WO1986007383A1 - Autoantigen vaccines - Google Patents

Autoantigen vaccines Download PDF

Info

Publication number
WO1986007383A1
WO1986007383A1 PCT/US1986/001226 US8601226W WO8607383A1 WO 1986007383 A1 WO1986007383 A1 WO 1986007383A1 US 8601226 W US8601226 W US 8601226W WO 8607383 A1 WO8607383 A1 WO 8607383A1
Authority
WO
WIPO (PCT)
Prior art keywords
dna
peptide
sequence
protein
encoding
Prior art date
Application number
PCT/US1986/001226
Other languages
English (en)
French (fr)
Inventor
Karen D. Talmadge
John C. Fiddes
Original Assignee
Biotechnology Research Partners, Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biotechnology Research Partners, Ltd. filed Critical Biotechnology Research Partners, Ltd.
Publication of WO1986007383A1 publication Critical patent/WO1986007383A1/en
Priority to DK058887A priority Critical patent/DK58887A/da
Priority to KR870700098A priority patent/KR880700077A/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575—Hormones
    • C07K14/59—Follicle-stimulating hormone [FSH]; Chorionic gonadotropins, e.g.hCG [human chorionic gonadotropin]; Luteinising hormone [LH]; Thyroid-stimulating hormone [TSH]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/035—Fusion polypeptide containing a localisation/targetting motif containing a signal for targeting to the external surface of a cell, e.g. to the outer membrane of Gram negative bacteria, GPI- anchored eukaryote proteins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/24011—Poxviridae
    • C12N2710/24111—Orthopoxvirus, e.g. vaccinia virus, variola
    • C12N2710/24141—Use of virus, viral particle or viral elements as a vector
    • C12N2710/24143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/16011—Orthomyxoviridae
    • C12N2760/16111—Influenzavirus A, i.e. influenza A virus
    • C12N2760/16122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

  • This invention relates to construction and design of vaccines which neutralize the effects of indigenous proteins.
  • vaccines can be made species specific or can have cross-species effectiveness. They are particularly useful in the control of fertility in both humans and animals.
  • An important embodiment of such vaccines utilizes vaccinia-borne antigens.
  • vaccines prepared from proteins or peptide conjugates have certain inherent disadvantages. Preparation of the peptides and formulation of the vaccines are expensive, and administration must be done under controlled conditions by trained personnel. Also, because these vaccines are prepared by conjugation of the autoantigen to a carrier at the protein, rather than at the genetic level, some denaturation inevitably occurs. It is thus difficult to achieve uniform compositions from batch to batch, and some compositions have lowered antigenicity. resulting in variable immune responses.
  • vaccinia virus An alternative to protein-based vaccines has been known for many years. Smallpox has been successfully eradicated through the use of vaccines comprised of vaccinia virus. Vaccine comprised of vaccinia virus has tremendous advantages in terms of cost (approximately two cents per dose) and also in terms of handling, as it can be administered as a scratch under nonsterile field conditions and maintains its stability at room temperature when previously freeze-dried. These properties of vaccinia have recently been used to advantage in preparing vaccines against other infectious agents by recombining the genes encoding the desired immunogens against, for example, hepatitis B, herpes, influenza, and rabies, into the vaccinia genome.
  • the recombined vaccinia can then be used in a manner analogous to the original smallpox vaccine, with all the attendant advantages. See. for example. Smith, G.L., and Moss, B., Biotechniques (1984) 306-312; Smith. G.L.. Nature (1983) 302:490-495; Panicali. D.. et al. Proc Natl Acad Sci (USA) (1983) 80.:5364-5368; Paoletti, E.. et al, Proc Natl Acad Sci (1984). 81:193-197; Wiktor. T.J.. Proc Natl Acad Sci (1984) 11:7194-7198; and Panicali. D.. et al, Proc Natl Acad Sci (1982) 79:4927-4931.
  • the desirable properties of the vaccinia carrier have, however, never been marshalled to administer effective vaccines directed against autoantigens.
  • the appropriate autoantigens for control of fertility depend on the species of the subject, but are generally related to those hormones which regulate the reproductive system.
  • Human chorionic gonadotropin is a particular such antigen which,, if neutralized, would be incapable of its necessary role in the maintenance of human pregnancy. Thus, raising neutralizing antibodies against this factor, for example through the vehicle of vaccinia-borne administration would result in effective control of the consequences of conception in humans.
  • the use of chorionic gonadotropin carboxy-terminal peptide is not workable in animals in general, however, because there is no placental production of chorionic gonadotropin in most species except horses.
  • DNA sequences encoding a number of hormones known to be significant in controlling the estrus cycle such as luteinizing hormone (LH) and follicle stimulating hormone (FSH) are usable.
  • LH luteinizing hormone
  • FSH follicle stimulating hormone
  • the DNA encoding GnRH is effective in generating antibodies which prevent fertility in these animals.
  • GnRH sexual function of both male and female farm animals and in dogs and cats is controlled primarily by GnRH, either sex may be rendered infertile or sterilized using such vaccines.
  • the invention provides vaccines which are low-cost, effective preparations suitable for use in developing countries as well as in the industrialized world for fertility control, both in humans and in animals.
  • the vaccines are also useful, in general, to control any metabolic function which is regulated by an indigenous protein or autoantigen.
  • the vaccines include those which provide protection against pregnancy in humans for limited time periods and which are reversible so ,as to permit their use without the negative effect and disincentive of permanent sterilization.
  • Such vaccines are immunogenic forms of human chorionic gonadotropin (hCG) . a placental product necessary for maintenance of pregnancy.
  • Other hormones connected with reproductive function, such as GnRH. and certain forms of LH can also be used as the basis for providing antigenic determinants in the * human vaccine.
  • Analogous vaccines using autoantigenic forms of. for example. GnRH. FSH. or LH are useful in fertility control in animals.
  • the immunogens can be administered as DNA constructs with vaccinia virus, a vehicle which permits low-cost formulation as well as administration under a range of conditions some of which may be less than desirable for delivery of medical services. They can also be administered in more conventional methods such as protein vaccines using, for example, an autoantigenic construction encoding the appropriate region of the appropriate hormone as the antigenic determinant.
  • the invention has broader application.
  • Native proteins in general can be made effective as autoantigens by multimerization of their epitopes or by conjugation to a non-bacterial amino acid sequence in the form of a fusion protein and can be administered in conventional or vaccinia-borne forms.
  • any metabolic function regulated by peptides is susceptible to control by appropriate vaccines.
  • the species specificity of such vaccines can be controlled since this depends upon the choice of epitopes.
  • the vaccines can thus be constructed to be broadly applicable across species lines, or can be limited in their effect to a single species of choice.
  • the invention relates to the use of autoantigens as vaccines to control metabolic function wherein the antibodies to an appropriate indigenous protein are raised in response to a recombinantly created "autoantigenic" form, such as. preferably, a multimer which contains at least 2 repeating units of at least one epitope associated with the indigenous protein, or as a recombinantly produced fusion protein bearing a suitable epitope.
  • autoantigenic forms are constructed at the DNA level, using recombinant techniques, and the autoantigenic proteins may either be generated in situ in the subject, if the DNA encoding the autoantigen is properly disposed in a vaccinia vehicle, or they may be produced using recombinant techniques and supplied as peptides or proteins.
  • the autoantigen is a multimer. and the DNA encoding an indigenous peptide. such as a hormone, or an epitope-containing portion thereof, is manipulated . in vitro to obtain repeating coding sequence for a multimer of this sequence.
  • the proteins which form the basis for the vaccine may also be monomers with respect to an autoantigen epitope if they are disposed in suitable carrier proteins which provide sufficient immunogenicity.
  • the DNA encoding this epitope is, in this case, ligated to the DNA encoding the carrier.
  • the epitope-containing moiety can be linked to a carrier to create immunogenicity at the protein level.
  • the invention relates to antipregnancy vaccines useful in humans which are based on epitopes of a specific region of the hCG protein - the carboxy terminal peptide (CTP) which represents the end of the " ⁇ -hCG" chain.
  • CTP carboxy terminal peptide
  • hCG contains two non-covalently bound subunits designated ⁇ and ⁇ .
  • These monomers and multimers include CTPs modified by containing no cysteine at position 110 or having cysteine replaced with a serine or other equivalent amino acid residue at position 110.
  • vaccines against pregnancy in farm animals and pets are based on the production of immunogenic forms of a fertility controlling autoantigen gonadotropin releasing factor (GnRH) a product of the hypothalamus which controls release of certain hormones from the pituitary.
  • GnRH gonadotropin releasing factor
  • the most preferred forms of GnRH are modifications of the human sequence wherein the N-terminal pyroglutamic acid (presumably formed by cyclization in serum) is replaced by glutamine and the C-terminal amidated glycine is replaced by glutamine.
  • Still other embodiments utilize immunogenic forms of other fertility controlling autoantigens, specifically, LH and FSH, in both animals and humans.
  • an aspect of the invention are vaccines whose species specificity is regulated by the choice of epitopes in converting portions of human, bovine, and dog LH ⁇ chains to autoantigens. Depending on the portions of the peptides chosen, these vaccines are species-specific or species-versatile in their application.
  • the desired autoantigen can if desired be administered in the form of a recombinant vaccinia containing expressible monomers and multimers of the autoantigen.
  • a recombinant vaccinia containing expressible monomers and multimers of the autoantigen.
  • the autoantigen for example, the multimers of CTP or GnRH
  • intracellular expression is expected to result.
  • the secondary carrier functions to transport the autoantigen monomers or multimers to the surface of infected cells. This creates more effective exposure of the autoantigen to the subject, and enhances the immune response.
  • a carrier protein encoding sequence such as influenza hemagglutinin (HA) encoding DNA
  • the secondary carrier functions to transport the autoantigen monomers or multimers to the surface of infected cells. This creates more effective exposure of the autoantigen to the subject, and enhances the immune response.
  • HA hemagglutinin
  • the desired autoantigen genes are cloned into the A or B antigenic regions of the influenza HA; in a second embodiment, they are cloned between the HA signal sequence and membrane anchor portions. Both of these approaches result in presentation of the antigen at the surface of the cell.
  • the desired autoantigen DNAs can be cloned into HA encoding DNA so that the resulting proteins are linked operably to the signal sequence, but with the membrane anchor portion of the HA eliminated.
  • other signal sequences such as, for example, those associated with bacterial alkaline phosphatase (BAP) or renin can be used to effect secretion of the the desired autoantigen immunogens. or the signal sequence associated with the native antigenic protein may be employed.
  • the invention relates to methods of preventing pregnancy or controlling other metabolic functions by administration of the foregoing vaccines and to methods of preparation of such vaccines, as well as to intermediate vectors and DNA sequences useful in their preparation.
  • the invention relates to antibodies produced in response to these vaccines. These antibodies are particularly useful in assessing the levels of the hormones themselves through immunoassay. Accordingly also included within the invention are labeled and unlabelled forms of the these antibodies, and these antibodies both in soluble form and bound to a solid support. Spleens obtained from animals immunized with the vaccines of the invention can also be used as a source of cells for immortalization to obtain corresponding monoclonal preparations.
  • Figure 1 shows the DNA sequences useful in preparing the gene encoding modified and unmodified ⁇ -hCG CTP monomers and multimers representing amino acids 109-145 of ⁇ -hCG.
  • Figure 2 shows the amino acid sequence for GnRH in several species and the DNA sequences useful in '5 preparing the genes encoding modified human and chickenll GnRH monomers and multimers.
  • Figure 3a shows the cDNA sequence of and method of constructing appropriate multimers of a portion of the ⁇ peptide of bovine LH.
  • Figure 3b shows the cDNA sequence of and method of constructing appropriate multimers of a portion of the ⁇ peptide of dog LH.
  • Figure 4 shows the cDNA sequence of and method of constructing appropriate multimers of a portion of 5 the ⁇ peptide of human LH.
  • Figure 5 shows modification of pKK223-3 to obtain the host vector pVAl and of pKT19 and pKT41 to obtain the host vector pVA2.
  • Figure 6 shows the construction of derivative 20 vectors pHAl and pHA2 containing an HA-encoding DNA.
  • Figure 7 shows a map of a typical hemagglutinin encoding gene with useful restriction sites for its use as a carrier.
  • Figure 8 shows the modification of the HA gene 25 for insertion of autoantigen multimers in the HA antigenic regions.
  • Figure 9 shows the construction of intermediate vectors carrying an HA gene modified by insertion of autoantigen between its signal sequence and membrane 30 anchor.
  • Figures 10a, 10b, and 10c show the construction of intermediate vectors containing autoantigen inserts into an HA secondary carrier which lacks membrane anchor codons.
  • Figures 11 and 12 show the construction of vectors designed to effect autoantigen secretion using the signal sequences of BAP and renin, respectively.
  • Figure 13 shows the construction of pGS20 and a diagram of its use in effecting integration of a desired sequence into the vaccinia virus TK gene.
  • Figure 14 shows the results of a gel analyzing the proteins produced by cells tranfected with expression vectors for the autoantigenic CTPs of the invention.
  • Figure 15a shows a comparison of human, rat, bovine, and dog ⁇ LH amino acid sequences.
  • Figure 15b shows the location of peptides useful in species- specific vaccines, and the sequences of oligonucleotides encoding them.
  • the invention in one aspect, relates to methods and constructions which utilize the vaccinia system to introduce and express genes for autoantigens in vertebrate hosts.
  • vaccinia has been used as a vehicle for DNA sequences which express proteins that are already immunogenic in the target host, and have not been employed to obtain expression of autoantigens that are altered to render them immunogenic.
  • a particularly suitable "alteration” includes use of multimeric genes to produce multimeric antigens, so that the joined regions form the foreign epitopes. Immunogenicity is also provided when monomeric as well as multimeric genes inserted into DNA regions encoding known antigenic sites, such as those which reside in influenza hemagglutinin.
  • the autoantigen will then be presented in a part of the protein known to be accessible to antibodies, and the other hemagglutinin antigenic sites as well as the joining regions to the antigen region sequence represent the foreign epitopes.
  • These and other constructions employing monomeric and multimeric genes in foreign proteins use these foreign proteins to carry and dispose the resulting chimeras to the infected cell surface or to secrete them from the infected cell. This transport makes the autoantigen-bearing chimeras accessible to the immune system.
  • the proteins which result from .in situ expression of these recombinant constructs are immunogens, the immunogens could also be produced outside the subject using recombinant techniques and administered as conventional protein vaccines.
  • This recombinant expression includes the use of conventional procaryotic and eucaryotic expression systems and hosts, as well as transient expression from a recombinant intermediate shuttle vector using standard transformation into vaccinia-susceptible cells and infection with vaccinia virus.
  • these antibodies are effective in producing antibodies which are immunospecific for the hormones involved in reproduction or for other indigenous proteins, these antibodies can, of course, be purified and used in immunoassays for the determination of the antigen.
  • A. Conferring Immunogenicity on indigenous Proteins At the heart of the invention is the use of recombinant techniques to create forms of indigenous proteins which are immunogenic, and which therefore behave as autoantigens.
  • autoantigens are portions of or complete sequences of proteins normally made in the host. and which proteins are thus immunologically privileged, unless they are made immunogenic.
  • This immunogenicity can be obtained by linking the gene for an autoantigen which represents all or part of the immunologically privileged protein to a gene for an additional sequence, either a duplicate of the autoantigen or another secondary carrier protein, or both, so that the junction region between the autoantigen and its adjacent amino acids is clearly foreign to the host organism and is capable of conferring immunogenicity on the entire protein.
  • the chimeric proteins produced by the inserts into vaccinia virus exhibit this property when produced in situ, or the same coding sequences can be produced using recombinant expression techniques in, vitro and then used as conventional vaccines.
  • the autoantigen in some cases, especially where. the autoantigen is only a portion of an immunologically privileged protein, the autoantigen alone may be immunogenic.
  • the invention concerns recombinantly produced immunogenic forms of indigenous proteins.
  • the immunogenic form obtained by constructing the gene encoding and producing either: a multimer which consists essentially of at least 2 repeating units of at least one epitope of the indigenous protein, or at least one epitope of the indigenous protein conjugated to a non-bacterial polypeptide. or a multimer which consists essentially of at least 2 repeating units of at least one epitope of the indigenous protein conjugated to an additional polypeptide sequence.
  • multimers .of the desired autoantigen are created at the DNA level.
  • the junction regions of the multimeric proteins constitute the foreign sequences which confer immunogenicity on the resulting polymeric protein.
  • This approach has the advantage of generating a relatively large immunogen with few irrelevant epitopes, and with a high concentration of the desired determinant, as compared, for example, with the more traditional conjugation of the desired hapten with a carrier protein.
  • the protein is "polymerized" at the DNA level, resulting in a recombinant polymer which more closely resembles the native peptide form.
  • Recombinant multimers have been constructed from proinsulin (Shen, S., Proc Natl Acad Sci (USA) (1984) £1.:4627-4631) . and the multimers expressed in E. coli. These multimers were used to stabilize the recombinant protein, and were subsequently depolymerized to regenerate the monomeric form, which was the desired product.
  • Recombinant multimers of the "CS" protein of the human malaria parasite have also been constructed (Young, J.F., et al. Science (1985) 228:958-962) .
  • peptides encoded by monomers, dimers and trimers of a Xhol fragment which therefore contain 16, 32. or 48 tandem copies of a repeated tetrapeptide sequence.
  • the native protein contains 37 repeats of this tetrapeptide interspersed with 4 identical (to each other) tetrapeptides.
  • the peptides are found to be immunogenic in mice.
  • the immunogenicity of the protein may also be enhanced by inserting it into the antigenic regions of a protein derived from an infectious material such as a viral surface protein, or to a carrier which functions simply to increase the size of the peptide.
  • the “carrier” is a peptide sequence resulting in the production of a fusion protein between at least one epitope of the desired autoantigen and a non-bacterially derived sequence capable of conferring immunogenicity on the epitope which provides the hapten for the immunogen.
  • the junction region represents unfamiliar sequence to the recipient, and the additional peptide confers sufficient size, if needed, to raise antibodies against this determinant.
  • the peptide sequences of the influenza hemagglutinin protein are particularly useful in providing the needed additional amino acid sequence.
  • a diagram of a typical hemagglutinin (HA) gene is shown in Figure 7. The particular map shown is of the antigenic variant A/Japan/305/57 (H2) as disclosed in Gething, M.J..
  • the gene encodes a signal sequence, a peptide containing approximately 550 amino acids followed by a membrane anchor sequence.
  • the gene is framed by Ball, Ndel. and PstI restriction sites and contains several convenient restriction sites in the body of the amino acid sequence.
  • T e epitopes may be ligated into the antigenic regions shown as A and B by providing blunt end restriction sites between codons in these regions using site specific utagenesis.
  • the naturally occurring restriction sites may be used to result in proteins extended by the remaining portions of the HA carrier.
  • the HA sequences serve merely to provide the desired immunogenicity on the construct.
  • retaining the signal sequence and deleting the membrane anchor in the cultured cells will result in the ability to recover the desired protein from the culture medium.
  • the HA sequences serve functions more directly related to the presentation of the antigenic determinant to the host.
  • multimer encoding sequences may be ligated to DNA encoding carrier in a ⁇ combination of the foregoing methods.
  • vaccinia as carrier for any autoantigenic gene constructed as described above in that the levels of immunogenicity may be adjusted through the nature of the protein encoded.
  • the encoded autoantigenic protein will be produced as an • intracellular protein with limited exposure to the immune system. Insertion into an antigenic region of a viral protein will result in display of the antigen on the cell surface; similar enhancement may be obtained by using additional secondary carrier sequences which result, in secretion from the infected cell or disposition on the cell surface.
  • the autoantigens are constructs of peptides which are involved in metabolic control of the subject host, especially hormonal control, and. in particular, fertility control.
  • coding sequences derived from ⁇ -hCG are made immunogenic' and are thus useful in creating vaccines which prevent pregnancy in humans.
  • GnRH and LH of known sequence are made in a form to confer infertility on a variety of animals.
  • Human GnRH is illustrated for use in animals in general, including dogs and cats.
  • other GnRH peptides of known sequence such as the GnRH peptides shown for salmon and chicken in Figure 2.
  • porcine and bovine sequences are identical with each other and with the human sequence. Presumably, in view of the high degree of sequence homology with species as distant as salmon, the GnRH native to dogs or cats or to other farm animals will at least have immunological cross-reactivity with the human and or chicken forms.
  • bovine, dog, and human LH ⁇ peptides are illustrated. These may have considerable cross-species reactivity, especially if regions of homogeneity are included. However, as illustrated below, species specific vaccines may also be constructed by recombinantly generating peptides or multimers of peptides which represent non-homologous regions.
  • autoantigens which are fertility controlling autoantigens can also be used and include, for example, those derived from ovum proteins such as zona pellucida peptide; sperm antigens such as hyaluronidase and acrosin; the sperm-specific isozyme of lactose dehydrogenase, and the additional pituitary hormone follicle stimulating hormone (FSH) .
  • ovum proteins such as zona pellucida peptide
  • sperm antigens such as hyaluronidase and acrosin
  • the sperm-specific isozyme of lactose dehydrogenase and the additional pituitary hormone follicle stimulating hormone (FSH) .
  • FSH pituitary hormone follicle stimulating hormone
  • vaccines which succeed in immunizing the subject based on the CTP portion of ⁇ HCG are particularly pre ⁇ ferred, but it is also effective to utilize the entire ⁇ HCG subunit or other portion thereof, or the ovine ⁇ LH subunit or portion thereof to prevent pregnancy in humans.
  • vaccines which are specific in raising antibodies against GnRH are preferred.
  • vaccines which are species specific — i.e., which are capable of preventing pregnancy or inducing sterility in only the species to which they are administered.
  • These vaccines utilize epitopes which reside in regions of the hormones 0 controlling reproduction which are non-homologous between species, particularly between humans and species to which humans must administer the vaccines. This may be especially desirable in constructing a vaccine useful in animals, as there would then be little danger of 5 affecting the humans responsible for its administration.
  • the illustration below sets forth an exemplary procedure whereby a region of low homology is chosen as the antigenic determinant for a vaccine.
  • the gene encoding 0 inhibin. a hormone which affects fertility by lowering the ability of the pituitary to secrete FSH can be used; here the antibodies would increase the fertility of the host. See Olson, P.W., et al. Symposium on Endocrinology, Vet Clin NA: Small Animal Practice (1984) 1 _:927-926. It also may be desirable to immunize the host against these and other hormones in order to regulate overproduction of these hormones and the resulting metabolic aberrations.
  • the autoantigens with which the invention is most concerned are "fertility controlling"—i.e., hormones which are involved in the physiological control of sex characteristics including behavior and fecundity.
  • the most preferred embodiment of vaccines against human pregnancy are those wherin the autoantigenic peptides are derived from the carboxy terminal peptide (CTP) of the ⁇ chain of human chorionic gonadotropin ( ⁇ -hCG) .
  • CTP carboxy terminal peptide
  • ⁇ -hCG human chorionic gonadotropin
  • the CTP region is unique to hCG, thus minimizing the likelihood of unwanted interference with other essential hormones by antibodies raised against CTP.
  • hCG itself is a glycoprotein of molecular weight 38 kd, of which 30% represents sugar.
  • the protein has two dissimilar subunits, ⁇ and ⁇ -hCG. which are coupled by, noncovalent linkage.
  • the ⁇ subunits of hCG and of three other hormones—luteinizing hormone (LH) , follicle-stimulating hormone (FSH), and thyroid-stimulating hormone (TSH) are identical in humans.
  • hCG is secreted by the placenta; LH, FSH, and TSH are secreted by the pituitary.
  • the ⁇ subunits of all four of these hormones show differences between them, but do retain some amino acid sequence homologies.
  • the homologies " are greatest between hCG and hLH ⁇ subunits; however, hCG contains an additional thirty amino acids extended beyond the 115 amino-acid residues in the ⁇ subunit of hLH.
  • positions 111-145 of ⁇ -hCG show no counterpart in hLH.
  • the peptide represented by positions 109-145 of hCG, conjugated to a carrier protein such as bovine gamma globulin or diphtheria toxoid.
  • a second advantage of utilizing the CTP region of ⁇ -hCG is that the hormone which it represents, as a placenta-derived hormone, is not generated directly by the host. Thus, antibodies raised against hCG which are not cross-reactive with FSH. LH, or TSH do not interfere with a hormone which might regulate the metabolism of the immunized subject.
  • the role* of hCG is presumed to be stimulation of steroid (progesterone) production by the corpus luteum following conception, until steroid production by the placenta itself can be established.
  • hCG Production of hCG by the placenta apparently begins within six days of conception, and is essential for the maintenance of pregnancy. If sufficient levels of hCG are not synthesized by eleven days, the corpus luteum regresses and normal menstruation occurs; the effect of this failure would presumably be mimicked by neutralizing antibodies. Immunization against hCG thus represents immunization against a non-maternal (although immunologically privileged) hormone which is apparently designed specifically for the maintenance of pregnancy and is presumptively not secreted for any other additional purpose.
  • a third advantage of using a partial sequence of hCG is that a vaccine using CTP as the immunogen provides sterility that is apparently reversible, as judged by preliminary tests on baboons. (Stevens, supra). This reversibility is thought to be due to the direction of T-cell memory not against native hCG but against the hCG/carrier protein joining regions. Therefore, production of the native hormone in intermittent pregnancies (which are presumably then terminated by the antibodies) is not likely to boost the anti-hCG response, and this has been shown in baboons (Stevens, supra).
  • the ability to construct the CTP portion as an unfamiliar protein may indeed account, in the previously disclosed constructions, for the immugenicity of what might otherwise be considered an indigenous protein. (Indeed, this feature is not limited to CTP but is true of autoantigens in general. The subjects are not boosted by their own hormone or endogenous peptide production. )
  • Vaccinia offers such a possibility by providing a means for producing large quantities of immunogen in situ, as well as constituting a vehicle which has the benefit of collective experience through smallpox vaccinations and, more recently, through experimental immunizations against other diseases, as outlined above.
  • Fusion proteins containing the CTP monomer or multimer may be made using conventional recombinant techniques, and used in a manner common to traditional subunit vaccines.
  • Gonadotropin releasing hormone is a decapeptide secreted by the hypothalamus and controls the release of both luteinizing hormone (LH) and follicle stimulating hormone (FSH) in vertebrates (Fink, G., British Medical Bulletin (1979) 3_5_:155-160) . These hormones, in turn, control the levels of steroid hormones such as estradiol and progesterone.
  • LH luteinizing hormone
  • FSH follicle stimulating hormone
  • the amino acid sequence of the decapeptide GnRH has been determined for several species, as shown in Figure 2, and the cDNA for human GnHRH has been cloned, so that its sequence is established beyond doubt (Seeburg. P.H., et al. Nature (1984) 311:666-668).
  • GnRH was formerly designated LHRH and is so named in the Seeburg paper.
  • LH and FSH are significant in regulating the estrus cycles of dogs and cats, although different patterns are obtained.
  • luteinizing hormone peaks sharply at the onset of estrus and falls off as the period of estrus proceeds and is dissipated.
  • FSH also reaches a peak at this time, although the peak is slightly retarded from that of LH and the patterns are not precisely the same.
  • the levels of estradiol (controlled by FSH) and progesterone (controlled by LH) also cycle. Therefore, the estrus cycle is destroyed by preventing secretion of LH and FSH from the pituitary. This can be accomplished by suppression of GnRH activity through immunoreaction.
  • GnRH cross species effectiveness of a single vaccine.
  • the amino acid sequence of GnRH is highly conserved among species. As shown in Figure 2, human, sheep, rat, pig, and cow GnRH are completely homologous; the most highly differing peptide is one of two derived from chickens which shows only three amino acid residue differences. All of these have biological activity in rats.
  • the constructs used in the present invention are derived from the human sequence but are modified by substituting the glutamine residue at the N-terminal position in place of the pyroglutamic acid. This substitution has the effect of retaining the glutamic acid structure but preserving the uncharged structure of the pyroglutamate.
  • the resulting peptide thus does not require cyclization of the glutamic acid residue, and can be conveniently produced in the cytoplasm of the infected cell without concern for the presence of conditions to effect this processing, such as are ordinarily found in serum.
  • the multimer as obtained from these constructs will have a C-terminal glutamine which mimics the amidation of the naturally occurring decapeptide. also obviating the need for subsequent processing.
  • Administration may be as a vaccinia virus construct or as a conventional subunit vaccine.
  • Vaccines are also illustrated below which are derived from human, bovine, and dog LH ⁇ chain sequences.
  • LH is involved in maintenance of the corpus luteum. and although regulation of its level varies from species to species, it is essential for fertility in all. Therefore, antibodies capable of neutralizing LH are effective antifertility agents.
  • Figure 15a shows a comparison of the amino acid sequences of human, rat. bovine, and dog LH. Many regions are highly homologous, but the boxes designate regions where the differences from human sequence occur.
  • Vaccines based on raising antibodies to LH can thus be made species-specific (or at least, ineffective in humans) by selecting these regions of low homology to obtain the autoantigen. In general, species specificity is obtained by selecting non-homologous regions, or vaccines can be made effective across species lines by using homologous regions.
  • Figure 15b suggests peptides of interest for cow-specific and dog-specific vaccines.
  • non-homologous peptides indicated are sufficiently short that genes encoding them can easily be made using the currently available chemical synthesis methods.
  • the monomeric and multimeric units analogous to those of CTP and GnRH described above can be synthesized and manipulated in similar ways, either individually, or as cocktails which include two or three of the desired peptides.
  • DNA capable of encoding major portions of either the bovine or human sequences can most conveniently be obtained by ' recovering a cDNA clone from libraries constructed using bovine or human pituitary mRNA.
  • Complete genomic coding sequences for bovine LH (Virgin. J.B.. et al.
  • ligation into a carrier protein, production of a fusion protein, and so forth; and the means of administration - as a vaccinia borne expression system or as a protein or mixture of proteins produced by recombinant means, are similar to those described in connection with GnRH and CTP.
  • Antibodies raised against the immunogenic proteins of the invention, whether these proteins are produced for vaccine formulation or in situ, are useful in diagnosis and, if correctly prepared, in passive treatment. Conventional processes known in the art are used to prepare these antibodies. Both the antibodies themselves and their immunospecific fragments, such as Fab fragments are thus useful.
  • CTP carboxy terminal peptide
  • ⁇ -hCG is a 145 amino acid peptj.de of known sequence, (Fiddes, J.C., et al. Nature (1980) 186.:684-687) .
  • the approximately 30 amino acids representing positions 109-145 represents a unique determinant among this group.
  • CTP refers to a peptide having an amino acid sequence substantially similar to that represented by amino acids 109-145 of the native ⁇ -hCG.
  • ami ⁇ o acid sequence may be made without affecting the immunological characteristics of the resulting peptide.
  • Amino acid additions, deletions, and alterations can be made so long as they do not negatively affect the ability of the resulting peptide to elicit neutralizing antibodies against hCG itself.
  • modifications include, but are not limited to, deletion of the cysteine residue at position 110 or replacement of the cysteine residue by serine or another amino acid which does not impair the immunogenicity of the resultant modified form, such as, for example, alanine, glycine, or valine. Deletion of this cysteine residue provides an improved form of the protein as the fortuitous formation of unwanted disulfides is thus prevented.
  • CTP also used in the vaccines of the invention.
  • These multimers may consist of multiples of 2-10 of the CTP peptide and are head-to-tail ligations of the monomer form.
  • CTP designates embodiments which contain 2-10 of the approximately 30-mers corresponding to CTP.
  • GnRH gonadotropin releasing factor
  • hormone or “hormone” or “GnRH” refers to the hypothalamus product which is generally believed to effect the release of FSH and LH from the pituitary, as well as to perform other regulatory functions relating to sexual activity, and which is typified by the amino acid sequences determined for various vertebrate species as shown in Figure 2. Where the context clearly so requires, GnRH also refers to the appropriate DNA sequence which encodes the referenced peptide.
  • GnRH refers to a peptide having an amino acid sequence substantially similar to that .represented in Figure 2; however, it is understood that minor modifications of the amino acid sequence may be made without affecting the immunological characteristics of the resulting peptide, and the definition includes these resulting peptides.
  • amino acid additions, deletions, and alterations can be made so long as they do not negatively affect the ability of the resulting peptide to elicit neutralizing antibodies against GnRH itself.
  • modifications include, but are not limited to, replacing the pyroglutamic acid residue at position 1 of the human sequence by glutamine, and addition of a glutamine residue at the C-terminus of the monomer or multimer.
  • Multimers of GnRH which comprise repeated sequences of the particular GnRH peptide employed. These multimers may consist of multiples of 2-10 of the GnRH peptide and are head-to-tail ligations of the monomer form. Thus GnRH . where n is 2-10, designates embodiments which contain 2-10 of the decamer corresponding to GnRH.
  • the multimers may contain an additional C-terminal amino acid, as is the case in the illustration below.
  • human LH or hLH
  • bovine LH or bLH
  • dog LH or dLH
  • the bLH, dLH, and hLH antigens used in the invention have the amino acid sequences shown in Figures 3a, 3b, and 4, or significant portions thereof. Where the context clearly so requires, b-, d-, or hLH also refers to the appropriate DNA sequences which encode the referenced peptides.
  • bLH refers to a peptide having an amino acid sequence or portion substantially similar to that represented in Figure 3a (dLH to that of Figure 3b; hLH to that of Figure 4); however, it is understood that minor modifications of the amino acid sequence may be made without affecting the immunological characteristics of the resulting peptide, and the definition includes these resulting peptides.
  • amino acid additions, deletions, and alterations can be made so long as they do not negatively affect the ability of the resulting peptide to elicit neutralizing antibodies against the appropriate LH itself.
  • multimers of the bovine, dog, and human LH which comprise repeated sequences of the particular LH peptide employed. These multimers may consist of multiples of a signifi-cant portion of the appropriate LH sequence, such as, for example, the amino acids represented by residues
  • bLHn designates embodiments which contain 2-10 of the peptide representing residues 22-85 of the bLH sequence, or its functional equivalent
  • dLH and hLH designate the corresponding multimers of the sequence of amino acids 43-115 of dog LH and 2-111 of hLH, respectively or their functional equivalents.
  • Hamonen refers to a monomer (if n is 1) or multimer of the appropriate portion of any particular hormone.
  • Autoantigen refers to a protein or portion thereof which is normally present in the targeted host, at least intermittently, and which normally does not elicit an immune response from the host. Such autoantigens may ordinarily be made immunogenic only by using them as a hapten through conjugation to a suitable carrier.
  • the carrier may simply be an extension of the amino acid chain; indeed, the extension may simply be reproduction of the autoantigen in multiple units.
  • the immunogenicity presumably results from the unfamiliar junction regions in this case.
  • immunogenicity results from the junction regions when the autoantigen is linked to sequences which serve a secondary function, such as providing antigenic epitopes themselves, or serving carrier functions.
  • a portion of an immunologically privileged protein may, itself be immunogenic.
  • autoantigen is used both to refer to the unaltered protein desired to be made immunogenic and to the autoantigen of interest in the immunogenic construct.
  • Non-bacterial carrier refers to a carrier protein which confers immunogenicity on an epitope of the indigenous protein by virtue of enhancing the size of the peptide and/or providing junction regions which contain amino acid sequences foreign to the host.
  • the additional sequence may be any protein of non-bacterial origin, may include viral coat or core proteins, secreted yeast proteins, such as invertase, which have no homologous counterparts, in mammals, and membrane bound and secreted proteins from protozoa, such as malaria.
  • Particularly useful carrier proteins are those derived from influenza hemagglutinin.
  • derived from means that the amino acid sequence is the same as that for a portion containing at least 10 amino acids of the sequence of the source protein, and, of course, is not meant to mean physically obtained from that protein per se.
  • Useful sequences derived from the hemagglutinin protein include portions of the antigenic regions and of the membrane anchor region of this protein.
  • “Secondary carrier” refers to a protein which is capable of transporting the autoantigen such as CTP or LH or its multimer to the surface of a cell infected with vaccinia virus containing the DNA encoding both the secondary carrier and the CTP or LH or its multimer, or of effecting the secretion of CTP or LH or its multimer from the infected cell.
  • the vaccinia virus per se is generally referred to herein as a "carrier” for foreign sequences included in its genome.
  • foreign DNAs additional to the DNA encoding autoantigen, such as CTP or LH or its multimer may encode proteins which are secondary carriers for the im unogen.
  • influenza hemagglutinin protein is representative of secondary carriers useful in this regard.
  • proteins which are known to be transported tp the surface of infected cells may also be used.
  • proteins include the neuraminidase peptide of influenza, rabies glycoprotein, and herpes simplex virus (HSV) glycoprotein D.
  • Signal sequences operable in infected cells may be derived from a variety of sources including preprorenin. preproinsulin, preprorennin, and bacterial alkaline phosphatase.
  • An alternate method of secreting antigen utilizes the pre-S gene of hepatitis.
  • the gene encoding the desired antigen is cloned into the pre-S gene, resulting in secretion of the chimeric protein, which naturally aggregates to form an empty hepatitis virus coat (Valenzuela, et al. Vaccines 85: Molecular and Chemical Basis of Resistance to Parasitic. Bacterial, and Viral Diseases. New York. Cold Spring Harbor Press, 1985, pp. 285-290).
  • "Operably linked” refers to juxtaposition so that the functionality of the elements is preserved.
  • promoters operably linked to coding sequences permit their expressions in suitable hosts.
  • Signal sequences operably linked to other peptides or, at the DNA level, signal sequence encoding DNA operably linked to peptide encoding DNAs) permit the secretion of the subject peptide from the host cell.
  • a DNA encoding a signal sequence which is derived from influenza hemagglutinin refers to a DNA constructed so as to encode a peptide sequence substantially similar to that which is found in influenza HA, and that sequence may be constructed by, for example, obtaining cDNA from the HA protein, by synthetic methods using,automated oligonucleotide synthesis, or in any other manner designed to recreate a coding sequence for the desired peptide.
  • the desired immunogen is transferred into a nonessential portion of the vaccinia genome by coinfecting host cells with both native vaccinia and a carrier plasmid which contains the foreign gene sandwiched between sequences homologous with the selected nonessential portion of the vaccinia genome.
  • the foreign gene is provided with a vaccinia promoter, which will permit its expression under the influence of the vaccinia transcription and translation systems.
  • a general purpose vector capable of housing the foreign gene has been disclosed by Moss.
  • pGS20 has a vector fragment derived from PBR328, a vector compatible with E. coli which contains the E. coli origin of replication and the ampicillin resistance gene.
  • the vector contains the promoter from the 7.5 k gene of vaccinia, excised as a 275 bp HincII/Rsal fragment (Venkatsen, et al.
  • TK vaccinia thymidine kinase
  • pGS20 is constructed as follows: pBR328 is digested with EcoRI, blunted, and religated. The resulting vector is then digested with Hindlll and ligated to the Hindlll J fragment of vaccinia. The resulting plasmid is digested with BamHI and Bglll and religated, thus eliminating the non-TK sequences, along with some unnecessary vector sequences from the insert, as well as eliminating the BamHI and Bglll sites.
  • the vector is completed by inserting the HincII/Rsal 7.5 kD gene promoter fragment into the Smal site of pUC8, excising the promoter as an EcoRI/BamHI fragment, and ligating it with the isolated EcoRI/Smal/BamHI linker fragment from pUC8 into EcoRI-digested vaccinia vector.
  • Figure 13 also shows the nucleotide sequence in the region of the promoter/restriction site fragment junction for the CTP multimer embodiment.
  • the DNA encoding the desired immunogen is inserted into pGS20 using the restriction sites downstream of the promoter, as shown.
  • the recombination vector is amplified in E. coli using transformation to Amp and then coinfected along with wild-type vaccinia into CV-1 cells.
  • vaccinia transcribes and replicates its genome in the cytoplasm of infected cells.
  • Many of the enzymes involved in its nucleic acid metabolism, such as DNA and RNA polymerases, enzymes to cap, methylate, and polyadenylate RNA, as well as thymidine kinase, are encoded in its own genome.
  • protein-free vaccinia is noninfective—since it encodes its own transcriptase and apparently cannot,use the transcriptase used by its eukaryotic host, it cannot synthesize required proteins using its DNA alone in combination with the host cell machinery.
  • TK-encoding sequences to effect recombination is particularly desirable, as not only is this a nonessential portion of the vaccinia genome, but a selectable marker is provided for cells containing the recombined vaccinia—i.e., when the foreign DNA is inserted, the TK gene is inactivated, and the tk- recombinant viruses can be selected by plaque assay on tk- cells in the presence of 5-bromodeoxyuridine
  • tk- recombinant virus plaques can be selected yielding the desired recombinant vaccinia. Additionally, tk- vaccinia have been shown to
  • 5 6 be 10 to 10 times less virulent in animals as compared to wild-type vaccinia, indicating the potential for an increased safety factor in humans.
  • pGS20 is a convenient illustrative vector, it is understood that alternative constructions involving other vaccinia promoters in other nonessential regions of the gene may be used (Moss, et al. Gene
  • the recombined vaccinia can also be administered as a killed vaccine.
  • Subject cells in tissue culture are infected with vaccinia in vitro, and then heat-killed.
  • the attenuated, killed vaccinia are then administered with an adjuvant as are conventional vaccines.
  • the autoantigenic constructions of the invention need not necessarily be administered as vaccinia borne DNA encoding them. They may also be produced as proteins using standard means of recombinant protein production and adminstered as conventional vaccines. The choice of route is dependent, of course, on the subject species and on the nature of the antigen.
  • the pGS20 vectors containing the desired autoantigen sequences may be used as expression vectors in vitro by using the transient expression which occurs when susceptible cells transfected with this vector are infected with vaccinia virus.
  • the protein produced may be obtained from the cell lysate or. from the supernatants, depending on whether construction of the vectors results or does not result in secretion.
  • the autoantigens are administered as proteins, they are formulated into conventional dosage forms as injectables, either as solutions, suspensions, emulsions, or solids for reconstitution. Suitable excipients include water, saline, dextrose solution, glycerol solution. Hank's solution.
  • the peptides representing the non-homologous regions of LH. are typically linked to carrier proteins, either at the protein or DNA level. Techniques for ligation at the DNA level are standard: mediation of the reaction using an appropriate ligase is used, as described below.
  • carrier protein in this case is an antigenically neutral peptide appropriate to the species, such as. for example. BSA for use in cattle, or HSA or tetanus toxoid for use in , humans.
  • the vaccines of the invention are successful in raising antibodies which recognize epitopes associated with important regulators of metabolism, they prpovide a useful means to obtain components of immunoassays for such antigenic species.
  • antibody preparations obtained as a result of immunization with the vaccines provided.
  • the antibody preparations may be obtained directly from the antisera as polyclonal preparations, or the peripheral blood cells or spleen cells from an immunized mammal may be used as fusion partners and monoclonal immunoglobulin producing hybridomas obtained.
  • the invention therefore includes the Fab regions of the antibodies produced.
  • the antibody or Fab portion can be labeled or attached to solid support, or otherwise modified as is understood in the art in preparation for use in the assays.
  • Plasmid DNA sequences, or synthesized oligonucleotides are cleaved, tailored, and religated in the form desired.
  • Site specific DNA cleavage is performed by treating with the suitable restriction enzyme (or enzymes) under conditions which are generally understood in the art, and the particulars of which are specified by the manufacturer of these commercially available restriction enzymes. See, e.g.. New England Biolabs, Product Catalog.
  • suitable restriction enzyme or enzymes
  • about 1 ⁇ g of plasmid or DNA sequence is cleaved by one unit of enzyme in about 20 ⁇ l of buffer solution; in the examples herein, typically, an excess of restriction enzyme is used to insure complete digestion of the DNA substrate. Incubation times of about one hour to two hours at about 37°C are workable, although variations can be tolerated.
  • protein is removed by extraction with phenol/chloroform, and may be followed by ether extraction, and the nucleic acid recovered from aqueous. fractions by precipitation with ethanol.
  • size separation of the cleaved fragments may be performed by polyacylamide gel or agarose gel electrophoresis using standard techniques. A general description of size separations is found in Methods in Enzvmology (1980) 65:499-560.
  • Restriction cleaved fragments may be blunt ended by treating with the large fragment of E. coli DNA polymerase I (Klenow) in the presenpe of the four deoxynucleotide triphosphates (dNTPs) using incubation times of about 15 to 25 min at 20 to 25°C in 50 mM Tris pH 7.6. 50 mM NaCl, 6 mM MgCl , 6 mM DTT and 1 mM dNTPs. The Klenow fragment fills in at 5' sticky ends but chews back protruding 3' single strands, even though the four dNTPs are present.
  • E. coli DNA polymerase I Klenow
  • dNTPs deoxynucleotide triphosphates
  • selective repair can be performed by supplying only one of the, or ' selected, dNTPs within the limitations dictated by the nature of the sticky ends. After treatment with Klenow, the mixture is extracted with phenol/chloroform and ethanol precipitated. Treatment under appropriate conditions with SI nuclease or mung bean nuclease results in hydrolysis of any single-stranded portion.
  • Synthetic oligonucleotides are prepared by the method of Efimov, V. A., et al (Nucleic Acids Res (1982) 6875-6894), and.can be prepared using commercially available automated oligonucleotide synthesizers.
  • kinasing of single strands prior to annealing or for labeling is achieved using an excess, e.g., approximately 10 units of polynucleotide kinase to 1 nmole substrate in the presence of 50 mM Tris, pH 7.6, 10 mM MgCl , 5 mM dithiothreitol, 1-2 mM ATP, 1.7 pmoles ⁇ 32P-ATP (2.9 mCi/mmole), 0.1 mM spermidine, 0.1 mM EDTA.
  • an excess e.g., approximately 10 units of polynucleotide kinase to 1 nmole substrate in the presence of 50 mM Tris, pH 7.6, 10 mM MgCl , 5 mM dithiothreitol, 1-2 mM ATP, 1.7 pmoles ⁇ 32P-ATP (2.9 mCi/mmole), 0.1 mM spermidine, 0.1
  • Ligations are performed in 15-50 ⁇ l volumes under the following standard conditions and temperatures: 20 mM Tris-HCl, pH 7.5, 10 mM MgCl., 10 mM DTT, 33 ⁇ g/ml BSA. 10 mM-50 mM NaCl. and either 40 ⁇ M ATP. 0.01-0.02 (Weiss) units T4 DNA ligase at 0°C
  • vector fragment In vector constructions employing "vector fragments", the vector fragment is commonly treated with .bacterial alkaline phosphatase (BAP) or calf intestinal alkaline phosphatase (CIP) in order to remove the 5' phosphate and prevent religation of the vector.
  • BAP .bacterial alkaline phosphatase
  • CIP calf intestinal alkaline phosphatase
  • site specific primer directed mutagenesis is used. This is conducted using a primer synthetic oligonucleotide complementary to a single stranded phage DNA to be mutagenized except for limited mismatching, representing the desired mutation. Briefly, the synthetic oligonucleotide is used as a primer to direct synthesis of a strand complementary to the phage, and the resulting double-stranded DNA is transformed into a phage-supporting host bacterium. Cultures of the transformed bacteria are plated in top agar. permitting plaque formation from single cells which harbor the phage.
  • 50% of the new plaques will contain the phage having, as a single strand, the mutated form; 50% will have the original sequence.
  • the resulting plaques are hybridized with kinased synthetic primer and then washed at a temperature which permits hybrids of an exact match to remain, but at which the mismatches with the original strand are washed off. Plaques which remain hybridized to the probe at the stringent wash temperature are then picked, cultured, and the DNA recovered. Details of site specific mutation procedures are described below in specific examples.
  • plaques are screened by replicating the plaques onto duplicate nitrocellulose filter papers (S & S type BA-85) and infected cells are allowed to grow at 37°C for 14-16 hr on L agar containing 15 ⁇ g/ml tetracycline.
  • the colonies are lysed with 10% SDS and the DNA is fixed to the filter by sequential treatment for 5 min with 500 mM NaOH/1.5 M NaCl, then 0.5 M Tris HCl(pH 8.0)/1.5 M NaCl followed by 2 x standard saline citrate (SSC). Filters are air dried and baked at 80°C for 2 hr.
  • the duplicate filters are prehybridized at 42°C for 2-8 hr with 10 ml per filter of oligo-hybridization buffer (6 x SSC. 0.1% SDS. 1 mM EDTA. 5x Denhardt's. 0.05% sodium pyrophosphate and 50 ⁇ g/ml denatured and sheared salmon sperm DNA).
  • the samples are hybridized with kinased 5 oligonucleotide probes of 15-30 nucleotides under conditions which depend on the composition of the oligonucleotide. Typical conditions employ a temperature of 30-42°C for 24-36 hr with 5 ml/filter of this same oligo-hybridization buffer containing probe. ° The filters are washed two times for 15 min at 23°C, each time with 6 x SSC, 0.1% SDS and 50 mM sodium phosphate buffer at pH 7, then are washed once for 2 min at the stringent wash temperature with 6 x SSC and 0.1% SDS.
  • the stringent wash temperature for 5 oligonuceotides of 16-24 bases with from 1 to 3 mismatches will be 40-70°C, and can most easily be determined by successive washes of the hybridized filter.
  • the hybridized filters can be washed first at 40°C, then at 50°C, then at 60°C, and 0 then at 70°C, with air drying of the filter and autoradiography at -70°C overnight between each wash.
  • E. coli strain MC1061 was used for cloning and sequencing, and for expression of construction under control of most bacterial promoters.
  • E. coli strains susceptible to phage infection such as E.- coli strain JM101 are employed.
  • the monkey cell line. CV-1 is used for eucaryotic expression.
  • procaryotic and eucaryotic systems may be used to express the autoantigen encoding sequences; procaryotic hosts are, of course, the most convenient for cloning procedures. Procaryotes most frequently are represented by various strains of E. coli; however, other icrobial strains may also be used. Plasmid vectors which contain replication sites, selectable markers and control sequences derived from a species
  • E. coli is typically transformed using derivatives of pBR322, a plasmid derived from an E. coli species by Bolivar, et al. Gene (1977) 1:95.
  • pBR322 contains genes for ampicillin and tetracycline resistance, and thus provides multiple selectable markers which can be either retained or destroyed in constructing the desired vector.
  • Commonly used procaryotic control sequences which are defined herein to include promoters for transcription initiation, optionally with an operator, along with ribosome binding site sequences, include such commonly used promoters as the ⁇ -lactamase (penicillinase) and lactose (lac) promoter systems (Chang, et al.
  • eucaryotic microbes such as yeast, may also be used as hosts.
  • Laboratory strains of Saccharomyces cerevisiae. Baker's yeast are most used although a number of other strains or species are commonly available.
  • control sequences for yeast vectors include promoters for the synthesis of glycolytic enzymes (Hess, et al, J Adv Enzyme Reg (1968) 2 : 1 49 - Holland, et al. Biochemistry (1978) 37:4900) . Additional promoters known in the art include the promoter for 3-phosphoglycerate kinase (Hitzeman, et al, J Biol Chem
  • transcription controlled by growth conditions and/or genetic background are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, the alpha factor system and enzymes responsible for maltose and galactose utilization. It is also believed terminator sequences 5 are desirable at the 3' end of the coding sequences. - Such terminators are found in the 3' untranslated region following the coding sequences in yeast-derived genes.
  • Expression vectors for such cells ordinarily include promoters and control sequences compatible with • • mammalian cells such as, for example, the commonly used early and late promoters from Simian Virus 40 (SV 40) 0 (Fiers, et al. Nature (1978) 273:113) , or other viral promoters such as those derived from polyoma, Adenovirus 2. bovine papilloma virus, or avian sarcoma viruses.
  • the controllable promoter, hMTII Kerin, M. , et al. Nature (1982) 299:797-802
  • General 5 aspects of mammalian cell host system transformations have been described by Axel (supra).
  • Enhancer regions are important in optimizing expression; these are, generally, sequences found upstream or downstream of the promoter region in 0 non-coding DNA regions. Origins of replication may be obtained, if needed, from viral sources. However, integration into the chromosome is a common mechanism for DNA replication in eucaryotes. Depending on the host cell used, transformation is done using standard techniques appropriate to such cells. The calcium treatment employing calcium chloride, as described by Cohen. S.N., Proc Natl Acad 5 Sci (USA) (1972) 69.:2110. or the RbCl method described in Maniatis. et al. Molecular Cloning: A Laboratory Manual (1982) Cold Spring Harbor Press, p.
  • RNA may be prepared from the- corresponding gland, such as the pituitary for LH, in a 5 previously uninvestigated species, for example, rabbit, and a cDNA library prepared and probed. Effective techniques for extraction for mRNA are known in the art and generally employ affinity chromatography with oligo dT to obtain polyadenylated messenger RNA. The RNA is 0 then used to obtain a cDNA library, for example, by cloning into the phage vector ⁇ gtlO (Hunyh, T.V.
  • cDNA can then be probed with denatured DNA sequences derived from the hormone sequences disclosed herein, for example, bovine LH ⁇ chain or the dog LH sequence.
  • A. CTP Multimers The construction of the desired genes is shown in Figure 1. The major portion of the gene is isolated as the BstN ⁇ /Sau3A fragment encoding amino acids 117-141 (Fiddes. J.C., et al. Nature (1980) 286:684-687). The 5' end and 3' end of the gene are synthesized chemically i order to provide desired overhang for polymerization, and, if desired, codon alteration. For all of the CTP fragments illustrated, the middle portion and C-terminal portions are identical; differences, however, occur in the upstream segment, depending on whether the native sequence is used or that altered in the 110 position.
  • the three pertinent fragments are ligated to obtain the ⁇ -hCG CTP monomer and the desired product is isolated using polyacrylamide gels.
  • the desired CTPn constructs are blunt-ended using Klenow and the appropriate dNTPs and either amplifled in E. coli using intermediate vectors (Example 3) before direct recombination into vaccinia or are cloned into secondary carrier protein-encoding sequences before amplification in E. coli and subsequent recombination into vaccinia.
  • the DNA sequences of the desired genes are shown in Figure 2.
  • the double stranded potion encoding the monomer is obtained by annealing the two complementary strands, which strands are synthesized employing standard automated techniques.
  • the monomer is isolated on a gel. and confirmed to be of the correct size.
  • Multimers are obtained by self-polymerization and separation of the various multimers on gels, e.g., the
  • the desired GnRHn constructs are blunt-ended using Klenow and the appropriate dNTPs and either amplified in E. coli using intermediate vectors (Example 3) before direct recombination into vaccinia or cloned into secondary carrier protein-encoding sequences before amplification in E. coli and subsequent recombination into vaccinia.
  • the cDNA inserts are then transferred from the lambda phage vectors to the EcoRI site of pBR322 «to obtain the cloning vectors phLH and pbLH for the human and bovine forms of the protein, respectively.
  • cDNA encoding the ⁇ peptides of dog LH was obtained from a ⁇ gtl0 cDNA library prepared using dog pituitary mRNA as template.
  • the library was probed with the same Hindlll HCG ⁇ peptide described above, and a single clone containing the coding sequence from amino acid 18 to the stop codon after amino acid 121 was retrieved.
  • This clone in combination with another similarly retrieved from the library, permitted deduction of the entire amino acid sequence for dog ⁇ LH, as well as the 18 residue signal sequence preceding the N-terrainal serine residue of the mature protein.
  • the complete cDNA sequence encoding the mature protein and its signal peptide, along with the deduced amino acid sequence is shown in Figure 3b.
  • the single clone containing the sequence encoding amino acids 18-121 was retrieved under hybridization conditions which include 30% formamide at 42° followed by washing 2 times at 50°C in 2XSSC.
  • the EcoRI insert in the ⁇ gtlO clone was then moved into the EcoRI site of pBR322 to obtain the cloning vector pdLH for the dog protein.
  • the cDNA encoding the cat protein is prepared from ca pituitary mRNA and cloned into pBR322 to obtain pcLH.
  • the multimers are prepared directly in the vectors.
  • a repeating sequence encoding amino acids 22-85 is inserted into the full length sequence in pbLH by repeatedly inserting the 192 bp fragment obtained by Haelll digestion of pbLH into the Stul site which coincides with the Haelll site at the codon for amino acid 22 (see Figure 3). While the blunt ended Haelll fragment can be inserted in two possible orientations, the correct construction is distinguishable by restriction analysis, as it produces an EcoRI/StuI digestion fragment 192 bp shorter than the incorrect construction. The Haelll fragment insertion is repeated for the desired number of (n-1) times, resulting in the 22-85 region peptide repeated n times (the Stul digested vector provides the additional repeat). Preferred values for n are 3-10.
  • the EcoRI insert of phLH is first transferred to the EcoRI site of M13mp8 for site specific mutagenesis to provide an Maelll site at amino acids 1-2 to complement that already present in the cDNA bridging the codons for amino acids 111-112.
  • Maelll is obtained by the purification procedure of schraid, K. , et al. Nucleic Acids Res (1985)).
  • the primer is CCGTAGGTCACTGGGCGAAGCC as shown in Figure 4.
  • the single stranded mutagenized phage is then hybridized to universal primer, extended with Klenow and the four dNTPs (30 minutes at room temperature), and cleaved with Maelll to obtain the desired fragment extending between the new Maelll site at codons 1-2 of the mature sequence and the naturally occuring Maelll site at 111-112. This fragment is ligated by self polymerization in a manner analogous to that described
  • the dog multimer is constructed using the cDNA region between codon 43 (a Rsal site) and codon 115 (a Smal site).
  • the multimer is prepared by repeatedly inserting the blunt Rsal/Sraal fragment into Smal cleaved pdLH and its resultants. Insertion of the Rsal/Smal fragment into the Smal site of pdLH, when in the correct orientation, destroys the Rsal site of the insert and recreates the Smal site at the 3' end, thus permitting the repetitive insertion.
  • the multimerized region can then be released by digestion with Rsal/Smal as the only Smal site remaining is at the 3' end of the multimerized region.
  • the relevant portions of the junction regions are shown in Figure 3b. As above, preferred values of n are 3-10.
  • Figure 5 shows the construction of the cloning vector pVAl derived from pKK223-3 (Brosius. J., et al, Proc Natl Acad Sci (USA) (1984) 81:6929-6933). Construction of pVA2. derived from pKT19 and pKT41 (Talmadge, K., et al. Gene (1980) 11:235-241). is also shown in Figure 5.
  • the resulting cloning vectors ideally should lack Ndel and Ball sites to permit those contained in the NoPst/R oligomer to be used uniquely for subsequent insertion of the desired coding sequences; as Ball is a troublesome enzyme, the alternate upstream sites in the NoPst/R insert, the Ncol and BamHI sites, can be used in its place.
  • the cloning vector also must carry markers, such as those conferring antibiotic resistance, as well as, preferably, a high copy number origin of replication. Two such vectors were constructed, pVAl, which fits the foregoing criteria but contains a Hindi restriction site in the Amp gene, and pVA2.
  • pKK223-3 is first treated to remove unneeded DNA sequences and to remove an extraneous PvuII site.
  • pKK223-3 is digested with EcoRI and PvuII, blunt-ended with Klenow, and then religated to generate pALl.
  • pALl a 2.6 kb plasmid with the required origin of replication and the Amp gene.
  • pALl is then treated with EcoRI and PstI and ligated to the NoPst/R oligomer to obtain pVAl-,
  • pKT19 and pKT41 were digested with EcoRI and SphI, and the small pKT19 fragment isolated from a polyacrylaraide gel was ligated to the large pKT41 fragment, also isolated from a 1% agarose gel, to obtain pKT1941...
  • pKT1941 was digested with PvuII, ligated to a Kpnl linker, cleaved with Kpnl, and the religated to eliminate the PvuII site, creating pKT1941.1.
  • the Ball and Ndel sites present in pKT1941.1 were eliminated in a two step procedure, the first step comprising digestion with Ndel, blunting with Klenow.
  • the synthetic polymerized multimers described in Example IA are blunted and ligated into the Ncol(repair)/Ndel(repair) digested vectors.
  • suitable forms of the multimers can be inserted into the Ncol(blunt)/Ndel(blunt) vectors to provide, for example, pVAl/hLH and pVA2/bLH .
  • a n n properly placed Ncol site is needed, as shown in Figures 3 and 4. to place the upstream portion in reading frame with the start codon provided by the repaired Ncol from the vector.
  • the multimer inserts are therefore removed from pbLH and phLH multimer-containing vectors by EcoRI digestion and placed into the EcoRI site of M13mp8 for site specific mutagenesis. the replicative forms obtained, and the Ncol(single strand removed)/EcoRI(blunt) fragments removed for insertion into pVAl or pVA2.
  • the above vectors can be referred to generically as pVA/Hormone.
  • the hormone monomers or multimers, preceded by an ATG start codon obtained by repair of the Ncol site and terminated by the termination codons provided in the NoPst/R fragment are transferred to pGS20 as a BamHI/Smal fragment.
  • Transient recombinant expression may be obtained using cells transfected with the pGS20 derivative and infected with vaccinia, or the vaccinia recombinants from these cells may be used directly as vaccines.
  • the monomer or multimer hormone fragments may be ligated into vectors carrying the coding sequences for other proteins, as described below.
  • Example 4 Preparation of Derivative Vectors Containing HA
  • pHAl is used for insertion of the multimeric sequences into the mutagenized antigenic sites of the HA gene. As described below, it is provided with blunt ' end-resulting cleavage sites in the antigenic regions by site directed mutagenesis. In the constructions for GnRH and CTP, which are described in detail, these sites are located between codons. so that the reading frame for these multimers, which also terminates at codon boundaries, is maintained.
  • pHA2 permits insertion using native restriction sites to ligate these multimers to the membrane anchor and signal sequences, the restriction sites also provide blunt-end termination at codon boundaries.
  • pHA3 permits use of the EcoRI sites in the HA gene for ligation of the LH sequences, which have an extra bp beyond the codon boundary at either end. The construction of pHAl and pHA2 is shown in
  • FIG. 6 The HA gene from pSVL-HA8 or pSVE-HA3 (Gething, M.J.. Nature (1981) 293:620-625) was excised using HindiII/BamHI digestion. The resulting fragment contains the entire gene. A map of the HA gene is shown in Figure 7.
  • the HA gene fragment was ligated into Hindlll/Bglll digested pW6. a modified pBR322 which retains Amp , but which contains a linker providing the desired restriction sites in the region of the deleted Tet resistance gene.
  • pW6 pBR322 was digested with EcoRI and Nrul and ligated with an EcoRI/blunt synthetic oligonucleotide, designated herein R/NoNru, and shown in the Figure, which contains BamHI, Hindlll, Bglll, and Smal sites.
  • the pHAl vector therefore contains the entire HA gene framed by BamHI and Smal sites.
  • THe HA gene from pHAl is excised as a BamHI/Ndel fragment, which contains all of the gene except the codon 611 and the stop codon; the stop codon in pHA2 is provided by the downstream portion of the NoPst/R oligomer of pVA2.
  • the pHA3 vector is prepared from pHA2 by disgesting with EcoRI, blunting, and religating to eliminate the EcoRI site of the linker before insertion of the HA gene as above.
  • the pHAl cloning vector containing the HA gene can be conveniently modified to receive the in-frame multimer fragments by creating the restriction sites shown below, except for the Hpal site, in the A and B antigenic regions.
  • pHA2 can be modified to provide the Hpal site. This is accomplished through site-specific mutagenesis using the site-specific primers: 5'-GTGTCTGGTAGGCCTTCATTTTTC-3' , which provides a Stul site between codons 139 and 140 in the A antigenic regions, as shown (HA/Stu);
  • the mutagenesis is conducted by excising the BamHI/Smal insert from pHAl or pHA2, ligating the insert into BamHI/Smal-digested M13mp8 for the mutagenesis, then religating the altered phage inserts into the original vectors.
  • the exemplified restriction sites above are designed to provide for in-frame insertion of the CTP and GnRH multimers prepared as described herein.
  • HA proteins are carried to the surface of the infected cell, expression of the chimeras recombined into vaccinia results in exposure of these epitopes at cell surfaces.
  • the HA gene insert has a blunt-end generating Hindi (Sail) restriction site between codons 16 and 17 and a blunt-end generating PvuII restriction site between codons 450 and 451. Cleavage of the HA gene with Hindi (Sail) and PvuII excises the major portion of the HA protein and permits insertion of the hormone derived monomer and multimers between the signal sequence and the membrane anchor.
  • the HA gene as inserted into pHA2 or pHA3 is used, as this vector does not contain interfering restriction sites.
  • the preparation of the analogous vectors containing the LH sequences is as follows.
  • bovine LH pHA3 is digested with EcoRI which cuts at codons 226-227 and 394-395 of the HA gene and upon blunting leaves a two base pair extension beyond the codon boundary at either end.
  • the bovine LH sequence containing, if desired, the multimeric forms is digested with Ddel which cuts between codons 18 and 19 and between 86 and 87 as shown in Figure 3 and which leaves an additional base pair extending beyond the codon boundary at either end. Therefore, ligation of the bLH sequences into the vector prepared as above places the bLH coding sequences into reading frame with those of the HA gene.
  • pHA2 is digested with Hindi (see Figure 7) which cleaves between codons 16 and 17 at the codon boundary and in codon 208 to leave one base pair extending beyond the codon boundary of codon 209.
  • Hindi see Figure 7
  • This permits ligation of the human monomeric or multimeric ⁇ LH DNA which is excised from the cloning vector by digestion with Ncol and Stul to obtain the portion spanning codon 1 through all but the last base pair of codon 115. This places the human ⁇ LH cDNA in reading frame with the HA sequences.
  • the multimerized fragment from the pBR322 based vector of Example I is removed as a Rsal/Smal blunted fragment and ligated into pHA2, which has been digested with Sail, blunted and then digested with Hindi.
  • the relevant junction regions are:
  • Chimeras for Secretion of Hormone Immunogen Using HA Signal Vectors providing for secretion may be constructed in three ways.
  • the vectors constructed in Example 5, which contain hormone antigen in the antigenic regions of the HA carrier (Stu, Nru, Hpa. RV) can be further modified to delete the membrane anchor portion of the HA protein by using site-specific mutagenesis for deletion of the codons downstream of codon 514.
  • an Ndel/PvuII fragment between codons 451 and 510 may be deleted using restriction cleavage and religation for those vectors derived from pHA2.
  • Third, a portion of HA lacking the membrane anchor can be used. in the first approach, illustrated in Figure
  • vectors containing the monomer or multimer derived from pHA2 in Example 5 may be digested with PvuII and PstI to delete the desired
  • Still another anchor-minus vector is 5 constructed from an anchor-minus form of the HA gene from pSVEH20-A (Gething, M.J., et al.- Nature (1982) 300:598-603) as the carrier protein, as shown in Figure 10c.
  • the HA minus anchor portion is obtained as a BamHI/Ndel fragment for insertion into pVA2 by 0 converting the downstream BamHI site in this partial gene to Ndel. This is accomplished by digesting PSVEHA20 with BamHI, treating with Klenow and the four dNTPs, and ligation to an Ndel linker.
  • pVAl/HA is subsequently modified by mutagenesis to accommodate the desired Hormone at the antigenic sites in a manner precisely analogous to that described for pVAl/HA in Example 5.
  • Example 8 Other Intermediate Vectors with Signal Sequences
  • the signal sequences from other proteins may also be used to construct intermediate vectors so that the ultimate recombinant vaccinia carrier will express hormone derived antigen as a secreted protein.
  • a synthetic gene encoding the bacterial alkaline phosphatase (BAP) signal sequence may be used.
  • the construction of intermediate vectors carrying this sequence operably linked to multimer is shown in Figure 11.
  • the gene is synthesized using conventional techniques by construction of a series of complementary oligomers which hybridize to display compatible restriction sites. (ol5-o20) as illustrated in Figure 11.
  • the synthetic gene fragment having a partial Ncol 5' overhang and Hindlll 3' overhang is ligated into a host vector.
  • pSSl which has been digested with Ncol and Hindlll.
  • pSSl is a pBR322 derivative in which the synthetic oligonucleotides ol3 and ol4 shown in Figure 11 are ligated into the BamHI/EcoRI vector fragment of pBR322 to create a series of convenient restriction sites.
  • the resulting vector. pSS2 is digested with Hindlll and blunt-ended with Klenow.
  • pHormone/BAP then contain the hormone antigen in reading frame with the BAP signal sequence and terminated with a reading frame in-frame stop codon and bounded by Smal and BamHI sites provided by the oligomer fragment which had been inserted in pBR322. These intermediate vectors. pHormone/BAP. are then used as sources of the BamHI/Smal insert for transfer into vaccinia.
  • the preprorenin signal sequence linked to the hormone antigen fragment may also be used. This construction is shown in Figure 12. As shown, the pSSl is digested with Hindlll, blunted with Klenow, and phenol extracted, digested with Ncol, and the vector fragment isolated. The blunted hormone antigen is ligated to the vector fragment along with the renin signal sequence. The renin signal sequence is obtained as an Ncol/Rsal signal sequence-bearing fragment excised from pPP14. (pPP14 is extensively described in U.S. Serial No. 719,414. filed 3 April 1985, assigned to the same assignee and incorporated herein by reference; pPP14 carries the preprorenin cDNA insert).
  • the ligation products are the pHormone/renin series, where the renin signal sequence is placed immediately upstream of the hormone antigen encoding gene, and the vector donates an in-frame stop codon (and two unimportant extra amino acids) immediately downstream of the hormone gene.
  • Example 9 Preparation of Vaccinia Recombinants All of the intermediate vectors whose preparation has been described in Examples 3, 5-7, and 8 contain hormone antigen bearing cassettes which can be excised as BamHI/Smal fragments for insertion into pGS20 by digesting the intermediate vectors with BamHI and Smal, isolating the excised fragments on gels, and treating BamHI/Smal-digested pGS20 with a tenfold molar excess of the isolated fragment.
  • the resulting pGS20 derivatives contain the hormone antigen cassette in operable linkage to the vaccinia promoter and bounded by the portions of the TK gene, as shown in Figure 13.
  • recombinant vectors are transfected into cells infected with wild-type vaccinia virus, which was purchased from Wyeth Laboratories, Inc. (Marietta, PA) and plaque purified twice in CV-1 cells.
  • a small aliquot of virus stock (0.1 ml) is diluted with an equal volume of trypsin (0.25 mg/ml) and incubated for 30 min at 37°C with vortexing, followed by sonication to disperse any cell clumps.
  • the virus is diluted to a
  • CV-1 cells are infected in monolayers on 60 mm plates with 1 ml vaccinia virus to give a multiplicity of infection of 0.05 pfu/cell.
  • the virus inoculum is incubated on the cells for 2 hr at 37°C with rocking.
  • the DNA for transformation is prepared as described in Graham, et al. Virology (1973) 52:456; Stow, et al. J Gen Virol (1976) 13:447; and Frost, et al. Virology (1978) 9JL:39. Briefly.
  • plasmid (pGS20 derivative) DNA 5-10 ⁇ g of plasmid (pGS20 derivative) DNA. and 1-2 ⁇ g wild-type vaccinia virus DNA are added to 1 ml to Hepes-buffered saline (0.14 molar NaCl. 5 mM KC1, 1 mM Na phosphate, 0.1% dextrose, 20 mM Hepes. pH 7.05), and 50 ⁇ l of 2.5 molar CaCl is added. The solutions are mixed and left at room temperature for 30 min, and the desired precipitate of DNA forms in this time.
  • the virus inoculum is aspirated from the CV-1 cell layers, and 1 ml of the DNA precipitate is substituted and the layers left at room temperature for 30 min, after which 9 ml prewarmed Eagle's MEM containing 8% FBS is added.
  • the layers are incubated for 3.5 hr at 37°C, before aspirating off the medium and replacing it with 10 ml fresh Eagle's MEM containing 8% FBS.
  • the monolayers are then left at 37°C for 2 days, resulting in the devlopment of vaccinia cytopathic effects.
  • the cells and virus are harvested by scraping, spun down, and resuspended in 0.5 ml Eagle's MEM and " frozen at -20°C.
  • the resuspended virus/cell pellets are freeze-thawed three times by freezing the cells at -20°C for 30 minutes and quickly thawing them at 37°C, followed by sonication for one minute to disperse the virus/cell clumps.
  • the resulting crude virus stock is then inoculated in serial 10-fold dilutions onto 143 cells (Mackett. M. , et al, J Virol (1984) 49.:857-864) . a human tk- cell line.
  • the 143 monolayers are then overlaid with 1% agarose containing 1 x modified Eagle's medium, 5% fetal bovine serum, and 25 ⁇ g/ml 5-bromodeoxyuridine (BUdR) ; After incubation for two days at 37°C, BUdR-resistant plaques are picked and grown for 48 hours at 37°C in 24 well plates of 143 cell monolayers in the presence of 25 ⁇ g/ml BUdR.
  • Virus is harvested and assayed for the presence of the hormone antigen gene by DNA-DNA dot blot hybridization, as follows: cells are scraped from the dish into an Eppendorf centrifuge tube, centrifuged for
  • the baked filter is prehybridized for 1 hour at 42°C in 5 ml 50% formamide, 4 x SSC, 5 x Denhardt's solution, and 0.1 mg/ml sheared and boiled salmon sperm DNA. The filter is then hybridized overnight at 42°C to
  • the probe is prepared by isolating 5 ⁇ g of hCG CTP gene insert from one of the hCG CTP gene intermediate vectors and nick translating the DNA using a commercially available nick translation kit. The filter is then washed twice for 30 minutes in 0.5 x SSC, 0.1% SDS, air dried, and autoradiographed overnight at -70°C.
  • Virus containing desired hormone gene inserts are infected onto monolayers of 143 cells and left until a confluent cytopathic effect is obtained.
  • the culture medium is then aspirated off and the cells lysed in 1% SDS, 0.1 M ⁇ -mercaptoethanol, 50 mM Tris-HCl, pH 7.8..
  • the lysate is made 0.5 mg/ml in proteinase K, incubated 4 hours at 37°C. phenol extracted, ethanol precipitated, and analyzed by restriction enzyme analysis to show that the vaccinia genomes contain the desired genes.
  • Example 10 Bioassay Rabbits are used as subjects to assess the ability of the recombinant vaccinia to raise titers of neutralizing anti-hormone antibodies in serum.
  • the following describes the procedure for CTP encoding vaccines; however, other hormones can be assayed using, for example, GnRH, LH, or FSH in place of CTP.
  • the procedure is analogous, but the antigen component in each assay is the appropriate hormone.
  • Pairs of rabbits are inoculated with wild-type or recombinant virus by intradermal injection of 1-2 x g
  • hCG is iodinated in a 100 ⁇ l reaction by the chloramine T method of Greenwood, F.C., et al (J Bioche (1963) 89:114-123) in a 100 ⁇ l reaction mixture containing 5 ⁇ g hCG, 1 mCi c -* Na125I, 0.1 ⁇ g chloramine T, and 0.1 M NaPO.. pH
  • 125 I-hCG is performed by reverse-phase HPLC on a C, g 0 column.
  • the interstitial cells of rat testis are homogenized in phosphate-buffered saline (PBS) as described in Catt, K.J., et al (J Clin Endocrinol Metab (1974) 14:123-127).
  • PBS phosphate-buffered saline
  • the homogenate is centrifuged at 5 1500 g for 50 min and the pellet resuspended in 10 ml
  • a saturation binding curve is performed by incubating 100 ⁇ l of testis homgenate, 50 ⁇ l of
  • 125 tracer I -hCG (20,000 cpm) in PBS-bovine gamma globulin (1 mg/ml), and 100 ⁇ l of hCG at various 0 concentrations 0.1 to 100 ng/ml in preimmune serum, including a no-hCG control.
  • the receptor-bound tracer is quantified by filtration through albumin-soaked 0.45 ⁇ cellulose membranes and counted in a Beckman Gamma 5000 gamma 5 counter. The concentration of hCG that results in 80% binding to the testis homogenate is then used with the labeled tracer in subsequent assays.
  • Sera are tested for neutralizing activity by incubation with 100 ⁇ l testis homogenate, 50 ⁇ l of tracer I 125-hCG (20,000 0 cpm) in PBS-bovine gamma globulin (1 mg/ml), 50 ⁇ l of hCG at the concentration determined in the saturation binding assay above, and 50 ⁇ l of sera diluted from 100 ⁇ l testis homogenate, 50 ⁇ l of tracer I 125-hCG (20,000 0 cpm) in PBS-bovine gamma globulin (1 mg/ml), 50 ⁇ l of hCG at the concentration determined in the saturation binding assay above, and 50 ⁇ l of sera diluted from
  • the titer of neutralizing activity is the dilution of serum that inhibits 50% of the binding in this assay.
  • the titer of sera from animals that have low-level immunoneutralization responses will be 1:5 to 1:50.
  • moderate responders will have sera with titers of 1:50 to 1:250, and strong responders will have sera with titers of greater than 1:1000.
  • Recombinant vaccinia directing the expression of intracellular hCG antigens are more likely to produce low responses, and various secreted and membrane-bound antigens are more likely to produce moderate and strong responses.
  • An alternate assay based on the change in weight of rat uterus can also be used.
  • the recombinant vaccinia which produce moderate to strong immunoneutralization responses in rabbits or show positive responses in the rat uterus weight assay will be tested for fertility control in baboons or rhesus monkeys.
  • the recombinant viruses that produce strong responses in rabbits will confer protection for longer periods of time, up to 3-5 years or more in humans, and the recombinant viruses that produce moderate responses in rabbits will protect fo'r a shorter period of time, from 6 months to 3 years in humans.
  • Example 11 Preparation of Peptide Vaccines
  • the coding sequences for the autoantigens described above may also be expressed using conventional recombinant techniques, and the resulting peptides used as conventional vaccines.
  • the constructions in pGS20 which have been described in detail can be transiently expressed in CV-1 monkey cells using vaccinia virus coinfection, in the procedure of Cochran, M.A.. et al. Proc Natl Acad Sci USA (1985) H:19-23. Briefly, the CV-1 cells are infected with vaccinia at a oi of 30. and then transfected using calcium phosphate precipitation with the autoantigen-containing pGS20. The cells are harvested 12-48 hours after transfection. and the autoantigen recovered. If the autoantigen is membrane bound, the cells are solubilized; if sereted, the autoantigen is recovered from the medium.
  • coding sequences for the hormones are placed under control of conventional control sequences in expression vectors.
  • a particularly useful host vector is pKT52.
  • pKT52 contains the "trc" promoter followed by an ATG and is constructed as follows below.
  • the "trc" promoter contains the upstream portions of the trp promoter and the downstream, operator-containing, regions of the lac promoter.
  • pKT52 To prepare pKT52, pKK233-2 (Araann, E., et al. Gene (1985) 40.:183-190) was digested with EcoRI and PvuII,- filled in with dATP and dTTP, and religated to obtain the correct construction pKT52.
  • pKT52 contains the desired trc promoter, a downstream ATG start codon, and downstream Ncol, PstI and Hindlll sites.
  • the autoantigen containing cassette can be excised from any of the vectors set forth above and inserted into Ncol/Hindlll digested pKT52.
  • pMT plasminogen activator-binding protein
  • EcoRI site a convenient EcoRI site
  • pMT-Apo a convenient EcoRI site
  • the host vector, pMT contains the raetallot ionein II (hMTII) control sequences, as described by Karin, M. , et al. Nature (1982)
  • Plasmid 84H (Karin, M.. et al (supra)) which carries the hMTII gene was digested, to completion with BamHI, treated with exonuclease Bal-31 to remove terminal nucleotides, and then digested with Hindlll to liberate an 840 bp fragment containing nucleotides -765 to +70 of the MTII gene (nucleotide +1 is the first nucleotide transcribed). The 840 bp fragment was isolated and ligated with Hindlll/HincII digested pUC8 (Vieira, J., et al.
  • pMT-Apo harbors a portion of the human liver protein ApoA gene (Shoulders, C. C, et al. Nucleic Acids Res (1983) U:2827-2837) which contains the 3'-terminal regulatory signals.
  • a Pstl/PstI 2.2 kb fragment of ApoA gene (blunt ended) was cloned into the Smal site of the pMT polylinker region, and the majority of the ApoA gene removed by digestion with BamHI, blunt ending with Klenow, digestion with Stul, and religation.
  • the resulting vector contains roughly 500 bp of the ApoA gene from the 3' terminus as confirmed by dideoxy-sequence analysis.
  • the autoantigen is inserted as an NcoI/EcoRI fragment.
  • Example 12 Antigenicity of Recombinantly Produced Peptides Intermediate vectors containing multimers of 2 copies of serllO CTP.
  • Example 11 The proteins were labeled with S methionine, recovered from the cell surfaces, and a portion of them immunoprecipitated with polyclonal sera raised against hCG or GnRH as appropriate. The labeled proteins and their immunoprecipitates were analyzed on a 12.5% Laemmli gel, and the results are shown in Figure 14.
  • Lanes 1 and 14 of Figure 14 show low and high molecular weight standard, lanes 2-5 are total proteins from cells transformed with the vectors indicated on the figure. The high background levels did not permit proteins uniquely produced by the inserts to become apparent. However, immunoprecipitation with the appropriate antiserum permitted detection and verification of the molecular weights of these proteins. Lanes 6 and 7 show the results of immunoprecipitation of membrane bound proteins of the CV-1 cells using anti-GnRH; lane 6 represents the pGS20/HA/GnRH transformant. lane 7 is the pGS20 transformed control. The anti-GnRH is specific for the GnRH mid-region, as described by King. J.A.. et al.
  • the smeared band at approximately 23 kd is of roughly the correct molecular weight (17 kd contributed by HA, 6 kd by the multimer) and may be a glycosylated protein (there are two glycosylation sites - both in the HA sequence) .
  • Lanes 8-13 are immunoprecipitates with Miles antiserum (lanes 11-13) or Meloy antiserum (lanes 8-10). both raised against whole hCG in rabbits. Lanes 10 and 13 represent pGS20/HA/CTP (serllO) transformants and show the presence of a new immunoprecipitated protein of approximately correct molecular weight (17 kd from the HA. 12 kd from the multimer). The control lanes 8 and 11. and the transformants with the nollO multimer. lanes 9 and 12, do not show new bands.
  • Example 13 Construction of Species Specific Vaccines Advantage is taken of the regions of low species homology in the LH sequences shown in Figure 15 to construct peptides based on these which are species-specific antifertility vaccines.
  • Appropriate oligo ers encoding the peptides represented by amino acids 58-69. 104-118 of the bovine sequence and 58-68 and 104-107 of the dog sequence, as shown in Figure 15 represent positions of low homology with human LHj thus permitting vaccines made from them to be handled safely by humans.
  • These oligomers may be polymerized and blunted to obtain multimers which are treated as described above to generate vaccines.
  • the peptides are relatively short, it may be advantageous to use them simultaneously to obtain a vaccine of maximum effectiveness.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Endocrinology (AREA)
  • Virology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Toxicology (AREA)
  • Reproductive Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)
  • Seeds, Soups, And Other Foods (AREA)
PCT/US1986/001226 1985-06-04 1986-06-04 Autoantigen vaccines WO1986007383A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
DK058887A DK58887A (da) 1985-06-04 1987-02-04 Autoantigene vacciner
KR870700098A KR880700077A (ko) 1985-06-04 1987-02-04 자기항원 백신

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US74116885A 1985-06-04 1985-06-04
US741,168 1985-06-04
US75684785A 1985-07-18 1985-07-18
US756,847 1985-07-18

Publications (1)

Publication Number Publication Date
WO1986007383A1 true WO1986007383A1 (en) 1986-12-18

Family

ID=27113816

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1986/001226 WO1986007383A1 (en) 1985-06-04 1986-06-04 Autoantigen vaccines

Country Status (5)

Country Link
EP (1) EP0224574A4 (da)
KR (1) KR880700077A (da)
AU (1) AU5993186A (da)
DK (1) DK58887A (da)
WO (1) WO1986007383A1 (da)

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0259891A2 (en) * 1986-09-12 1988-03-16 Kyowa Hakko Kogyo Co., Ltd. [Leu 13] motilin, DNAs coding for same and methods for producing same
GR890100540A (en) * 1988-08-30 1990-08-22 Applied Research Systems Hybrid particle immunogens
WO1991005049A1 (en) * 1989-09-29 1991-04-18 International Development Research Centre A recombinant birth control vaccine
AU617716B2 (en) * 1987-11-26 1991-12-05 Lafon Pharma S.A. Peptide structures, immunogens containing them and their uses in the control of fertility
WO1994015633A1 (en) * 1992-12-31 1994-07-21 The International Development Research Centre ANTI-CANCER UTILITY OF hCG VACCINES
US5420113A (en) * 1986-09-12 1995-05-30 Kyowa Hakko Kogyo Co., Ltd. [Leu13]motilin, DNAs coding for same and methods for producing same
WO1996024675A1 (en) * 1995-02-10 1996-08-15 University Of Saskatchewan GnRH-LEUKOTOXIN CHIMERAS
US5688506A (en) * 1994-01-27 1997-11-18 Aphton Corp. Immunogens against gonadotropin releasing hormone
US5695952A (en) * 1986-09-12 1997-12-09 Kyowa Hakko Kogyo Co., Ltd. Method for producing Leu13 !motilin
US5733553A (en) * 1989-09-29 1998-03-31 Talwar; Gursaran Prasad Recombinant birth control vaccine
US5762931A (en) * 1992-12-31 1998-06-09 National Institute Of Immunology Anti-cancer utility of HCG vaccines
US5837268A (en) * 1991-10-16 1998-11-17 University Of Saskatchewan GnRH-leukotoxin chimeras
WO2000041717A2 (en) * 1998-12-18 2000-07-20 Avi Biopharma, Inc. Chorionic gonadotropin dna vaccines and methods
CN1108820C (zh) * 1999-11-12 2003-05-21 清华大学 单表位重复或多联单表位重复－表位疫苗的制备方法
WO2004099244A2 (en) 2003-05-09 2004-11-18 Pharmexa A/S Immunogenic human tnf alpha analogues with reduced cytotoxicity and methods of their preparation
WO2005042575A2 (en) * 2003-10-30 2005-05-12 Pharmexa A/S Method for down-regulation of vegf
WO2005090995A2 (en) * 2004-02-20 2005-09-29 Aplagen Gmbh Method for the detection of autoantibodies against specific peptides and its use in diagnosis and treatment of pregnancy-loss or infertility
US7807441B2 (en) 1998-10-05 2010-10-05 Bn Immunotherapeutics, Inc. Methods for therapeutic vaccination
WO2014159813A1 (en) 2013-03-13 2014-10-02 Moderna Therapeutics, Inc. Long-lived polynucleotide molecules
CN116063576A (zh) * 2022-11-16 2023-05-05 安徽农业大学 Fshr-dtt重组去势疫苗及其制备方法和应用

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1985001958A1 (en) * 1983-11-02 1985-05-09 Reddy Vemuri B Production of heterodimeric human fertility hormones
WO1985001959A1 (en) * 1983-11-02 1985-05-09 Integrated Genetics, Inc. Production of heterodimeric human fertlity hormones

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2068971B (en) * 1980-01-30 1983-06-08 Searle & Co Recombinant dna techniques
NZ213759A (en) * 1984-10-19 1989-01-27 Genentech Inc Lhrh-ctp protein conjugates influencing prolactin fsh and lh release

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1985001958A1 (en) * 1983-11-02 1985-05-09 Reddy Vemuri B Production of heterodimeric human fertility hormones
WO1985001959A1 (en) * 1983-11-02 1985-05-09 Integrated Genetics, Inc. Production of heterodimeric human fertlity hormones

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
Fertilility and Sterility (Philadelphia, Pennsylvania, USA) Volume 36, issued July 1981 (STEVENS et al.) "Antifertility Effects of Immunization of Female Baboons with C-Terminal Peptides of the B-Subuit of Human Chorionic Gonadotropin". see pages 98-106. *
Journal of Andrology (Birmingham, Alabama, USA) Volume 4 issued July 1983 (SCHANBACHER et al.) "Animal Model of Isolated Gonadotropin Deficiency". see pages 233-239. *
Nature (London, England), Volume 302 issued April 1983 (SMITH et al.) "Infectious Vaccinia Virus Recombinants that Express Hepatitis B Virus Surface Antigen", see pages 490-495. *
Proc. Natl. Acad. Sci. USA (Washington D.C., USA) Volume 81 issued August 1984 (SHEN et al) "Multiple Joined Genes Prevent Product Degradation". see pages 4627-4631. *
Proc. Natl. Acad. Sci. USA (Washington, D.C. USA) Volume 81 issued September 1984 (TADEUSZ et al.) "Protection from Rabies by a Vaccinia Virus Recombinant Containing the Rabies Virus Glycoprotein Gene". see pages 7192-7198. *
Proc. Natl. Acad. Sci. USA (Washington, D.C. USA) Volume 82 issued February 1985 (TALWAR et al.) "Bioeffective Monoclonal Antibody against the Decapeptide Gonadotropin-Releasing Hormone: Reacting Determinant and Action on Ovulation and Estrus Suppression". see pages 1228-1231. *
Proc. Natl. Acad. Sci. USA (Washington, D.C., USA) Volume 80, issued December 1983 (SMITH et al,) "Construction and Characterization of an Infectious Vaccinia Virus Recombinant that Expresses the Influenza Hemagglutinin Gene and Induces Resistance to Influenza Virus Infection in Hamsters". see pages 715-7159. *
Proc. Natl. Acad. Sci. USA (Washington, D.C., USA) Volume 82, issued June 1985 (REDDY et al) "Expression of Human Choriogonadotropin in Monkey Cells Using a Single SV40 Vector". see pages 3644-3648. *
See also references of EP0224574A4 *

Cited By (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5695952A (en) * 1986-09-12 1997-12-09 Kyowa Hakko Kogyo Co., Ltd. Method for producing Leu13 !motilin
EP0259891A3 (en) * 1986-09-12 1989-08-09 Kyowa Hakko Kogyo Co., Ltd. Ûleu 13¨ motilin, dnas coding for same and methods for producing same
US5420113A (en) * 1986-09-12 1995-05-30 Kyowa Hakko Kogyo Co., Ltd. [Leu13]motilin, DNAs coding for same and methods for producing same
EP0259891A2 (en) * 1986-09-12 1988-03-16 Kyowa Hakko Kogyo Co., Ltd. [Leu 13] motilin, DNAs coding for same and methods for producing same
US5721353A (en) * 1986-09-12 1998-02-24 Kyowa Hakko Kogyo Co., Ltd. DNAs coding for LCU13 ! motilin
US6018037A (en) * 1986-09-12 2000-01-25 Kyowa Hakko Kogyo Co., Ltd DNA coding for (Leu13) motilin
AU617716B2 (en) * 1987-11-26 1991-12-05 Lafon Pharma S.A. Peptide structures, immunogens containing them and their uses in the control of fertility
GR890100540A (en) * 1988-08-30 1990-08-22 Applied Research Systems Hybrid particle immunogens
WO1991005049A1 (en) * 1989-09-29 1991-04-18 International Development Research Centre A recombinant birth control vaccine
US5733553A (en) * 1989-09-29 1998-03-31 Talwar; Gursaran Prasad Recombinant birth control vaccine
US6521746B1 (en) 1991-10-16 2003-02-18 University Of Saskatchewan Polynucleotides encoding LKT 111
US6022960A (en) * 1991-10-16 2000-02-08 University Of Saskatchewan GnRH-leukotoxin chimeras
US5837268A (en) * 1991-10-16 1998-11-17 University Of Saskatchewan GnRH-leukotoxin chimeras
US5762931A (en) * 1992-12-31 1998-06-09 National Institute Of Immunology Anti-cancer utility of HCG vaccines
WO1994015633A1 (en) * 1992-12-31 1994-07-21 The International Development Research Centre ANTI-CANCER UTILITY OF hCG VACCINES
US6303123B1 (en) 1994-01-27 2001-10-16 Aphton Corporation Methods for the treatment of hormone-dependent tumors with immunogens against gonadotropin releasing hormone
US5688506A (en) * 1994-01-27 1997-11-18 Aphton Corp. Immunogens against gonadotropin releasing hormone
US6132720A (en) * 1994-01-27 2000-10-17 Aphton Corp. Immunogens against gonadotropin releasing hormone
WO1996024675A1 (en) * 1995-02-10 1996-08-15 University Of Saskatchewan GnRH-LEUKOTOXIN CHIMERAS
US7807441B2 (en) 1998-10-05 2010-10-05 Bn Immunotherapeutics, Inc. Methods for therapeutic vaccination
WO2000041717A3 (en) * 1998-12-18 2000-11-16 Avi Biopharma Inc Chorionic gonadotropin dna vaccines and methods
WO2000041717A2 (en) * 1998-12-18 2000-07-20 Avi Biopharma, Inc. Chorionic gonadotropin dna vaccines and methods
CN1108820C (zh) * 1999-11-12 2003-05-21 清华大学 单表位重复或多联单表位重复－表位疫苗的制备方法
WO2004099244A2 (en) 2003-05-09 2004-11-18 Pharmexa A/S Immunogenic human tnf alpha analogues with reduced cytotoxicity and methods of their preparation
WO2005042575A2 (en) * 2003-10-30 2005-05-12 Pharmexa A/S Method for down-regulation of vegf
WO2005042575A3 (en) * 2003-10-30 2005-06-23 Pharmexa As Method for down-regulation of vegf
WO2005090995A2 (en) * 2004-02-20 2005-09-29 Aplagen Gmbh Method for the detection of autoantibodies against specific peptides and its use in diagnosis and treatment of pregnancy-loss or infertility
WO2005090995A3 (en) * 2004-02-20 2006-03-30 Aplagen Gmbh Method for the detection of autoantibodies against specific peptides and its use in diagnosis and treatment of pregnancy-loss or infertility
WO2014159813A1 (en) 2013-03-13 2014-10-02 Moderna Therapeutics, Inc. Long-lived polynucleotide molecules
CN116063576A (zh) * 2022-11-16 2023-05-05 安徽农业大学 Fshr-dtt重组去势疫苗及其制备方法和应用

Also Published As

Publication number Publication date
EP0224574A1 (en) 1987-06-10
DK58887D0 (da) 1987-02-04
DK58887A (da) 1987-04-03
EP0224574A4 (en) 1988-04-26
AU5993186A (en) 1987-01-07
KR880700077A (ko) 1988-02-15

Similar Documents

Publication Publication Date Title
WO1986007383A1 (en) Autoantigen vaccines
US5171568A (en) Recombinant herpes simplex gb-gd vaccine
US5648079A (en) Herpes simplex virus glycoprotein B vaccine
EP0139417B2 (en) Vaccines based on membrane bound proteins and process for making them
Pachl et al. Expression of cell-associated and secreted forms of herpes simplex virus type 1 glycoprotein gB in mammalian cells
CA1337181C (en) Recombinant herpes simplex gb-gd vaccine
EP0208672B1 (en) Vaccines and diagnostics derived from bovine diarrhea virus
EP0229826A1 (en) Methods and compositions useful in preventing equine influenza
WO1991016922A1 (en) Analogs of glycoprotein hormones having altered immunological characteristics, efficacy and/or receptor specificity
US6193983B1 (en) Equine herpesvirus glycoproteins
CA2040441C (en) Fusion proteins
NO172855B (no) Fremgangsmaate for fremstilling av et herpes simplex virusgd glycoprotein
EP0236977A2 (en) Bovine virus diarrhea and hog cholera vaccines
EP1035133B1 (en) Fusion proteins comprising carriers that can induce a dual immune response
CA2187908C (en) Non-splicing variants of gp350/220
WO1990001546A1 (en) Equine herpesvirus-1 vaccine
Srinivasan et al. Targeting vaccinia virus-expressed secretory beta subunit of human chorionic gonadotropin to the cell surface induces antibodies
CA2047585A1 (en) Herpesvirus-based viral vector which expresses a foot and mouth disease virus epitope on the surface of virus-infected cells and on the surface of virus particles, and vaccine against foot and mouth disease containing the same
JPS62503073A (ja) 自己抗原ワクチン
US5733553A (en) Recombinant birth control vaccine
AU622044B2 (en) Fusion proteins
GUPTA et al. Identification of Novel Transmembrane Gene Sequence and Its Use for Cell-Surface Targeting of βSubunit of Human Chorionic Gonadotropin
JP2787926B2 (ja) 融合タンパク質
EP0494158A1 (en) A recombinant birth control vaccine

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU DE DK GB JP KR

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE FR GB IT LU NL SE

WWE Wipo information: entry into national phase

Ref document number: 1986903969

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1986903969

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWW Wipo information: withdrawn in national office

Ref document number: 1986903969

Country of ref document: EP