::Tn10 Tn10Δ16Δ17

Kan^r

TT421 TN2501 Tet^r Kan^s 3.4 (6/176) panC:Tn10 zae1615::

Tn10Δ16Δ17 Kan^r

* pepM alleles were scored by testing growth on Met-Gly-Gly as Met source. Table 6. Levels of peptidase M in duplication strains.

Strain Specific Activity* μmol Met/min/mg

TN 2529 (pepM⁺) 0.025

TN 2563 (pepM⁺/pepM⁺) 0.076

TN 2547 (pepM100) 0.60

TN 2565 (pepM⁺/pepM100) 0.77

* Standard assays using Met-Ala-Ser as substrate were performed. TABLE 7

Partial N-terminal Amino Acid Sequence of

Peptidase M

As Sequenced from the pI 5.2 Fraction

AlalleSerlleLysThrSerGluAspIleGluLysMetArgVal AlaGlyArgLeuAlaAlaGluValLeuGluMetlleGluProTyr IleLysProGlyValThr ...

TABLE 8

Probes used in Example 7

Probe 32/1A

(3') CTY CTR TARCTY TTY TAC (5') Probe 32/1B

(3^l) CTY CTR TATCTY TTY TAC (5')

(Y = C or T; R = A or G; site of single mismatch underlined)

LARGE PROBES Probe N52-1B

(3') GCTATCTCTATCAAAACTTCTGAAGATA (5')

Probe N52-2'

(3') GACTTCTATAGCTTTTTTACGCACAACGACCAGCAGAC (5')

(Probe N52-1B and Probe N52-2' are complementary between the marked bases. These oligonucleotides are annealed to each other and extended with radioactive nucleotide triphosphates with the help of Klenow enzyme, the unincorporated triphosphates of oligonucleotides are separated from the mixture of oligonucleotides. This mixture of oligonucleotides was used as a probe to identify the DNA corresponding to pepM gene.)

Claims

CLAIMS :

1. An enzyme capable of cleaving an N-terminal methionine from a polypeptide, wherein said enzyme is substantially incapable of cleaving any other N-terminal amino acid from said polypeptide and is substantially incapable of cleaving methionine at any part of said polypeptide other than the N-terminus.

2. The enzyme of claim 1, wherein said enzyme is Peptidase M.

3. The enzyme of claim 1, wherein the second amino acid of said polypeptide is selected from the group consisting of alanine, eysteine, glycine, proline, serine, threonine, tryptophan, tyrosine, and valine.

4. A method for producing a polypeptide free of an N-terminal methionine, comprising treating said polypeptide having an N-terminal methionine with the enzyme of claim 1 or 2.

5. A polypeptide produced by the method of claim 4.

6. A method for producing a polypeptide free of an N-terminal methionine, comprising the steps of: (a) culturing a unicellular organism that contains: (i) a DNA sequence coding for said polypeptide operatively linked to an expression control sequence, and (ii) a DNA sequence coding for the enzyme of claim 1 or 2 operatively linked to an expression control sequence; and (b) collecting said polypeptide from said microorganism.

7. A method for producing a polypeptide free of an N-terminal methionine, comprising the steps of: (a) selecting a host which produces said polypeptide with an N-terminal methionine; (b) transforming said host with a DNA sequence coding for the enzyme of claim 1 or 2 operatively linked to an expression control sequence; and (c) culturing said transferred host.

8. A method for producing a polypeptide free of an N-terminal methionine, comprising the steps of: (a) selecting a host that overproduces the enzyme of claims 1 or 2; (b) transforming said host with a DNA sequence coding for said polypeptide operatively linked to an expression control sequence; and (c) culturing said transformed host.

9. A DNA sequence selected from the group consisting of: (a) a DNA sequence coding for peptidase M; (b) a DNA sequence coding for an active fragment of peptidase M; (c) a DNA sequence coding for an analog of peptidase M; and (d) a DNA sequence degenerate with respect to any of the DNA sequences described in (a), (b), or (c).

10. A recombinant DNA molecule comprising at least one of the DNA sequences of claim 9.

11. A host transformed by the recombinant

DNA molecule of claim 10.

12. A method for selecting a strain of a microorganism that overproduces an enzyme, wherein said enzyme operates on a first substrate and a second substrate and wherein said enzyme has substantially more activity with respect to said first substrate than with respect to said second substrate, comprising the steps of: (a) culturing said microorganism in a culturing medium containing said second substrate as the only source of a nutriant required for growth and not said first substrate; and (b) isolating strains of said microorganism that show high activity towards said second substrate.

13. The polypeptide of Claim 5, wherein said polypeptides interleukin-IB (IL-1B).