WO1986002650A1 - Novel polypeptides having growth factor activity and nucleic acid sequences encoding the polypeptides - Google Patents
Novel polypeptides having growth factor activity and nucleic acid sequences encoding the polypeptides Download PDFInfo
- Publication number
- WO1986002650A1 WO1986002650A1 PCT/US1985/002103 US8502103W WO8602650A1 WO 1986002650 A1 WO1986002650 A1 WO 1986002650A1 US 8502103 W US8502103 W US 8502103W WO 8602650 A1 WO8602650 A1 WO 8602650A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- amino acid
- carbon atoms
- neutral
- aliphatic
- acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/475—Growth factors; Growth regulators
- C07K14/485—Epidermal growth factor [EGF], i.e. urogastrone
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/14011—Baculoviridae
- C12N2710/14111—Nucleopolyhedrovirus, e.g. autographa californica nucleopolyhedrovirus
- C12N2710/14141—Use of virus, viral particle or viral elements as a vector
- C12N2710/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/10022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
Definitions
- a significant number of polypeptides secreted by mammalian cells are found to have growth factor activity. These compounds have been found to be substantially conserved over a wide range of mammals. Much of the interest in these compounds is stimulated by their association with oncogenicity. There is also interest in how the production of the growth factors is regulated and how they in turn regulate cellular activity.
- viruses infections of mammalian cells by viruses results in proliferation of the growth of the cells.
- members of the poxvirus family such as variola, vaccinia and, such viruses associated with particular diseases such as Shope fibroma virus, Yaba tumor virus, and Molluscum contagiosum virus (MCV) .
- Ven atesan et al. , J. Virol. (1982) 4 :637-646 describes the DNA sequencing of structural . genes encoding vaccinia virus proteins.
- Cooper e_t al. , ibid (1981) 3_7:284-294 report the translation of mRNA's encoded within the inverted terminal repetition of the vaccinia virus genome.
- Proliferative diseases for members of the poxvirus family have been reported for Shope fibroma virus (Shope, J. Ex . Med. (1932) 5_6_:793-822; Yaba tumor virus (Niven et al., J. Path. Bacteriol.
- VVF vaccinia virus growth factor
- compositions act as mitogens and can be used in nutrient media, as reagents for the detection of growth factor receptors or the presence of growth factors, and as competitors for transforming growth factor and epidermal growth factor.
- the compositions find therapeutic use, for example, to promote epithelial- ization and healing of burns and wounds.
- the novel compositions may be synthesized.
- the subject peptides may be formed as oligopeptides or fused proteins employing recombinant techniques in a wide variety of hosts.
- Figure 1 is an amino acid sequence comparison of the vaccinia virus protein with known growth factors, where the initial amino acid of the WF is aspartic acid (D) at position 20; and
- Figure 2 is a fragment of the vaccinia virus protein, beginning at amino acid 44 and terminating at amino acid 90, with residues which are identical in the polypeptide fragments, mEGF, hEGF and rTGF being cross-hatched.
- Novel compositions which can act as agonists or antagonists of epidermal growth factor (EGF) or transforming growth factor (TGF) are provided, which provide for a wide variety of applications in cell culture, diagnostics, ij vivo therapy, and in combination with other peptides in the formation of hybrid polypeptides as immunogens for production of antibodies.
- Polynucleotide sequences may be isolated or prepared which may be introduced into an expression vector for expression of the subject compositions.
- the compositions find analogy in fragments of viral proteins, particularly poxvirus proteins.
- the poxvirus proteins are found to have regions which have structures analogous to surface membrane proteins.
- the structural gene coding for the polypeptide has regions analogous to regions functioning as a leader sequence and processing signal and as a transmembrane integrator sequence, with the growth factor fragment sequence intermediate the leader and integrator sequence.
- the subject polypeptides are characterized by being capable of having at least one loop or circle, usually three loops or circles, as a result of cysteines which form bridges, where the physiologically active portion of the molecule providing a growth factor related activity will be from about 12 to 65 amino acids, usually 15 to 60 amino acids.
- two of the loops are of from 12 to 15 amino acids (14-17 annular amino acids) , exclusive of the cysteine bridge, more particularly- one is of 12 or 13 amino acids (14 or 15 annular amino acids) and the other of 15 amino " acids (17 annular amino acids) , where the N-terminal proximal loop will usually be of from 12 to 13 amino acids, more usually of 12 amino acids, and the middle loop will be of 15 amino acids.
- the third loop or C-proximal loop will be of
- the one letter symbols for amino acids have their conventional meaning, wherein C is cysteine, G is glycine, Y is tyrosine, and R is arginine;
- Al intends a neutral amino acid, which will be described in more detail below, particularly, wherein Al is an aliphatic amino acid of from 2 to 6, .
- aa 25 is a neutral am o acid which may be aliphatic, particularly of from 3 to 4 carbon atoms, or aromatic, particularly of 9 carbon atoms, and having from 0 to 1 oxy substituents, e.g., alanine, serine, threonine or tyrosine;
- ⁇ aa 27 may be neutral or basic, being particularly of from 4 to 6 carbon atoms, and when neutral having from 0 to 1 carboxamide group, e.g., arginine, valine, leucine, isoleucine, asparagine or glutamine;
- aa 29 is a neutral amino
- aa is a neutral or acidic amino acid,-of - from 5 to 6 carbon atoms, where neutral is exemplified by valine, leucine and isoleucine and where acidic is exemplified by aspartic and glutamic acids;
- aa38 is an aliphatic neutral substituted amino acid or acidic amino acid, wherein the substituent is carboxamide and is of from 4 to 5 carbon atoms, e.g., asparagine, glutamine, aspartic acid or glutamic acid;
- aa 39 is an aromatic amino acid or a neutral aliphatic amino acid of from 3 to 4 carbon atoms having an hydroxyl substituent, preferably aromatic, e.g., histidine, tyrosine, serine or threonine;
- aa 40 is neutral unsubsti.tuted ali.phati.c or basic amino acid, wherein the neutral amino acids are of from 3 to 5 carbon atoms, e.g.,
- the abbreviations in the parentheses refer to the particular amino acid groups.
- the amino acids are the naturally occurring L-amin'o acids.
- the loop between the cysteines in the above formula will have from 0 to 1 acidic amino acid, preferably no acidic amino acids, and the amino acids immediately flanking the cysteines outside the loop will include at least one charged amino acid, preferably a basic amino acid, more preferably, having in addition an amido substituted aliphatic amino acid.
- a basic amino acid more preferably, having in addition an amido substituted aliphatic amino acid.
- amino acids in the loop from 4 to 6, usually 5 amino acids, will be neutral aliphatic amino acids and not more than 2, usually 2, will be aromatic amino acids.
- polypeptide is of fewer than 130 amino acids, more particularly of fewer than 50 amino acids, and at least 40 amino acids, preferably at least about 42 amino acids.
- polypeptides including amino acids 44 to 86 as indicated in Figure 1 of WP.
- aa29 is a substituted or unsubstituted aliphatic amino acid of from 3 to 6 carbon atoms having from 0 to 1 hydroxyl group, particularly serine;
- aa 30 is preferably histidine, serine or an unsubstituted aliphatic amino acid of from 5 to 6 carbon atoms, particularly where one of aa 29 and aa30 is histidine and the other is serine;
- Al is preferably a substituted aliphatic amino acid having one hydroxyl group and of from 3 to 4 carbon atoms; aaaa 3 35 is preferably an unsubstituted aliphatic amino acid of from 5 to 6 carbon atoms; aaaa 3 388 iiss pprreeffeerraabbllyy aa ssuubbssttiittuuted aliphatic amino acid of from 4 to 5 carbon atoms,, wherein the substitution is carboxamide; aa 39 is preferably aromatic, more preferably histidine.
- the second loop is preferably of from about 14 to 16 amino acids exclusive of the cysteine bridge, more preferably of about 15 amino acids.
- amino acids from 6 to 9, preferably 7 to 9, more preferably about 8 are aliphatic amino acids either substituted or unsubstituted, preferably not more than about 3 of the amino acids being substituted, more preferably from 1 to 2 amino acids being substituted; there will be from 2 to 4 aromatic amino acids, more particularly 3 aromatic amino acids, desirably histidine and tyrosine; there will be from 2 to 4 acidic amino acids, preferably 3 acidic amino acids, more particularly aspartic acid; and there will be from 0 to 2, more usually 1 basic amino acid, particularly arginine.
- the cysteine forming the subject loop closest to the cysteine of the other loop will be separated by from 0 to 2, more usually from 0 to 1 amino acids, particularly arginine.
- PP 1 and PP2 are the same or different and may be hydrogens, indicating the terminal portion of the indicated polypeptide or may be polypeptides having a total of up to about 1000 amino acids, more usually of up to about 500 amino acids and may have a total of as few as 1 amino acid, or may individually or separately be polypeptides of from 1 to 100 amino acids, more usually from about 1 to 75 amino acids, more particularly from about 5 to 50 amino acids; these polypeptides will have specific applications in modifying the specifically described sequence for a predetermined purpose; PP 1 and PP2 may be the same or different from the natural pox virus polypeptide, usually different; the * indicates the conservation of the amino acid of the vaccinia virus peptide and mouse and human epidermal growth factor, where a space is introduced between amino acids 55 and 56 of the vaccinia virus peptide in order to provide for the alignment of cysteines defining the loops, as
- 4 aa may be any amino acid, particularly of from 2 to 6 carbon atoms, which may be neutral, acidic or basic, more particularly of from 3 to 6 carbon atoms, including proline, aspartic acid, serine and arginine;
- 5 aa is an acidic or a neutral substituted aliphatic amino acid, particularly glutamic acid or an hydroxy substituted amino acid of from 3 to 4 carbon atoms, more particularly serine;
- g aa is an unsubstituted aliphatic amino acid of from 2 to 6, usually 2 to 3, carbon atoms, or an aromatic amino acid, particularly glycine, histidine or tyrosine;
- 7 aa is an acidic or neutral substituted aliphatic amino acid, particularly of from 3 to 5, more particularly 4 carbon atoms, such as aspartic acid and threonine;
- g aa is a neutral unsubstituted aliphatic amino acid of from 2 to 5, usually 2 to 3, carbon atoms, particularly substituted with carboxamide (4 to 5 carbon atoms), e.g., glutamine, particularly glycine;
- aa is a neutral amino acid, either aliphatic or aromatic, more particularly aliphatic, particularly of from 5 to 6 carbon atoms, more particularly leucine or phenylalanine;
- aa 12 i.s an aroma,t_i.c ammo acid or a carboxamide substituted aliphatic amino acid of from 4 to 5 carbon atoms, particularly histidine or asparagine;
- aa is a neutral aliphatic amino acid or acidic amino acid, more particularly glycine or aspartic acid;
- Ar intends an aromatic amino acid, which may have a carbocyclic or heterocyclic ring, and includes histidine, phenylalanine or tyrosine;
- aa 19 may be any ammo acid, particularly aliphatic acidic or basic amino acids, more particularly of from 4 to 6 carbon atoms, more preferably of from 5 to 6 carbon atoms, particularly arginine, valine and glutamic acid;
- aa 20 is an aci.di.c amm. o acid or neutral aliphatic amino acid, either substituted or unsubstituted of from 3 to 6, usually 3 to 5, carbon atoms, having from 0 to 1 hydroxyl group, and includes aspartic acid, glutamic acid, glutamine, serine or alanine;
- 21 aa is a neutral unsubstituted aliphatic amino acid or acidic amino acid of from 5 to 6 carbon atoms, particularly a neutral aliphatic amino acid, which includes isoleucine, leucine or glutamic acid;
- Ac is an acidic amino acid which is aspartic acid or glutamic acid;
- aa is a neutral aliphatic or basic amino acid, of from 2 to 6 carbon atoms, when neutral, of from 2 to 4 carbon atoms having from 0 to 1 hydroxyl substituent, e.g., glycine and serine; and when basic, being lysine or arginine, particularly lysine; aa 24 is an aliphatic amino acid, proline or
- an aromatic amino acid particularly a thiosubstituted aliphatic amino acid, more particularly methionine, or tyrosine
- aa 41 is a neutral unsubstituted aliphatic or acidic amino acid of from 4 to 6 carbon atoms
- aa is a neutral aliphatic or basic amino acid, particularly a neutral aliphatic amino acid which may be substituted or unsubstituted of from 4 to 6 carbon atoms, either unsubstituted or carboxamide
- PP has the following sequence:
- PP PP .
- the above sequence comes within the definition of PP 1; PP1' may be hydrogen or an amino acid sequence.
- 35 is any number
- amino acid sequence indicated may be present.
- the sequence will involve contiguous amino acids, that is, amino acids in their numerical order without deletions.
- PP 1' may be joined to aa-1, aa-5, or the like;
- aa may be any amino acid, particularly aliphatic, of from about 3 to 6 carbon atoms preferably neutral or basic, more particularly neutral or basic of from about 5 to 6 carbon atoms;
- aa -2 may be any amino acid, either aliphatic or aromatic, particularly aliphatic, more particularly of from about 4 to 6 carbon atoms;
- _-3 aa may be aliphatic or aromatic, particularly aliphatic, either polar or non-polar, of from 2 to 6, more usually of from 2 to 5 carbon atoms, generally having from 0 to 1 hydroxyl substituent;
- aa -4 may be any aliphatic ammo acid,. particularly neutral, generally of from 3 to 6 carbon atoms, usually of from 3 to 5 carbon atoms, and may be polar or non-polar, particularly proline and asparagine;
- aa -5 may be any aliphatic am o acid, particularly a neutral or basic amino acid, more particularly of from about 4 to 6 carbon atoms, preferably an aliphatic neutral amino acid;
- —6 aa is an aliphatic amino acid of from about 3 to 6, more usually of from about 4 to 6 carbon atoms, particularly acidic or aliphatic, more particularly acidic; da -7, -8, -11, -15, -16, -17, -23 and -27 ⁇ a i ⁇ .c ⁇ aliphatic amino acids of from 3 to 5 carbon atoms, either polar or non-polar, particularly polar having from 0 to 1 hydroxyl substituent; a.a-9, -20, -23 and -25, a._re_ milieuno_n-_po_l,a_rdon aliphatic amino acids of from 2 to 6, more usually of from 2 to 3 carbon atoms; aa -10 and -21 are pol,ar al _i .p .ha _t__i .c amm.
- o aci.d s of from 4 to 5 carbon atoms, particularly having a carboxamido substituent; aa -12,' -14 and -19 are a -l,i•ph_at_i.c amm ⁇ o aci -d_s of from 2 to 6 carbon atoms, more particularly of from
- —26 aa is an aromatic amino acid, particularly phenylalanine.
- PP may conveniently be an unrelated amino acid sequence which may serve as a fusion protein, particularly to provide VGF as an immunogen for production of antibodies to VGF and its congeners, such as EGF .and TGF- ⁇ .
- the primary aspects of the subject compositions are the sequence in the parentheses, particularly between the cysteine at position 28 and the cysteine at position 37 and the loops generated by the cysteines at positions 2 and 10 and the cysteines at positions 15 and 26.
- the subject compositions have the loop created by the cysteines at positions 28 and 37 in conjunction with the loop created by the cysteines at positions 15 and 26.
- Varying combinations of polypeptide sequences may be prepared by employing as one fragment the C-terminal portion of one sequence with the N-terminal portion of another sequence as a second fragment, whereby polypeptides of from about 40 to 65 amino acids, usually about 50 to 60 amino acids are provided.
- the juncture will be made at some point b ,_e_t_ween aa20 and, aa27, par_t.i.cul-,arl.y aa20 to aa25
- the fragments are joined at a site not more than 5 amino acids from the sequence C-X-C, where X is any amino acid.
- the framework structure of the cysteines is retained with the cystine bridges defining loops of the sizes described previously.
- a fragment may be employed from any EGF, TGF, VGF (portion of the vaccinia virus having substantial homology with other growth factors and depicted in Fig. 2) , or other growth factor having the same framework structure of the subject compositions and similar physiologic activity.
- EGF EGF
- TGF EGF
- VGF portion of the vaccinia virus having substantial homology with other growth factors and depicted in Fig. 2
- other growth factor having the same framework structure of the subject compositions and similar physiologic activity.
- the mammalian source such as primate, e.g., human, rodent, e.g., rat and mouse, bovine, avian, porcine, etc.
- the fragments will generally be of from about 15 to 50, usually 15 to 45 ammo acids, since aa 20 does not intend the twentieth amino acid of the compound, but only of the specific sequence which has been specifically defined.
- VGF is modified where VGF has an alanine substituted for a tyrosine which introduces an SphI restriction site.
- This provides for a convenient site for linking one fragment from the VGF gene to a fragment from another growth factor.
- the entire sequence could be synthesized without any amino acid changes.
- the subject polypeptides may be synthesized in accordance with conventional polypeptide synthesizing techniques, using a commercially available polypeptide synthesizer.
- the subject compositions may be unglycosylated or glycosylated. Depending upon the particular amino acid sequence, one or more glycosylation sites may be present, usually not more than six, more usually not more than three, glycosylation sites.
- the glycosylation sites may or may not be glycosylated.
- the saccharides will usually add not more than 6kDal (kilodaltons) , usually not more than about 5kDal, to the total molecular weight of the active polypeptide.
- Sugars involved will be mannose, glucose, N-acetylglucosamine, galactose, glucuronic acid, galacturonic acid, sialic acid, etc.
- compositions find a wide variety of applications d ⁇ vitro and ⁇ x vivo as agonists or antagonists for growth factors, such as epidermal growth factor (EGF) , and transforming growth factor (TGF) , particularly TGF-I.
- growth factors such as epidermal growth factor (EGF)
- TGF transforming growth factor
- hEGF appears to be identical to human urogastrone.
- EGF has been found to exert a variety of effects on prenatal and neonatal tissue growth. Among the effects are precocious eye-opening, wound healing, incisor eruption, and accelerated maturation of the lung.
- EGF receptors are found in a wide variety of adult tissues. EGF is found to stimulate phosphorylation of its own receptor. EGF is also found to be related to increased bone resorption.
- Transforming growth factor has many analogous activities to that of EGF.
- TGF binds to the EGF receptor leading to phosphorylation of the receptor, enhancement of its tyrosine-specific kinase activity and to stimulation of cell growth.
- Cohen in: Biological Response Mediators and Modulators (ed. August, J.T.), Academic, New York, 1983, pp. 7-12; Tarn et al. , Nature (1984) 309:376-378; Ibbotson et al. , Science (1983) 221:1292-1294.
- the subject compounds have particular application as drugs as agonists for EGF, and for wound healing, such as epithelialization of wounds, such as burns, eye wounds, surgical incisions, and the like.
- the active ingredient may be employed in a convenient . vehicle, e.g., Silvadene, in amounts ranging from about 0.01 to 0.5, usually from about 0.075 to 0.2 ⁇ g/ml.
- the formulation is spread over the wound, so as to provide a complete coating of the wound with the formulation. Treatments may be as frequent as four times a day or as infrequent as every other day or less, depending upon the nature of the wound, its response to the treatment, the concentration of the active ingredient, and the like.
- compositions can be used as reagents in diagnostic assays or for the preparation of reagents, such as polyclonal or monoclonal antibodies.
- reagents they may be used for the detection of analogous growth factors or for the detection of antibodies to the growth factors in physiological fluids, such as blood.
- the polypeptide may be labeled or unlabeled.
- labels include radionuclides, enzymes, fluorescers, particles, chemiluminescers, enzyme substrates or cofactors, enzyme inhibitors, magnetic particles, etc. See for example, U.S. Patent Nos.
- a wide variety of methods exist for linking the labels to the polypeptides which may involve use of the N-terminal amino group for functionalization to form a pyrazolone, while other free amino groups are protected, where the pyrazolone may then be contacted with various reagents, e.g., amino groups, to link to the detectable signal generating moiety.
- various reagents e.g., amino groups
- polypeptide may be contacted with an active agent, e.g., an activated carboxylic acid and randomly substituted, where biologically active material may be separated from biologically inactivated material as a result of the random substitution.
- an active agent e.g., an activated carboxylic acid and randomly substituted
- biologically active material may be separated from biologically inactivated material as a result of the random substitution.
- the polypeptide may be modified to provide for the desired functionality as part of the synthetic procedure.
- the subject compositions can also be used for monitoring EGF receptors.
- the subject compositions can also be used for monitoring cellular response to EGF and/or TGF by providing for competition between these naturally occurring materials and a composition according to the subject invention. In this way, changes in the receptor conformation can be monitored.
- the concentration of the additive will vary widely, due to fluctuations in activity, varied purpose, and variations in receptors.
- the subject compositions can also be used for various therapeutic purposes involving growth stimulation or control of bone formation. These compounds may be administered in appropriate physiological carriers intraperitoneally, subcutaneously, intravenously, intraarterially, or by application to the site of interest.
- the subject compositions can be introduced into liposomes, which may or may not involve the use of antibodies for site direction.
- Various carriers include phosphate buffered saline, saline, water, or the like.
- concentration of the additive will vary widely, depending upon its ultimate use and activity.
- Other additives may also be included in the formulations, such as EGF, TGF, other growth factors, bacteriocides, e.g., antibiotics, bacteriostats, buffers, etc.
- the subject polypeptides where PP 1-4 are hydrogen or short oligopeptide chains (fewer than five amino acids) may be joined to antigenic polypeptides or proteins, for injection into mammalian hosts.
- the antigenic protein will have at least about 60 amino acids and will usually be not more than 10 kilodaltons (kDal) .
- Common antigenic proteins include bovine serum albumin, keyhole limpet hemocyanin, tetanus toxoid, etc.
- the subject polypeptides are joined to the antigenic protein in sufficient number to provide the desired immunogenic response. Usually there will be two or more booster injections after the initial injection.
- spleen is isolated and splenocytes fused with an appropriate fusion partner in accordance with conventional ways.
- the resulting hybridomas are then screened for antibodies binding to the epitopic sites of the subject polypeptide.
- These antibodies may be used for a variety of purposes, such as diagnostic reagents, therapy, etc.
- the antibodies when used as reagents may be labeled or unlabeled, as described for the polypeptides.
- compositions can be prepared in a variety of ways depending on the size of the composition. Particularly below about 80, more particularly below about 60 amino acids, the composition can be prepared by synthesis in accordance with conventional ways. See, for example, Merrifield, Solid-Phase Peptide Synthesis, "The Peptides Analysis, Synthesis, Biology,” Special Methods in Peptide Synthesis, Part A, Vol. 2, Gross and Meinhofer eds., Academic Press, NY, 1980, pp. 1-284. See also, U.S. Patent No. 4,127,526.
- hybrid DNA technology can be employed, where DNA sequences can be used which code for the desired polypeptide or precursor thereof.
- DNA sequences can be synthesized employing conventional techniques such as overlapping single strands which may be ligated together to define the desired coding sequence.
- the termini can be designed to provide restriction sites or one or both termini may be blunt-ended for ligation to complementary ends of an expression vector.
- an initial methionine is provided for expression of the sequence.
- Expression vectors are generally available and are amply described in the literature.
- a poxvirus may be isolated and by various techniques, the mRNA isolated, which codes for the polypeptide including the growth factor, the mRNA reverse transcribed, the resulting single-stranded (ss) DNA used as a template to prepare double-stranded (ds) DNA and the ds DNA gene isolated.
- This gene may then be manipulated in a variety of ways to remove undesired untranslated region or undesired codons, for example, employing primer repair, in vitro mutagenesis to introduce a restriction site or different amino acid at one or more appropriate sites, or introduction into a vector, followed by restriction and exonuclease digestion to remove the terminal bases.
- the gene may be reduced to the desired number of codons.
- the coding region may be restricted and the lost nucleotides replaced by employing an adapter for joining the coding region to the desired flanking region, such as another coding region which codes for a foreign polypeptide to be joined to the subject polypeptide to provide a fused protein.
- the DNA coding for the growth factor sequence may be excised from the W genome by cleavage with Alul and Hpall to give a 190bp fragment. This may then be manipulated as described above.
- Expression vectors are characterized by having transcriptional and translational regulatory initiation and termination signal regions, where a DNA sequence having an open reading frame may be inserted between them and will be under the transcriptional and translational control of the signals.
- the expression vector may have one or more markers which allow for selection of the host having the expression vector and maintenance of the expression vector in the host.
- the transcriptional initiation may be subject to inducible control, by temperature change, chemicals, or the like. In this manner, one can grow the host cells to high density, prior to initiation of the production of the desired product.
- replication systems there may be one or more replication systems. For extrachromosomal maintenance, it will be necessary to have a replication system which is functional in the host to be used for expression. Where the host is other than a bacterium, it will frequently be desirable to have a second replication system which allows for cloning in a bacterium, to enhance the availability of the plasmid and allow for purification and characterization.
- a wide variety of prokaryotic or eukaryotic hosts may be employed, including unicellular microorganisms, both prokaryotic and eukaryotic, cold-blooded and warm-blooded eukaryotes, such as insects and mammals, or the like. By employing different constructs for expression of the gene, one can introduce the constructs into different hosts.
- the host may provide for different products by providing for glycosylation to varying degrees with the same or different sugars or providing for an unglycosylated product.
- the glycosylation may occur at one or more, usually not more than two glycosylation sites present in the VGF sequence, where for glycosylation at least one sugar will be added and usually not more than about 6kDal of sugars, usually not more than about
- a eukaryotic host particularly a mammalian host
- other maturation processes e.g., glycosylation.
- the DNA sequence encoding for the subject oligopeptide joined to the naturally occurring secretory leader and processing signal with the subject DNA sequence by itself or fused to a DNA sequence coding for a foreign polypeptide not naturally joined to the subject oligopeptide, one can provide for secretion of the subject polypeptides with concommitant removal of the secretory leader processing signal in an appropriate eukaryotic host.
- the leader and processing signal may be substituted with a leader and processing signal recognized by the intended expression host.
- a stable replication system is not required.
- the sequences of interest will be flanked by. sequences homologous with a sequence present in the host genome to enhance the probability for recombination.
- a marker is included, particularly one which allows for amplification, such as genes expressing metallothioneins, dihydrofolate reductase or thymidine kinase, so that the insertion sequence is not only maintained but amplified.
- the subject polypeptides may be used with various hosts for inducing an immunogenic response, enhancing cellular proliferation, wound healing or the like.
- hosts for wounds, epithelialization and vasculari- zation is observed, as well as rapid restoration of the strength of the wound, that is, resistance to separation or tearing.
- Hosts include mammals, such as rodents, domestic animals, primates and humans.
- rTGF rat TGF
- mEGF mouse EGF
- hEGF human EGF
- residues near the N-terminus between residues 5 and 15 and near the C-terminus between residues 100 and 124 may be considered by analogy to integral membrane glycoproteins as having a N-terminal hydrophobic signal sequence, which is removed proteolytically during or immediately after translation, and a C-terminal transmembranous sequence, which serves to anchor the mature protein in the membrane. Cleavage of the viral polypeptide at arg-43 and arg-90 would lead to release of a soluble polypeptide.
- the 140 residue W polypeptide may be assumed to give rise first to a membrane-associated protein of approximately 120 residues after removal of a signal peptide and then to a soluble growth factor peptide of about 47 residues.
- the following DNA sequences were designed for synthesis and expression in an E. coli host.
- the sequences were designed to employ primarily bacterial preferred codons.
- the sequences contain several useful restriction sites, a few being indicated.
- the VGF sequence differs from the natural sequence in being DGMACRC rather than DGMYCRC.
- the subsequent chimeric sequences are prepared by synthesizing the two fragments bounded by BssHII and SphI sites and SphI and BamHI sites and ligating these fragments into the plasmid vector containing the modified TGF or VGF structural gene.
- a synthetic VGF gene is prepared from the following fragments:
- VGFs4 3' GCAACGGTCGTACAACAAGACCAGCTGATGGTCGCAATTCCTAG
- the VGF gene may be assembled according to conventional procedures and used for insertion into an appropriate expression vector, joined to other fragments to extend the N- and/or C-terminus, or the like.
- BSC-1 cell monolayers were infected with 15 plaque-forming units (pfu) per cell of purified virus, and incubated at 37°C with approximately 1ml of Eagle's basal medium supplemented with 2% fetal calf serum per 2x10 cells. Mock-infected cells were treated in an identical manner. Cell culture supernatants were clarified by low speed centrifugation and lyophilized. The residue was then resuspended in 1M acetic acid and dialyzed extensively against 0.2M acetic acid. Insoluble material was removed by centrifugation and the supernatant was lyophilized and resuspended in 1/lOOth of the original volume of 1M acetic acid and stored at 4°C.
- 125 produce an inhibition of I-EGF binding equivalent to that produced by a known amount of EGF.
- Radioimmunoassay Each 50 ⁇ l reaction contained the following: 20mM sodium phosphate at pH 7.4, 200nM NaCl, 40mM dithiothreitol, 0.1% bovine serum albumin, 0.1% NaN 3 , 125 I-labeled peptide (2xl0 4 cpm) corresponding to the 17 carboxyl-terminal residues of TGF- ⁇ (Linsley et a ⁇ L. , Proc. Natl. Acad. Sci. USA (1985) 8_2:356-369) , antiserum at a final dilution of 1:5000, and other additions as specified.
- the reaction was initiated by the addition of antiserum and was continued at 23°C for 90min. An equal volume of 10% formalin-fixed S_. aureus (Pansorbin, Calbiochem) was then added, and incubation was continued for an additional 30min at 23°C. The immunoadsorbant was removed by sedimentation, and the amount of bound
- 125I-labeled peptide was measured.
- the amount of bound peptide as corrected for nonspecific binding measured in the absence of antibody (less than 5% of the total) and expressed as a percentage of maximal binding.
- the medium derived from BSC-1 cells 24hr after infection with W was tested for the presence of. material that could compete with 125I-EGF for binding to EGF receptor-rich human epidermoid carcinoma cells
- Control medium volume from mock-infected BSC-1 control cultures contained minimal activity in competition with EGF.
- VGF VGF were observed in the culture medium. By 12hr, maximum amounts of this activity were found in culture supernatant with only a slight increase noted at 24hr.
- the level of EGF production was found to be a function of the multiplicity of virus infection as demonstrated by "the following Table 1.
- Acid-solubilized polypeptides (10.5mg) from the supernatants were applied to a Bio-Gel P10 column equilibrated with 1M acetic acid and samples of each fraction tested for activity competing with EGF.
- the major active peak (fraction 42) eluted slightly after the M 29,000 carbonic anhydrase marker with an apparent M of 25,000.
- the molecular weight was confirmed by utilizing tandemly linked Bio-Sil TSK 250 HPLC sizing columns, with all of the activity eluting as a major peak in the region of the M 25,000 protein marker.
- One microgram of partially purified VGF was equivalent to 90ng of EGF in the radioreceptor competition assay.
- VGF Biological activity of VGF.
- a comparison of levels of VGF produced by BSC-1 cells infected with 15pfu of W per cell with that of TGF- ⁇ produced by retrovirus-transformed cells is shown in the following Table 2.
- TABLE 2 Comparison of the biological activity of VGF with TGF- ⁇ and EGF
- VGF [90ng equivalents (eq) of EGF per ⁇ g of protein] was purified by gel filtration followed by elution from a C. folk ⁇ Bondapak (Waters Associates) column. TGF- ⁇ was purified from Snyder-Theilen feline sarcoma virus-transformed Fisher rat embryo -cells as described in Marquardt et al., Proc. Natl. Acad. Sci. USA (1983) 80:4684-4688; EGF was purified from mouse submaxillary gland (Cohen e _ al_. ,
- EGF equivalents were based on a standard 125 I-EGF binding competition curve as described. Mitogenesis assays were as described; quiescent cultures of diploid human fibroblasts received lOng of purified EGF/ml or the same number of EGF equivalent of VG /ml. Values for [ 125 I]iodo- deoxyuridine ([ 125 I]IdU) incorporated represent the average of triplicate determinations.
- the number of soft-agar colonies represent the average number of colonies containing a minimum of 20 NRK cells per six random low- power fields 10 days after seeding (1.5X10 1 * cell/ml) with purified EGF (5ng/ml) or the same number of EGF equivalents of VGF/ml and 2.0ng of TGF- ⁇ /ml purified from human platelets as described in Assoian et_ al. , ibid. (1983) 258:7155-7160. Plates of NRK cells treated with TGF- ⁇ alone above did not form colonies.
- amino-terminal amino acid sequence is as follows:
- VGF begins with aspartic acid at residue 20 of the primary translation product (Fig. 1) .
- VGF as TrpE Fusion Protein pVG3
- a plasmid containing part of the early region of Vaccinia virus is available from B. Moss (NIH) .
- a 260bp Sau3AI-HpaII fragment was inserted into the TrpE expression plasmid pJH14, using the BamHI and Hindlll sites.
- the recombinant plasmid was introduced into E. coli by transfection, and expression of the recombinant protein was induced by indoleacetic acid.
- the fusion protein was purified from the bacteria, and the VGF sequence was excised by digestion with the enzyme Lys C. The digest was shown to contain an activity that competed with EGF in the radioreceptor assay.
- Rabbit antiserum to vaccinia virus precipitates polypeptides of lOkDal and 25kDal from lysates of these cells.
- the EGF receptor binding activity was found to be about llOng eq./ g protein.
- TGF- ⁇ expressed in yeast is 115ng eq./mg protein.
- An additional expression system which is used to express the VGF recombinant protein is an insect system. See Maeda et a_l. and Carbonell et al_. , supra.
- Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes.
- the virus grows in Spodoptera frugiperda cells.
- the envelope gene can be cloned into non-essential regions (for example, the polyhedrin gene) of the virus and is .placed under control of an AcNPV promoter (for example, the polyhedrin promoter) .
- VGF gene construct Successful insertion of the VGF gene construct will result in inactivation of the polyhedrin gene and production of non-occluded recombinant virus (i.e., virus lacking the proteinaceous coat coded for by the polyhedrin gene) . These recombinant viruses are then used to infect Spodoptera frugiperda cells in which the inserted gene is expressed.
- non-occluded recombinant virus i.e., virus lacking the proteinaceous coat coded for by the polyhedrin gene
- the VGF gene of interest is placed under the control of a suitable promoter for an insect cell system.
- Plasmids pAc ⁇ lO and pAc611 contain the polyhedrin gene cloned into a plasmid vector possessing an ampicillin resistance marker.
- Polylinkers are inserted into this gene which are 50 bases downstream from the transcriptional start site of the polyhedrin gene and 7 bases before the first ATG.
- the VGF gene is cloned into a convenient polylinker site, so that it is under the control of the polyhedrin promoter.
- the ATG initiation methionine codon and the translational termination codons are those of the VGF gene;.,the transcriptional start sites and polyadenylation signals are those of the polyhedrin gene.
- the host cell for AcNPV is Spodoptera frugiperda (SF) .
- SF Spodoptera frugiperda
- the VGF containing plasmid is mixed with AcNPV DNA and transfected into SF cells using the calcium phosphate technique.
- Recombinant viruses are isolated from the medium and plaque purified on SF cells. Recombinant plaques are identified by hybridization using radiolabeled VGF DNA as probe.
- recombinant virus Once recombinant virus is identified, it is then expanded on SF cells. The recombinant virus stock is then used to '-infect SF cells, the cells lysed, and supernatants screened for production of VGF protein, which is purified as described above for vaccinia virus-infected mammalian cell.
- the predicted sequence of VGF produced in insect cells is:
- This 121-residue sequence starts with the N-terminal sequence that has been determined directly for VGF purified from W-infected monkey cells (that is, at residue 20 -of the VGF open reading frame) and continues to the last residue of the open reading frame. It thus lacks the signal peptide (residues 1-19 of the open reading frame) but includes the transmembranous sequence (YIPSPGIMLVLVGIIIITCCLLSVY) .
- the predicted MW of the 121-residue peptide . is 13,304, not counting carbohydrate.
- the apparent MW of the baculovirus-produced VGF is 17,000, significantly smaller than that obtained from W-infected cells, indicating that the two forms have probably been processed differently.
- the baculovirus-produced VGF may lack an additional portion of the N-terminal sequence, or a portion of the
- C-terminal sequence or both, and/or could differ in the type and extent of glycosylation.
- Table 3 represents the approximate percentage of each burn epithelialized as judged visually.
- VGF is a potent epithelializing agent comparing satisfactorily with other growth factors which have been previously tested and demonstrated to have mitogenic activity.
- novel compositions having a wide ranging capability in a variety of fields, such as diagnostics, in vitro and in vivo effects on cells, acting as mitogens, additives in nutrient media, use as agonists and antagonists to EGF and TGF, acting as immunogens, acting as therapeutics, enhancing wound healing, and the like.
- the oligopeptide can be used by itself or in combination with other polypeptides, fused to the other polypeptides to vary the properties of the other polypeptides, resulting in binding of the polypeptide to cells having growth factor receptors.
- one can reversibly bind various polypeptides to cells having growth factor receptors, affecting the properties of the cells in predetermined ways.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Toxicology (AREA)
- Virology (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| FI862734A FI862734A7 (fi) | 1984-10-30 | 1985-10-23 | Uudet polypeptidit, joilla on kasvutekijäaktiivisuutta ja nukleiinihap posekvenssit, jotka koodaavat polypeptidejä. |
| NO1986862613A NO862613D0 (no) | 1984-10-30 | 1986-06-27 | Nye polypeptider med vekstfaktoraktivitet og nukleinsyresekvenser som koder for polypeptidene. |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US66652084A | 1984-10-30 | 1984-10-30 | |
| US666,520 | 1984-10-30 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO1986002650A1 true WO1986002650A1 (en) | 1986-05-09 |
Family
ID=24674411
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US1985/002103 Ceased WO1986002650A1 (en) | 1984-10-30 | 1985-10-23 | Novel polypeptides having growth factor activity and nucleic acid sequences encoding the polypeptides |
Country Status (12)
| Country | Link |
|---|---|
| EP (1) | EP0199769A4 (https=) |
| JP (1) | JPS62501071A (https=) |
| AU (2) | AU600433B2 (https=) |
| ES (7) | ES8702925A1 (https=) |
| FI (1) | FI862734A7 (https=) |
| GR (1) | GR852610B (https=) |
| IL (1) | IL76866A0 (https=) |
| NO (1) | NO862613D0 (https=) |
| NZ (1) | NZ213984A (https=) |
| PH (2) | PH24603A (https=) |
| PT (1) | PT81408B (https=) |
| WO (1) | WO1986002650A1 (https=) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4863899A (en) * | 1983-05-09 | 1989-09-05 | Todaro George J | Biologically active polypeptides |
| FR2632321A1 (fr) * | 1988-03-24 | 1989-12-08 | Oncogen | Sequence d'adn codant pour un polypeptide, cassette d'expression comprenant une telle sequence, cellule hote comprenant la cassette d'expression et procede pour produire un tel polypeptide |
| US5240912A (en) * | 1983-05-09 | 1993-08-31 | Todaro George J | Transforming growth factor (TGF) peptides |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPS63167797A (ja) * | 1985-12-18 | 1988-07-11 | マイクロジエネシス,インコ−ポレイテイド | 選択された昆虫宿主細胞中で選択されたポリペプチドを製造する方法 |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3917824A (en) * | 1973-03-28 | 1975-11-04 | Ici Ltd | Pharmaceutical compositions containing epidermal growth factor or closely related derivatives thereof for inhibiting the secretion of acidic gastric juice in warm blooded animals |
| US4230691A (en) * | 1978-05-23 | 1980-10-28 | The Massachusetts General Hospital | Nerve growth factor antibody and process |
| EP0046039A1 (en) * | 1980-08-05 | 1982-02-17 | G.D. Searle & Co. | Synthetic urogastrone gene, corresponding plasmid recombinants, transformed cells, production thereof and urogastrone expression |
| US4366246A (en) * | 1977-11-08 | 1982-12-28 | Genentech, Inc. | Method for microbial polypeptide expression |
| WO1985002198A1 (en) * | 1983-11-01 | 1985-05-23 | Amgen | Microbial expression of type i transforming growth factor, polypeptide analogs thereof and hybrid egf/tgf polypeptides |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH064673B2 (ja) * | 1980-11-10 | 1994-01-19 | ゲネンテツク・インコ−ポレ−テツド | ハイブリド型ヒト白血球インタフエロン |
| GB8507666D0 (en) * | 1985-03-25 | 1985-05-01 | Wellcome Found | Epidermal growth factor production |
-
1985
- 1985-10-23 JP JP60504725A patent/JPS62501071A/ja active Pending
- 1985-10-23 WO PCT/US1985/002103 patent/WO1986002650A1/en not_active Ceased
- 1985-10-23 EP EP19850905376 patent/EP0199769A4/en not_active Withdrawn
- 1985-10-23 FI FI862734A patent/FI862734A7/fi not_active IP Right Cessation
- 1985-10-23 AU AU48687/85A patent/AU600433B2/en not_active Ceased
- 1985-10-28 IL IL76866A patent/IL76866A0/xx unknown
- 1985-10-29 ES ES548316A patent/ES8702925A1/es not_active Expired
- 1985-10-29 NZ NZ213984A patent/NZ213984A/en unknown
- 1985-10-29 GR GR852610A patent/GR852610B/el unknown
- 1985-10-30 PT PT81408A patent/PT81408B/pt not_active IP Right Cessation
- 1985-10-30 PH PH32995A patent/PH24603A/en unknown
-
1986
- 1986-04-30 ES ES554630A patent/ES8802074A1/es not_active Expired
- 1986-04-30 ES ES554629A patent/ES8802185A1/es not_active Expired
- 1986-04-30 ES ES554628A patent/ES8802061A1/es not_active Expired
- 1986-06-27 NO NO1986862613A patent/NO862613D0/no unknown
- 1986-10-24 ES ES557145A patent/ES8707741A1/es not_active Expired
-
1987
- 1987-09-01 ES ES557710A patent/ES8801379A1/es not_active Expired
- 1987-09-01 ES ES557708A patent/ES8801378A1/es not_active Expired
-
1989
- 1989-03-27 PH PH38379A patent/PH25794A/en unknown
-
1990
- 1990-11-12 AU AU66551/90A patent/AU633377B2/en not_active Ceased
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3917824A (en) * | 1973-03-28 | 1975-11-04 | Ici Ltd | Pharmaceutical compositions containing epidermal growth factor or closely related derivatives thereof for inhibiting the secretion of acidic gastric juice in warm blooded animals |
| US4366246A (en) * | 1977-11-08 | 1982-12-28 | Genentech, Inc. | Method for microbial polypeptide expression |
| US4230691A (en) * | 1978-05-23 | 1980-10-28 | The Massachusetts General Hospital | Nerve growth factor antibody and process |
| EP0046039A1 (en) * | 1980-08-05 | 1982-02-17 | G.D. Searle & Co. | Synthetic urogastrone gene, corresponding plasmid recombinants, transformed cells, production thereof and urogastrone expression |
| WO1985002198A1 (en) * | 1983-11-01 | 1985-05-23 | Amgen | Microbial expression of type i transforming growth factor, polypeptide analogs thereof and hybrid egf/tgf polypeptides |
Non-Patent Citations (8)
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4863899A (en) * | 1983-05-09 | 1989-09-05 | Todaro George J | Biologically active polypeptides |
| US5240912A (en) * | 1983-05-09 | 1993-08-31 | Todaro George J | Transforming growth factor (TGF) peptides |
| FR2632321A1 (fr) * | 1988-03-24 | 1989-12-08 | Oncogen | Sequence d'adn codant pour un polypeptide, cassette d'expression comprenant une telle sequence, cellule hote comprenant la cassette d'expression et procede pour produire un tel polypeptide |
| GR890100185A (en) * | 1988-03-24 | 1990-01-19 | Oncogen | Novel polypeptides having growth factor activity and nucleic acid sequences encoding the polypeptides |
| BE1004202A5 (fr) * | 1988-03-24 | 1992-10-13 | Oncogen | Nouveaux polypeptides ayant une activite de facteur de croissance et sequences d'acides nucleiques codant pour les polypeptides. |
Also Published As
| Publication number | Publication date |
|---|---|
| EP0199769A4 (en) | 1989-11-29 |
| AU4868785A (en) | 1986-05-15 |
| PT81408A (en) | 1985-11-01 |
| EP0199769A1 (en) | 1986-11-05 |
| AU600433B2 (en) | 1990-08-16 |
| ES8802185A1 (es) | 1988-04-01 |
| ES554630A0 (es) | 1988-03-16 |
| NO862613L (no) | 1986-06-27 |
| ES8802061A1 (es) | 1988-03-16 |
| AU633377B2 (en) | 1993-01-28 |
| ES554629A0 (es) | 1988-04-01 |
| NZ213984A (en) | 1991-05-28 |
| ES8801379A1 (es) | 1988-01-01 |
| FI862734L (fi) | 1986-06-26 |
| ES548316A0 (es) | 1987-01-16 |
| ES557710A0 (es) | 1988-01-01 |
| ES8801378A1 (es) | 1988-01-01 |
| ES8702925A1 (es) | 1987-01-16 |
| NO862613D0 (no) | 1986-06-27 |
| JPS62501071A (ja) | 1987-04-30 |
| FI862734A0 (fi) | 1986-06-26 |
| ES554628A0 (es) | 1988-03-16 |
| AU6655190A (en) | 1991-01-24 |
| FI862734A7 (fi) | 1986-06-26 |
| ES8707741A1 (es) | 1987-08-16 |
| PH25794A (https=) | 1991-11-05 |
| IL76866A0 (en) | 1986-02-28 |
| ES557708A0 (es) | 1988-01-01 |
| GR852610B (https=) | 1986-03-04 |
| PH24603A (en) | 1990-08-17 |
| ES557145A0 (es) | 1987-08-16 |
| ES8802074A1 (es) | 1988-03-16 |
| PT81408B (pt) | 1987-11-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2107109B1 (en) | Recombinant vascular endothelial cell growth factor D (VEGF-D) | |
| US5843883A (en) | Methods of wound healing and treating hyperproliferative diseases of epidermis comprising administering trunicated keratinocyte growh factor (KGF) having increased biological activity | |
| US5830995A (en) | Fanphiregulins: a family of heparin-binding epithelial cell growth factors | |
| AU646014B2 (en) | Novel platelet-derived growth factor B chain analogs and method for homogeneous production thereof | |
| IE881597L (en) | Expression of Human Proapolipoprotein A-I | |
| AU600433B2 (en) | Novel polypeptides having growth factor activity and nucleic acid sequences encoding the polypeptides | |
| CA2237543A1 (en) | New form of amphiregulin, methods for producing and using the same and compositions comprising the same | |
| GB2219799A (en) | Epidermal growth receptor-binding polypeptides | |
| CA2216165C (en) | Ndf peptides | |
| TAM et al. | Mapping the receptor‐recognition site of human transforming growth factor‐α | |
| PH25991A (en) | Antibodies to novel polypeptide having growth factor activity | |
| CA1326639C (en) | Nucleic acid encoding tgf-.beta. and its uses | |
| HK1025789B (en) | Recombinant vascular endothelial cell growth factor d (vegf-d) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AU FI JP NO |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): AT BE CH DE FR GB IT LU NL SE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1985905376 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 862734 Country of ref document: FI |
|
| WWP | Wipo information: published in national office |
Ref document number: 1985905376 Country of ref document: EP |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 1985905376 Country of ref document: EP |